Research ArticleMolecular Analysis of Methanogen Richness in Landfill andMarshland Targeting 16S rDNA Sequences

Shailendra Yadav1 Sharbadeb Kundu1 Sankar K Ghosh1 and S S Maitra2

1Department of Biotechnology Assam University Silchar Assam 788011 India2School of Biotechnology Jawaharlal Nehru University New Delhi 110067 India

Correspondence should be addressed to S S Maitra cbtjnuhotmailcom

Received 8 June 2015 Revised 26 August 2015 Accepted 30 August 2015

Academic Editor Derek Caetano-Anolles

Copyright copy 2015 Shailendra Yadav et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Methanogens a key contributor in global carbon cycling methane emission and alternative energy production generate methanegas via anaerobic digestion of organic matter The methane emission potential depends upon methanogenic diversity and activitySince they are anaerobes and difficult to isolate and culture their diversity present in the landfill sites of Delhi and marshlands ofSouthern Assam India was analyzed using molecular techniques like 16S rDNA sequencing DGGE and qPCR The sequencingresults indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in theGhazipur and Bhalsawa landfill sites of Delhi Sequences related to the phyla Crenarchaeota (thermophilic) andThaumarchaeota(mesophilic) were detected from marshland sites of Southern Assam India Jaccard analysis of DGGE gel using Gel2K showedthree main clusters depending on the number and similarity of band patterns The copy number analysis of hydrogenotrophicmethanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern AssamThe knowledge about ldquomethanogenic archaea compositionrdquo and ldquoabundancerdquo in the contrasting ecosystems like ldquolandfillrdquo andldquomarshlandrdquo may reorient our understanding of the Archaea inhabitants This study could shed light on the relationship betweenmethane-dynamics and the global warming process

1 Introduction

Methane is an important greenhouse gas because it is 25 timesmore powerful than CO

2in global warming potential (ie

the ability of the gas to trap heat in the atmosphere) andthus plays a crucial role in climate change and carbon cycling[1 2] Methane emission has contributed approximately 20to global climate change frompreindustrial times [1 3] About500ndash600Tg of methane is emitted annually to the atmo-sphere of which 74 is biogenic produced by methanogenicArchaea [4]

The methanogenic Archaea (methanogens) usually oc-curs in highly reduced anoxic environments such as landfillswetlands rice fields rumen and marine sediments wherethey serve as a terminal electron sink [5 6] Methanogensare strict anaerobes and the presence of oxygen leads to theformation of reactive oxygen species (ROS) which damagetheir cellmembranes DNA and proteins [7 8]Methanogens

are phylogenetically divided into 5 familieswithin the phylumEuryarchaeota and are comprised of 31 known genera [910] Methanogens can utilize a wide range of compoundsfor methane production but in most natural systems thereare two major pathways for methanogenesis reduction ofCO2(hydrogenotrophic methanogenesis) and cleavage of

acetates (acetoclastic methanogenesis) A third pathway formethane generation is calledmethylotrophicmethanogenesisthat occurs inmarine sediments and salt lakeswheremethaneis produced from methylated compounds such as trimethy-lamine [11 12]

Landfill sites are the third largest source of methane Itconstitutes about 30 and 24 of the anthropogenic methaneproduction in Europe andUS respectively [4 13] In compar-ison to the western countries the composition of municipalsolid waste (MSW) in developing countries like India ishigher (40ndash60) in organic waste This has more potentialto emit higher GHGs (Green House Gases) per ton of MSW

Hindawi Publishing CorporationArchaeaVolume 2015 Article ID 563414 9 pageshttpdxdoiorg1011552015563414

2 Archaea

Table 1 Sampling point from Delhi landfill site (Ghazipur Bhalswa and Okhla) and Southern Assam marshland (Silcoorie Lake (Silchar)Badarpur and Karimganj) areas

Feature Ghazipur Bhalswa Okhla Silcoorie Lake(Silchar) Badarpur Karimganj

Location 28∘37101584022410158401015840N77∘19101584025710158401015840E

28∘441015840271610158401015840N779∘91015840279210158401015840E

28∘3010158404210158401015840N77∘1610158405910158401015840E

24∘45101584017810158401015840N92∘46101584058310158401015840E

24∘5410158400010158401015840N92∘3610158400010158401015840E

24∘5210158400010158401015840N92∘2110158400010158401015840E

Type Leachate Soil and leachate Leachate Lake sediment Marshy pond Rice paddyDepth 150 cm 200 cm 150 cm 40 cm 100 cm Surface

compared to the developed world [14] Moreover landfillsin India are neither well planned nor engineered and areoften found in low-lying open areas where municipal wasteis haphazardly and indiscriminately disposed These siteshave neither landfill lining to avoid percolation of leachateto groundwater table nor leachate collection facility The citygenerates about 6000 tonnes of solid waste per day and theexpected quantity of solid waste generation in Delhi wouldbe about 12750 tonnes per day by 2015 [15] Due to scarcityof land in big cities municipal authorities are using thesame landfill for nearly 10ndash20 years Thus the possibility ofanaerobic emission of GHGs further increases [16]

Microbial decomposition climatic conditions MSWwastes characteristics and landfilling operations are amongthemany factors that contribute to the generation ofmethane[2 17] The migration of gas and leachate away from thelandfill boundaries and their release into the surroundingenvironment present serious environmental threats includ-ing potential health hazards fires and explosions damageto vegetation unpleasant odors landfill settlement groundwater pollution air pollution and global warming [18ndash20]

Wetlands (marshland) are the largest source of naturalmethane emissions contributing about 10ndash231 Tg methaneper year accounting for 20ndash39 of annual global CH

4

emission [4 21] Methanogens in the moist anoxic (oxygen-free) wetland soil produce CH

4as they decompose dead plant

material The methane emission from wetland was increasedby 7 from 2003 to 2007 [2 19] Methane production inwetlands is affected by the acetate supply through acetatefermentation or the CO

2reduction potential [22 23] The

exponential increase in the rate of CH4production with

temperature is due to the availability of more substratesand is not associated with changes in the composition ofmethanogens [24] Methanogens belonging to the groupsMethanomicrobiales andMethanosarcinales performing ace-toclastic and methylotrophic pathway were found to bedominant in landfill sites [25ndash27] In acidic conditions due tothe presence of acid tolerant hydrogenotrophicmethanogensH2CO2is efficiently converted to methane compared to

acetate andmethanogenic activity decreases with decrease inpH regardless of the substrates [28]

The prokaryotic diversity in our planet dictates ourplanetrsquos ecosystems by acting as key functional drivers [29]The understanding of the functional potential of the mostindividual microbial flora residing within the ecosystemis extremely limited because of our inability to isolateand culture them in laboratory conditions [30] Since themethanogens are anaerobes and are difficult to culture they

are identified by culture independent molecular techniqueslike PCR amplification denaturing gradient gel electrophore-sis (DGGE) and quantitative real-time PCR usingmolecularmarkers such as 16S rDNA genetic locus [31ndash34] Hencethe present study was aimed at detecting the methanogenicArchaea inhabitants (richness) (by DGGE) identification byDNA sequencing and quantification by qPCR in both thelandfill sites of Delhi andmarshland sites of Southern AssamIndia

2 Material and Methods

21 Collection of Leachate and Sediment Samples Leachatesamples were collected from three landfill sites (BhalswaOkhla and Ghazipur) in the area of New Delhi India Thesesites are active landfill sites and are still in use They do nothave the leachate collection facility or landfill liner to avoidpercolation of leachate to the ground water table (aquifer)Soil sediment sample was collected from marshlands (Sil-coorie Lake (Silchar) Badarpur and Karimganj) of SouthernAssam India in sterile falcon tubesThe details of sites alongwith criteria and physiochemical parameters are shown inTables 1 and 2

22 Nucleic Acid Extraction PCR Amplification and CloningDNA from both landfill leachate and marshland sedimentsamples was extracted on the same day of sampling using FastDNA Spin Kit for Soil (MP Biomedicals CA USA) DNAfrom themarshlands and landfill leachatewas amplified usingthe primer set 86FWD and 1340REV (Table 3)

The amplification profile was 94∘C for 5min 94∘C for 30 sfor 30 cycles and 58∘C for 1 minute elongation at 72∘C for 2minutes and final extension at 72∘C for 10 minutes followedby a cooling step down to 4∘C [35 36] Obtained 16S rDNAPCRproducts were purified by PCRpurification kit (Fermen-tas UK) as recommended by manufacturer protocol PCRamplicons of 16S rDNA gene were cloned inside PTZ57RTvector using the Insta-TA cloning kit (Fermentas UK)and transformed into Escherichia coli DH5120572 The positiveclones were selected using blue-white screening on Luria-Bertani plates containing Ampicillin (100mgmL) X-gal(20mgmL) and IPTG (100mM)Then positive clones weresequenced using M13 FWD primer

23 DNA Sequencing and Phylogenetic Analysis of 16S rDNAClones Sequencing was performed for all the clones with

Archaea 3

Table 2 Chemical analysis of leachate samples obtained from three landfill and marshland sites All parameters are in mg Lminus1 adapted fromGhosh et al 2015 and Roy and Gupta 2012 [37 38]

Parameter Bhalswa Ghazipur Okhla Silcoorie Lake (Silchar) Karimganj BadarpurpH 81 84 83 627 689 669TDS 31469 29700 33657 53282 68293 65312COD 29930 31600 29020 NA NA NAFe 1032 981 651 281 617 389Cl 227 11742 264 911 1260 1631

Table 3 List of primers for PCR amplification of 16S rDNA gene and DGGE used in the present study

Primer Sequence (51015840-31015840) ReferenceMET86 F GCT CAG TAA CAC GTG Wright and Pimm 2003 [36]MET1340 R CGG TGT GTG CAA GGA519FWD CAGCCGCCGCGGTAA Cheng et al 2009 [35]915REV GTGCTCCCCCGCCAATTCCT

915GC CGC CCG GGG CGC GCC CCG GGC GGG GCG GGGGCA CGG GGGGTT GTGCTCCCCCGCCAATTCCT Cheng et al 2009 [35]

Table 4 List of accession numbers of the sequences submitted in NCBI and their percent similarity with database along with the samplingsites

Accession number Sample ID Tentative organism name LocationKM0412391 MET1 LAND Methanoculleus thermophiles (99 similarity with JF3301141) Bhalswa landfillKM0412401 MET2 LAND Methanoculleus thermophiles (99 similarity with JF3301141) Bhalswa landfillKM0412411 MET3 LAND Uncultured archaeon clone (99 similarity with AB5353551) Bhalswa landfillKM0412421 METG1 LAND Uncultured archaeon clone (94 similarity with JF8071451) Ghazipur landfillKM0412481 METK2 MARSH Uncultured euryarchaeote clone (98 similarity with KF3600111) KarimganjKM0412491 METK4 MARSH Uncultured archaeon clone (100 similarity with JQ2456871) KarimganjKM0412501 SD1 MARSH Uncultured archaeon clone (97 similarity with JF3041361) Silcoorie Lake (Silchar)KM0412511 SD3 MARSH Uncultured archaeon clone (97 similarity with JF7087031) Silcoorie Lake (Silchar)KM0412521 SD4 MARSH Uncultured archaeon clone (91 similarity with AB3648931) Silcoorie Lake (Silchar)KM0412431 MetG2 landfill Methylobacillus flagellates (97 similarity with NR 0741781) Ghazipur landfillKM0412441 MetG3 landfill Methylobacillus arboreus (99 similarity with NR 1088511) Ghazipur landfillKM0412451 MEtG4 landfill Methylobacillus flagellates (99 similarity with NR 0741781) Ghazipur landfillKM0412461 MetG6 landfill Methylobacillus flagellates (98 similarity with NR 0741781) Ghazipur landfillKM0412471 MetG7 landfill Methylobacillus arboreus (99 similarity with NR 1088511) Ghazipur landfill

the ABI prism 3130 Genetic Analyzer (Applied Biosys-tem Inc CA) at Department of Biochemistry SouthCampus Delhi University The sequences were edited toexclude the PCR primer-binding site and manually correctedwith Sequence Scanner 10 (Applied Biosystems) and werechecked further for vector contamination using the Vec-screen tool (httpwwwncbinlmnihgovtoolsvecscreen)The sequences showing similarity with vector sequences fromboth ends were trimmed Sequences were then comparedwith the available nucleotide database from the NCBI Gen-Bank using the BLAST program [39] The partial nucleotidesequences of 16S rDNA genes were submitted to NCBI underaccession numbers KM041239 to KM041252 (Table 4)

Partial 16S rDNA sequences obtained from this studywere used for similarity search in NCBI database using

BLAST program After performing BLAST sequences show-ing similarity above 90 were used and aligned in MEGAsoftware version 60 [40] using ClustalW The phylogeneticrelatedness among clones was estimated using the MaximumLikelihood tree using Kimura K2P+G model with 2000bootstrap value [41] For model selection Bayesian analysiswas performed and the model with lowest BIC value (ie121048604) was chosen for tree construction All positionscontaining gaps and missing data were eliminated from thedataset (complete deletion option)The phylogenetic analysiswas carried out using MEGA software version 60 [40](Figure 1)

24 Denaturing Gradient Gel Electrophoresis For denaturinggradient gel electrophoresis genomic DNA extracted from

4 Archaea

gi|374627936Methanoplanus limicola Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

I

MetG7 landfill

MetG3 landfill

METG1 LAND

METK2 MARSH

gi|219850687Methanosphaerula palustrisAB5353551 Uncultured archaeon gene for 16S rRNA

MET3 LAND

MET1 LAND

MET2 LAND

JF3301141 Methanoculleus thermophilus 16S rRNA

gi|478482031Candidatus Methanomethylophilus alvus

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Crenarchaeota

Thaumarchaeota

Methylobacillus flagellatus_16S rRNA

MetG2 landfill

MetG6 landfill99

MEtG4 landfill

02

9699

91

9352

9898

92

15

9957

50100

47

6599

99

85

99

30

99

9917

15

77

62

59

98

9782

99

JF8071451 Uncultured archaeon clone QTP C83 16S rRNA

gi|343198895Methanoculleus receptaculi

gi|126177952Methanoculleus marisnigrigi|636560821Methanoculleus hydrogenitrophicus

gi|254971238Methanoculleus thermophilus

Methylobacillus arboreus_16S rRNA

gi|645321034Methanomassiliicoccus luminyensis

gi|631251679Methanoregula formicica

gi|485099044Methanoregula formicica

gi|470467532Methanoregula boonei

gi|444303982Thermofilum pendens Hrk

gi|265678906Thermofilum pendens strain HVv3

gi|444304108Staphylothermus hellenicus

METK4 MARSH

JQ2456871 Uncultured archaeon clone SYNH02 ew01A-104 16S rRNA

SD4 MARSH

SD3 MARSH

SD1 MARSH

KF5645961 Uncultured archaeon clone AP0-53 16S rRNA

gi|631251601Methanolinea mesophila

KF3600111 Uncultured euryarchaeote clone ZW-M-5 16S rRNA

JF3041361 Uncultured archaeon clone 5(22) 16S rRNA

JN2274881 Candidatus Nitrosotalea devanaterra isolate Nd1 16S rRNA

HQ3311161 Nitrosopumilaceae archaeon MY1 16S rRNA

JQ3467651 Nitrosopumilus maritimus SCM1 16S rRNA

gi|507148109Candidatus Nitrososphaera gargensis

II

III

IIIb

IIIa

Figure 1 The phylogenetic relationship of 40 partial 16S rDNA sequences (the confirmed 14 sequences of clones are generated in this studyrecovered from both Delhi landfills (marked with black circle grey circle and grey triangle) and Southern Assam marshland sites (markedwith black triangle)) was inferred by the ML method using K2P+G parameter model with 2000 bootstrap replicates using the MEGA 6 treebuilding program

landfill and marshland was amplified using primer 519FWDand 915GC which gave a product length of about 500 bpDGGE was performed with a D-Code universal mutationdetection system (Biorad Hercules CA USA) using 16 cmby 16 cm and one mm gels PCR products were loaded onto7 (wv) polyacrylamide gel The polyacrylamide gels (Bis-Acrylamide 375 1) were made with denaturing gradients

ranging from 30 to 70 100 denaturant contained 7Murea and 40 formamide Electrophoresis was initially run at200V for 10min at 60∘C and afterwards for 15 h at 85V Afterelectrophoresis the gel was silver-stained and scanned underwhite light using Gel Doc (Biorad) (Figure 2) DGGE gelwas further analyzed using Gel2K software (Svein NorlandDepartment of Biology University of Bergen Norway)

Archaea 5

OK BH GZ SON SIL KRM BDR

Figure 2 Community profiling of methanogens using 16s rDNAbased onDGGE the community profiling ofmethanogenic diversitypresent in the leachate sample of Delhi landfill site (OK BH andGZ) and marshland sample of Southern Assam (SON SIL KRMand BDR)

25 Quantification of Methanogens by Quantitative Real-TimePCR Analysis Real-time PCR was done for absolute quan-tification of methanogens 16S rDNA fragments obtainedfrom pure culture of methanogens (DSMZ) were cloned andserially diluted for making standard curve as was previouslydone by Steinberg and Regan [27] Real-time PCR reactionwas carried out in triplicate using the temperature profile asrecommended for the Agilent 2x master mix that is initialdenaturation at 95∘C for 3 minutes subsequent denaturationat 95∘C for 30 seconds annealing at 60∘C for 10 seconds andelongation at 65∘C for 1 minute Melt curve analysis to detectthe presence of primer dimer was performed after the finalextension by increasing the temperature from 50 to 95∘Cwith05∘C increments every 10 s

3 Results and Discussions

31 Identification of Methanogenic Archaea in Landfill andMarshland Sequences of MET1 LAND and MET2 LANDobtained from the Bhalswa landfill site are clustered withMethanoculleus thermophilus methanogens belonging to theorder Methanomicrobiales which are hydrogenotrophic innature Third sequence of MET3 LAND from the Bhalswalandfill site clustered with the Candidatus Methanomethy-lophilus alvus Mx1201 which is H

2-dependent methy-

lotrophic methanogens In Figure 1 it is shown that thesethree sequences from the landfill sites of Delhi are clusteredwith Euryarchaeota cluster (Cluster I) Sequence METG1LAND obtained from the Ghazipur landfill site Delhi clus-tered with Methanomassiliicoccus luminyensis (Cluster II)Sequences obtained frommarshland sites of Southern Assamwere clustered (Cluster III) separately with Crenarchaeota(Cluster IIIa) and Thaumarchaeota (Cluster IIIb) There arefive more sequences from the landfill sites of Delhi They arerelated to two different species of methanotrophs (methane

oxidizing bacteria) (see Table 4) Methylobacillus arboreus(marked as grey triangle) and Methylobacillus flagellatus(marked as grey circle) and are clustered separately as shownin Figure 1

Phylogenetic analysis of 16S rDNA clones indicates thepresence of methanogens belonging to the phylum Eur-yarchaeota order Methanomicrobiales Methanobacteriales-1 and seventh order of methanogens in the landfill sites [42ndash44] Both Candidatus Methanomethylophilus alvus Mx1201and Methanomassiliicoccus luminyensis represent a mono-phyletic lineage that is not phylogenetically associated withany of the previously known orders of methanogens or theanaerobic methanotrophic ANME1 lineage [43 45] Theybelong to the Mx order clusters with two lineages the plank-tonic Marine Group II (MG-II) and the sediment dwellingMarine Benthic Group D (MBG-D) [45ndash47] The other fivesequences from Ghazipur landfill sites revealed presence ofmethanotrophs belonging to class Betaproteobacteria familyMethylophilaceae 16S rDNA clones obtained from marsh-land sites of Southern Assam revealed a cluster of Archaeathat are distantly related to twodifferent phyla CrenarchaeotaandThaumarchaeota Microorganisms belonging to the phy-lum Thaumarchaeota (recently proposed) are thermophilicandmesophilic in nature and are found to be present in awidevariety of ecosystems including marine and fresh waterssoils and also hot environment [44 48ndash52]

32 Culture Independent Molecular Analysis of MethanogenicDiversity Microbes dominated in the history of living organ-isms and they are a fundamental part of the biosphere Thestudy of microbial diversity has been therefore essential forunderstanding the evolution of life Traditionally cultivationbased methods have contributed to our knowledge abouttheir whereabouts and diversity of microbes in naturallyoccurring communities However only a small fraction ofthe prokaryotes has been cultivated in vitro by standardmethodsTherefore this knowledgemay not reveal the actualcomposition andor diversity associated with an ecosystem[31 33] In the present study we used culture indepen-dent molecular techniques like 16S rDNA PCR cloning-sequencing DGGE and qPCR for estimation of the richnessand diversity of the methanogenic Archaea in the landfillsite of Delhi and marshland areas of Southern Assam Thesetechniques arewidely used formolecular community analysisof microbes present in various types of habitats [32 42 53ndash56] A combination of DNA sequencing DGGE and quanti-tative PCR (qPCR) can provide valuable information aboutmicrobial consortia associated with a specific ecosystemDenaturing gradient gel electrophoresis (DGGE) is used todetermine the genetic diversity of microbial communitiesThe procedure is based on electrophoresis of PCR-amplified16S rDNA fragments in polyacrylamide gels containing alinearly increasing gradient of denaturants In DGGE DNAfragments of the same length but with different base-paircomposition can be separated Separation is based on theelectrophoretic mobility of partially melted DNA moleculesin a polyacrylamide gel and resulting into a band pattern [57ndash60] DGGE can reveal 1-2 of the actual diversity present inthe samples [61]

6 Archaea

Table 5 Copy number of methanogens present per gram samples of Okhla and Bhalswa landfill site Delhi and Silcoorie Lake Assam India

Pure culture Okhla Bhalswa Silcoorie Lake (Silchar)M arbophilicus 398119890 + 014ndash68119890 + 014 538119890 + 014ndash97119890 + 014 278119890 + 011ndash78119890 + 011M bryantii 114119890 + 017ndash18119890 + 017 46119890 + 016ndash82119890 + 016 12119890 + 013ndash21119890 + 013M mobile 667119890 + 015ndash75119890 + 015 342119890 + 015ndash48119890 + 015 397119890 + 012ndash41119890 + 012M mazei 189119890 + 014ndash25119890 + 014 221119890 + 015ndash28119890 + 015 113119890 + 012ndash15119890 + 012

Table 6 Methanogenic pathways and microorganisms that are associated

Domain Archaea kingdom Archaebacteria phylum EuryarchaeotaMethanogenic pathway Orders ReactionAcetoclastic Methanosarcinales CH

3COOHrarrCH

4+ CO

2

Hydrogenotrophic Methanosarcinales 4H2+ CO

2rarrCH

4+ 2H2O

Methanobacteriales 4HCOOHrarrCH4+ 3CO

2+ 2H2O

MethanococcalesMethanomicrobialesMethanopyrales

Methylotrophic Methanosarcinales 4CH3OHrarr 3CH

4+ CO

2+ 2H2O

33 Estimation of Methanogenic Richness by QuantitativeReal-Time PCR DNA extracted from the three samplingpoints that is two landfill sites Okhla and Bhalswa of Delhiand Silcoorie Lake (Silchar) of SouthernAssam was screenedfor the quantification of methanogens The copy number ofall methanogens (pure culture) was higher in the two landfillsites than that of marshland in Southern Assam (Table 5)Methanogenic pathway associated with the methanogensorder and its reactions involved in the process are includedin Table 6

The copy numbers ofMethanomicrobium mobile belong-ing to the order Methanomicrobiales and Methanobac-terium bryantii belonging to the order Methanobacteriales-1 were found to be higher in both landfill sites in com-parison to the Silcoorie Lake (Silchar) of Southern AssamCopy number of Methanobrevibacter arboriphilus (orderMethanobacteriales-1) andMethanosarcinamazei (acetoclas-tic) (order Methanosarcinales) was found to be higher in theBhalswa landfill site than Okhla landfill site and SilcoorieLake (Silchar) marshland site The value of 119877Sq and slope 119889119877for standard curve was 0948 and minus2641 and the efficiencyof the reaction was 1391 The 119877Sq and slope 119889119877 values forldquoabsoluterdquo quantification of Methanobrevibacter arboriphilusare 0903 and minus2128 119877Sq (119889119877) and slope 119889119877 values for thisquantification of Methanobacterium bryantii are 0877 andminus1384 119877Sq (119889119877) and slope 119889119877 values of Methanomicrobiummobile are 0956 and minus2563 respectively The values of 119877Sq(119889119877) and slope 119889119877 forMethanosarcina mazei were 0394 andminus2051 respectively

Methanogens pertaining to both acetotrophic and hy-drogenotrophic decomposition pathways were detected inMSW landfills which have been reported earlier [25 26 42]Acetate serves as a precursor for more than 70 of CH

4

(methane) formation in the most anaerobic digestion pro-cess [62] Therefore acetoclastic methanogens which utilizeacetate as substrate play a key role in stabilizing the pollution

load of wastewater by methanogenesis In the present studyquantitative PCR indicates the higher methanogenic richnessin both landfill sites of Delhi compared to marshland ofSilcoorie Lake Silchar

34 Diversity of Methanogenic Archaea by DenaturingGradient Gel Electrophoresis Abundance and diversity ofmethanogenic Archaea were studied in three landfill and fourmarshland sites situated at different location in Delhi andSouthernAssam India 16S rDNAampliconswere cloned andthen analyzed on the DGGE gel for estimation of the archaealrichness in respective samples as shown in Figure 2

Band patterns of 16S rDNA amplicons obtained fromthe landfill sites (OK BH and GZ) of Delhi and marshlandsamples (SON SIL KRM and BDR) of Southern Assamwerecompared for methanogens richness and diversity analysisusing Gel2K software Analysis of DGGE image revealed thepresence of total 38 bands There are some unique bands ineach lane which indicates the variation ofmethanogens com-munity residing in those particular samples Cluster analysisof bands using Jaccard analysis indicated the presence of threemain clusters consisting of localities that differ in number ofsimilarity versus DGGE bands (Figure 3)

In the first cluster Badarpur beetle-nut pond and Sil-coorie Lake (Silchar) of Southern Assam clustered togethershowing similar band pattern In the second cluster inter-estingly despite being two different ecosystems Ghazipurlandfill sites of Delhi clusteredwithwetland of Sonbill South-ern Assam India In the third cluster the two landfill sitesof Delhi (Okhla and Bhalswa) clustered together showingsimilar band pattern In terms of richness number of bandsfrom the respective samples fromBhalswa landfill and Sonbillwetland have maximum of 11 bands followed by Ghazipurlandfill site and Silcoorie Lake (Silchar) having 10 bands eachOkhla landfill and Badarpur beetle-nut pond showed 9 bands

Archaea 7

Jacc

ard

10

08

06

04

02

00 Bada

rpur

Silc

oorie

Karim

ganj

Sonb

ill

Gha

zipu

r

Bhal

saw

a

Okh

la

Comp

Figure 3 Jaccard cluster diagram of DGGE bands obtained from landfill sites of Delhi and marshland of Southern Assam India

each in the cluster In the Karimganj rice paddy field sampleonly four bands were observed showing the least diversity

Microbial diversity within contaminated ecosystems likelandfill should be less diverse than those in natural systemslike a wetland because the diversity may be influenced by thecomplexity of toxic chemical mixtures heavy metals presentand duration of time the populations have been exposed Inthe present study after analyzing DGGE gel banding patternand the number of bands we found that the methanogenicdiversity present in both landfills (anthropogenic system) andmarshland (natural) is quite similar except for the samplesobtained from the Karimganj rice paddy field where onlyfour bands appeared The number of total bands observedin this study was in accordance with the number of DGGEbands reported previously [42 51 56 57] It strongly indicatesthat the methanogenic Archaea diversity in both landfill andmarshland is influenced by sampling location rather thantype

4 Conclusions

In the sequencing of themolecular marker for archaeal diver-sity 16S rDNA identified the orders named as Methanobac-teriales and Methanosarcinales in both landfill sites and thephylum Crenarchaeota (thermophilic) in marshland Quan-titative PCR indicated a higher abundance ofmethanogens inlandfill compared to that of marshland sites The knowledgeabout the composition and abundance of methanogenicArchaea in a landfill may provide information on thedecomposition mechanism of municipal solid waste and thesubsequent generation of methane This information canbe exploited for controlling methane emission from land-fill by mitigation process The increasing knowledge about

the genomic content of microbes belonging to the phylumThaumarchaeota (mesophilic) will enrich our understandingof their adaptative behavior in the transposition from ther-mophily to mesophily This indicates whether they follow asimilar or different evolutionary pattern with respect to thephylum Euryarchaeota

Abbreviations

MSW Municipal solid wasteGHGs Green House GasesDGGE Denaturing gradient gel electrophoresismM MillimolarMg MilligrammL MillilitreTg Teragram

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Dr S S Maitra and Professor Sankar K Ghosh are grateful tothe Department of Biotechnology (DBT) of the Governmentof India for providing a Grant (BT14NETBP2010) Theauthors are extremely thankful to the referees for theirvaluable suggestions for improving the quality of the paperThe authors are indebted to Dr Santanu Raychaudhuri a UScitizen presently assigned as a Visiting Research Faculty atAssam University for correcting the paper

8 Archaea

References

[1] G Yvon-Durocher A P Allen D Bastviken et al ldquoMethanefluxes show consistent temperature dependence across micro-bial to ecosystem scalesrdquoNature vol 507 no 7493 pp 488ndash4912014

[2] S D Bridgham H Cadillo-Quiroz J K Keller and Q ZhuangldquoMethane emissions fromwetlands biogeochemical microbialand modeling perspectives from local to global scalesrdquo GlobalChange Biology vol 19 no 5 pp 1325ndash1346 2013

[3] J T Houghton Y Ding D J Griggs et al Climate Change2001 The Scientific Basis vol 881 Cambridge University PressCambridge Mass USA 2001

[4] S Solomon Climate Change 2007mdashThe Physical Science BasisWorkingGroup IContribution to the FourthAssessment Report ofthe IPCC vol 4 Cambridge University Press Cambridge UK2007

[5] R Angel P Claus and R Conrad ldquoMethanogenic archaea areglobally ubiquitous in aerated soils and become active underwet anoxic conditionsrdquoThe ISME Journal vol 6 no 4 pp 847ndash862 2012

[6] A R Daquiado K M Cho T Y Kim S C Kim H-H Changand Y B Lee ldquoMethanogenic archaea diversity in Hanwoo(Bos taurus coreanae) rumen fluid rectal dung and barn floormanure using a culture-independent method based on mcrAgene sequencesrdquo Anaerobe vol 27 pp 77ndash81 2014

[7] R S Oremland ldquoBiogeochemistry of methanogenic bacteriardquoin Biology of Anaerobic Microorganisms pp 641ndash705 JohnWiley amp Sons 1988

[8] S H Zinder ldquoPhysiological ecology of methanogensrdquo inMethanogenesis pp 128ndash206 Springer Berlin Germany 1993

[9] J-L Garcia B K C Patel and B Ollivier ldquoTaxonomic phy-logenetic and ecological diversity of methanogenic ArchaeardquoAnaerobe vol 6 no 4 pp 205ndash226 2000

[10] E Bapteste C Brochier and Y Boucher ldquoHigher-level clas-sification of the Archaea evolution of methanogenesis andmethanogensrdquo Archaea vol 1 no 5 pp 353ndash363 2005

[11] J N Reeve J Nolling R M Morgan and D R SmithldquoMethanogenesis genes genomes and whorsquos on firstrdquo Journalof Bacteriology vol 179 no 19 pp 5975ndash5986 1997

[12] R K Thauer A-K Kaster H Seedorf W Buckel and RHedderich ldquoMethanogenic archaea ecologically relevant dif-ferences in energy conservationrdquo Nature Reviews Microbiologyvol 6 no 8 pp 579ndash591 2008

[13] C C Mitigation IPCC Special Report on Renewable EnergySources and Climate Change Mitigation 2011

[14] D Mayumi J Dolfing S Sakata et al ldquoCarbon dioxideconcentration dictates alternativemethanogenic pathways in oilreservoirsrdquo Nature Communications vol 4 article 1998 2013

[15] S Gupta N Choudhary and B J Alappat ldquoBioreactor landfillfor MSW disposal in Delhirdquo in Proceedings of the InternationalConference on Sustainable Solid Waste Management ChennaiIndia September 2007

[16] M Rawat and A Ramanathan ldquoAssessment of methane fluxfrom municipal solid waste (MSW) landfill areas of DelhiIndiardquo Journal of Environmental Protection vol 2 no 4 pp399ndash407 2011

[17] V Talyan R P Dahiya S Anand and T R SreekrishnanldquoQuantification of methane emission from municipal solidwaste disposal in Delhirdquo Resources Conservation and Recyclingvol 50 no 3 pp 240ndash259 2007

[18] L B Hansen K Finster H Fossing and N Iversen ldquoAnaerobicmethane oxidation in sulfate depleted sediments effects ofsulfate and molybdate additionsrdquo Aquatic Microbial Ecologyvol 14 no 2 pp 195ndash204 1998

[19] A A Bloom P I Palmer A Fraser S R David and CFrankenberg ldquoLarge-scale controls of methanogenesis inferredfrom methane and gravity spaceborne datardquo Science vol 327no 5963 pp 322ndash325 2010

[20] V Singh and A Mittal ldquoToxicity analysis and public healthaspects of municipal landfill leachate a case study of OkhlaLandfill Delhirdquo in Proceedings of the 8th World Wide Workshopfor Young Environmental Scientists WWW-YES 2009 UrbanWaters Resource or Risks 2ndash5 June 2009 2011

[21] D Liu W Ding Z Jia and Z Cai ldquoThe impact of dissolvedorganic carbon on the spatial variability of methanogenicarchaea communities in natural wetland ecosystems acrossChinardquo Applied Microbiology and Biotechnology vol 96 no 1pp 253ndash263 2012

[22] B P Walter M Heimann R D Shannon and J R White ldquoAprocess-based model to derive methane emissions from naturalwetlandsrdquoGeophysical Research Letters vol 23 no 25 pp 3731ndash3734 1996

[23] L S Chasar J P Chanton P H Glaser and D I SiegelldquoMethane concentration and stable isotope distribution asevidence of rhizospheric processes Comparison of a fen andbog in the glacial Lake Agassiz Peatland complexrdquo Annals ofBotany vol 86 no 3 pp 655ndash663 2000

[24] G B Avery Jr R D Shannon J R White C S Martensand M J Alperin ldquoControls on methane production in a tidalfreshwater estuary and a peatland methane production viaacetate fermentation and CO

2reductionrdquo Biogeochemistry vol

62 no 1 pp 19ndash37 2003[25] L-N Huang Y-Q Chen H Zhou S Luo C-Y Lan and L-H

Qu ldquoCharacterization of methanogenic Archaea in the leachateof a closed municipal solid waste landfillrdquo FEMS MicrobiologyEcology vol 46 no 2 pp 171ndash177 2003

[26] W Laloui-Carpentier T Li V Vigneron L Mazeas and TBouchez ldquoMethanogenic diversity and activity in municipalsolid waste landfill leachatesrdquoAntonie van Leeuwenhoek vol 89no 3-4 pp 423ndash434 2006

[27] L M Steinberg and J M Regan ldquoPhylogenetic comparison ofthe methanogenic communities from an acidic oligotrophicfen and an anaerobic digester treating municipal wastewatersludgerdquoApplied and Environmental Microbiology vol 74 no 21pp 6663ndash6671 2008

[28] Q Ban J Li L Zhang Y Zhang and A K Jha ldquoPhylogeneticdiversity of methanogenic archaea and kinetics of methaneproduction at slightly acidic conditions of an anaerobic sludgerdquoInternational Journal of Agriculture and Biology vol 15 no 2pp 347ndash351 2013

[29] S G Tringe and EM Rubin ldquoMetagenomics DNA sequencingof environmental samplesrdquo Nature Reviews Genetics vol 6 no11 pp 805ndash814 2005

[30] R D Bardgett and W H van der Putten ldquoBelowgroundbiodiversity and ecosystem functioningrdquo Nature vol 515 no7528 pp 505ndash511 2014

[31] N R Pace ldquoNew perspective on the natural microbial worldmolecularmicrobial ecologyrdquoASMNews vol 62 no 9 pp 463ndash470 1996

[32] J L Kirk L A Beaudette M Hart et al ldquoMethods of studyingsoil microbial diversityrdquo Journal ofMicrobiologicalMethods vol58 no 2 pp 169ndash188 2004

Archaea 9

[33] R I Amann W Ludwig and K-H Schleifer ldquoPhylogeneticidentification and in situ detection of individual microbial cellswithout cultivationrdquo Microbiological Reviews vol 59 no 1 pp143ndash169 1995

[34] M Keller and K Zengler ldquoTapping into microbial diversityrdquoNature Reviews Microbiology vol 2 no 2 pp 141ndash150 2004

[35] Y F Cheng S Y Mao J X Liu and W Y Zhu ldquoMoleculardiversity analysis of rumenmethanogenic Archaea from goat ineastern China by DGGEmethods using different primer pairsrdquoLetters in AppliedMicrobiology vol 48 no 5 pp 585ndash592 2009

[36] A-D G Wright and C Pimm ldquoImproved strategy for pre-sumptive identification ofmethanogens using 16S riboprintingrdquoJournal of Microbiological Methods vol 55 no 2 pp 337ndash3492003

[37] P Ghosh A Gupta and I S Thakur ldquoCombined chemicaland toxicological evaluation of leachate from municipal solidwaste landfill sites of Delhi Indiardquo Environmental Science andPollution Research vol 22 no 12 pp 9148ndash9158 2015

[38] S Roy and A Gupta ldquoWater quality assessment of river barakand tributaries in Assam Indiardquo Pollution Research vol 31 no3 pp 445ndash450 2012

[39] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990

[40] K Tamura G Stecher D Peterson A Filipski and S KumarldquoMEGA6molecular evolutionary genetics analysis version 60rdquoMolecular Biology and Evolution vol 30 no 12 pp 2725ndash27292013

[41] M Kimura ldquoA simple method for estimating evolutionary ratesof base substitutions through comparative studies of nucleotidesequencesrdquo Journal ofMolecular Evolution vol 16 no 2 pp 111ndash120 1980

[42] T Watanabe M Kimura and S Asakawa ldquoDiversity ofmethanogenic archaeal communities in Japanese paddy fieldecosystem estimated by denaturing gradient gel electrophore-sisrdquoBiology and Fertility of Soils vol 46 no 4 pp 343ndash353 2010

[43] G Borrel H M B Harris W Tottey et al ldquoGenomesequence of lsquoCandidatusMethanomethylophilus alvusrsquo Mx1201a methanogenic archaeon from the human gut belonging to aseventh order of methanogensrdquo Journal of Bacteriology vol 194no 24 pp 6944ndash6945 2012

[44] H Juottonen Archaea Bacteria and methane production alongenvironmental gradients in fens and bogs [PhD thesis] Univer-sity of Helsinki Helsinki Finland 2008

[45] G Borrel PW OrsquoToole HM B Harris P Peyret J-F Brugereand S Gribaldo ldquoPhylogenomic data support a seventh orderof methylotrophic methanogens and provide insights into theevolution of methanogenesisrdquo Genome Biology and Evolutionvol 5 no 10 pp 1769ndash1780 2013

[46] V Iverson R M Morris C D Frazar C T BerthiaumeR L Morales and E V Armbrust ldquoUntangling genomesfrom metagenomes revealing an uncultured class of marineeuryarchaeotardquo Science vol 335 no 6068 pp 587ndash590 2012

[47] K G Lloyd L Schreiber D G Petersen et al ldquoPredominantarchaea in marine sediments degrade detrital proteinsrdquoNaturevol 496 no 7444 pp 215ndash218 2013

[48] I Anderson R Wirth S Lucas et al ldquoComplete genomesequence of Staphylothermus hellenicusP8Trdquo Standards inGenomic Sciences vol 5 no 1 p 12 2011

[49] C Brochier-Armanet S Gribaldo and P Forterre ldquoSpotlight onthe thaumarchaeotardquo The ISME Journal vol 6 no 2 pp 227ndash230 2012

[50] P E Galand H Fritze R Conrad and K Yrjala ldquoPathwaysfor methanogenesis and diversity of methanogenic archaea inthree boreal peatland ecosystemsrdquo Applied and EnvironmentalMicrobiology vol 71 no 4 pp 2195ndash2198 2005

[51] M Ikenaga S Asakawa Y Muraoka and M KimuraldquoMethanogenic archaeal communities in rice roots grown inflooded soil pots estimation by PCR-DGGE and sequenceanalysesrdquo Soil Science and Plant Nutrition vol 50 no 5 pp 701ndash711 2004

[52] A Spang A Poehlein P Offre et al ldquoThe genome ofthe ammonia-oxidizing Candidatus nitrososphaera gargensisinsights into metabolic versatility and environmental adapta-tionsrdquoEnvironmentalMicrobiology vol 14 no 12 pp 3122ndash31452012

[53] P P Chaudhary L Brablcova I Buriankova and M RulıkldquoMolecular diversity and tools for deciphering the methanogencommunity structure and diversity in freshwater sedimentsrdquoAppliedMicrobiology and Biotechnology vol 97 no 17 pp 7553ndash7562 2013

[54] A V Piterina and J T Pembroke ldquoUse of PCR-DGGE basedmolecular methods to analyse microbial community diversityand stability during the thermophilic stages of an ATADwastewater sludge treatment process as an aid to performancemonitoringrdquo ISRN Biotechnology vol 2013 Article ID 16264513 pages 2013

[55] T Watanabe M Kimura and S Asakawa ldquoCommunity struc-ture of methanogenic archaea in paddy field soil under doublecropping (rice-wheat)rdquo Soil Biology and Biochemistry vol 38no 6 pp 1264ndash1274 2006

[56] T Watanabe M Kimura and S Asakawa ldquoDynamics ofmethanogenic archaeal communities based on rRNA analysisand their relation to methanogenic activity in Japanese paddyfield soilsrdquo Soil Biology and Biochemistry vol 39 no 11 pp2877ndash2887 2007

[57] L Brablcova I Buriankova P Badurova P P Chaudharyand M Rulık ldquoMethanogenic archaea diversity in hyporheicsediments of a small lowland streamrdquoAnaerobe vol 32 pp 24ndash31 2015

[58] V Mach M B Blaser P Claus P P Chaudhary and M RulAkldquoMethane production potentials pathways and communitiesof methanogens in vertical sediment profiles of river SitkardquoFrontiers in Microbiology vol 6 article 506 2015

[59] GMuyzer ldquoDGGETGGE amethod for identifying genes fromnatural ecosystemsrdquoCurrent Opinion inMicrobiology vol 2 no3 pp 317ndash322 1999

[60] G Muyzer E C De Waal and A G Uitterlinden ldquoProfilingof complex microbial populations by denaturing gradient gelelectrophoresis analysis of polymerase chain reaction-amplifiedgenes coding for 16S rRNArdquo Applied and Environmental Micro-biology vol 59 no 3 pp 695ndash700 1993

[61] S J Macnaughton J R Stephen A D Venosa G A DavisY-J Chang and D C White ldquoMicrobial population changesduring bioremediation of an experimental oil spillrdquoApplied andEnvironmental Microbiology vol 65 no 8 pp 3566ndash3574 1999

[62] Y Yu C Lee J Kim and S Hwang ldquoGroup-specific primer andprobe sets to detect methanogenic communities using quanti-tative real-time polymerase chain reactionrdquo Biotechnology andBioengineering vol 89 no 6 pp 670ndash679 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

2 Archaea

Table 1 Sampling point from Delhi landfill site (Ghazipur Bhalswa and Okhla) and Southern Assam marshland (Silcoorie Lake (Silchar)Badarpur and Karimganj) areas

Feature Ghazipur Bhalswa Okhla Silcoorie Lake(Silchar) Badarpur Karimganj

Location 28∘37101584022410158401015840N77∘19101584025710158401015840E

28∘441015840271610158401015840N779∘91015840279210158401015840E

28∘3010158404210158401015840N77∘1610158405910158401015840E

24∘45101584017810158401015840N92∘46101584058310158401015840E

24∘5410158400010158401015840N92∘3610158400010158401015840E

24∘5210158400010158401015840N92∘2110158400010158401015840E

Type Leachate Soil and leachate Leachate Lake sediment Marshy pond Rice paddyDepth 150 cm 200 cm 150 cm 40 cm 100 cm Surface

compared to the developed world [14] Moreover landfillsin India are neither well planned nor engineered and areoften found in low-lying open areas where municipal wasteis haphazardly and indiscriminately disposed These siteshave neither landfill lining to avoid percolation of leachateto groundwater table nor leachate collection facility The citygenerates about 6000 tonnes of solid waste per day and theexpected quantity of solid waste generation in Delhi wouldbe about 12750 tonnes per day by 2015 [15] Due to scarcityof land in big cities municipal authorities are using thesame landfill for nearly 10ndash20 years Thus the possibility ofanaerobic emission of GHGs further increases [16]

Microbial decomposition climatic conditions MSWwastes characteristics and landfilling operations are amongthemany factors that contribute to the generation ofmethane[2 17] The migration of gas and leachate away from thelandfill boundaries and their release into the surroundingenvironment present serious environmental threats includ-ing potential health hazards fires and explosions damageto vegetation unpleasant odors landfill settlement groundwater pollution air pollution and global warming [18ndash20]

Wetlands (marshland) are the largest source of naturalmethane emissions contributing about 10ndash231 Tg methaneper year accounting for 20ndash39 of annual global CH

4

emission [4 21] Methanogens in the moist anoxic (oxygen-free) wetland soil produce CH

4as they decompose dead plant

material The methane emission from wetland was increasedby 7 from 2003 to 2007 [2 19] Methane production inwetlands is affected by the acetate supply through acetatefermentation or the CO

2reduction potential [22 23] The

exponential increase in the rate of CH4production with

temperature is due to the availability of more substratesand is not associated with changes in the composition ofmethanogens [24] Methanogens belonging to the groupsMethanomicrobiales andMethanosarcinales performing ace-toclastic and methylotrophic pathway were found to bedominant in landfill sites [25ndash27] In acidic conditions due tothe presence of acid tolerant hydrogenotrophicmethanogensH2CO2is efficiently converted to methane compared to

acetate andmethanogenic activity decreases with decrease inpH regardless of the substrates [28]

The prokaryotic diversity in our planet dictates ourplanetrsquos ecosystems by acting as key functional drivers [29]The understanding of the functional potential of the mostindividual microbial flora residing within the ecosystemis extremely limited because of our inability to isolateand culture them in laboratory conditions [30] Since themethanogens are anaerobes and are difficult to culture they

are identified by culture independent molecular techniqueslike PCR amplification denaturing gradient gel electrophore-sis (DGGE) and quantitative real-time PCR usingmolecularmarkers such as 16S rDNA genetic locus [31ndash34] Hencethe present study was aimed at detecting the methanogenicArchaea inhabitants (richness) (by DGGE) identification byDNA sequencing and quantification by qPCR in both thelandfill sites of Delhi andmarshland sites of Southern AssamIndia

2 Material and Methods

21 Collection of Leachate and Sediment Samples Leachatesamples were collected from three landfill sites (BhalswaOkhla and Ghazipur) in the area of New Delhi India Thesesites are active landfill sites and are still in use They do nothave the leachate collection facility or landfill liner to avoidpercolation of leachate to the ground water table (aquifer)Soil sediment sample was collected from marshlands (Sil-coorie Lake (Silchar) Badarpur and Karimganj) of SouthernAssam India in sterile falcon tubesThe details of sites alongwith criteria and physiochemical parameters are shown inTables 1 and 2

22 Nucleic Acid Extraction PCR Amplification and CloningDNA from both landfill leachate and marshland sedimentsamples was extracted on the same day of sampling using FastDNA Spin Kit for Soil (MP Biomedicals CA USA) DNAfrom themarshlands and landfill leachatewas amplified usingthe primer set 86FWD and 1340REV (Table 3)

The amplification profile was 94∘C for 5min 94∘C for 30 sfor 30 cycles and 58∘C for 1 minute elongation at 72∘C for 2minutes and final extension at 72∘C for 10 minutes followedby a cooling step down to 4∘C [35 36] Obtained 16S rDNAPCRproducts were purified by PCRpurification kit (Fermen-tas UK) as recommended by manufacturer protocol PCRamplicons of 16S rDNA gene were cloned inside PTZ57RTvector using the Insta-TA cloning kit (Fermentas UK)and transformed into Escherichia coli DH5120572 The positiveclones were selected using blue-white screening on Luria-Bertani plates containing Ampicillin (100mgmL) X-gal(20mgmL) and IPTG (100mM)Then positive clones weresequenced using M13 FWD primer

23 DNA Sequencing and Phylogenetic Analysis of 16S rDNAClones Sequencing was performed for all the clones with

Archaea 3

Table 2 Chemical analysis of leachate samples obtained from three landfill and marshland sites All parameters are in mg Lminus1 adapted fromGhosh et al 2015 and Roy and Gupta 2012 [37 38]

Parameter Bhalswa Ghazipur Okhla Silcoorie Lake (Silchar) Karimganj BadarpurpH 81 84 83 627 689 669TDS 31469 29700 33657 53282 68293 65312COD 29930 31600 29020 NA NA NAFe 1032 981 651 281 617 389Cl 227 11742 264 911 1260 1631

Table 3 List of primers for PCR amplification of 16S rDNA gene and DGGE used in the present study

Primer Sequence (51015840-31015840) ReferenceMET86 F GCT CAG TAA CAC GTG Wright and Pimm 2003 [36]MET1340 R CGG TGT GTG CAA GGA519FWD CAGCCGCCGCGGTAA Cheng et al 2009 [35]915REV GTGCTCCCCCGCCAATTCCT

915GC CGC CCG GGG CGC GCC CCG GGC GGG GCG GGGGCA CGG GGGGTT GTGCTCCCCCGCCAATTCCT Cheng et al 2009 [35]

Table 4 List of accession numbers of the sequences submitted in NCBI and their percent similarity with database along with the samplingsites

Accession number Sample ID Tentative organism name LocationKM0412391 MET1 LAND Methanoculleus thermophiles (99 similarity with JF3301141) Bhalswa landfillKM0412401 MET2 LAND Methanoculleus thermophiles (99 similarity with JF3301141) Bhalswa landfillKM0412411 MET3 LAND Uncultured archaeon clone (99 similarity with AB5353551) Bhalswa landfillKM0412421 METG1 LAND Uncultured archaeon clone (94 similarity with JF8071451) Ghazipur landfillKM0412481 METK2 MARSH Uncultured euryarchaeote clone (98 similarity with KF3600111) KarimganjKM0412491 METK4 MARSH Uncultured archaeon clone (100 similarity with JQ2456871) KarimganjKM0412501 SD1 MARSH Uncultured archaeon clone (97 similarity with JF3041361) Silcoorie Lake (Silchar)KM0412511 SD3 MARSH Uncultured archaeon clone (97 similarity with JF7087031) Silcoorie Lake (Silchar)KM0412521 SD4 MARSH Uncultured archaeon clone (91 similarity with AB3648931) Silcoorie Lake (Silchar)KM0412431 MetG2 landfill Methylobacillus flagellates (97 similarity with NR 0741781) Ghazipur landfillKM0412441 MetG3 landfill Methylobacillus arboreus (99 similarity with NR 1088511) Ghazipur landfillKM0412451 MEtG4 landfill Methylobacillus flagellates (99 similarity with NR 0741781) Ghazipur landfillKM0412461 MetG6 landfill Methylobacillus flagellates (98 similarity with NR 0741781) Ghazipur landfillKM0412471 MetG7 landfill Methylobacillus arboreus (99 similarity with NR 1088511) Ghazipur landfill

the ABI prism 3130 Genetic Analyzer (Applied Biosys-tem Inc CA) at Department of Biochemistry SouthCampus Delhi University The sequences were edited toexclude the PCR primer-binding site and manually correctedwith Sequence Scanner 10 (Applied Biosystems) and werechecked further for vector contamination using the Vec-screen tool (httpwwwncbinlmnihgovtoolsvecscreen)The sequences showing similarity with vector sequences fromboth ends were trimmed Sequences were then comparedwith the available nucleotide database from the NCBI Gen-Bank using the BLAST program [39] The partial nucleotidesequences of 16S rDNA genes were submitted to NCBI underaccession numbers KM041239 to KM041252 (Table 4)

Partial 16S rDNA sequences obtained from this studywere used for similarity search in NCBI database using

BLAST program After performing BLAST sequences show-ing similarity above 90 were used and aligned in MEGAsoftware version 60 [40] using ClustalW The phylogeneticrelatedness among clones was estimated using the MaximumLikelihood tree using Kimura K2P+G model with 2000bootstrap value [41] For model selection Bayesian analysiswas performed and the model with lowest BIC value (ie121048604) was chosen for tree construction All positionscontaining gaps and missing data were eliminated from thedataset (complete deletion option)The phylogenetic analysiswas carried out using MEGA software version 60 [40](Figure 1)

24 Denaturing Gradient Gel Electrophoresis For denaturinggradient gel electrophoresis genomic DNA extracted from

4 Archaea

gi|374627936Methanoplanus limicola Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

I

MetG7 landfill

MetG3 landfill

METG1 LAND

METK2 MARSH

gi|219850687Methanosphaerula palustrisAB5353551 Uncultured archaeon gene for 16S rRNA

MET3 LAND

MET1 LAND

MET2 LAND

JF3301141 Methanoculleus thermophilus 16S rRNA

gi|478482031Candidatus Methanomethylophilus alvus

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Crenarchaeota

Thaumarchaeota

Methylobacillus flagellatus_16S rRNA

MetG2 landfill

MetG6 landfill99

MEtG4 landfill

02

9699

91

9352

9898

92

15

9957

50100

47

6599

99

85

99

30

99

9917

15

77

62

59

98

9782

99

JF8071451 Uncultured archaeon clone QTP C83 16S rRNA

gi|343198895Methanoculleus receptaculi

gi|126177952Methanoculleus marisnigrigi|636560821Methanoculleus hydrogenitrophicus

gi|254971238Methanoculleus thermophilus

Methylobacillus arboreus_16S rRNA

gi|645321034Methanomassiliicoccus luminyensis

gi|631251679Methanoregula formicica

gi|485099044Methanoregula formicica

gi|470467532Methanoregula boonei

gi|444303982Thermofilum pendens Hrk

gi|265678906Thermofilum pendens strain HVv3

gi|444304108Staphylothermus hellenicus

METK4 MARSH

JQ2456871 Uncultured archaeon clone SYNH02 ew01A-104 16S rRNA

SD4 MARSH

SD3 MARSH

SD1 MARSH

KF5645961 Uncultured archaeon clone AP0-53 16S rRNA

gi|631251601Methanolinea mesophila

KF3600111 Uncultured euryarchaeote clone ZW-M-5 16S rRNA

JF3041361 Uncultured archaeon clone 5(22) 16S rRNA

JN2274881 Candidatus Nitrosotalea devanaterra isolate Nd1 16S rRNA

HQ3311161 Nitrosopumilaceae archaeon MY1 16S rRNA

JQ3467651 Nitrosopumilus maritimus SCM1 16S rRNA

gi|507148109Candidatus Nitrososphaera gargensis

II

III

IIIb

IIIa

Figure 1 The phylogenetic relationship of 40 partial 16S rDNA sequences (the confirmed 14 sequences of clones are generated in this studyrecovered from both Delhi landfills (marked with black circle grey circle and grey triangle) and Southern Assam marshland sites (markedwith black triangle)) was inferred by the ML method using K2P+G parameter model with 2000 bootstrap replicates using the MEGA 6 treebuilding program

landfill and marshland was amplified using primer 519FWDand 915GC which gave a product length of about 500 bpDGGE was performed with a D-Code universal mutationdetection system (Biorad Hercules CA USA) using 16 cmby 16 cm and one mm gels PCR products were loaded onto7 (wv) polyacrylamide gel The polyacrylamide gels (Bis-Acrylamide 375 1) were made with denaturing gradients

ranging from 30 to 70 100 denaturant contained 7Murea and 40 formamide Electrophoresis was initially run at200V for 10min at 60∘C and afterwards for 15 h at 85V Afterelectrophoresis the gel was silver-stained and scanned underwhite light using Gel Doc (Biorad) (Figure 2) DGGE gelwas further analyzed using Gel2K software (Svein NorlandDepartment of Biology University of Bergen Norway)

Archaea 5

OK BH GZ SON SIL KRM BDR

Figure 2 Community profiling of methanogens using 16s rDNAbased onDGGE the community profiling ofmethanogenic diversitypresent in the leachate sample of Delhi landfill site (OK BH andGZ) and marshland sample of Southern Assam (SON SIL KRMand BDR)

25 Quantification of Methanogens by Quantitative Real-TimePCR Analysis Real-time PCR was done for absolute quan-tification of methanogens 16S rDNA fragments obtainedfrom pure culture of methanogens (DSMZ) were cloned andserially diluted for making standard curve as was previouslydone by Steinberg and Regan [27] Real-time PCR reactionwas carried out in triplicate using the temperature profile asrecommended for the Agilent 2x master mix that is initialdenaturation at 95∘C for 3 minutes subsequent denaturationat 95∘C for 30 seconds annealing at 60∘C for 10 seconds andelongation at 65∘C for 1 minute Melt curve analysis to detectthe presence of primer dimer was performed after the finalextension by increasing the temperature from 50 to 95∘Cwith05∘C increments every 10 s

3 Results and Discussions

31 Identification of Methanogenic Archaea in Landfill andMarshland Sequences of MET1 LAND and MET2 LANDobtained from the Bhalswa landfill site are clustered withMethanoculleus thermophilus methanogens belonging to theorder Methanomicrobiales which are hydrogenotrophic innature Third sequence of MET3 LAND from the Bhalswalandfill site clustered with the Candidatus Methanomethy-lophilus alvus Mx1201 which is H

2-dependent methy-

lotrophic methanogens In Figure 1 it is shown that thesethree sequences from the landfill sites of Delhi are clusteredwith Euryarchaeota cluster (Cluster I) Sequence METG1LAND obtained from the Ghazipur landfill site Delhi clus-tered with Methanomassiliicoccus luminyensis (Cluster II)Sequences obtained frommarshland sites of Southern Assamwere clustered (Cluster III) separately with Crenarchaeota(Cluster IIIa) and Thaumarchaeota (Cluster IIIb) There arefive more sequences from the landfill sites of Delhi They arerelated to two different species of methanotrophs (methane

oxidizing bacteria) (see Table 4) Methylobacillus arboreus(marked as grey triangle) and Methylobacillus flagellatus(marked as grey circle) and are clustered separately as shownin Figure 1

Phylogenetic analysis of 16S rDNA clones indicates thepresence of methanogens belonging to the phylum Eur-yarchaeota order Methanomicrobiales Methanobacteriales-1 and seventh order of methanogens in the landfill sites [42ndash44] Both Candidatus Methanomethylophilus alvus Mx1201and Methanomassiliicoccus luminyensis represent a mono-phyletic lineage that is not phylogenetically associated withany of the previously known orders of methanogens or theanaerobic methanotrophic ANME1 lineage [43 45] Theybelong to the Mx order clusters with two lineages the plank-tonic Marine Group II (MG-II) and the sediment dwellingMarine Benthic Group D (MBG-D) [45ndash47] The other fivesequences from Ghazipur landfill sites revealed presence ofmethanotrophs belonging to class Betaproteobacteria familyMethylophilaceae 16S rDNA clones obtained from marsh-land sites of Southern Assam revealed a cluster of Archaeathat are distantly related to twodifferent phyla CrenarchaeotaandThaumarchaeota Microorganisms belonging to the phy-lum Thaumarchaeota (recently proposed) are thermophilicandmesophilic in nature and are found to be present in awidevariety of ecosystems including marine and fresh waterssoils and also hot environment [44 48ndash52]

32 Culture Independent Molecular Analysis of MethanogenicDiversity Microbes dominated in the history of living organ-isms and they are a fundamental part of the biosphere Thestudy of microbial diversity has been therefore essential forunderstanding the evolution of life Traditionally cultivationbased methods have contributed to our knowledge abouttheir whereabouts and diversity of microbes in naturallyoccurring communities However only a small fraction ofthe prokaryotes has been cultivated in vitro by standardmethodsTherefore this knowledgemay not reveal the actualcomposition andor diversity associated with an ecosystem[31 33] In the present study we used culture indepen-dent molecular techniques like 16S rDNA PCR cloning-sequencing DGGE and qPCR for estimation of the richnessand diversity of the methanogenic Archaea in the landfillsite of Delhi and marshland areas of Southern Assam Thesetechniques arewidely used formolecular community analysisof microbes present in various types of habitats [32 42 53ndash56] A combination of DNA sequencing DGGE and quanti-tative PCR (qPCR) can provide valuable information aboutmicrobial consortia associated with a specific ecosystemDenaturing gradient gel electrophoresis (DGGE) is used todetermine the genetic diversity of microbial communitiesThe procedure is based on electrophoresis of PCR-amplified16S rDNA fragments in polyacrylamide gels containing alinearly increasing gradient of denaturants In DGGE DNAfragments of the same length but with different base-paircomposition can be separated Separation is based on theelectrophoretic mobility of partially melted DNA moleculesin a polyacrylamide gel and resulting into a band pattern [57ndash60] DGGE can reveal 1-2 of the actual diversity present inthe samples [61]

6 Archaea

Table 5 Copy number of methanogens present per gram samples of Okhla and Bhalswa landfill site Delhi and Silcoorie Lake Assam India

Pure culture Okhla Bhalswa Silcoorie Lake (Silchar)M arbophilicus 398119890 + 014ndash68119890 + 014 538119890 + 014ndash97119890 + 014 278119890 + 011ndash78119890 + 011M bryantii 114119890 + 017ndash18119890 + 017 46119890 + 016ndash82119890 + 016 12119890 + 013ndash21119890 + 013M mobile 667119890 + 015ndash75119890 + 015 342119890 + 015ndash48119890 + 015 397119890 + 012ndash41119890 + 012M mazei 189119890 + 014ndash25119890 + 014 221119890 + 015ndash28119890 + 015 113119890 + 012ndash15119890 + 012

Table 6 Methanogenic pathways and microorganisms that are associated

Domain Archaea kingdom Archaebacteria phylum EuryarchaeotaMethanogenic pathway Orders ReactionAcetoclastic Methanosarcinales CH

3COOHrarrCH

4+ CO

2

Hydrogenotrophic Methanosarcinales 4H2+ CO

2rarrCH

4+ 2H2O

Methanobacteriales 4HCOOHrarrCH4+ 3CO

2+ 2H2O

MethanococcalesMethanomicrobialesMethanopyrales

Methylotrophic Methanosarcinales 4CH3OHrarr 3CH

4+ CO

2+ 2H2O

33 Estimation of Methanogenic Richness by QuantitativeReal-Time PCR DNA extracted from the three samplingpoints that is two landfill sites Okhla and Bhalswa of Delhiand Silcoorie Lake (Silchar) of SouthernAssam was screenedfor the quantification of methanogens The copy number ofall methanogens (pure culture) was higher in the two landfillsites than that of marshland in Southern Assam (Table 5)Methanogenic pathway associated with the methanogensorder and its reactions involved in the process are includedin Table 6

The copy numbers ofMethanomicrobium mobile belong-ing to the order Methanomicrobiales and Methanobac-terium bryantii belonging to the order Methanobacteriales-1 were found to be higher in both landfill sites in com-parison to the Silcoorie Lake (Silchar) of Southern AssamCopy number of Methanobrevibacter arboriphilus (orderMethanobacteriales-1) andMethanosarcinamazei (acetoclas-tic) (order Methanosarcinales) was found to be higher in theBhalswa landfill site than Okhla landfill site and SilcoorieLake (Silchar) marshland site The value of 119877Sq and slope 119889119877for standard curve was 0948 and minus2641 and the efficiencyof the reaction was 1391 The 119877Sq and slope 119889119877 values forldquoabsoluterdquo quantification of Methanobrevibacter arboriphilusare 0903 and minus2128 119877Sq (119889119877) and slope 119889119877 values for thisquantification of Methanobacterium bryantii are 0877 andminus1384 119877Sq (119889119877) and slope 119889119877 values of Methanomicrobiummobile are 0956 and minus2563 respectively The values of 119877Sq(119889119877) and slope 119889119877 forMethanosarcina mazei were 0394 andminus2051 respectively

Methanogens pertaining to both acetotrophic and hy-drogenotrophic decomposition pathways were detected inMSW landfills which have been reported earlier [25 26 42]Acetate serves as a precursor for more than 70 of CH

4

(methane) formation in the most anaerobic digestion pro-cess [62] Therefore acetoclastic methanogens which utilizeacetate as substrate play a key role in stabilizing the pollution

load of wastewater by methanogenesis In the present studyquantitative PCR indicates the higher methanogenic richnessin both landfill sites of Delhi compared to marshland ofSilcoorie Lake Silchar

34 Diversity of Methanogenic Archaea by DenaturingGradient Gel Electrophoresis Abundance and diversity ofmethanogenic Archaea were studied in three landfill and fourmarshland sites situated at different location in Delhi andSouthernAssam India 16S rDNAampliconswere cloned andthen analyzed on the DGGE gel for estimation of the archaealrichness in respective samples as shown in Figure 2

Band patterns of 16S rDNA amplicons obtained fromthe landfill sites (OK BH and GZ) of Delhi and marshlandsamples (SON SIL KRM and BDR) of Southern Assamwerecompared for methanogens richness and diversity analysisusing Gel2K software Analysis of DGGE image revealed thepresence of total 38 bands There are some unique bands ineach lane which indicates the variation ofmethanogens com-munity residing in those particular samples Cluster analysisof bands using Jaccard analysis indicated the presence of threemain clusters consisting of localities that differ in number ofsimilarity versus DGGE bands (Figure 3)

In the first cluster Badarpur beetle-nut pond and Sil-coorie Lake (Silchar) of Southern Assam clustered togethershowing similar band pattern In the second cluster inter-estingly despite being two different ecosystems Ghazipurlandfill sites of Delhi clusteredwithwetland of Sonbill South-ern Assam India In the third cluster the two landfill sitesof Delhi (Okhla and Bhalswa) clustered together showingsimilar band pattern In terms of richness number of bandsfrom the respective samples fromBhalswa landfill and Sonbillwetland have maximum of 11 bands followed by Ghazipurlandfill site and Silcoorie Lake (Silchar) having 10 bands eachOkhla landfill and Badarpur beetle-nut pond showed 9 bands

Archaea 7

Jacc

ard

10

08

06

04

02

00 Bada

rpur

Silc

oorie

Karim

ganj

Sonb

ill

Gha

zipu

r

Bhal

saw

a

Okh

la

Comp

Figure 3 Jaccard cluster diagram of DGGE bands obtained from landfill sites of Delhi and marshland of Southern Assam India

each in the cluster In the Karimganj rice paddy field sampleonly four bands were observed showing the least diversity

Microbial diversity within contaminated ecosystems likelandfill should be less diverse than those in natural systemslike a wetland because the diversity may be influenced by thecomplexity of toxic chemical mixtures heavy metals presentand duration of time the populations have been exposed Inthe present study after analyzing DGGE gel banding patternand the number of bands we found that the methanogenicdiversity present in both landfills (anthropogenic system) andmarshland (natural) is quite similar except for the samplesobtained from the Karimganj rice paddy field where onlyfour bands appeared The number of total bands observedin this study was in accordance with the number of DGGEbands reported previously [42 51 56 57] It strongly indicatesthat the methanogenic Archaea diversity in both landfill andmarshland is influenced by sampling location rather thantype

4 Conclusions

In the sequencing of themolecular marker for archaeal diver-sity 16S rDNA identified the orders named as Methanobac-teriales and Methanosarcinales in both landfill sites and thephylum Crenarchaeota (thermophilic) in marshland Quan-titative PCR indicated a higher abundance ofmethanogens inlandfill compared to that of marshland sites The knowledgeabout the composition and abundance of methanogenicArchaea in a landfill may provide information on thedecomposition mechanism of municipal solid waste and thesubsequent generation of methane This information canbe exploited for controlling methane emission from land-fill by mitigation process The increasing knowledge about

the genomic content of microbes belonging to the phylumThaumarchaeota (mesophilic) will enrich our understandingof their adaptative behavior in the transposition from ther-mophily to mesophily This indicates whether they follow asimilar or different evolutionary pattern with respect to thephylum Euryarchaeota

Abbreviations

MSW Municipal solid wasteGHGs Green House GasesDGGE Denaturing gradient gel electrophoresismM MillimolarMg MilligrammL MillilitreTg Teragram

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Dr S S Maitra and Professor Sankar K Ghosh are grateful tothe Department of Biotechnology (DBT) of the Governmentof India for providing a Grant (BT14NETBP2010) Theauthors are extremely thankful to the referees for theirvaluable suggestions for improving the quality of the paperThe authors are indebted to Dr Santanu Raychaudhuri a UScitizen presently assigned as a Visiting Research Faculty atAssam University for correcting the paper

8 Archaea

References

[1] G Yvon-Durocher A P Allen D Bastviken et al ldquoMethanefluxes show consistent temperature dependence across micro-bial to ecosystem scalesrdquoNature vol 507 no 7493 pp 488ndash4912014

[2] S D Bridgham H Cadillo-Quiroz J K Keller and Q ZhuangldquoMethane emissions fromwetlands biogeochemical microbialand modeling perspectives from local to global scalesrdquo GlobalChange Biology vol 19 no 5 pp 1325ndash1346 2013

[3] J T Houghton Y Ding D J Griggs et al Climate Change2001 The Scientific Basis vol 881 Cambridge University PressCambridge Mass USA 2001

[4] S Solomon Climate Change 2007mdashThe Physical Science BasisWorkingGroup IContribution to the FourthAssessment Report ofthe IPCC vol 4 Cambridge University Press Cambridge UK2007

[5] R Angel P Claus and R Conrad ldquoMethanogenic archaea areglobally ubiquitous in aerated soils and become active underwet anoxic conditionsrdquoThe ISME Journal vol 6 no 4 pp 847ndash862 2012

[6] A R Daquiado K M Cho T Y Kim S C Kim H-H Changand Y B Lee ldquoMethanogenic archaea diversity in Hanwoo(Bos taurus coreanae) rumen fluid rectal dung and barn floormanure using a culture-independent method based on mcrAgene sequencesrdquo Anaerobe vol 27 pp 77ndash81 2014

[7] R S Oremland ldquoBiogeochemistry of methanogenic bacteriardquoin Biology of Anaerobic Microorganisms pp 641ndash705 JohnWiley amp Sons 1988

[8] S H Zinder ldquoPhysiological ecology of methanogensrdquo inMethanogenesis pp 128ndash206 Springer Berlin Germany 1993

[9] J-L Garcia B K C Patel and B Ollivier ldquoTaxonomic phy-logenetic and ecological diversity of methanogenic ArchaeardquoAnaerobe vol 6 no 4 pp 205ndash226 2000

[10] E Bapteste C Brochier and Y Boucher ldquoHigher-level clas-sification of the Archaea evolution of methanogenesis andmethanogensrdquo Archaea vol 1 no 5 pp 353ndash363 2005

[11] J N Reeve J Nolling R M Morgan and D R SmithldquoMethanogenesis genes genomes and whorsquos on firstrdquo Journalof Bacteriology vol 179 no 19 pp 5975ndash5986 1997

[12] R K Thauer A-K Kaster H Seedorf W Buckel and RHedderich ldquoMethanogenic archaea ecologically relevant dif-ferences in energy conservationrdquo Nature Reviews Microbiologyvol 6 no 8 pp 579ndash591 2008

[13] C C Mitigation IPCC Special Report on Renewable EnergySources and Climate Change Mitigation 2011

[14] D Mayumi J Dolfing S Sakata et al ldquoCarbon dioxideconcentration dictates alternativemethanogenic pathways in oilreservoirsrdquo Nature Communications vol 4 article 1998 2013

[15] S Gupta N Choudhary and B J Alappat ldquoBioreactor landfillfor MSW disposal in Delhirdquo in Proceedings of the InternationalConference on Sustainable Solid Waste Management ChennaiIndia September 2007

[16] M Rawat and A Ramanathan ldquoAssessment of methane fluxfrom municipal solid waste (MSW) landfill areas of DelhiIndiardquo Journal of Environmental Protection vol 2 no 4 pp399ndash407 2011

[17] V Talyan R P Dahiya S Anand and T R SreekrishnanldquoQuantification of methane emission from municipal solidwaste disposal in Delhirdquo Resources Conservation and Recyclingvol 50 no 3 pp 240ndash259 2007

[18] L B Hansen K Finster H Fossing and N Iversen ldquoAnaerobicmethane oxidation in sulfate depleted sediments effects ofsulfate and molybdate additionsrdquo Aquatic Microbial Ecologyvol 14 no 2 pp 195ndash204 1998

[19] A A Bloom P I Palmer A Fraser S R David and CFrankenberg ldquoLarge-scale controls of methanogenesis inferredfrom methane and gravity spaceborne datardquo Science vol 327no 5963 pp 322ndash325 2010

[20] V Singh and A Mittal ldquoToxicity analysis and public healthaspects of municipal landfill leachate a case study of OkhlaLandfill Delhirdquo in Proceedings of the 8th World Wide Workshopfor Young Environmental Scientists WWW-YES 2009 UrbanWaters Resource or Risks 2ndash5 June 2009 2011

[21] D Liu W Ding Z Jia and Z Cai ldquoThe impact of dissolvedorganic carbon on the spatial variability of methanogenicarchaea communities in natural wetland ecosystems acrossChinardquo Applied Microbiology and Biotechnology vol 96 no 1pp 253ndash263 2012

[22] B P Walter M Heimann R D Shannon and J R White ldquoAprocess-based model to derive methane emissions from naturalwetlandsrdquoGeophysical Research Letters vol 23 no 25 pp 3731ndash3734 1996

[23] L S Chasar J P Chanton P H Glaser and D I SiegelldquoMethane concentration and stable isotope distribution asevidence of rhizospheric processes Comparison of a fen andbog in the glacial Lake Agassiz Peatland complexrdquo Annals ofBotany vol 86 no 3 pp 655ndash663 2000

[24] G B Avery Jr R D Shannon J R White C S Martensand M J Alperin ldquoControls on methane production in a tidalfreshwater estuary and a peatland methane production viaacetate fermentation and CO

2reductionrdquo Biogeochemistry vol

62 no 1 pp 19ndash37 2003[25] L-N Huang Y-Q Chen H Zhou S Luo C-Y Lan and L-H

Qu ldquoCharacterization of methanogenic Archaea in the leachateof a closed municipal solid waste landfillrdquo FEMS MicrobiologyEcology vol 46 no 2 pp 171ndash177 2003

[26] W Laloui-Carpentier T Li V Vigneron L Mazeas and TBouchez ldquoMethanogenic diversity and activity in municipalsolid waste landfill leachatesrdquoAntonie van Leeuwenhoek vol 89no 3-4 pp 423ndash434 2006

[27] L M Steinberg and J M Regan ldquoPhylogenetic comparison ofthe methanogenic communities from an acidic oligotrophicfen and an anaerobic digester treating municipal wastewatersludgerdquoApplied and Environmental Microbiology vol 74 no 21pp 6663ndash6671 2008

[28] Q Ban J Li L Zhang Y Zhang and A K Jha ldquoPhylogeneticdiversity of methanogenic archaea and kinetics of methaneproduction at slightly acidic conditions of an anaerobic sludgerdquoInternational Journal of Agriculture and Biology vol 15 no 2pp 347ndash351 2013

[29] S G Tringe and EM Rubin ldquoMetagenomics DNA sequencingof environmental samplesrdquo Nature Reviews Genetics vol 6 no11 pp 805ndash814 2005

[30] R D Bardgett and W H van der Putten ldquoBelowgroundbiodiversity and ecosystem functioningrdquo Nature vol 515 no7528 pp 505ndash511 2014

[31] N R Pace ldquoNew perspective on the natural microbial worldmolecularmicrobial ecologyrdquoASMNews vol 62 no 9 pp 463ndash470 1996

[32] J L Kirk L A Beaudette M Hart et al ldquoMethods of studyingsoil microbial diversityrdquo Journal ofMicrobiologicalMethods vol58 no 2 pp 169ndash188 2004

Archaea 9

[33] R I Amann W Ludwig and K-H Schleifer ldquoPhylogeneticidentification and in situ detection of individual microbial cellswithout cultivationrdquo Microbiological Reviews vol 59 no 1 pp143ndash169 1995

[34] M Keller and K Zengler ldquoTapping into microbial diversityrdquoNature Reviews Microbiology vol 2 no 2 pp 141ndash150 2004

[35] Y F Cheng S Y Mao J X Liu and W Y Zhu ldquoMoleculardiversity analysis of rumenmethanogenic Archaea from goat ineastern China by DGGEmethods using different primer pairsrdquoLetters in AppliedMicrobiology vol 48 no 5 pp 585ndash592 2009

[36] A-D G Wright and C Pimm ldquoImproved strategy for pre-sumptive identification ofmethanogens using 16S riboprintingrdquoJournal of Microbiological Methods vol 55 no 2 pp 337ndash3492003

[37] P Ghosh A Gupta and I S Thakur ldquoCombined chemicaland toxicological evaluation of leachate from municipal solidwaste landfill sites of Delhi Indiardquo Environmental Science andPollution Research vol 22 no 12 pp 9148ndash9158 2015

[38] S Roy and A Gupta ldquoWater quality assessment of river barakand tributaries in Assam Indiardquo Pollution Research vol 31 no3 pp 445ndash450 2012

[39] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990

[40] K Tamura G Stecher D Peterson A Filipski and S KumarldquoMEGA6molecular evolutionary genetics analysis version 60rdquoMolecular Biology and Evolution vol 30 no 12 pp 2725ndash27292013

[41] M Kimura ldquoA simple method for estimating evolutionary ratesof base substitutions through comparative studies of nucleotidesequencesrdquo Journal ofMolecular Evolution vol 16 no 2 pp 111ndash120 1980

[42] T Watanabe M Kimura and S Asakawa ldquoDiversity ofmethanogenic archaeal communities in Japanese paddy fieldecosystem estimated by denaturing gradient gel electrophore-sisrdquoBiology and Fertility of Soils vol 46 no 4 pp 343ndash353 2010

[43] G Borrel H M B Harris W Tottey et al ldquoGenomesequence of lsquoCandidatusMethanomethylophilus alvusrsquo Mx1201a methanogenic archaeon from the human gut belonging to aseventh order of methanogensrdquo Journal of Bacteriology vol 194no 24 pp 6944ndash6945 2012

[44] H Juottonen Archaea Bacteria and methane production alongenvironmental gradients in fens and bogs [PhD thesis] Univer-sity of Helsinki Helsinki Finland 2008

[45] G Borrel PW OrsquoToole HM B Harris P Peyret J-F Brugereand S Gribaldo ldquoPhylogenomic data support a seventh orderof methylotrophic methanogens and provide insights into theevolution of methanogenesisrdquo Genome Biology and Evolutionvol 5 no 10 pp 1769ndash1780 2013

[46] V Iverson R M Morris C D Frazar C T BerthiaumeR L Morales and E V Armbrust ldquoUntangling genomesfrom metagenomes revealing an uncultured class of marineeuryarchaeotardquo Science vol 335 no 6068 pp 587ndash590 2012

[47] K G Lloyd L Schreiber D G Petersen et al ldquoPredominantarchaea in marine sediments degrade detrital proteinsrdquoNaturevol 496 no 7444 pp 215ndash218 2013

[48] I Anderson R Wirth S Lucas et al ldquoComplete genomesequence of Staphylothermus hellenicusP8Trdquo Standards inGenomic Sciences vol 5 no 1 p 12 2011

[49] C Brochier-Armanet S Gribaldo and P Forterre ldquoSpotlight onthe thaumarchaeotardquo The ISME Journal vol 6 no 2 pp 227ndash230 2012

[50] P E Galand H Fritze R Conrad and K Yrjala ldquoPathwaysfor methanogenesis and diversity of methanogenic archaea inthree boreal peatland ecosystemsrdquo Applied and EnvironmentalMicrobiology vol 71 no 4 pp 2195ndash2198 2005

[51] M Ikenaga S Asakawa Y Muraoka and M KimuraldquoMethanogenic archaeal communities in rice roots grown inflooded soil pots estimation by PCR-DGGE and sequenceanalysesrdquo Soil Science and Plant Nutrition vol 50 no 5 pp 701ndash711 2004

[52] A Spang A Poehlein P Offre et al ldquoThe genome ofthe ammonia-oxidizing Candidatus nitrososphaera gargensisinsights into metabolic versatility and environmental adapta-tionsrdquoEnvironmentalMicrobiology vol 14 no 12 pp 3122ndash31452012

[53] P P Chaudhary L Brablcova I Buriankova and M RulıkldquoMolecular diversity and tools for deciphering the methanogencommunity structure and diversity in freshwater sedimentsrdquoAppliedMicrobiology and Biotechnology vol 97 no 17 pp 7553ndash7562 2013

[54] A V Piterina and J T Pembroke ldquoUse of PCR-DGGE basedmolecular methods to analyse microbial community diversityand stability during the thermophilic stages of an ATADwastewater sludge treatment process as an aid to performancemonitoringrdquo ISRN Biotechnology vol 2013 Article ID 16264513 pages 2013

[55] T Watanabe M Kimura and S Asakawa ldquoCommunity struc-ture of methanogenic archaea in paddy field soil under doublecropping (rice-wheat)rdquo Soil Biology and Biochemistry vol 38no 6 pp 1264ndash1274 2006

[56] T Watanabe M Kimura and S Asakawa ldquoDynamics ofmethanogenic archaeal communities based on rRNA analysisand their relation to methanogenic activity in Japanese paddyfield soilsrdquo Soil Biology and Biochemistry vol 39 no 11 pp2877ndash2887 2007

[57] L Brablcova I Buriankova P Badurova P P Chaudharyand M Rulık ldquoMethanogenic archaea diversity in hyporheicsediments of a small lowland streamrdquoAnaerobe vol 32 pp 24ndash31 2015

[58] V Mach M B Blaser P Claus P P Chaudhary and M RulAkldquoMethane production potentials pathways and communitiesof methanogens in vertical sediment profiles of river SitkardquoFrontiers in Microbiology vol 6 article 506 2015

[59] GMuyzer ldquoDGGETGGE amethod for identifying genes fromnatural ecosystemsrdquoCurrent Opinion inMicrobiology vol 2 no3 pp 317ndash322 1999

[60] G Muyzer E C De Waal and A G Uitterlinden ldquoProfilingof complex microbial populations by denaturing gradient gelelectrophoresis analysis of polymerase chain reaction-amplifiedgenes coding for 16S rRNArdquo Applied and Environmental Micro-biology vol 59 no 3 pp 695ndash700 1993

[61] S J Macnaughton J R Stephen A D Venosa G A DavisY-J Chang and D C White ldquoMicrobial population changesduring bioremediation of an experimental oil spillrdquoApplied andEnvironmental Microbiology vol 65 no 8 pp 3566ndash3574 1999

[62] Y Yu C Lee J Kim and S Hwang ldquoGroup-specific primer andprobe sets to detect methanogenic communities using quanti-tative real-time polymerase chain reactionrdquo Biotechnology andBioengineering vol 89 no 6 pp 670ndash679 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Archaea 3

Table 2 Chemical analysis of leachate samples obtained from three landfill and marshland sites All parameters are in mg Lminus1 adapted fromGhosh et al 2015 and Roy and Gupta 2012 [37 38]

Parameter Bhalswa Ghazipur Okhla Silcoorie Lake (Silchar) Karimganj BadarpurpH 81 84 83 627 689 669TDS 31469 29700 33657 53282 68293 65312COD 29930 31600 29020 NA NA NAFe 1032 981 651 281 617 389Cl 227 11742 264 911 1260 1631

Table 3 List of primers for PCR amplification of 16S rDNA gene and DGGE used in the present study

Primer Sequence (51015840-31015840) ReferenceMET86 F GCT CAG TAA CAC GTG Wright and Pimm 2003 [36]MET1340 R CGG TGT GTG CAA GGA519FWD CAGCCGCCGCGGTAA Cheng et al 2009 [35]915REV GTGCTCCCCCGCCAATTCCT

915GC CGC CCG GGG CGC GCC CCG GGC GGG GCG GGGGCA CGG GGGGTT GTGCTCCCCCGCCAATTCCT Cheng et al 2009 [35]

Table 4 List of accession numbers of the sequences submitted in NCBI and their percent similarity with database along with the samplingsites

Accession number Sample ID Tentative organism name LocationKM0412391 MET1 LAND Methanoculleus thermophiles (99 similarity with JF3301141) Bhalswa landfillKM0412401 MET2 LAND Methanoculleus thermophiles (99 similarity with JF3301141) Bhalswa landfillKM0412411 MET3 LAND Uncultured archaeon clone (99 similarity with AB5353551) Bhalswa landfillKM0412421 METG1 LAND Uncultured archaeon clone (94 similarity with JF8071451) Ghazipur landfillKM0412481 METK2 MARSH Uncultured euryarchaeote clone (98 similarity with KF3600111) KarimganjKM0412491 METK4 MARSH Uncultured archaeon clone (100 similarity with JQ2456871) KarimganjKM0412501 SD1 MARSH Uncultured archaeon clone (97 similarity with JF3041361) Silcoorie Lake (Silchar)KM0412511 SD3 MARSH Uncultured archaeon clone (97 similarity with JF7087031) Silcoorie Lake (Silchar)KM0412521 SD4 MARSH Uncultured archaeon clone (91 similarity with AB3648931) Silcoorie Lake (Silchar)KM0412431 MetG2 landfill Methylobacillus flagellates (97 similarity with NR 0741781) Ghazipur landfillKM0412441 MetG3 landfill Methylobacillus arboreus (99 similarity with NR 1088511) Ghazipur landfillKM0412451 MEtG4 landfill Methylobacillus flagellates (99 similarity with NR 0741781) Ghazipur landfillKM0412461 MetG6 landfill Methylobacillus flagellates (98 similarity with NR 0741781) Ghazipur landfillKM0412471 MetG7 landfill Methylobacillus arboreus (99 similarity with NR 1088511) Ghazipur landfill

the ABI prism 3130 Genetic Analyzer (Applied Biosys-tem Inc CA) at Department of Biochemistry SouthCampus Delhi University The sequences were edited toexclude the PCR primer-binding site and manually correctedwith Sequence Scanner 10 (Applied Biosystems) and werechecked further for vector contamination using the Vec-screen tool (httpwwwncbinlmnihgovtoolsvecscreen)The sequences showing similarity with vector sequences fromboth ends were trimmed Sequences were then comparedwith the available nucleotide database from the NCBI Gen-Bank using the BLAST program [39] The partial nucleotidesequences of 16S rDNA genes were submitted to NCBI underaccession numbers KM041239 to KM041252 (Table 4)

Partial 16S rDNA sequences obtained from this studywere used for similarity search in NCBI database using

BLAST program After performing BLAST sequences show-ing similarity above 90 were used and aligned in MEGAsoftware version 60 [40] using ClustalW The phylogeneticrelatedness among clones was estimated using the MaximumLikelihood tree using Kimura K2P+G model with 2000bootstrap value [41] For model selection Bayesian analysiswas performed and the model with lowest BIC value (ie121048604) was chosen for tree construction All positionscontaining gaps and missing data were eliminated from thedataset (complete deletion option)The phylogenetic analysiswas carried out using MEGA software version 60 [40](Figure 1)

24 Denaturing Gradient Gel Electrophoresis For denaturinggradient gel electrophoresis genomic DNA extracted from

4 Archaea

gi|374627936Methanoplanus limicola Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

I

MetG7 landfill

MetG3 landfill

METG1 LAND

METK2 MARSH

gi|219850687Methanosphaerula palustrisAB5353551 Uncultured archaeon gene for 16S rRNA

MET3 LAND

MET1 LAND

MET2 LAND

JF3301141 Methanoculleus thermophilus 16S rRNA

gi|478482031Candidatus Methanomethylophilus alvus

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Crenarchaeota

Thaumarchaeota

Methylobacillus flagellatus_16S rRNA

MetG2 landfill

MetG6 landfill99

MEtG4 landfill

02

9699

91

9352

9898

92

15

9957

50100

47

6599

99

85

99

30

99

9917

15

77

62

59

98

9782

99

JF8071451 Uncultured archaeon clone QTP C83 16S rRNA

gi|343198895Methanoculleus receptaculi

gi|126177952Methanoculleus marisnigrigi|636560821Methanoculleus hydrogenitrophicus

gi|254971238Methanoculleus thermophilus

Methylobacillus arboreus_16S rRNA

gi|645321034Methanomassiliicoccus luminyensis

gi|631251679Methanoregula formicica

gi|485099044Methanoregula formicica

gi|470467532Methanoregula boonei

gi|444303982Thermofilum pendens Hrk

gi|265678906Thermofilum pendens strain HVv3

gi|444304108Staphylothermus hellenicus

METK4 MARSH

JQ2456871 Uncultured archaeon clone SYNH02 ew01A-104 16S rRNA

SD4 MARSH

SD3 MARSH

SD1 MARSH

KF5645961 Uncultured archaeon clone AP0-53 16S rRNA

gi|631251601Methanolinea mesophila

KF3600111 Uncultured euryarchaeote clone ZW-M-5 16S rRNA

JF3041361 Uncultured archaeon clone 5(22) 16S rRNA

JN2274881 Candidatus Nitrosotalea devanaterra isolate Nd1 16S rRNA

HQ3311161 Nitrosopumilaceae archaeon MY1 16S rRNA

JQ3467651 Nitrosopumilus maritimus SCM1 16S rRNA

gi|507148109Candidatus Nitrososphaera gargensis

II

III

IIIb

IIIa

Figure 1 The phylogenetic relationship of 40 partial 16S rDNA sequences (the confirmed 14 sequences of clones are generated in this studyrecovered from both Delhi landfills (marked with black circle grey circle and grey triangle) and Southern Assam marshland sites (markedwith black triangle)) was inferred by the ML method using K2P+G parameter model with 2000 bootstrap replicates using the MEGA 6 treebuilding program

landfill and marshland was amplified using primer 519FWDand 915GC which gave a product length of about 500 bpDGGE was performed with a D-Code universal mutationdetection system (Biorad Hercules CA USA) using 16 cmby 16 cm and one mm gels PCR products were loaded onto7 (wv) polyacrylamide gel The polyacrylamide gels (Bis-Acrylamide 375 1) were made with denaturing gradients

ranging from 30 to 70 100 denaturant contained 7Murea and 40 formamide Electrophoresis was initially run at200V for 10min at 60∘C and afterwards for 15 h at 85V Afterelectrophoresis the gel was silver-stained and scanned underwhite light using Gel Doc (Biorad) (Figure 2) DGGE gelwas further analyzed using Gel2K software (Svein NorlandDepartment of Biology University of Bergen Norway)

Archaea 5

OK BH GZ SON SIL KRM BDR

Figure 2 Community profiling of methanogens using 16s rDNAbased onDGGE the community profiling ofmethanogenic diversitypresent in the leachate sample of Delhi landfill site (OK BH andGZ) and marshland sample of Southern Assam (SON SIL KRMand BDR)

25 Quantification of Methanogens by Quantitative Real-TimePCR Analysis Real-time PCR was done for absolute quan-tification of methanogens 16S rDNA fragments obtainedfrom pure culture of methanogens (DSMZ) were cloned andserially diluted for making standard curve as was previouslydone by Steinberg and Regan [27] Real-time PCR reactionwas carried out in triplicate using the temperature profile asrecommended for the Agilent 2x master mix that is initialdenaturation at 95∘C for 3 minutes subsequent denaturationat 95∘C for 30 seconds annealing at 60∘C for 10 seconds andelongation at 65∘C for 1 minute Melt curve analysis to detectthe presence of primer dimer was performed after the finalextension by increasing the temperature from 50 to 95∘Cwith05∘C increments every 10 s

3 Results and Discussions

31 Identification of Methanogenic Archaea in Landfill andMarshland Sequences of MET1 LAND and MET2 LANDobtained from the Bhalswa landfill site are clustered withMethanoculleus thermophilus methanogens belonging to theorder Methanomicrobiales which are hydrogenotrophic innature Third sequence of MET3 LAND from the Bhalswalandfill site clustered with the Candidatus Methanomethy-lophilus alvus Mx1201 which is H

2-dependent methy-

lotrophic methanogens In Figure 1 it is shown that thesethree sequences from the landfill sites of Delhi are clusteredwith Euryarchaeota cluster (Cluster I) Sequence METG1LAND obtained from the Ghazipur landfill site Delhi clus-tered with Methanomassiliicoccus luminyensis (Cluster II)Sequences obtained frommarshland sites of Southern Assamwere clustered (Cluster III) separately with Crenarchaeota(Cluster IIIa) and Thaumarchaeota (Cluster IIIb) There arefive more sequences from the landfill sites of Delhi They arerelated to two different species of methanotrophs (methane

oxidizing bacteria) (see Table 4) Methylobacillus arboreus(marked as grey triangle) and Methylobacillus flagellatus(marked as grey circle) and are clustered separately as shownin Figure 1

Phylogenetic analysis of 16S rDNA clones indicates thepresence of methanogens belonging to the phylum Eur-yarchaeota order Methanomicrobiales Methanobacteriales-1 and seventh order of methanogens in the landfill sites [42ndash44] Both Candidatus Methanomethylophilus alvus Mx1201and Methanomassiliicoccus luminyensis represent a mono-phyletic lineage that is not phylogenetically associated withany of the previously known orders of methanogens or theanaerobic methanotrophic ANME1 lineage [43 45] Theybelong to the Mx order clusters with two lineages the plank-tonic Marine Group II (MG-II) and the sediment dwellingMarine Benthic Group D (MBG-D) [45ndash47] The other fivesequences from Ghazipur landfill sites revealed presence ofmethanotrophs belonging to class Betaproteobacteria familyMethylophilaceae 16S rDNA clones obtained from marsh-land sites of Southern Assam revealed a cluster of Archaeathat are distantly related to twodifferent phyla CrenarchaeotaandThaumarchaeota Microorganisms belonging to the phy-lum Thaumarchaeota (recently proposed) are thermophilicandmesophilic in nature and are found to be present in awidevariety of ecosystems including marine and fresh waterssoils and also hot environment [44 48ndash52]

32 Culture Independent Molecular Analysis of MethanogenicDiversity Microbes dominated in the history of living organ-isms and they are a fundamental part of the biosphere Thestudy of microbial diversity has been therefore essential forunderstanding the evolution of life Traditionally cultivationbased methods have contributed to our knowledge abouttheir whereabouts and diversity of microbes in naturallyoccurring communities However only a small fraction ofthe prokaryotes has been cultivated in vitro by standardmethodsTherefore this knowledgemay not reveal the actualcomposition andor diversity associated with an ecosystem[31 33] In the present study we used culture indepen-dent molecular techniques like 16S rDNA PCR cloning-sequencing DGGE and qPCR for estimation of the richnessand diversity of the methanogenic Archaea in the landfillsite of Delhi and marshland areas of Southern Assam Thesetechniques arewidely used formolecular community analysisof microbes present in various types of habitats [32 42 53ndash56] A combination of DNA sequencing DGGE and quanti-tative PCR (qPCR) can provide valuable information aboutmicrobial consortia associated with a specific ecosystemDenaturing gradient gel electrophoresis (DGGE) is used todetermine the genetic diversity of microbial communitiesThe procedure is based on electrophoresis of PCR-amplified16S rDNA fragments in polyacrylamide gels containing alinearly increasing gradient of denaturants In DGGE DNAfragments of the same length but with different base-paircomposition can be separated Separation is based on theelectrophoretic mobility of partially melted DNA moleculesin a polyacrylamide gel and resulting into a band pattern [57ndash60] DGGE can reveal 1-2 of the actual diversity present inthe samples [61]

6 Archaea

Table 5 Copy number of methanogens present per gram samples of Okhla and Bhalswa landfill site Delhi and Silcoorie Lake Assam India

Pure culture Okhla Bhalswa Silcoorie Lake (Silchar)M arbophilicus 398119890 + 014ndash68119890 + 014 538119890 + 014ndash97119890 + 014 278119890 + 011ndash78119890 + 011M bryantii 114119890 + 017ndash18119890 + 017 46119890 + 016ndash82119890 + 016 12119890 + 013ndash21119890 + 013M mobile 667119890 + 015ndash75119890 + 015 342119890 + 015ndash48119890 + 015 397119890 + 012ndash41119890 + 012M mazei 189119890 + 014ndash25119890 + 014 221119890 + 015ndash28119890 + 015 113119890 + 012ndash15119890 + 012

Table 6 Methanogenic pathways and microorganisms that are associated

Domain Archaea kingdom Archaebacteria phylum EuryarchaeotaMethanogenic pathway Orders ReactionAcetoclastic Methanosarcinales CH

3COOHrarrCH

4+ CO

2

Hydrogenotrophic Methanosarcinales 4H2+ CO

2rarrCH

4+ 2H2O

Methanobacteriales 4HCOOHrarrCH4+ 3CO

2+ 2H2O

MethanococcalesMethanomicrobialesMethanopyrales

Methylotrophic Methanosarcinales 4CH3OHrarr 3CH

4+ CO

2+ 2H2O

33 Estimation of Methanogenic Richness by QuantitativeReal-Time PCR DNA extracted from the three samplingpoints that is two landfill sites Okhla and Bhalswa of Delhiand Silcoorie Lake (Silchar) of SouthernAssam was screenedfor the quantification of methanogens The copy number ofall methanogens (pure culture) was higher in the two landfillsites than that of marshland in Southern Assam (Table 5)Methanogenic pathway associated with the methanogensorder and its reactions involved in the process are includedin Table 6

The copy numbers ofMethanomicrobium mobile belong-ing to the order Methanomicrobiales and Methanobac-terium bryantii belonging to the order Methanobacteriales-1 were found to be higher in both landfill sites in com-parison to the Silcoorie Lake (Silchar) of Southern AssamCopy number of Methanobrevibacter arboriphilus (orderMethanobacteriales-1) andMethanosarcinamazei (acetoclas-tic) (order Methanosarcinales) was found to be higher in theBhalswa landfill site than Okhla landfill site and SilcoorieLake (Silchar) marshland site The value of 119877Sq and slope 119889119877for standard curve was 0948 and minus2641 and the efficiencyof the reaction was 1391 The 119877Sq and slope 119889119877 values forldquoabsoluterdquo quantification of Methanobrevibacter arboriphilusare 0903 and minus2128 119877Sq (119889119877) and slope 119889119877 values for thisquantification of Methanobacterium bryantii are 0877 andminus1384 119877Sq (119889119877) and slope 119889119877 values of Methanomicrobiummobile are 0956 and minus2563 respectively The values of 119877Sq(119889119877) and slope 119889119877 forMethanosarcina mazei were 0394 andminus2051 respectively

Methanogens pertaining to both acetotrophic and hy-drogenotrophic decomposition pathways were detected inMSW landfills which have been reported earlier [25 26 42]Acetate serves as a precursor for more than 70 of CH

4

(methane) formation in the most anaerobic digestion pro-cess [62] Therefore acetoclastic methanogens which utilizeacetate as substrate play a key role in stabilizing the pollution

load of wastewater by methanogenesis In the present studyquantitative PCR indicates the higher methanogenic richnessin both landfill sites of Delhi compared to marshland ofSilcoorie Lake Silchar

34 Diversity of Methanogenic Archaea by DenaturingGradient Gel Electrophoresis Abundance and diversity ofmethanogenic Archaea were studied in three landfill and fourmarshland sites situated at different location in Delhi andSouthernAssam India 16S rDNAampliconswere cloned andthen analyzed on the DGGE gel for estimation of the archaealrichness in respective samples as shown in Figure 2

Band patterns of 16S rDNA amplicons obtained fromthe landfill sites (OK BH and GZ) of Delhi and marshlandsamples (SON SIL KRM and BDR) of Southern Assamwerecompared for methanogens richness and diversity analysisusing Gel2K software Analysis of DGGE image revealed thepresence of total 38 bands There are some unique bands ineach lane which indicates the variation ofmethanogens com-munity residing in those particular samples Cluster analysisof bands using Jaccard analysis indicated the presence of threemain clusters consisting of localities that differ in number ofsimilarity versus DGGE bands (Figure 3)

In the first cluster Badarpur beetle-nut pond and Sil-coorie Lake (Silchar) of Southern Assam clustered togethershowing similar band pattern In the second cluster inter-estingly despite being two different ecosystems Ghazipurlandfill sites of Delhi clusteredwithwetland of Sonbill South-ern Assam India In the third cluster the two landfill sitesof Delhi (Okhla and Bhalswa) clustered together showingsimilar band pattern In terms of richness number of bandsfrom the respective samples fromBhalswa landfill and Sonbillwetland have maximum of 11 bands followed by Ghazipurlandfill site and Silcoorie Lake (Silchar) having 10 bands eachOkhla landfill and Badarpur beetle-nut pond showed 9 bands

Archaea 7

Jacc

ard

10

08

06

04

02

00 Bada

rpur

Silc

oorie

Karim

ganj

Sonb

ill

Gha

zipu

r

Bhal

saw

a

Okh

la

Comp

Figure 3 Jaccard cluster diagram of DGGE bands obtained from landfill sites of Delhi and marshland of Southern Assam India

each in the cluster In the Karimganj rice paddy field sampleonly four bands were observed showing the least diversity

Microbial diversity within contaminated ecosystems likelandfill should be less diverse than those in natural systemslike a wetland because the diversity may be influenced by thecomplexity of toxic chemical mixtures heavy metals presentand duration of time the populations have been exposed Inthe present study after analyzing DGGE gel banding patternand the number of bands we found that the methanogenicdiversity present in both landfills (anthropogenic system) andmarshland (natural) is quite similar except for the samplesobtained from the Karimganj rice paddy field where onlyfour bands appeared The number of total bands observedin this study was in accordance with the number of DGGEbands reported previously [42 51 56 57] It strongly indicatesthat the methanogenic Archaea diversity in both landfill andmarshland is influenced by sampling location rather thantype

4 Conclusions

In the sequencing of themolecular marker for archaeal diver-sity 16S rDNA identified the orders named as Methanobac-teriales and Methanosarcinales in both landfill sites and thephylum Crenarchaeota (thermophilic) in marshland Quan-titative PCR indicated a higher abundance ofmethanogens inlandfill compared to that of marshland sites The knowledgeabout the composition and abundance of methanogenicArchaea in a landfill may provide information on thedecomposition mechanism of municipal solid waste and thesubsequent generation of methane This information canbe exploited for controlling methane emission from land-fill by mitigation process The increasing knowledge about

the genomic content of microbes belonging to the phylumThaumarchaeota (mesophilic) will enrich our understandingof their adaptative behavior in the transposition from ther-mophily to mesophily This indicates whether they follow asimilar or different evolutionary pattern with respect to thephylum Euryarchaeota

Abbreviations

MSW Municipal solid wasteGHGs Green House GasesDGGE Denaturing gradient gel electrophoresismM MillimolarMg MilligrammL MillilitreTg Teragram

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Dr S S Maitra and Professor Sankar K Ghosh are grateful tothe Department of Biotechnology (DBT) of the Governmentof India for providing a Grant (BT14NETBP2010) Theauthors are extremely thankful to the referees for theirvaluable suggestions for improving the quality of the paperThe authors are indebted to Dr Santanu Raychaudhuri a UScitizen presently assigned as a Visiting Research Faculty atAssam University for correcting the paper

8 Archaea

References

[1] G Yvon-Durocher A P Allen D Bastviken et al ldquoMethanefluxes show consistent temperature dependence across micro-bial to ecosystem scalesrdquoNature vol 507 no 7493 pp 488ndash4912014

[2] S D Bridgham H Cadillo-Quiroz J K Keller and Q ZhuangldquoMethane emissions fromwetlands biogeochemical microbialand modeling perspectives from local to global scalesrdquo GlobalChange Biology vol 19 no 5 pp 1325ndash1346 2013

[3] J T Houghton Y Ding D J Griggs et al Climate Change2001 The Scientific Basis vol 881 Cambridge University PressCambridge Mass USA 2001

[4] S Solomon Climate Change 2007mdashThe Physical Science BasisWorkingGroup IContribution to the FourthAssessment Report ofthe IPCC vol 4 Cambridge University Press Cambridge UK2007

[5] R Angel P Claus and R Conrad ldquoMethanogenic archaea areglobally ubiquitous in aerated soils and become active underwet anoxic conditionsrdquoThe ISME Journal vol 6 no 4 pp 847ndash862 2012

[6] A R Daquiado K M Cho T Y Kim S C Kim H-H Changand Y B Lee ldquoMethanogenic archaea diversity in Hanwoo(Bos taurus coreanae) rumen fluid rectal dung and barn floormanure using a culture-independent method based on mcrAgene sequencesrdquo Anaerobe vol 27 pp 77ndash81 2014

[7] R S Oremland ldquoBiogeochemistry of methanogenic bacteriardquoin Biology of Anaerobic Microorganisms pp 641ndash705 JohnWiley amp Sons 1988

[8] S H Zinder ldquoPhysiological ecology of methanogensrdquo inMethanogenesis pp 128ndash206 Springer Berlin Germany 1993

[9] J-L Garcia B K C Patel and B Ollivier ldquoTaxonomic phy-logenetic and ecological diversity of methanogenic ArchaeardquoAnaerobe vol 6 no 4 pp 205ndash226 2000

[10] E Bapteste C Brochier and Y Boucher ldquoHigher-level clas-sification of the Archaea evolution of methanogenesis andmethanogensrdquo Archaea vol 1 no 5 pp 353ndash363 2005

[11] J N Reeve J Nolling R M Morgan and D R SmithldquoMethanogenesis genes genomes and whorsquos on firstrdquo Journalof Bacteriology vol 179 no 19 pp 5975ndash5986 1997

[12] R K Thauer A-K Kaster H Seedorf W Buckel and RHedderich ldquoMethanogenic archaea ecologically relevant dif-ferences in energy conservationrdquo Nature Reviews Microbiologyvol 6 no 8 pp 579ndash591 2008

[13] C C Mitigation IPCC Special Report on Renewable EnergySources and Climate Change Mitigation 2011

[14] D Mayumi J Dolfing S Sakata et al ldquoCarbon dioxideconcentration dictates alternativemethanogenic pathways in oilreservoirsrdquo Nature Communications vol 4 article 1998 2013

[15] S Gupta N Choudhary and B J Alappat ldquoBioreactor landfillfor MSW disposal in Delhirdquo in Proceedings of the InternationalConference on Sustainable Solid Waste Management ChennaiIndia September 2007

[16] M Rawat and A Ramanathan ldquoAssessment of methane fluxfrom municipal solid waste (MSW) landfill areas of DelhiIndiardquo Journal of Environmental Protection vol 2 no 4 pp399ndash407 2011

[17] V Talyan R P Dahiya S Anand and T R SreekrishnanldquoQuantification of methane emission from municipal solidwaste disposal in Delhirdquo Resources Conservation and Recyclingvol 50 no 3 pp 240ndash259 2007

[18] L B Hansen K Finster H Fossing and N Iversen ldquoAnaerobicmethane oxidation in sulfate depleted sediments effects ofsulfate and molybdate additionsrdquo Aquatic Microbial Ecologyvol 14 no 2 pp 195ndash204 1998

[19] A A Bloom P I Palmer A Fraser S R David and CFrankenberg ldquoLarge-scale controls of methanogenesis inferredfrom methane and gravity spaceborne datardquo Science vol 327no 5963 pp 322ndash325 2010

[20] V Singh and A Mittal ldquoToxicity analysis and public healthaspects of municipal landfill leachate a case study of OkhlaLandfill Delhirdquo in Proceedings of the 8th World Wide Workshopfor Young Environmental Scientists WWW-YES 2009 UrbanWaters Resource or Risks 2ndash5 June 2009 2011

[21] D Liu W Ding Z Jia and Z Cai ldquoThe impact of dissolvedorganic carbon on the spatial variability of methanogenicarchaea communities in natural wetland ecosystems acrossChinardquo Applied Microbiology and Biotechnology vol 96 no 1pp 253ndash263 2012

[22] B P Walter M Heimann R D Shannon and J R White ldquoAprocess-based model to derive methane emissions from naturalwetlandsrdquoGeophysical Research Letters vol 23 no 25 pp 3731ndash3734 1996

[23] L S Chasar J P Chanton P H Glaser and D I SiegelldquoMethane concentration and stable isotope distribution asevidence of rhizospheric processes Comparison of a fen andbog in the glacial Lake Agassiz Peatland complexrdquo Annals ofBotany vol 86 no 3 pp 655ndash663 2000

[24] G B Avery Jr R D Shannon J R White C S Martensand M J Alperin ldquoControls on methane production in a tidalfreshwater estuary and a peatland methane production viaacetate fermentation and CO

2reductionrdquo Biogeochemistry vol

62 no 1 pp 19ndash37 2003[25] L-N Huang Y-Q Chen H Zhou S Luo C-Y Lan and L-H

Qu ldquoCharacterization of methanogenic Archaea in the leachateof a closed municipal solid waste landfillrdquo FEMS MicrobiologyEcology vol 46 no 2 pp 171ndash177 2003

[26] W Laloui-Carpentier T Li V Vigneron L Mazeas and TBouchez ldquoMethanogenic diversity and activity in municipalsolid waste landfill leachatesrdquoAntonie van Leeuwenhoek vol 89no 3-4 pp 423ndash434 2006

[27] L M Steinberg and J M Regan ldquoPhylogenetic comparison ofthe methanogenic communities from an acidic oligotrophicfen and an anaerobic digester treating municipal wastewatersludgerdquoApplied and Environmental Microbiology vol 74 no 21pp 6663ndash6671 2008

[28] Q Ban J Li L Zhang Y Zhang and A K Jha ldquoPhylogeneticdiversity of methanogenic archaea and kinetics of methaneproduction at slightly acidic conditions of an anaerobic sludgerdquoInternational Journal of Agriculture and Biology vol 15 no 2pp 347ndash351 2013

[29] S G Tringe and EM Rubin ldquoMetagenomics DNA sequencingof environmental samplesrdquo Nature Reviews Genetics vol 6 no11 pp 805ndash814 2005

[30] R D Bardgett and W H van der Putten ldquoBelowgroundbiodiversity and ecosystem functioningrdquo Nature vol 515 no7528 pp 505ndash511 2014

[31] N R Pace ldquoNew perspective on the natural microbial worldmolecularmicrobial ecologyrdquoASMNews vol 62 no 9 pp 463ndash470 1996

[32] J L Kirk L A Beaudette M Hart et al ldquoMethods of studyingsoil microbial diversityrdquo Journal ofMicrobiologicalMethods vol58 no 2 pp 169ndash188 2004

Archaea 9

[33] R I Amann W Ludwig and K-H Schleifer ldquoPhylogeneticidentification and in situ detection of individual microbial cellswithout cultivationrdquo Microbiological Reviews vol 59 no 1 pp143ndash169 1995

[34] M Keller and K Zengler ldquoTapping into microbial diversityrdquoNature Reviews Microbiology vol 2 no 2 pp 141ndash150 2004

[35] Y F Cheng S Y Mao J X Liu and W Y Zhu ldquoMoleculardiversity analysis of rumenmethanogenic Archaea from goat ineastern China by DGGEmethods using different primer pairsrdquoLetters in AppliedMicrobiology vol 48 no 5 pp 585ndash592 2009

[36] A-D G Wright and C Pimm ldquoImproved strategy for pre-sumptive identification ofmethanogens using 16S riboprintingrdquoJournal of Microbiological Methods vol 55 no 2 pp 337ndash3492003

[37] P Ghosh A Gupta and I S Thakur ldquoCombined chemicaland toxicological evaluation of leachate from municipal solidwaste landfill sites of Delhi Indiardquo Environmental Science andPollution Research vol 22 no 12 pp 9148ndash9158 2015

[38] S Roy and A Gupta ldquoWater quality assessment of river barakand tributaries in Assam Indiardquo Pollution Research vol 31 no3 pp 445ndash450 2012

[39] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990

[40] K Tamura G Stecher D Peterson A Filipski and S KumarldquoMEGA6molecular evolutionary genetics analysis version 60rdquoMolecular Biology and Evolution vol 30 no 12 pp 2725ndash27292013

[41] M Kimura ldquoA simple method for estimating evolutionary ratesof base substitutions through comparative studies of nucleotidesequencesrdquo Journal ofMolecular Evolution vol 16 no 2 pp 111ndash120 1980

[42] T Watanabe M Kimura and S Asakawa ldquoDiversity ofmethanogenic archaeal communities in Japanese paddy fieldecosystem estimated by denaturing gradient gel electrophore-sisrdquoBiology and Fertility of Soils vol 46 no 4 pp 343ndash353 2010

[43] G Borrel H M B Harris W Tottey et al ldquoGenomesequence of lsquoCandidatusMethanomethylophilus alvusrsquo Mx1201a methanogenic archaeon from the human gut belonging to aseventh order of methanogensrdquo Journal of Bacteriology vol 194no 24 pp 6944ndash6945 2012

[44] H Juottonen Archaea Bacteria and methane production alongenvironmental gradients in fens and bogs [PhD thesis] Univer-sity of Helsinki Helsinki Finland 2008

[45] G Borrel PW OrsquoToole HM B Harris P Peyret J-F Brugereand S Gribaldo ldquoPhylogenomic data support a seventh orderof methylotrophic methanogens and provide insights into theevolution of methanogenesisrdquo Genome Biology and Evolutionvol 5 no 10 pp 1769ndash1780 2013

[46] V Iverson R M Morris C D Frazar C T BerthiaumeR L Morales and E V Armbrust ldquoUntangling genomesfrom metagenomes revealing an uncultured class of marineeuryarchaeotardquo Science vol 335 no 6068 pp 587ndash590 2012

[47] K G Lloyd L Schreiber D G Petersen et al ldquoPredominantarchaea in marine sediments degrade detrital proteinsrdquoNaturevol 496 no 7444 pp 215ndash218 2013

[48] I Anderson R Wirth S Lucas et al ldquoComplete genomesequence of Staphylothermus hellenicusP8Trdquo Standards inGenomic Sciences vol 5 no 1 p 12 2011

[49] C Brochier-Armanet S Gribaldo and P Forterre ldquoSpotlight onthe thaumarchaeotardquo The ISME Journal vol 6 no 2 pp 227ndash230 2012

[50] P E Galand H Fritze R Conrad and K Yrjala ldquoPathwaysfor methanogenesis and diversity of methanogenic archaea inthree boreal peatland ecosystemsrdquo Applied and EnvironmentalMicrobiology vol 71 no 4 pp 2195ndash2198 2005

[51] M Ikenaga S Asakawa Y Muraoka and M KimuraldquoMethanogenic archaeal communities in rice roots grown inflooded soil pots estimation by PCR-DGGE and sequenceanalysesrdquo Soil Science and Plant Nutrition vol 50 no 5 pp 701ndash711 2004

[52] A Spang A Poehlein P Offre et al ldquoThe genome ofthe ammonia-oxidizing Candidatus nitrososphaera gargensisinsights into metabolic versatility and environmental adapta-tionsrdquoEnvironmentalMicrobiology vol 14 no 12 pp 3122ndash31452012

[53] P P Chaudhary L Brablcova I Buriankova and M RulıkldquoMolecular diversity and tools for deciphering the methanogencommunity structure and diversity in freshwater sedimentsrdquoAppliedMicrobiology and Biotechnology vol 97 no 17 pp 7553ndash7562 2013

[54] A V Piterina and J T Pembroke ldquoUse of PCR-DGGE basedmolecular methods to analyse microbial community diversityand stability during the thermophilic stages of an ATADwastewater sludge treatment process as an aid to performancemonitoringrdquo ISRN Biotechnology vol 2013 Article ID 16264513 pages 2013

[55] T Watanabe M Kimura and S Asakawa ldquoCommunity struc-ture of methanogenic archaea in paddy field soil under doublecropping (rice-wheat)rdquo Soil Biology and Biochemistry vol 38no 6 pp 1264ndash1274 2006

[56] T Watanabe M Kimura and S Asakawa ldquoDynamics ofmethanogenic archaeal communities based on rRNA analysisand their relation to methanogenic activity in Japanese paddyfield soilsrdquo Soil Biology and Biochemistry vol 39 no 11 pp2877ndash2887 2007

[57] L Brablcova I Buriankova P Badurova P P Chaudharyand M Rulık ldquoMethanogenic archaea diversity in hyporheicsediments of a small lowland streamrdquoAnaerobe vol 32 pp 24ndash31 2015

[58] V Mach M B Blaser P Claus P P Chaudhary and M RulAkldquoMethane production potentials pathways and communitiesof methanogens in vertical sediment profiles of river SitkardquoFrontiers in Microbiology vol 6 article 506 2015

[59] GMuyzer ldquoDGGETGGE amethod for identifying genes fromnatural ecosystemsrdquoCurrent Opinion inMicrobiology vol 2 no3 pp 317ndash322 1999

[60] G Muyzer E C De Waal and A G Uitterlinden ldquoProfilingof complex microbial populations by denaturing gradient gelelectrophoresis analysis of polymerase chain reaction-amplifiedgenes coding for 16S rRNArdquo Applied and Environmental Micro-biology vol 59 no 3 pp 695ndash700 1993

[61] S J Macnaughton J R Stephen A D Venosa G A DavisY-J Chang and D C White ldquoMicrobial population changesduring bioremediation of an experimental oil spillrdquoApplied andEnvironmental Microbiology vol 65 no 8 pp 3566ndash3574 1999

[62] Y Yu C Lee J Kim and S Hwang ldquoGroup-specific primer andprobe sets to detect methanogenic communities using quanti-tative real-time polymerase chain reactionrdquo Biotechnology andBioengineering vol 89 no 6 pp 670ndash679 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

4 Archaea

gi|374627936Methanoplanus limicola Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

I

MetG7 landfill

MetG3 landfill

METG1 LAND

METK2 MARSH

gi|219850687Methanosphaerula palustrisAB5353551 Uncultured archaeon gene for 16S rRNA

MET3 LAND

MET1 LAND

MET2 LAND

JF3301141 Methanoculleus thermophilus 16S rRNA

gi|478482031Candidatus Methanomethylophilus alvus

Euryarchaeota

Euryarchaeota

Euryarchaeota

Euryarchaeota

Crenarchaeota

Thaumarchaeota

Methylobacillus flagellatus_16S rRNA

MetG2 landfill

MetG6 landfill99

MEtG4 landfill

02

9699

91

9352

9898

92

15

9957

50100

47

6599

99

85

99

30

99

9917

15

77

62

59

98

9782

99

JF8071451 Uncultured archaeon clone QTP C83 16S rRNA

gi|343198895Methanoculleus receptaculi

gi|126177952Methanoculleus marisnigrigi|636560821Methanoculleus hydrogenitrophicus

gi|254971238Methanoculleus thermophilus

Methylobacillus arboreus_16S rRNA

gi|645321034Methanomassiliicoccus luminyensis

gi|631251679Methanoregula formicica

gi|485099044Methanoregula formicica

gi|470467532Methanoregula boonei

gi|444303982Thermofilum pendens Hrk

gi|265678906Thermofilum pendens strain HVv3

gi|444304108Staphylothermus hellenicus

METK4 MARSH

JQ2456871 Uncultured archaeon clone SYNH02 ew01A-104 16S rRNA

SD4 MARSH

SD3 MARSH

SD1 MARSH

KF5645961 Uncultured archaeon clone AP0-53 16S rRNA

gi|631251601Methanolinea mesophila

KF3600111 Uncultured euryarchaeote clone ZW-M-5 16S rRNA

JF3041361 Uncultured archaeon clone 5(22) 16S rRNA

JN2274881 Candidatus Nitrosotalea devanaterra isolate Nd1 16S rRNA

HQ3311161 Nitrosopumilaceae archaeon MY1 16S rRNA

JQ3467651 Nitrosopumilus maritimus SCM1 16S rRNA

gi|507148109Candidatus Nitrososphaera gargensis

II

III

IIIb

IIIa

Figure 1 The phylogenetic relationship of 40 partial 16S rDNA sequences (the confirmed 14 sequences of clones are generated in this studyrecovered from both Delhi landfills (marked with black circle grey circle and grey triangle) and Southern Assam marshland sites (markedwith black triangle)) was inferred by the ML method using K2P+G parameter model with 2000 bootstrap replicates using the MEGA 6 treebuilding program

landfill and marshland was amplified using primer 519FWDand 915GC which gave a product length of about 500 bpDGGE was performed with a D-Code universal mutationdetection system (Biorad Hercules CA USA) using 16 cmby 16 cm and one mm gels PCR products were loaded onto7 (wv) polyacrylamide gel The polyacrylamide gels (Bis-Acrylamide 375 1) were made with denaturing gradients

ranging from 30 to 70 100 denaturant contained 7Murea and 40 formamide Electrophoresis was initially run at200V for 10min at 60∘C and afterwards for 15 h at 85V Afterelectrophoresis the gel was silver-stained and scanned underwhite light using Gel Doc (Biorad) (Figure 2) DGGE gelwas further analyzed using Gel2K software (Svein NorlandDepartment of Biology University of Bergen Norway)

Archaea 5

OK BH GZ SON SIL KRM BDR

Figure 2 Community profiling of methanogens using 16s rDNAbased onDGGE the community profiling ofmethanogenic diversitypresent in the leachate sample of Delhi landfill site (OK BH andGZ) and marshland sample of Southern Assam (SON SIL KRMand BDR)

25 Quantification of Methanogens by Quantitative Real-TimePCR Analysis Real-time PCR was done for absolute quan-tification of methanogens 16S rDNA fragments obtainedfrom pure culture of methanogens (DSMZ) were cloned andserially diluted for making standard curve as was previouslydone by Steinberg and Regan [27] Real-time PCR reactionwas carried out in triplicate using the temperature profile asrecommended for the Agilent 2x master mix that is initialdenaturation at 95∘C for 3 minutes subsequent denaturationat 95∘C for 30 seconds annealing at 60∘C for 10 seconds andelongation at 65∘C for 1 minute Melt curve analysis to detectthe presence of primer dimer was performed after the finalextension by increasing the temperature from 50 to 95∘Cwith05∘C increments every 10 s

3 Results and Discussions

31 Identification of Methanogenic Archaea in Landfill andMarshland Sequences of MET1 LAND and MET2 LANDobtained from the Bhalswa landfill site are clustered withMethanoculleus thermophilus methanogens belonging to theorder Methanomicrobiales which are hydrogenotrophic innature Third sequence of MET3 LAND from the Bhalswalandfill site clustered with the Candidatus Methanomethy-lophilus alvus Mx1201 which is H

2-dependent methy-

lotrophic methanogens In Figure 1 it is shown that thesethree sequences from the landfill sites of Delhi are clusteredwith Euryarchaeota cluster (Cluster I) Sequence METG1LAND obtained from the Ghazipur landfill site Delhi clus-tered with Methanomassiliicoccus luminyensis (Cluster II)Sequences obtained frommarshland sites of Southern Assamwere clustered (Cluster III) separately with Crenarchaeota(Cluster IIIa) and Thaumarchaeota (Cluster IIIb) There arefive more sequences from the landfill sites of Delhi They arerelated to two different species of methanotrophs (methane

oxidizing bacteria) (see Table 4) Methylobacillus arboreus(marked as grey triangle) and Methylobacillus flagellatus(marked as grey circle) and are clustered separately as shownin Figure 1

Phylogenetic analysis of 16S rDNA clones indicates thepresence of methanogens belonging to the phylum Eur-yarchaeota order Methanomicrobiales Methanobacteriales-1 and seventh order of methanogens in the landfill sites [42ndash44] Both Candidatus Methanomethylophilus alvus Mx1201and Methanomassiliicoccus luminyensis represent a mono-phyletic lineage that is not phylogenetically associated withany of the previously known orders of methanogens or theanaerobic methanotrophic ANME1 lineage [43 45] Theybelong to the Mx order clusters with two lineages the plank-tonic Marine Group II (MG-II) and the sediment dwellingMarine Benthic Group D (MBG-D) [45ndash47] The other fivesequences from Ghazipur landfill sites revealed presence ofmethanotrophs belonging to class Betaproteobacteria familyMethylophilaceae 16S rDNA clones obtained from marsh-land sites of Southern Assam revealed a cluster of Archaeathat are distantly related to twodifferent phyla CrenarchaeotaandThaumarchaeota Microorganisms belonging to the phy-lum Thaumarchaeota (recently proposed) are thermophilicandmesophilic in nature and are found to be present in awidevariety of ecosystems including marine and fresh waterssoils and also hot environment [44 48ndash52]

32 Culture Independent Molecular Analysis of MethanogenicDiversity Microbes dominated in the history of living organ-isms and they are a fundamental part of the biosphere Thestudy of microbial diversity has been therefore essential forunderstanding the evolution of life Traditionally cultivationbased methods have contributed to our knowledge abouttheir whereabouts and diversity of microbes in naturallyoccurring communities However only a small fraction ofthe prokaryotes has been cultivated in vitro by standardmethodsTherefore this knowledgemay not reveal the actualcomposition andor diversity associated with an ecosystem[31 33] In the present study we used culture indepen-dent molecular techniques like 16S rDNA PCR cloning-sequencing DGGE and qPCR for estimation of the richnessand diversity of the methanogenic Archaea in the landfillsite of Delhi and marshland areas of Southern Assam Thesetechniques arewidely used formolecular community analysisof microbes present in various types of habitats [32 42 53ndash56] A combination of DNA sequencing DGGE and quanti-tative PCR (qPCR) can provide valuable information aboutmicrobial consortia associated with a specific ecosystemDenaturing gradient gel electrophoresis (DGGE) is used todetermine the genetic diversity of microbial communitiesThe procedure is based on electrophoresis of PCR-amplified16S rDNA fragments in polyacrylamide gels containing alinearly increasing gradient of denaturants In DGGE DNAfragments of the same length but with different base-paircomposition can be separated Separation is based on theelectrophoretic mobility of partially melted DNA moleculesin a polyacrylamide gel and resulting into a band pattern [57ndash60] DGGE can reveal 1-2 of the actual diversity present inthe samples [61]

6 Archaea

Table 5 Copy number of methanogens present per gram samples of Okhla and Bhalswa landfill site Delhi and Silcoorie Lake Assam India

Pure culture Okhla Bhalswa Silcoorie Lake (Silchar)M arbophilicus 398119890 + 014ndash68119890 + 014 538119890 + 014ndash97119890 + 014 278119890 + 011ndash78119890 + 011M bryantii 114119890 + 017ndash18119890 + 017 46119890 + 016ndash82119890 + 016 12119890 + 013ndash21119890 + 013M mobile 667119890 + 015ndash75119890 + 015 342119890 + 015ndash48119890 + 015 397119890 + 012ndash41119890 + 012M mazei 189119890 + 014ndash25119890 + 014 221119890 + 015ndash28119890 + 015 113119890 + 012ndash15119890 + 012

Table 6 Methanogenic pathways and microorganisms that are associated

Domain Archaea kingdom Archaebacteria phylum EuryarchaeotaMethanogenic pathway Orders ReactionAcetoclastic Methanosarcinales CH

3COOHrarrCH

4+ CO

2

Hydrogenotrophic Methanosarcinales 4H2+ CO

2rarrCH

4+ 2H2O

Methanobacteriales 4HCOOHrarrCH4+ 3CO

2+ 2H2O

MethanococcalesMethanomicrobialesMethanopyrales

Methylotrophic Methanosarcinales 4CH3OHrarr 3CH

4+ CO

2+ 2H2O

33 Estimation of Methanogenic Richness by QuantitativeReal-Time PCR DNA extracted from the three samplingpoints that is two landfill sites Okhla and Bhalswa of Delhiand Silcoorie Lake (Silchar) of SouthernAssam was screenedfor the quantification of methanogens The copy number ofall methanogens (pure culture) was higher in the two landfillsites than that of marshland in Southern Assam (Table 5)Methanogenic pathway associated with the methanogensorder and its reactions involved in the process are includedin Table 6

The copy numbers ofMethanomicrobium mobile belong-ing to the order Methanomicrobiales and Methanobac-terium bryantii belonging to the order Methanobacteriales-1 were found to be higher in both landfill sites in com-parison to the Silcoorie Lake (Silchar) of Southern AssamCopy number of Methanobrevibacter arboriphilus (orderMethanobacteriales-1) andMethanosarcinamazei (acetoclas-tic) (order Methanosarcinales) was found to be higher in theBhalswa landfill site than Okhla landfill site and SilcoorieLake (Silchar) marshland site The value of 119877Sq and slope 119889119877for standard curve was 0948 and minus2641 and the efficiencyof the reaction was 1391 The 119877Sq and slope 119889119877 values forldquoabsoluterdquo quantification of Methanobrevibacter arboriphilusare 0903 and minus2128 119877Sq (119889119877) and slope 119889119877 values for thisquantification of Methanobacterium bryantii are 0877 andminus1384 119877Sq (119889119877) and slope 119889119877 values of Methanomicrobiummobile are 0956 and minus2563 respectively The values of 119877Sq(119889119877) and slope 119889119877 forMethanosarcina mazei were 0394 andminus2051 respectively

Methanogens pertaining to both acetotrophic and hy-drogenotrophic decomposition pathways were detected inMSW landfills which have been reported earlier [25 26 42]Acetate serves as a precursor for more than 70 of CH

4

(methane) formation in the most anaerobic digestion pro-cess [62] Therefore acetoclastic methanogens which utilizeacetate as substrate play a key role in stabilizing the pollution

load of wastewater by methanogenesis In the present studyquantitative PCR indicates the higher methanogenic richnessin both landfill sites of Delhi compared to marshland ofSilcoorie Lake Silchar

34 Diversity of Methanogenic Archaea by DenaturingGradient Gel Electrophoresis Abundance and diversity ofmethanogenic Archaea were studied in three landfill and fourmarshland sites situated at different location in Delhi andSouthernAssam India 16S rDNAampliconswere cloned andthen analyzed on the DGGE gel for estimation of the archaealrichness in respective samples as shown in Figure 2

Band patterns of 16S rDNA amplicons obtained fromthe landfill sites (OK BH and GZ) of Delhi and marshlandsamples (SON SIL KRM and BDR) of Southern Assamwerecompared for methanogens richness and diversity analysisusing Gel2K software Analysis of DGGE image revealed thepresence of total 38 bands There are some unique bands ineach lane which indicates the variation ofmethanogens com-munity residing in those particular samples Cluster analysisof bands using Jaccard analysis indicated the presence of threemain clusters consisting of localities that differ in number ofsimilarity versus DGGE bands (Figure 3)

In the first cluster Badarpur beetle-nut pond and Sil-coorie Lake (Silchar) of Southern Assam clustered togethershowing similar band pattern In the second cluster inter-estingly despite being two different ecosystems Ghazipurlandfill sites of Delhi clusteredwithwetland of Sonbill South-ern Assam India In the third cluster the two landfill sitesof Delhi (Okhla and Bhalswa) clustered together showingsimilar band pattern In terms of richness number of bandsfrom the respective samples fromBhalswa landfill and Sonbillwetland have maximum of 11 bands followed by Ghazipurlandfill site and Silcoorie Lake (Silchar) having 10 bands eachOkhla landfill and Badarpur beetle-nut pond showed 9 bands

Archaea 7

Jacc

ard

10

08

06

04

02

00 Bada

rpur

Silc

oorie

Karim

ganj

Sonb

ill

Gha

zipu

r

Bhal

saw

a

Okh

la

Comp

Figure 3 Jaccard cluster diagram of DGGE bands obtained from landfill sites of Delhi and marshland of Southern Assam India

each in the cluster In the Karimganj rice paddy field sampleonly four bands were observed showing the least diversity

Microbial diversity within contaminated ecosystems likelandfill should be less diverse than those in natural systemslike a wetland because the diversity may be influenced by thecomplexity of toxic chemical mixtures heavy metals presentand duration of time the populations have been exposed Inthe present study after analyzing DGGE gel banding patternand the number of bands we found that the methanogenicdiversity present in both landfills (anthropogenic system) andmarshland (natural) is quite similar except for the samplesobtained from the Karimganj rice paddy field where onlyfour bands appeared The number of total bands observedin this study was in accordance with the number of DGGEbands reported previously [42 51 56 57] It strongly indicatesthat the methanogenic Archaea diversity in both landfill andmarshland is influenced by sampling location rather thantype

4 Conclusions

In the sequencing of themolecular marker for archaeal diver-sity 16S rDNA identified the orders named as Methanobac-teriales and Methanosarcinales in both landfill sites and thephylum Crenarchaeota (thermophilic) in marshland Quan-titative PCR indicated a higher abundance ofmethanogens inlandfill compared to that of marshland sites The knowledgeabout the composition and abundance of methanogenicArchaea in a landfill may provide information on thedecomposition mechanism of municipal solid waste and thesubsequent generation of methane This information canbe exploited for controlling methane emission from land-fill by mitigation process The increasing knowledge about

the genomic content of microbes belonging to the phylumThaumarchaeota (mesophilic) will enrich our understandingof their adaptative behavior in the transposition from ther-mophily to mesophily This indicates whether they follow asimilar or different evolutionary pattern with respect to thephylum Euryarchaeota

Abbreviations

MSW Municipal solid wasteGHGs Green House GasesDGGE Denaturing gradient gel electrophoresismM MillimolarMg MilligrammL MillilitreTg Teragram

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Dr S S Maitra and Professor Sankar K Ghosh are grateful tothe Department of Biotechnology (DBT) of the Governmentof India for providing a Grant (BT14NETBP2010) Theauthors are extremely thankful to the referees for theirvaluable suggestions for improving the quality of the paperThe authors are indebted to Dr Santanu Raychaudhuri a UScitizen presently assigned as a Visiting Research Faculty atAssam University for correcting the paper

8 Archaea

References

[1] G Yvon-Durocher A P Allen D Bastviken et al ldquoMethanefluxes show consistent temperature dependence across micro-bial to ecosystem scalesrdquoNature vol 507 no 7493 pp 488ndash4912014

[2] S D Bridgham H Cadillo-Quiroz J K Keller and Q ZhuangldquoMethane emissions fromwetlands biogeochemical microbialand modeling perspectives from local to global scalesrdquo GlobalChange Biology vol 19 no 5 pp 1325ndash1346 2013

[3] J T Houghton Y Ding D J Griggs et al Climate Change2001 The Scientific Basis vol 881 Cambridge University PressCambridge Mass USA 2001

[4] S Solomon Climate Change 2007mdashThe Physical Science BasisWorkingGroup IContribution to the FourthAssessment Report ofthe IPCC vol 4 Cambridge University Press Cambridge UK2007

[5] R Angel P Claus and R Conrad ldquoMethanogenic archaea areglobally ubiquitous in aerated soils and become active underwet anoxic conditionsrdquoThe ISME Journal vol 6 no 4 pp 847ndash862 2012

[6] A R Daquiado K M Cho T Y Kim S C Kim H-H Changand Y B Lee ldquoMethanogenic archaea diversity in Hanwoo(Bos taurus coreanae) rumen fluid rectal dung and barn floormanure using a culture-independent method based on mcrAgene sequencesrdquo Anaerobe vol 27 pp 77ndash81 2014

[7] R S Oremland ldquoBiogeochemistry of methanogenic bacteriardquoin Biology of Anaerobic Microorganisms pp 641ndash705 JohnWiley amp Sons 1988

[8] S H Zinder ldquoPhysiological ecology of methanogensrdquo inMethanogenesis pp 128ndash206 Springer Berlin Germany 1993

[9] J-L Garcia B K C Patel and B Ollivier ldquoTaxonomic phy-logenetic and ecological diversity of methanogenic ArchaeardquoAnaerobe vol 6 no 4 pp 205ndash226 2000

[10] E Bapteste C Brochier and Y Boucher ldquoHigher-level clas-sification of the Archaea evolution of methanogenesis andmethanogensrdquo Archaea vol 1 no 5 pp 353ndash363 2005

[11] J N Reeve J Nolling R M Morgan and D R SmithldquoMethanogenesis genes genomes and whorsquos on firstrdquo Journalof Bacteriology vol 179 no 19 pp 5975ndash5986 1997

[12] R K Thauer A-K Kaster H Seedorf W Buckel and RHedderich ldquoMethanogenic archaea ecologically relevant dif-ferences in energy conservationrdquo Nature Reviews Microbiologyvol 6 no 8 pp 579ndash591 2008

[13] C C Mitigation IPCC Special Report on Renewable EnergySources and Climate Change Mitigation 2011

[14] D Mayumi J Dolfing S Sakata et al ldquoCarbon dioxideconcentration dictates alternativemethanogenic pathways in oilreservoirsrdquo Nature Communications vol 4 article 1998 2013

[15] S Gupta N Choudhary and B J Alappat ldquoBioreactor landfillfor MSW disposal in Delhirdquo in Proceedings of the InternationalConference on Sustainable Solid Waste Management ChennaiIndia September 2007

[16] M Rawat and A Ramanathan ldquoAssessment of methane fluxfrom municipal solid waste (MSW) landfill areas of DelhiIndiardquo Journal of Environmental Protection vol 2 no 4 pp399ndash407 2011

[17] V Talyan R P Dahiya S Anand and T R SreekrishnanldquoQuantification of methane emission from municipal solidwaste disposal in Delhirdquo Resources Conservation and Recyclingvol 50 no 3 pp 240ndash259 2007

[18] L B Hansen K Finster H Fossing and N Iversen ldquoAnaerobicmethane oxidation in sulfate depleted sediments effects ofsulfate and molybdate additionsrdquo Aquatic Microbial Ecologyvol 14 no 2 pp 195ndash204 1998

[19] A A Bloom P I Palmer A Fraser S R David and CFrankenberg ldquoLarge-scale controls of methanogenesis inferredfrom methane and gravity spaceborne datardquo Science vol 327no 5963 pp 322ndash325 2010

[20] V Singh and A Mittal ldquoToxicity analysis and public healthaspects of municipal landfill leachate a case study of OkhlaLandfill Delhirdquo in Proceedings of the 8th World Wide Workshopfor Young Environmental Scientists WWW-YES 2009 UrbanWaters Resource or Risks 2ndash5 June 2009 2011

[21] D Liu W Ding Z Jia and Z Cai ldquoThe impact of dissolvedorganic carbon on the spatial variability of methanogenicarchaea communities in natural wetland ecosystems acrossChinardquo Applied Microbiology and Biotechnology vol 96 no 1pp 253ndash263 2012

[22] B P Walter M Heimann R D Shannon and J R White ldquoAprocess-based model to derive methane emissions from naturalwetlandsrdquoGeophysical Research Letters vol 23 no 25 pp 3731ndash3734 1996

[23] L S Chasar J P Chanton P H Glaser and D I SiegelldquoMethane concentration and stable isotope distribution asevidence of rhizospheric processes Comparison of a fen andbog in the glacial Lake Agassiz Peatland complexrdquo Annals ofBotany vol 86 no 3 pp 655ndash663 2000

[24] G B Avery Jr R D Shannon J R White C S Martensand M J Alperin ldquoControls on methane production in a tidalfreshwater estuary and a peatland methane production viaacetate fermentation and CO

2reductionrdquo Biogeochemistry vol

62 no 1 pp 19ndash37 2003[25] L-N Huang Y-Q Chen H Zhou S Luo C-Y Lan and L-H

Qu ldquoCharacterization of methanogenic Archaea in the leachateof a closed municipal solid waste landfillrdquo FEMS MicrobiologyEcology vol 46 no 2 pp 171ndash177 2003

[26] W Laloui-Carpentier T Li V Vigneron L Mazeas and TBouchez ldquoMethanogenic diversity and activity in municipalsolid waste landfill leachatesrdquoAntonie van Leeuwenhoek vol 89no 3-4 pp 423ndash434 2006

[27] L M Steinberg and J M Regan ldquoPhylogenetic comparison ofthe methanogenic communities from an acidic oligotrophicfen and an anaerobic digester treating municipal wastewatersludgerdquoApplied and Environmental Microbiology vol 74 no 21pp 6663ndash6671 2008

[28] Q Ban J Li L Zhang Y Zhang and A K Jha ldquoPhylogeneticdiversity of methanogenic archaea and kinetics of methaneproduction at slightly acidic conditions of an anaerobic sludgerdquoInternational Journal of Agriculture and Biology vol 15 no 2pp 347ndash351 2013

[29] S G Tringe and EM Rubin ldquoMetagenomics DNA sequencingof environmental samplesrdquo Nature Reviews Genetics vol 6 no11 pp 805ndash814 2005

[30] R D Bardgett and W H van der Putten ldquoBelowgroundbiodiversity and ecosystem functioningrdquo Nature vol 515 no7528 pp 505ndash511 2014

[31] N R Pace ldquoNew perspective on the natural microbial worldmolecularmicrobial ecologyrdquoASMNews vol 62 no 9 pp 463ndash470 1996

[32] J L Kirk L A Beaudette M Hart et al ldquoMethods of studyingsoil microbial diversityrdquo Journal ofMicrobiologicalMethods vol58 no 2 pp 169ndash188 2004

Archaea 9

[33] R I Amann W Ludwig and K-H Schleifer ldquoPhylogeneticidentification and in situ detection of individual microbial cellswithout cultivationrdquo Microbiological Reviews vol 59 no 1 pp143ndash169 1995

[34] M Keller and K Zengler ldquoTapping into microbial diversityrdquoNature Reviews Microbiology vol 2 no 2 pp 141ndash150 2004

[35] Y F Cheng S Y Mao J X Liu and W Y Zhu ldquoMoleculardiversity analysis of rumenmethanogenic Archaea from goat ineastern China by DGGEmethods using different primer pairsrdquoLetters in AppliedMicrobiology vol 48 no 5 pp 585ndash592 2009

[36] A-D G Wright and C Pimm ldquoImproved strategy for pre-sumptive identification ofmethanogens using 16S riboprintingrdquoJournal of Microbiological Methods vol 55 no 2 pp 337ndash3492003

[37] P Ghosh A Gupta and I S Thakur ldquoCombined chemicaland toxicological evaluation of leachate from municipal solidwaste landfill sites of Delhi Indiardquo Environmental Science andPollution Research vol 22 no 12 pp 9148ndash9158 2015

[38] S Roy and A Gupta ldquoWater quality assessment of river barakand tributaries in Assam Indiardquo Pollution Research vol 31 no3 pp 445ndash450 2012

[39] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990

[40] K Tamura G Stecher D Peterson A Filipski and S KumarldquoMEGA6molecular evolutionary genetics analysis version 60rdquoMolecular Biology and Evolution vol 30 no 12 pp 2725ndash27292013

[41] M Kimura ldquoA simple method for estimating evolutionary ratesof base substitutions through comparative studies of nucleotidesequencesrdquo Journal ofMolecular Evolution vol 16 no 2 pp 111ndash120 1980

[42] T Watanabe M Kimura and S Asakawa ldquoDiversity ofmethanogenic archaeal communities in Japanese paddy fieldecosystem estimated by denaturing gradient gel electrophore-sisrdquoBiology and Fertility of Soils vol 46 no 4 pp 343ndash353 2010

[43] G Borrel H M B Harris W Tottey et al ldquoGenomesequence of lsquoCandidatusMethanomethylophilus alvusrsquo Mx1201a methanogenic archaeon from the human gut belonging to aseventh order of methanogensrdquo Journal of Bacteriology vol 194no 24 pp 6944ndash6945 2012

[44] H Juottonen Archaea Bacteria and methane production alongenvironmental gradients in fens and bogs [PhD thesis] Univer-sity of Helsinki Helsinki Finland 2008

[45] G Borrel PW OrsquoToole HM B Harris P Peyret J-F Brugereand S Gribaldo ldquoPhylogenomic data support a seventh orderof methylotrophic methanogens and provide insights into theevolution of methanogenesisrdquo Genome Biology and Evolutionvol 5 no 10 pp 1769ndash1780 2013

[46] V Iverson R M Morris C D Frazar C T BerthiaumeR L Morales and E V Armbrust ldquoUntangling genomesfrom metagenomes revealing an uncultured class of marineeuryarchaeotardquo Science vol 335 no 6068 pp 587ndash590 2012

[47] K G Lloyd L Schreiber D G Petersen et al ldquoPredominantarchaea in marine sediments degrade detrital proteinsrdquoNaturevol 496 no 7444 pp 215ndash218 2013

[48] I Anderson R Wirth S Lucas et al ldquoComplete genomesequence of Staphylothermus hellenicusP8Trdquo Standards inGenomic Sciences vol 5 no 1 p 12 2011

[49] C Brochier-Armanet S Gribaldo and P Forterre ldquoSpotlight onthe thaumarchaeotardquo The ISME Journal vol 6 no 2 pp 227ndash230 2012

[50] P E Galand H Fritze R Conrad and K Yrjala ldquoPathwaysfor methanogenesis and diversity of methanogenic archaea inthree boreal peatland ecosystemsrdquo Applied and EnvironmentalMicrobiology vol 71 no 4 pp 2195ndash2198 2005

[51] M Ikenaga S Asakawa Y Muraoka and M KimuraldquoMethanogenic archaeal communities in rice roots grown inflooded soil pots estimation by PCR-DGGE and sequenceanalysesrdquo Soil Science and Plant Nutrition vol 50 no 5 pp 701ndash711 2004

[52] A Spang A Poehlein P Offre et al ldquoThe genome ofthe ammonia-oxidizing Candidatus nitrososphaera gargensisinsights into metabolic versatility and environmental adapta-tionsrdquoEnvironmentalMicrobiology vol 14 no 12 pp 3122ndash31452012

[53] P P Chaudhary L Brablcova I Buriankova and M RulıkldquoMolecular diversity and tools for deciphering the methanogencommunity structure and diversity in freshwater sedimentsrdquoAppliedMicrobiology and Biotechnology vol 97 no 17 pp 7553ndash7562 2013

[54] A V Piterina and J T Pembroke ldquoUse of PCR-DGGE basedmolecular methods to analyse microbial community diversityand stability during the thermophilic stages of an ATADwastewater sludge treatment process as an aid to performancemonitoringrdquo ISRN Biotechnology vol 2013 Article ID 16264513 pages 2013

[55] T Watanabe M Kimura and S Asakawa ldquoCommunity struc-ture of methanogenic archaea in paddy field soil under doublecropping (rice-wheat)rdquo Soil Biology and Biochemistry vol 38no 6 pp 1264ndash1274 2006

[56] T Watanabe M Kimura and S Asakawa ldquoDynamics ofmethanogenic archaeal communities based on rRNA analysisand their relation to methanogenic activity in Japanese paddyfield soilsrdquo Soil Biology and Biochemistry vol 39 no 11 pp2877ndash2887 2007

[57] L Brablcova I Buriankova P Badurova P P Chaudharyand M Rulık ldquoMethanogenic archaea diversity in hyporheicsediments of a small lowland streamrdquoAnaerobe vol 32 pp 24ndash31 2015

[58] V Mach M B Blaser P Claus P P Chaudhary and M RulAkldquoMethane production potentials pathways and communitiesof methanogens in vertical sediment profiles of river SitkardquoFrontiers in Microbiology vol 6 article 506 2015

[59] GMuyzer ldquoDGGETGGE amethod for identifying genes fromnatural ecosystemsrdquoCurrent Opinion inMicrobiology vol 2 no3 pp 317ndash322 1999

[60] G Muyzer E C De Waal and A G Uitterlinden ldquoProfilingof complex microbial populations by denaturing gradient gelelectrophoresis analysis of polymerase chain reaction-amplifiedgenes coding for 16S rRNArdquo Applied and Environmental Micro-biology vol 59 no 3 pp 695ndash700 1993

[61] S J Macnaughton J R Stephen A D Venosa G A DavisY-J Chang and D C White ldquoMicrobial population changesduring bioremediation of an experimental oil spillrdquoApplied andEnvironmental Microbiology vol 65 no 8 pp 3566ndash3574 1999

[62] Y Yu C Lee J Kim and S Hwang ldquoGroup-specific primer andprobe sets to detect methanogenic communities using quanti-tative real-time polymerase chain reactionrdquo Biotechnology andBioengineering vol 89 no 6 pp 670ndash679 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Archaea 5

OK BH GZ SON SIL KRM BDR

Figure 2 Community profiling of methanogens using 16s rDNAbased onDGGE the community profiling ofmethanogenic diversitypresent in the leachate sample of Delhi landfill site (OK BH andGZ) and marshland sample of Southern Assam (SON SIL KRMand BDR)

25 Quantification of Methanogens by Quantitative Real-TimePCR Analysis Real-time PCR was done for absolute quan-tification of methanogens 16S rDNA fragments obtainedfrom pure culture of methanogens (DSMZ) were cloned andserially diluted for making standard curve as was previouslydone by Steinberg and Regan [27] Real-time PCR reactionwas carried out in triplicate using the temperature profile asrecommended for the Agilent 2x master mix that is initialdenaturation at 95∘C for 3 minutes subsequent denaturationat 95∘C for 30 seconds annealing at 60∘C for 10 seconds andelongation at 65∘C for 1 minute Melt curve analysis to detectthe presence of primer dimer was performed after the finalextension by increasing the temperature from 50 to 95∘Cwith05∘C increments every 10 s

3 Results and Discussions

31 Identification of Methanogenic Archaea in Landfill andMarshland Sequences of MET1 LAND and MET2 LANDobtained from the Bhalswa landfill site are clustered withMethanoculleus thermophilus methanogens belonging to theorder Methanomicrobiales which are hydrogenotrophic innature Third sequence of MET3 LAND from the Bhalswalandfill site clustered with the Candidatus Methanomethy-lophilus alvus Mx1201 which is H

2-dependent methy-

lotrophic methanogens In Figure 1 it is shown that thesethree sequences from the landfill sites of Delhi are clusteredwith Euryarchaeota cluster (Cluster I) Sequence METG1LAND obtained from the Ghazipur landfill site Delhi clus-tered with Methanomassiliicoccus luminyensis (Cluster II)Sequences obtained frommarshland sites of Southern Assamwere clustered (Cluster III) separately with Crenarchaeota(Cluster IIIa) and Thaumarchaeota (Cluster IIIb) There arefive more sequences from the landfill sites of Delhi They arerelated to two different species of methanotrophs (methane

oxidizing bacteria) (see Table 4) Methylobacillus arboreus(marked as grey triangle) and Methylobacillus flagellatus(marked as grey circle) and are clustered separately as shownin Figure 1

Phylogenetic analysis of 16S rDNA clones indicates thepresence of methanogens belonging to the phylum Eur-yarchaeota order Methanomicrobiales Methanobacteriales-1 and seventh order of methanogens in the landfill sites [42ndash44] Both Candidatus Methanomethylophilus alvus Mx1201and Methanomassiliicoccus luminyensis represent a mono-phyletic lineage that is not phylogenetically associated withany of the previously known orders of methanogens or theanaerobic methanotrophic ANME1 lineage [43 45] Theybelong to the Mx order clusters with two lineages the plank-tonic Marine Group II (MG-II) and the sediment dwellingMarine Benthic Group D (MBG-D) [45ndash47] The other fivesequences from Ghazipur landfill sites revealed presence ofmethanotrophs belonging to class Betaproteobacteria familyMethylophilaceae 16S rDNA clones obtained from marsh-land sites of Southern Assam revealed a cluster of Archaeathat are distantly related to twodifferent phyla CrenarchaeotaandThaumarchaeota Microorganisms belonging to the phy-lum Thaumarchaeota (recently proposed) are thermophilicandmesophilic in nature and are found to be present in awidevariety of ecosystems including marine and fresh waterssoils and also hot environment [44 48ndash52]

32 Culture Independent Molecular Analysis of MethanogenicDiversity Microbes dominated in the history of living organ-isms and they are a fundamental part of the biosphere Thestudy of microbial diversity has been therefore essential forunderstanding the evolution of life Traditionally cultivationbased methods have contributed to our knowledge abouttheir whereabouts and diversity of microbes in naturallyoccurring communities However only a small fraction ofthe prokaryotes has been cultivated in vitro by standardmethodsTherefore this knowledgemay not reveal the actualcomposition andor diversity associated with an ecosystem[31 33] In the present study we used culture indepen-dent molecular techniques like 16S rDNA PCR cloning-sequencing DGGE and qPCR for estimation of the richnessand diversity of the methanogenic Archaea in the landfillsite of Delhi and marshland areas of Southern Assam Thesetechniques arewidely used formolecular community analysisof microbes present in various types of habitats [32 42 53ndash56] A combination of DNA sequencing DGGE and quanti-tative PCR (qPCR) can provide valuable information aboutmicrobial consortia associated with a specific ecosystemDenaturing gradient gel electrophoresis (DGGE) is used todetermine the genetic diversity of microbial communitiesThe procedure is based on electrophoresis of PCR-amplified16S rDNA fragments in polyacrylamide gels containing alinearly increasing gradient of denaturants In DGGE DNAfragments of the same length but with different base-paircomposition can be separated Separation is based on theelectrophoretic mobility of partially melted DNA moleculesin a polyacrylamide gel and resulting into a band pattern [57ndash60] DGGE can reveal 1-2 of the actual diversity present inthe samples [61]

6 Archaea

Table 5 Copy number of methanogens present per gram samples of Okhla and Bhalswa landfill site Delhi and Silcoorie Lake Assam India

Pure culture Okhla Bhalswa Silcoorie Lake (Silchar)M arbophilicus 398119890 + 014ndash68119890 + 014 538119890 + 014ndash97119890 + 014 278119890 + 011ndash78119890 + 011M bryantii 114119890 + 017ndash18119890 + 017 46119890 + 016ndash82119890 + 016 12119890 + 013ndash21119890 + 013M mobile 667119890 + 015ndash75119890 + 015 342119890 + 015ndash48119890 + 015 397119890 + 012ndash41119890 + 012M mazei 189119890 + 014ndash25119890 + 014 221119890 + 015ndash28119890 + 015 113119890 + 012ndash15119890 + 012

Table 6 Methanogenic pathways and microorganisms that are associated

Domain Archaea kingdom Archaebacteria phylum EuryarchaeotaMethanogenic pathway Orders ReactionAcetoclastic Methanosarcinales CH

3COOHrarrCH

4+ CO

2

Hydrogenotrophic Methanosarcinales 4H2+ CO

2rarrCH

4+ 2H2O

Methanobacteriales 4HCOOHrarrCH4+ 3CO

2+ 2H2O

MethanococcalesMethanomicrobialesMethanopyrales

Methylotrophic Methanosarcinales 4CH3OHrarr 3CH

4+ CO

2+ 2H2O

33 Estimation of Methanogenic Richness by QuantitativeReal-Time PCR DNA extracted from the three samplingpoints that is two landfill sites Okhla and Bhalswa of Delhiand Silcoorie Lake (Silchar) of SouthernAssam was screenedfor the quantification of methanogens The copy number ofall methanogens (pure culture) was higher in the two landfillsites than that of marshland in Southern Assam (Table 5)Methanogenic pathway associated with the methanogensorder and its reactions involved in the process are includedin Table 6

The copy numbers ofMethanomicrobium mobile belong-ing to the order Methanomicrobiales and Methanobac-terium bryantii belonging to the order Methanobacteriales-1 were found to be higher in both landfill sites in com-parison to the Silcoorie Lake (Silchar) of Southern AssamCopy number of Methanobrevibacter arboriphilus (orderMethanobacteriales-1) andMethanosarcinamazei (acetoclas-tic) (order Methanosarcinales) was found to be higher in theBhalswa landfill site than Okhla landfill site and SilcoorieLake (Silchar) marshland site The value of 119877Sq and slope 119889119877for standard curve was 0948 and minus2641 and the efficiencyof the reaction was 1391 The 119877Sq and slope 119889119877 values forldquoabsoluterdquo quantification of Methanobrevibacter arboriphilusare 0903 and minus2128 119877Sq (119889119877) and slope 119889119877 values for thisquantification of Methanobacterium bryantii are 0877 andminus1384 119877Sq (119889119877) and slope 119889119877 values of Methanomicrobiummobile are 0956 and minus2563 respectively The values of 119877Sq(119889119877) and slope 119889119877 forMethanosarcina mazei were 0394 andminus2051 respectively

Methanogens pertaining to both acetotrophic and hy-drogenotrophic decomposition pathways were detected inMSW landfills which have been reported earlier [25 26 42]Acetate serves as a precursor for more than 70 of CH

4

(methane) formation in the most anaerobic digestion pro-cess [62] Therefore acetoclastic methanogens which utilizeacetate as substrate play a key role in stabilizing the pollution

load of wastewater by methanogenesis In the present studyquantitative PCR indicates the higher methanogenic richnessin both landfill sites of Delhi compared to marshland ofSilcoorie Lake Silchar

34 Diversity of Methanogenic Archaea by DenaturingGradient Gel Electrophoresis Abundance and diversity ofmethanogenic Archaea were studied in three landfill and fourmarshland sites situated at different location in Delhi andSouthernAssam India 16S rDNAampliconswere cloned andthen analyzed on the DGGE gel for estimation of the archaealrichness in respective samples as shown in Figure 2

Band patterns of 16S rDNA amplicons obtained fromthe landfill sites (OK BH and GZ) of Delhi and marshlandsamples (SON SIL KRM and BDR) of Southern Assamwerecompared for methanogens richness and diversity analysisusing Gel2K software Analysis of DGGE image revealed thepresence of total 38 bands There are some unique bands ineach lane which indicates the variation ofmethanogens com-munity residing in those particular samples Cluster analysisof bands using Jaccard analysis indicated the presence of threemain clusters consisting of localities that differ in number ofsimilarity versus DGGE bands (Figure 3)

In the first cluster Badarpur beetle-nut pond and Sil-coorie Lake (Silchar) of Southern Assam clustered togethershowing similar band pattern In the second cluster inter-estingly despite being two different ecosystems Ghazipurlandfill sites of Delhi clusteredwithwetland of Sonbill South-ern Assam India In the third cluster the two landfill sitesof Delhi (Okhla and Bhalswa) clustered together showingsimilar band pattern In terms of richness number of bandsfrom the respective samples fromBhalswa landfill and Sonbillwetland have maximum of 11 bands followed by Ghazipurlandfill site and Silcoorie Lake (Silchar) having 10 bands eachOkhla landfill and Badarpur beetle-nut pond showed 9 bands

Archaea 7

Jacc

ard

10

08

06

04

02

00 Bada

rpur

Silc

oorie

Karim

ganj

Sonb

ill

Gha

zipu

r

Bhal

saw

a

Okh

la

Comp

Figure 3 Jaccard cluster diagram of DGGE bands obtained from landfill sites of Delhi and marshland of Southern Assam India

each in the cluster In the Karimganj rice paddy field sampleonly four bands were observed showing the least diversity

Microbial diversity within contaminated ecosystems likelandfill should be less diverse than those in natural systemslike a wetland because the diversity may be influenced by thecomplexity of toxic chemical mixtures heavy metals presentand duration of time the populations have been exposed Inthe present study after analyzing DGGE gel banding patternand the number of bands we found that the methanogenicdiversity present in both landfills (anthropogenic system) andmarshland (natural) is quite similar except for the samplesobtained from the Karimganj rice paddy field where onlyfour bands appeared The number of total bands observedin this study was in accordance with the number of DGGEbands reported previously [42 51 56 57] It strongly indicatesthat the methanogenic Archaea diversity in both landfill andmarshland is influenced by sampling location rather thantype

4 Conclusions

In the sequencing of themolecular marker for archaeal diver-sity 16S rDNA identified the orders named as Methanobac-teriales and Methanosarcinales in both landfill sites and thephylum Crenarchaeota (thermophilic) in marshland Quan-titative PCR indicated a higher abundance ofmethanogens inlandfill compared to that of marshland sites The knowledgeabout the composition and abundance of methanogenicArchaea in a landfill may provide information on thedecomposition mechanism of municipal solid waste and thesubsequent generation of methane This information canbe exploited for controlling methane emission from land-fill by mitigation process The increasing knowledge about

the genomic content of microbes belonging to the phylumThaumarchaeota (mesophilic) will enrich our understandingof their adaptative behavior in the transposition from ther-mophily to mesophily This indicates whether they follow asimilar or different evolutionary pattern with respect to thephylum Euryarchaeota

Abbreviations

MSW Municipal solid wasteGHGs Green House GasesDGGE Denaturing gradient gel electrophoresismM MillimolarMg MilligrammL MillilitreTg Teragram

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Dr S S Maitra and Professor Sankar K Ghosh are grateful tothe Department of Biotechnology (DBT) of the Governmentof India for providing a Grant (BT14NETBP2010) Theauthors are extremely thankful to the referees for theirvaluable suggestions for improving the quality of the paperThe authors are indebted to Dr Santanu Raychaudhuri a UScitizen presently assigned as a Visiting Research Faculty atAssam University for correcting the paper

8 Archaea

References

[1] G Yvon-Durocher A P Allen D Bastviken et al ldquoMethanefluxes show consistent temperature dependence across micro-bial to ecosystem scalesrdquoNature vol 507 no 7493 pp 488ndash4912014

[2] S D Bridgham H Cadillo-Quiroz J K Keller and Q ZhuangldquoMethane emissions fromwetlands biogeochemical microbialand modeling perspectives from local to global scalesrdquo GlobalChange Biology vol 19 no 5 pp 1325ndash1346 2013

[3] J T Houghton Y Ding D J Griggs et al Climate Change2001 The Scientific Basis vol 881 Cambridge University PressCambridge Mass USA 2001

[4] S Solomon Climate Change 2007mdashThe Physical Science BasisWorkingGroup IContribution to the FourthAssessment Report ofthe IPCC vol 4 Cambridge University Press Cambridge UK2007

[5] R Angel P Claus and R Conrad ldquoMethanogenic archaea areglobally ubiquitous in aerated soils and become active underwet anoxic conditionsrdquoThe ISME Journal vol 6 no 4 pp 847ndash862 2012

[6] A R Daquiado K M Cho T Y Kim S C Kim H-H Changand Y B Lee ldquoMethanogenic archaea diversity in Hanwoo(Bos taurus coreanae) rumen fluid rectal dung and barn floormanure using a culture-independent method based on mcrAgene sequencesrdquo Anaerobe vol 27 pp 77ndash81 2014

[7] R S Oremland ldquoBiogeochemistry of methanogenic bacteriardquoin Biology of Anaerobic Microorganisms pp 641ndash705 JohnWiley amp Sons 1988

[8] S H Zinder ldquoPhysiological ecology of methanogensrdquo inMethanogenesis pp 128ndash206 Springer Berlin Germany 1993

[9] J-L Garcia B K C Patel and B Ollivier ldquoTaxonomic phy-logenetic and ecological diversity of methanogenic ArchaeardquoAnaerobe vol 6 no 4 pp 205ndash226 2000

[10] E Bapteste C Brochier and Y Boucher ldquoHigher-level clas-sification of the Archaea evolution of methanogenesis andmethanogensrdquo Archaea vol 1 no 5 pp 353ndash363 2005

[11] J N Reeve J Nolling R M Morgan and D R SmithldquoMethanogenesis genes genomes and whorsquos on firstrdquo Journalof Bacteriology vol 179 no 19 pp 5975ndash5986 1997

[12] R K Thauer A-K Kaster H Seedorf W Buckel and RHedderich ldquoMethanogenic archaea ecologically relevant dif-ferences in energy conservationrdquo Nature Reviews Microbiologyvol 6 no 8 pp 579ndash591 2008

[13] C C Mitigation IPCC Special Report on Renewable EnergySources and Climate Change Mitigation 2011

[14] D Mayumi J Dolfing S Sakata et al ldquoCarbon dioxideconcentration dictates alternativemethanogenic pathways in oilreservoirsrdquo Nature Communications vol 4 article 1998 2013

[15] S Gupta N Choudhary and B J Alappat ldquoBioreactor landfillfor MSW disposal in Delhirdquo in Proceedings of the InternationalConference on Sustainable Solid Waste Management ChennaiIndia September 2007

[16] M Rawat and A Ramanathan ldquoAssessment of methane fluxfrom municipal solid waste (MSW) landfill areas of DelhiIndiardquo Journal of Environmental Protection vol 2 no 4 pp399ndash407 2011

[17] V Talyan R P Dahiya S Anand and T R SreekrishnanldquoQuantification of methane emission from municipal solidwaste disposal in Delhirdquo Resources Conservation and Recyclingvol 50 no 3 pp 240ndash259 2007

[18] L B Hansen K Finster H Fossing and N Iversen ldquoAnaerobicmethane oxidation in sulfate depleted sediments effects ofsulfate and molybdate additionsrdquo Aquatic Microbial Ecologyvol 14 no 2 pp 195ndash204 1998

[19] A A Bloom P I Palmer A Fraser S R David and CFrankenberg ldquoLarge-scale controls of methanogenesis inferredfrom methane and gravity spaceborne datardquo Science vol 327no 5963 pp 322ndash325 2010

[20] V Singh and A Mittal ldquoToxicity analysis and public healthaspects of municipal landfill leachate a case study of OkhlaLandfill Delhirdquo in Proceedings of the 8th World Wide Workshopfor Young Environmental Scientists WWW-YES 2009 UrbanWaters Resource or Risks 2ndash5 June 2009 2011

[21] D Liu W Ding Z Jia and Z Cai ldquoThe impact of dissolvedorganic carbon on the spatial variability of methanogenicarchaea communities in natural wetland ecosystems acrossChinardquo Applied Microbiology and Biotechnology vol 96 no 1pp 253ndash263 2012

[22] B P Walter M Heimann R D Shannon and J R White ldquoAprocess-based model to derive methane emissions from naturalwetlandsrdquoGeophysical Research Letters vol 23 no 25 pp 3731ndash3734 1996

[23] L S Chasar J P Chanton P H Glaser and D I SiegelldquoMethane concentration and stable isotope distribution asevidence of rhizospheric processes Comparison of a fen andbog in the glacial Lake Agassiz Peatland complexrdquo Annals ofBotany vol 86 no 3 pp 655ndash663 2000

[24] G B Avery Jr R D Shannon J R White C S Martensand M J Alperin ldquoControls on methane production in a tidalfreshwater estuary and a peatland methane production viaacetate fermentation and CO

2reductionrdquo Biogeochemistry vol

62 no 1 pp 19ndash37 2003[25] L-N Huang Y-Q Chen H Zhou S Luo C-Y Lan and L-H

Qu ldquoCharacterization of methanogenic Archaea in the leachateof a closed municipal solid waste landfillrdquo FEMS MicrobiologyEcology vol 46 no 2 pp 171ndash177 2003

[26] W Laloui-Carpentier T Li V Vigneron L Mazeas and TBouchez ldquoMethanogenic diversity and activity in municipalsolid waste landfill leachatesrdquoAntonie van Leeuwenhoek vol 89no 3-4 pp 423ndash434 2006

[27] L M Steinberg and J M Regan ldquoPhylogenetic comparison ofthe methanogenic communities from an acidic oligotrophicfen and an anaerobic digester treating municipal wastewatersludgerdquoApplied and Environmental Microbiology vol 74 no 21pp 6663ndash6671 2008

[28] Q Ban J Li L Zhang Y Zhang and A K Jha ldquoPhylogeneticdiversity of methanogenic archaea and kinetics of methaneproduction at slightly acidic conditions of an anaerobic sludgerdquoInternational Journal of Agriculture and Biology vol 15 no 2pp 347ndash351 2013

[29] S G Tringe and EM Rubin ldquoMetagenomics DNA sequencingof environmental samplesrdquo Nature Reviews Genetics vol 6 no11 pp 805ndash814 2005

[30] R D Bardgett and W H van der Putten ldquoBelowgroundbiodiversity and ecosystem functioningrdquo Nature vol 515 no7528 pp 505ndash511 2014

[31] N R Pace ldquoNew perspective on the natural microbial worldmolecularmicrobial ecologyrdquoASMNews vol 62 no 9 pp 463ndash470 1996

[32] J L Kirk L A Beaudette M Hart et al ldquoMethods of studyingsoil microbial diversityrdquo Journal ofMicrobiologicalMethods vol58 no 2 pp 169ndash188 2004

Archaea 9

[33] R I Amann W Ludwig and K-H Schleifer ldquoPhylogeneticidentification and in situ detection of individual microbial cellswithout cultivationrdquo Microbiological Reviews vol 59 no 1 pp143ndash169 1995

[34] M Keller and K Zengler ldquoTapping into microbial diversityrdquoNature Reviews Microbiology vol 2 no 2 pp 141ndash150 2004

[35] Y F Cheng S Y Mao J X Liu and W Y Zhu ldquoMoleculardiversity analysis of rumenmethanogenic Archaea from goat ineastern China by DGGEmethods using different primer pairsrdquoLetters in AppliedMicrobiology vol 48 no 5 pp 585ndash592 2009

[36] A-D G Wright and C Pimm ldquoImproved strategy for pre-sumptive identification ofmethanogens using 16S riboprintingrdquoJournal of Microbiological Methods vol 55 no 2 pp 337ndash3492003

[37] P Ghosh A Gupta and I S Thakur ldquoCombined chemicaland toxicological evaluation of leachate from municipal solidwaste landfill sites of Delhi Indiardquo Environmental Science andPollution Research vol 22 no 12 pp 9148ndash9158 2015

[38] S Roy and A Gupta ldquoWater quality assessment of river barakand tributaries in Assam Indiardquo Pollution Research vol 31 no3 pp 445ndash450 2012

[39] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990

[40] K Tamura G Stecher D Peterson A Filipski and S KumarldquoMEGA6molecular evolutionary genetics analysis version 60rdquoMolecular Biology and Evolution vol 30 no 12 pp 2725ndash27292013

[41] M Kimura ldquoA simple method for estimating evolutionary ratesof base substitutions through comparative studies of nucleotidesequencesrdquo Journal ofMolecular Evolution vol 16 no 2 pp 111ndash120 1980

[42] T Watanabe M Kimura and S Asakawa ldquoDiversity ofmethanogenic archaeal communities in Japanese paddy fieldecosystem estimated by denaturing gradient gel electrophore-sisrdquoBiology and Fertility of Soils vol 46 no 4 pp 343ndash353 2010

[43] G Borrel H M B Harris W Tottey et al ldquoGenomesequence of lsquoCandidatusMethanomethylophilus alvusrsquo Mx1201a methanogenic archaeon from the human gut belonging to aseventh order of methanogensrdquo Journal of Bacteriology vol 194no 24 pp 6944ndash6945 2012

[44] H Juottonen Archaea Bacteria and methane production alongenvironmental gradients in fens and bogs [PhD thesis] Univer-sity of Helsinki Helsinki Finland 2008

[45] G Borrel PW OrsquoToole HM B Harris P Peyret J-F Brugereand S Gribaldo ldquoPhylogenomic data support a seventh orderof methylotrophic methanogens and provide insights into theevolution of methanogenesisrdquo Genome Biology and Evolutionvol 5 no 10 pp 1769ndash1780 2013

[46] V Iverson R M Morris C D Frazar C T BerthiaumeR L Morales and E V Armbrust ldquoUntangling genomesfrom metagenomes revealing an uncultured class of marineeuryarchaeotardquo Science vol 335 no 6068 pp 587ndash590 2012

[47] K G Lloyd L Schreiber D G Petersen et al ldquoPredominantarchaea in marine sediments degrade detrital proteinsrdquoNaturevol 496 no 7444 pp 215ndash218 2013

[48] I Anderson R Wirth S Lucas et al ldquoComplete genomesequence of Staphylothermus hellenicusP8Trdquo Standards inGenomic Sciences vol 5 no 1 p 12 2011

[49] C Brochier-Armanet S Gribaldo and P Forterre ldquoSpotlight onthe thaumarchaeotardquo The ISME Journal vol 6 no 2 pp 227ndash230 2012

[50] P E Galand H Fritze R Conrad and K Yrjala ldquoPathwaysfor methanogenesis and diversity of methanogenic archaea inthree boreal peatland ecosystemsrdquo Applied and EnvironmentalMicrobiology vol 71 no 4 pp 2195ndash2198 2005

[51] M Ikenaga S Asakawa Y Muraoka and M KimuraldquoMethanogenic archaeal communities in rice roots grown inflooded soil pots estimation by PCR-DGGE and sequenceanalysesrdquo Soil Science and Plant Nutrition vol 50 no 5 pp 701ndash711 2004

[52] A Spang A Poehlein P Offre et al ldquoThe genome ofthe ammonia-oxidizing Candidatus nitrososphaera gargensisinsights into metabolic versatility and environmental adapta-tionsrdquoEnvironmentalMicrobiology vol 14 no 12 pp 3122ndash31452012

[53] P P Chaudhary L Brablcova I Buriankova and M RulıkldquoMolecular diversity and tools for deciphering the methanogencommunity structure and diversity in freshwater sedimentsrdquoAppliedMicrobiology and Biotechnology vol 97 no 17 pp 7553ndash7562 2013

[54] A V Piterina and J T Pembroke ldquoUse of PCR-DGGE basedmolecular methods to analyse microbial community diversityand stability during the thermophilic stages of an ATADwastewater sludge treatment process as an aid to performancemonitoringrdquo ISRN Biotechnology vol 2013 Article ID 16264513 pages 2013

[55] T Watanabe M Kimura and S Asakawa ldquoCommunity struc-ture of methanogenic archaea in paddy field soil under doublecropping (rice-wheat)rdquo Soil Biology and Biochemistry vol 38no 6 pp 1264ndash1274 2006

[56] T Watanabe M Kimura and S Asakawa ldquoDynamics ofmethanogenic archaeal communities based on rRNA analysisand their relation to methanogenic activity in Japanese paddyfield soilsrdquo Soil Biology and Biochemistry vol 39 no 11 pp2877ndash2887 2007

[57] L Brablcova I Buriankova P Badurova P P Chaudharyand M Rulık ldquoMethanogenic archaea diversity in hyporheicsediments of a small lowland streamrdquoAnaerobe vol 32 pp 24ndash31 2015

[58] V Mach M B Blaser P Claus P P Chaudhary and M RulAkldquoMethane production potentials pathways and communitiesof methanogens in vertical sediment profiles of river SitkardquoFrontiers in Microbiology vol 6 article 506 2015

[59] GMuyzer ldquoDGGETGGE amethod for identifying genes fromnatural ecosystemsrdquoCurrent Opinion inMicrobiology vol 2 no3 pp 317ndash322 1999

[60] G Muyzer E C De Waal and A G Uitterlinden ldquoProfilingof complex microbial populations by denaturing gradient gelelectrophoresis analysis of polymerase chain reaction-amplifiedgenes coding for 16S rRNArdquo Applied and Environmental Micro-biology vol 59 no 3 pp 695ndash700 1993

[61] S J Macnaughton J R Stephen A D Venosa G A DavisY-J Chang and D C White ldquoMicrobial population changesduring bioremediation of an experimental oil spillrdquoApplied andEnvironmental Microbiology vol 65 no 8 pp 3566ndash3574 1999

[62] Y Yu C Lee J Kim and S Hwang ldquoGroup-specific primer andprobe sets to detect methanogenic communities using quanti-tative real-time polymerase chain reactionrdquo Biotechnology andBioengineering vol 89 no 6 pp 670ndash679 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

6 Archaea

Table 5 Copy number of methanogens present per gram samples of Okhla and Bhalswa landfill site Delhi and Silcoorie Lake Assam India

Pure culture Okhla Bhalswa Silcoorie Lake (Silchar)M arbophilicus 398119890 + 014ndash68119890 + 014 538119890 + 014ndash97119890 + 014 278119890 + 011ndash78119890 + 011M bryantii 114119890 + 017ndash18119890 + 017 46119890 + 016ndash82119890 + 016 12119890 + 013ndash21119890 + 013M mobile 667119890 + 015ndash75119890 + 015 342119890 + 015ndash48119890 + 015 397119890 + 012ndash41119890 + 012M mazei 189119890 + 014ndash25119890 + 014 221119890 + 015ndash28119890 + 015 113119890 + 012ndash15119890 + 012

Table 6 Methanogenic pathways and microorganisms that are associated

Domain Archaea kingdom Archaebacteria phylum EuryarchaeotaMethanogenic pathway Orders ReactionAcetoclastic Methanosarcinales CH

3COOHrarrCH

4+ CO

2

Hydrogenotrophic Methanosarcinales 4H2+ CO

2rarrCH

4+ 2H2O

Methanobacteriales 4HCOOHrarrCH4+ 3CO

2+ 2H2O

MethanococcalesMethanomicrobialesMethanopyrales

Methylotrophic Methanosarcinales 4CH3OHrarr 3CH

4+ CO

2+ 2H2O

33 Estimation of Methanogenic Richness by QuantitativeReal-Time PCR DNA extracted from the three samplingpoints that is two landfill sites Okhla and Bhalswa of Delhiand Silcoorie Lake (Silchar) of SouthernAssam was screenedfor the quantification of methanogens The copy number ofall methanogens (pure culture) was higher in the two landfillsites than that of marshland in Southern Assam (Table 5)Methanogenic pathway associated with the methanogensorder and its reactions involved in the process are includedin Table 6

The copy numbers ofMethanomicrobium mobile belong-ing to the order Methanomicrobiales and Methanobac-terium bryantii belonging to the order Methanobacteriales-1 were found to be higher in both landfill sites in com-parison to the Silcoorie Lake (Silchar) of Southern AssamCopy number of Methanobrevibacter arboriphilus (orderMethanobacteriales-1) andMethanosarcinamazei (acetoclas-tic) (order Methanosarcinales) was found to be higher in theBhalswa landfill site than Okhla landfill site and SilcoorieLake (Silchar) marshland site The value of 119877Sq and slope 119889119877for standard curve was 0948 and minus2641 and the efficiencyof the reaction was 1391 The 119877Sq and slope 119889119877 values forldquoabsoluterdquo quantification of Methanobrevibacter arboriphilusare 0903 and minus2128 119877Sq (119889119877) and slope 119889119877 values for thisquantification of Methanobacterium bryantii are 0877 andminus1384 119877Sq (119889119877) and slope 119889119877 values of Methanomicrobiummobile are 0956 and minus2563 respectively The values of 119877Sq(119889119877) and slope 119889119877 forMethanosarcina mazei were 0394 andminus2051 respectively

Methanogens pertaining to both acetotrophic and hy-drogenotrophic decomposition pathways were detected inMSW landfills which have been reported earlier [25 26 42]Acetate serves as a precursor for more than 70 of CH

4

(methane) formation in the most anaerobic digestion pro-cess [62] Therefore acetoclastic methanogens which utilizeacetate as substrate play a key role in stabilizing the pollution

load of wastewater by methanogenesis In the present studyquantitative PCR indicates the higher methanogenic richnessin both landfill sites of Delhi compared to marshland ofSilcoorie Lake Silchar

34 Diversity of Methanogenic Archaea by DenaturingGradient Gel Electrophoresis Abundance and diversity ofmethanogenic Archaea were studied in three landfill and fourmarshland sites situated at different location in Delhi andSouthernAssam India 16S rDNAampliconswere cloned andthen analyzed on the DGGE gel for estimation of the archaealrichness in respective samples as shown in Figure 2

Band patterns of 16S rDNA amplicons obtained fromthe landfill sites (OK BH and GZ) of Delhi and marshlandsamples (SON SIL KRM and BDR) of Southern Assamwerecompared for methanogens richness and diversity analysisusing Gel2K software Analysis of DGGE image revealed thepresence of total 38 bands There are some unique bands ineach lane which indicates the variation ofmethanogens com-munity residing in those particular samples Cluster analysisof bands using Jaccard analysis indicated the presence of threemain clusters consisting of localities that differ in number ofsimilarity versus DGGE bands (Figure 3)

In the first cluster Badarpur beetle-nut pond and Sil-coorie Lake (Silchar) of Southern Assam clustered togethershowing similar band pattern In the second cluster inter-estingly despite being two different ecosystems Ghazipurlandfill sites of Delhi clusteredwithwetland of Sonbill South-ern Assam India In the third cluster the two landfill sitesof Delhi (Okhla and Bhalswa) clustered together showingsimilar band pattern In terms of richness number of bandsfrom the respective samples fromBhalswa landfill and Sonbillwetland have maximum of 11 bands followed by Ghazipurlandfill site and Silcoorie Lake (Silchar) having 10 bands eachOkhla landfill and Badarpur beetle-nut pond showed 9 bands

Archaea 7

Jacc

ard

10

08

06

04

02

00 Bada

rpur

Silc

oorie

Karim

ganj

Sonb

ill

Gha

zipu

r

Bhal

saw

a

Okh

la

Comp

Figure 3 Jaccard cluster diagram of DGGE bands obtained from landfill sites of Delhi and marshland of Southern Assam India

each in the cluster In the Karimganj rice paddy field sampleonly four bands were observed showing the least diversity

Microbial diversity within contaminated ecosystems likelandfill should be less diverse than those in natural systemslike a wetland because the diversity may be influenced by thecomplexity of toxic chemical mixtures heavy metals presentand duration of time the populations have been exposed Inthe present study after analyzing DGGE gel banding patternand the number of bands we found that the methanogenicdiversity present in both landfills (anthropogenic system) andmarshland (natural) is quite similar except for the samplesobtained from the Karimganj rice paddy field where onlyfour bands appeared The number of total bands observedin this study was in accordance with the number of DGGEbands reported previously [42 51 56 57] It strongly indicatesthat the methanogenic Archaea diversity in both landfill andmarshland is influenced by sampling location rather thantype

4 Conclusions

In the sequencing of themolecular marker for archaeal diver-sity 16S rDNA identified the orders named as Methanobac-teriales and Methanosarcinales in both landfill sites and thephylum Crenarchaeota (thermophilic) in marshland Quan-titative PCR indicated a higher abundance ofmethanogens inlandfill compared to that of marshland sites The knowledgeabout the composition and abundance of methanogenicArchaea in a landfill may provide information on thedecomposition mechanism of municipal solid waste and thesubsequent generation of methane This information canbe exploited for controlling methane emission from land-fill by mitigation process The increasing knowledge about

the genomic content of microbes belonging to the phylumThaumarchaeota (mesophilic) will enrich our understandingof their adaptative behavior in the transposition from ther-mophily to mesophily This indicates whether they follow asimilar or different evolutionary pattern with respect to thephylum Euryarchaeota

Abbreviations

MSW Municipal solid wasteGHGs Green House GasesDGGE Denaturing gradient gel electrophoresismM MillimolarMg MilligrammL MillilitreTg Teragram

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Dr S S Maitra and Professor Sankar K Ghosh are grateful tothe Department of Biotechnology (DBT) of the Governmentof India for providing a Grant (BT14NETBP2010) Theauthors are extremely thankful to the referees for theirvaluable suggestions for improving the quality of the paperThe authors are indebted to Dr Santanu Raychaudhuri a UScitizen presently assigned as a Visiting Research Faculty atAssam University for correcting the paper

8 Archaea

References

[1] G Yvon-Durocher A P Allen D Bastviken et al ldquoMethanefluxes show consistent temperature dependence across micro-bial to ecosystem scalesrdquoNature vol 507 no 7493 pp 488ndash4912014

[2] S D Bridgham H Cadillo-Quiroz J K Keller and Q ZhuangldquoMethane emissions fromwetlands biogeochemical microbialand modeling perspectives from local to global scalesrdquo GlobalChange Biology vol 19 no 5 pp 1325ndash1346 2013

[3] J T Houghton Y Ding D J Griggs et al Climate Change2001 The Scientific Basis vol 881 Cambridge University PressCambridge Mass USA 2001

[4] S Solomon Climate Change 2007mdashThe Physical Science BasisWorkingGroup IContribution to the FourthAssessment Report ofthe IPCC vol 4 Cambridge University Press Cambridge UK2007

[5] R Angel P Claus and R Conrad ldquoMethanogenic archaea areglobally ubiquitous in aerated soils and become active underwet anoxic conditionsrdquoThe ISME Journal vol 6 no 4 pp 847ndash862 2012

[6] A R Daquiado K M Cho T Y Kim S C Kim H-H Changand Y B Lee ldquoMethanogenic archaea diversity in Hanwoo(Bos taurus coreanae) rumen fluid rectal dung and barn floormanure using a culture-independent method based on mcrAgene sequencesrdquo Anaerobe vol 27 pp 77ndash81 2014

[7] R S Oremland ldquoBiogeochemistry of methanogenic bacteriardquoin Biology of Anaerobic Microorganisms pp 641ndash705 JohnWiley amp Sons 1988

[8] S H Zinder ldquoPhysiological ecology of methanogensrdquo inMethanogenesis pp 128ndash206 Springer Berlin Germany 1993

[9] J-L Garcia B K C Patel and B Ollivier ldquoTaxonomic phy-logenetic and ecological diversity of methanogenic ArchaeardquoAnaerobe vol 6 no 4 pp 205ndash226 2000

[10] E Bapteste C Brochier and Y Boucher ldquoHigher-level clas-sification of the Archaea evolution of methanogenesis andmethanogensrdquo Archaea vol 1 no 5 pp 353ndash363 2005

[11] J N Reeve J Nolling R M Morgan and D R SmithldquoMethanogenesis genes genomes and whorsquos on firstrdquo Journalof Bacteriology vol 179 no 19 pp 5975ndash5986 1997

[12] R K Thauer A-K Kaster H Seedorf W Buckel and RHedderich ldquoMethanogenic archaea ecologically relevant dif-ferences in energy conservationrdquo Nature Reviews Microbiologyvol 6 no 8 pp 579ndash591 2008

[13] C C Mitigation IPCC Special Report on Renewable EnergySources and Climate Change Mitigation 2011

[14] D Mayumi J Dolfing S Sakata et al ldquoCarbon dioxideconcentration dictates alternativemethanogenic pathways in oilreservoirsrdquo Nature Communications vol 4 article 1998 2013

[15] S Gupta N Choudhary and B J Alappat ldquoBioreactor landfillfor MSW disposal in Delhirdquo in Proceedings of the InternationalConference on Sustainable Solid Waste Management ChennaiIndia September 2007

[16] M Rawat and A Ramanathan ldquoAssessment of methane fluxfrom municipal solid waste (MSW) landfill areas of DelhiIndiardquo Journal of Environmental Protection vol 2 no 4 pp399ndash407 2011

[17] V Talyan R P Dahiya S Anand and T R SreekrishnanldquoQuantification of methane emission from municipal solidwaste disposal in Delhirdquo Resources Conservation and Recyclingvol 50 no 3 pp 240ndash259 2007

[18] L B Hansen K Finster H Fossing and N Iversen ldquoAnaerobicmethane oxidation in sulfate depleted sediments effects ofsulfate and molybdate additionsrdquo Aquatic Microbial Ecologyvol 14 no 2 pp 195ndash204 1998

[19] A A Bloom P I Palmer A Fraser S R David and CFrankenberg ldquoLarge-scale controls of methanogenesis inferredfrom methane and gravity spaceborne datardquo Science vol 327no 5963 pp 322ndash325 2010

[20] V Singh and A Mittal ldquoToxicity analysis and public healthaspects of municipal landfill leachate a case study of OkhlaLandfill Delhirdquo in Proceedings of the 8th World Wide Workshopfor Young Environmental Scientists WWW-YES 2009 UrbanWaters Resource or Risks 2ndash5 June 2009 2011

[21] D Liu W Ding Z Jia and Z Cai ldquoThe impact of dissolvedorganic carbon on the spatial variability of methanogenicarchaea communities in natural wetland ecosystems acrossChinardquo Applied Microbiology and Biotechnology vol 96 no 1pp 253ndash263 2012

[22] B P Walter M Heimann R D Shannon and J R White ldquoAprocess-based model to derive methane emissions from naturalwetlandsrdquoGeophysical Research Letters vol 23 no 25 pp 3731ndash3734 1996

[23] L S Chasar J P Chanton P H Glaser and D I SiegelldquoMethane concentration and stable isotope distribution asevidence of rhizospheric processes Comparison of a fen andbog in the glacial Lake Agassiz Peatland complexrdquo Annals ofBotany vol 86 no 3 pp 655ndash663 2000

[24] G B Avery Jr R D Shannon J R White C S Martensand M J Alperin ldquoControls on methane production in a tidalfreshwater estuary and a peatland methane production viaacetate fermentation and CO

2reductionrdquo Biogeochemistry vol

62 no 1 pp 19ndash37 2003[25] L-N Huang Y-Q Chen H Zhou S Luo C-Y Lan and L-H

Qu ldquoCharacterization of methanogenic Archaea in the leachateof a closed municipal solid waste landfillrdquo FEMS MicrobiologyEcology vol 46 no 2 pp 171ndash177 2003

[26] W Laloui-Carpentier T Li V Vigneron L Mazeas and TBouchez ldquoMethanogenic diversity and activity in municipalsolid waste landfill leachatesrdquoAntonie van Leeuwenhoek vol 89no 3-4 pp 423ndash434 2006

[27] L M Steinberg and J M Regan ldquoPhylogenetic comparison ofthe methanogenic communities from an acidic oligotrophicfen and an anaerobic digester treating municipal wastewatersludgerdquoApplied and Environmental Microbiology vol 74 no 21pp 6663ndash6671 2008

[28] Q Ban J Li L Zhang Y Zhang and A K Jha ldquoPhylogeneticdiversity of methanogenic archaea and kinetics of methaneproduction at slightly acidic conditions of an anaerobic sludgerdquoInternational Journal of Agriculture and Biology vol 15 no 2pp 347ndash351 2013

[29] S G Tringe and EM Rubin ldquoMetagenomics DNA sequencingof environmental samplesrdquo Nature Reviews Genetics vol 6 no11 pp 805ndash814 2005

[30] R D Bardgett and W H van der Putten ldquoBelowgroundbiodiversity and ecosystem functioningrdquo Nature vol 515 no7528 pp 505ndash511 2014

[31] N R Pace ldquoNew perspective on the natural microbial worldmolecularmicrobial ecologyrdquoASMNews vol 62 no 9 pp 463ndash470 1996

[32] J L Kirk L A Beaudette M Hart et al ldquoMethods of studyingsoil microbial diversityrdquo Journal ofMicrobiologicalMethods vol58 no 2 pp 169ndash188 2004

Archaea 9

[33] R I Amann W Ludwig and K-H Schleifer ldquoPhylogeneticidentification and in situ detection of individual microbial cellswithout cultivationrdquo Microbiological Reviews vol 59 no 1 pp143ndash169 1995

[34] M Keller and K Zengler ldquoTapping into microbial diversityrdquoNature Reviews Microbiology vol 2 no 2 pp 141ndash150 2004

[35] Y F Cheng S Y Mao J X Liu and W Y Zhu ldquoMoleculardiversity analysis of rumenmethanogenic Archaea from goat ineastern China by DGGEmethods using different primer pairsrdquoLetters in AppliedMicrobiology vol 48 no 5 pp 585ndash592 2009

[36] A-D G Wright and C Pimm ldquoImproved strategy for pre-sumptive identification ofmethanogens using 16S riboprintingrdquoJournal of Microbiological Methods vol 55 no 2 pp 337ndash3492003

[37] P Ghosh A Gupta and I S Thakur ldquoCombined chemicaland toxicological evaluation of leachate from municipal solidwaste landfill sites of Delhi Indiardquo Environmental Science andPollution Research vol 22 no 12 pp 9148ndash9158 2015

[38] S Roy and A Gupta ldquoWater quality assessment of river barakand tributaries in Assam Indiardquo Pollution Research vol 31 no3 pp 445ndash450 2012

[39] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990

[40] K Tamura G Stecher D Peterson A Filipski and S KumarldquoMEGA6molecular evolutionary genetics analysis version 60rdquoMolecular Biology and Evolution vol 30 no 12 pp 2725ndash27292013

[41] M Kimura ldquoA simple method for estimating evolutionary ratesof base substitutions through comparative studies of nucleotidesequencesrdquo Journal ofMolecular Evolution vol 16 no 2 pp 111ndash120 1980

[42] T Watanabe M Kimura and S Asakawa ldquoDiversity ofmethanogenic archaeal communities in Japanese paddy fieldecosystem estimated by denaturing gradient gel electrophore-sisrdquoBiology and Fertility of Soils vol 46 no 4 pp 343ndash353 2010

[43] G Borrel H M B Harris W Tottey et al ldquoGenomesequence of lsquoCandidatusMethanomethylophilus alvusrsquo Mx1201a methanogenic archaeon from the human gut belonging to aseventh order of methanogensrdquo Journal of Bacteriology vol 194no 24 pp 6944ndash6945 2012

[44] H Juottonen Archaea Bacteria and methane production alongenvironmental gradients in fens and bogs [PhD thesis] Univer-sity of Helsinki Helsinki Finland 2008

[45] G Borrel PW OrsquoToole HM B Harris P Peyret J-F Brugereand S Gribaldo ldquoPhylogenomic data support a seventh orderof methylotrophic methanogens and provide insights into theevolution of methanogenesisrdquo Genome Biology and Evolutionvol 5 no 10 pp 1769ndash1780 2013

[46] V Iverson R M Morris C D Frazar C T BerthiaumeR L Morales and E V Armbrust ldquoUntangling genomesfrom metagenomes revealing an uncultured class of marineeuryarchaeotardquo Science vol 335 no 6068 pp 587ndash590 2012

[47] K G Lloyd L Schreiber D G Petersen et al ldquoPredominantarchaea in marine sediments degrade detrital proteinsrdquoNaturevol 496 no 7444 pp 215ndash218 2013

[48] I Anderson R Wirth S Lucas et al ldquoComplete genomesequence of Staphylothermus hellenicusP8Trdquo Standards inGenomic Sciences vol 5 no 1 p 12 2011

[49] C Brochier-Armanet S Gribaldo and P Forterre ldquoSpotlight onthe thaumarchaeotardquo The ISME Journal vol 6 no 2 pp 227ndash230 2012

[50] P E Galand H Fritze R Conrad and K Yrjala ldquoPathwaysfor methanogenesis and diversity of methanogenic archaea inthree boreal peatland ecosystemsrdquo Applied and EnvironmentalMicrobiology vol 71 no 4 pp 2195ndash2198 2005

[51] M Ikenaga S Asakawa Y Muraoka and M KimuraldquoMethanogenic archaeal communities in rice roots grown inflooded soil pots estimation by PCR-DGGE and sequenceanalysesrdquo Soil Science and Plant Nutrition vol 50 no 5 pp 701ndash711 2004

[52] A Spang A Poehlein P Offre et al ldquoThe genome ofthe ammonia-oxidizing Candidatus nitrososphaera gargensisinsights into metabolic versatility and environmental adapta-tionsrdquoEnvironmentalMicrobiology vol 14 no 12 pp 3122ndash31452012

[53] P P Chaudhary L Brablcova I Buriankova and M RulıkldquoMolecular diversity and tools for deciphering the methanogencommunity structure and diversity in freshwater sedimentsrdquoAppliedMicrobiology and Biotechnology vol 97 no 17 pp 7553ndash7562 2013

[54] A V Piterina and J T Pembroke ldquoUse of PCR-DGGE basedmolecular methods to analyse microbial community diversityand stability during the thermophilic stages of an ATADwastewater sludge treatment process as an aid to performancemonitoringrdquo ISRN Biotechnology vol 2013 Article ID 16264513 pages 2013

[55] T Watanabe M Kimura and S Asakawa ldquoCommunity struc-ture of methanogenic archaea in paddy field soil under doublecropping (rice-wheat)rdquo Soil Biology and Biochemistry vol 38no 6 pp 1264ndash1274 2006

[56] T Watanabe M Kimura and S Asakawa ldquoDynamics ofmethanogenic archaeal communities based on rRNA analysisand their relation to methanogenic activity in Japanese paddyfield soilsrdquo Soil Biology and Biochemistry vol 39 no 11 pp2877ndash2887 2007

[57] L Brablcova I Buriankova P Badurova P P Chaudharyand M Rulık ldquoMethanogenic archaea diversity in hyporheicsediments of a small lowland streamrdquoAnaerobe vol 32 pp 24ndash31 2015

[58] V Mach M B Blaser P Claus P P Chaudhary and M RulAkldquoMethane production potentials pathways and communitiesof methanogens in vertical sediment profiles of river SitkardquoFrontiers in Microbiology vol 6 article 506 2015

[59] GMuyzer ldquoDGGETGGE amethod for identifying genes fromnatural ecosystemsrdquoCurrent Opinion inMicrobiology vol 2 no3 pp 317ndash322 1999

[60] G Muyzer E C De Waal and A G Uitterlinden ldquoProfilingof complex microbial populations by denaturing gradient gelelectrophoresis analysis of polymerase chain reaction-amplifiedgenes coding for 16S rRNArdquo Applied and Environmental Micro-biology vol 59 no 3 pp 695ndash700 1993

[61] S J Macnaughton J R Stephen A D Venosa G A DavisY-J Chang and D C White ldquoMicrobial population changesduring bioremediation of an experimental oil spillrdquoApplied andEnvironmental Microbiology vol 65 no 8 pp 3566ndash3574 1999

[62] Y Yu C Lee J Kim and S Hwang ldquoGroup-specific primer andprobe sets to detect methanogenic communities using quanti-tative real-time polymerase chain reactionrdquo Biotechnology andBioengineering vol 89 no 6 pp 670ndash679 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Archaea 7

Jacc

ard

10

08

06

04

02

00 Bada

rpur

Silc

oorie

Karim

ganj

Sonb

ill

Gha

zipu

r

Bhal

saw

a

Okh

la

Comp

Figure 3 Jaccard cluster diagram of DGGE bands obtained from landfill sites of Delhi and marshland of Southern Assam India

each in the cluster In the Karimganj rice paddy field sampleonly four bands were observed showing the least diversity

Microbial diversity within contaminated ecosystems likelandfill should be less diverse than those in natural systemslike a wetland because the diversity may be influenced by thecomplexity of toxic chemical mixtures heavy metals presentand duration of time the populations have been exposed Inthe present study after analyzing DGGE gel banding patternand the number of bands we found that the methanogenicdiversity present in both landfills (anthropogenic system) andmarshland (natural) is quite similar except for the samplesobtained from the Karimganj rice paddy field where onlyfour bands appeared The number of total bands observedin this study was in accordance with the number of DGGEbands reported previously [42 51 56 57] It strongly indicatesthat the methanogenic Archaea diversity in both landfill andmarshland is influenced by sampling location rather thantype

4 Conclusions

In the sequencing of themolecular marker for archaeal diver-sity 16S rDNA identified the orders named as Methanobac-teriales and Methanosarcinales in both landfill sites and thephylum Crenarchaeota (thermophilic) in marshland Quan-titative PCR indicated a higher abundance ofmethanogens inlandfill compared to that of marshland sites The knowledgeabout the composition and abundance of methanogenicArchaea in a landfill may provide information on thedecomposition mechanism of municipal solid waste and thesubsequent generation of methane This information canbe exploited for controlling methane emission from land-fill by mitigation process The increasing knowledge about

the genomic content of microbes belonging to the phylumThaumarchaeota (mesophilic) will enrich our understandingof their adaptative behavior in the transposition from ther-mophily to mesophily This indicates whether they follow asimilar or different evolutionary pattern with respect to thephylum Euryarchaeota

Abbreviations

MSW Municipal solid wasteGHGs Green House GasesDGGE Denaturing gradient gel electrophoresismM MillimolarMg MilligrammL MillilitreTg Teragram

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

Dr S S Maitra and Professor Sankar K Ghosh are grateful tothe Department of Biotechnology (DBT) of the Governmentof India for providing a Grant (BT14NETBP2010) Theauthors are extremely thankful to the referees for theirvaluable suggestions for improving the quality of the paperThe authors are indebted to Dr Santanu Raychaudhuri a UScitizen presently assigned as a Visiting Research Faculty atAssam University for correcting the paper

8 Archaea

References

[1] G Yvon-Durocher A P Allen D Bastviken et al ldquoMethanefluxes show consistent temperature dependence across micro-bial to ecosystem scalesrdquoNature vol 507 no 7493 pp 488ndash4912014

[2] S D Bridgham H Cadillo-Quiroz J K Keller and Q ZhuangldquoMethane emissions fromwetlands biogeochemical microbialand modeling perspectives from local to global scalesrdquo GlobalChange Biology vol 19 no 5 pp 1325ndash1346 2013

[3] J T Houghton Y Ding D J Griggs et al Climate Change2001 The Scientific Basis vol 881 Cambridge University PressCambridge Mass USA 2001

[4] S Solomon Climate Change 2007mdashThe Physical Science BasisWorkingGroup IContribution to the FourthAssessment Report ofthe IPCC vol 4 Cambridge University Press Cambridge UK2007

[5] R Angel P Claus and R Conrad ldquoMethanogenic archaea areglobally ubiquitous in aerated soils and become active underwet anoxic conditionsrdquoThe ISME Journal vol 6 no 4 pp 847ndash862 2012

[6] A R Daquiado K M Cho T Y Kim S C Kim H-H Changand Y B Lee ldquoMethanogenic archaea diversity in Hanwoo(Bos taurus coreanae) rumen fluid rectal dung and barn floormanure using a culture-independent method based on mcrAgene sequencesrdquo Anaerobe vol 27 pp 77ndash81 2014

[7] R S Oremland ldquoBiogeochemistry of methanogenic bacteriardquoin Biology of Anaerobic Microorganisms pp 641ndash705 JohnWiley amp Sons 1988

[8] S H Zinder ldquoPhysiological ecology of methanogensrdquo inMethanogenesis pp 128ndash206 Springer Berlin Germany 1993

[9] J-L Garcia B K C Patel and B Ollivier ldquoTaxonomic phy-logenetic and ecological diversity of methanogenic ArchaeardquoAnaerobe vol 6 no 4 pp 205ndash226 2000

[10] E Bapteste C Brochier and Y Boucher ldquoHigher-level clas-sification of the Archaea evolution of methanogenesis andmethanogensrdquo Archaea vol 1 no 5 pp 353ndash363 2005

[11] J N Reeve J Nolling R M Morgan and D R SmithldquoMethanogenesis genes genomes and whorsquos on firstrdquo Journalof Bacteriology vol 179 no 19 pp 5975ndash5986 1997

[12] R K Thauer A-K Kaster H Seedorf W Buckel and RHedderich ldquoMethanogenic archaea ecologically relevant dif-ferences in energy conservationrdquo Nature Reviews Microbiologyvol 6 no 8 pp 579ndash591 2008

[13] C C Mitigation IPCC Special Report on Renewable EnergySources and Climate Change Mitigation 2011

[14] D Mayumi J Dolfing S Sakata et al ldquoCarbon dioxideconcentration dictates alternativemethanogenic pathways in oilreservoirsrdquo Nature Communications vol 4 article 1998 2013

[15] S Gupta N Choudhary and B J Alappat ldquoBioreactor landfillfor MSW disposal in Delhirdquo in Proceedings of the InternationalConference on Sustainable Solid Waste Management ChennaiIndia September 2007

[16] M Rawat and A Ramanathan ldquoAssessment of methane fluxfrom municipal solid waste (MSW) landfill areas of DelhiIndiardquo Journal of Environmental Protection vol 2 no 4 pp399ndash407 2011

[17] V Talyan R P Dahiya S Anand and T R SreekrishnanldquoQuantification of methane emission from municipal solidwaste disposal in Delhirdquo Resources Conservation and Recyclingvol 50 no 3 pp 240ndash259 2007

[18] L B Hansen K Finster H Fossing and N Iversen ldquoAnaerobicmethane oxidation in sulfate depleted sediments effects ofsulfate and molybdate additionsrdquo Aquatic Microbial Ecologyvol 14 no 2 pp 195ndash204 1998

[19] A A Bloom P I Palmer A Fraser S R David and CFrankenberg ldquoLarge-scale controls of methanogenesis inferredfrom methane and gravity spaceborne datardquo Science vol 327no 5963 pp 322ndash325 2010

[20] V Singh and A Mittal ldquoToxicity analysis and public healthaspects of municipal landfill leachate a case study of OkhlaLandfill Delhirdquo in Proceedings of the 8th World Wide Workshopfor Young Environmental Scientists WWW-YES 2009 UrbanWaters Resource or Risks 2ndash5 June 2009 2011

[21] D Liu W Ding Z Jia and Z Cai ldquoThe impact of dissolvedorganic carbon on the spatial variability of methanogenicarchaea communities in natural wetland ecosystems acrossChinardquo Applied Microbiology and Biotechnology vol 96 no 1pp 253ndash263 2012

[22] B P Walter M Heimann R D Shannon and J R White ldquoAprocess-based model to derive methane emissions from naturalwetlandsrdquoGeophysical Research Letters vol 23 no 25 pp 3731ndash3734 1996

[23] L S Chasar J P Chanton P H Glaser and D I SiegelldquoMethane concentration and stable isotope distribution asevidence of rhizospheric processes Comparison of a fen andbog in the glacial Lake Agassiz Peatland complexrdquo Annals ofBotany vol 86 no 3 pp 655ndash663 2000

[24] G B Avery Jr R D Shannon J R White C S Martensand M J Alperin ldquoControls on methane production in a tidalfreshwater estuary and a peatland methane production viaacetate fermentation and CO

2reductionrdquo Biogeochemistry vol

62 no 1 pp 19ndash37 2003[25] L-N Huang Y-Q Chen H Zhou S Luo C-Y Lan and L-H

Qu ldquoCharacterization of methanogenic Archaea in the leachateof a closed municipal solid waste landfillrdquo FEMS MicrobiologyEcology vol 46 no 2 pp 171ndash177 2003

[26] W Laloui-Carpentier T Li V Vigneron L Mazeas and TBouchez ldquoMethanogenic diversity and activity in municipalsolid waste landfill leachatesrdquoAntonie van Leeuwenhoek vol 89no 3-4 pp 423ndash434 2006

[27] L M Steinberg and J M Regan ldquoPhylogenetic comparison ofthe methanogenic communities from an acidic oligotrophicfen and an anaerobic digester treating municipal wastewatersludgerdquoApplied and Environmental Microbiology vol 74 no 21pp 6663ndash6671 2008

[28] Q Ban J Li L Zhang Y Zhang and A K Jha ldquoPhylogeneticdiversity of methanogenic archaea and kinetics of methaneproduction at slightly acidic conditions of an anaerobic sludgerdquoInternational Journal of Agriculture and Biology vol 15 no 2pp 347ndash351 2013

[29] S G Tringe and EM Rubin ldquoMetagenomics DNA sequencingof environmental samplesrdquo Nature Reviews Genetics vol 6 no11 pp 805ndash814 2005

[30] R D Bardgett and W H van der Putten ldquoBelowgroundbiodiversity and ecosystem functioningrdquo Nature vol 515 no7528 pp 505ndash511 2014

[31] N R Pace ldquoNew perspective on the natural microbial worldmolecularmicrobial ecologyrdquoASMNews vol 62 no 9 pp 463ndash470 1996

[32] J L Kirk L A Beaudette M Hart et al ldquoMethods of studyingsoil microbial diversityrdquo Journal ofMicrobiologicalMethods vol58 no 2 pp 169ndash188 2004

Archaea 9

[33] R I Amann W Ludwig and K-H Schleifer ldquoPhylogeneticidentification and in situ detection of individual microbial cellswithout cultivationrdquo Microbiological Reviews vol 59 no 1 pp143ndash169 1995

[34] M Keller and K Zengler ldquoTapping into microbial diversityrdquoNature Reviews Microbiology vol 2 no 2 pp 141ndash150 2004

[35] Y F Cheng S Y Mao J X Liu and W Y Zhu ldquoMoleculardiversity analysis of rumenmethanogenic Archaea from goat ineastern China by DGGEmethods using different primer pairsrdquoLetters in AppliedMicrobiology vol 48 no 5 pp 585ndash592 2009

[36] A-D G Wright and C Pimm ldquoImproved strategy for pre-sumptive identification ofmethanogens using 16S riboprintingrdquoJournal of Microbiological Methods vol 55 no 2 pp 337ndash3492003

[37] P Ghosh A Gupta and I S Thakur ldquoCombined chemicaland toxicological evaluation of leachate from municipal solidwaste landfill sites of Delhi Indiardquo Environmental Science andPollution Research vol 22 no 12 pp 9148ndash9158 2015

[38] S Roy and A Gupta ldquoWater quality assessment of river barakand tributaries in Assam Indiardquo Pollution Research vol 31 no3 pp 445ndash450 2012

[39] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990

[40] K Tamura G Stecher D Peterson A Filipski and S KumarldquoMEGA6molecular evolutionary genetics analysis version 60rdquoMolecular Biology and Evolution vol 30 no 12 pp 2725ndash27292013

[41] M Kimura ldquoA simple method for estimating evolutionary ratesof base substitutions through comparative studies of nucleotidesequencesrdquo Journal ofMolecular Evolution vol 16 no 2 pp 111ndash120 1980

[42] T Watanabe M Kimura and S Asakawa ldquoDiversity ofmethanogenic archaeal communities in Japanese paddy fieldecosystem estimated by denaturing gradient gel electrophore-sisrdquoBiology and Fertility of Soils vol 46 no 4 pp 343ndash353 2010

[43] G Borrel H M B Harris W Tottey et al ldquoGenomesequence of lsquoCandidatusMethanomethylophilus alvusrsquo Mx1201a methanogenic archaeon from the human gut belonging to aseventh order of methanogensrdquo Journal of Bacteriology vol 194no 24 pp 6944ndash6945 2012

[44] H Juottonen Archaea Bacteria and methane production alongenvironmental gradients in fens and bogs [PhD thesis] Univer-sity of Helsinki Helsinki Finland 2008

[45] G Borrel PW OrsquoToole HM B Harris P Peyret J-F Brugereand S Gribaldo ldquoPhylogenomic data support a seventh orderof methylotrophic methanogens and provide insights into theevolution of methanogenesisrdquo Genome Biology and Evolutionvol 5 no 10 pp 1769ndash1780 2013

[46] V Iverson R M Morris C D Frazar C T BerthiaumeR L Morales and E V Armbrust ldquoUntangling genomesfrom metagenomes revealing an uncultured class of marineeuryarchaeotardquo Science vol 335 no 6068 pp 587ndash590 2012

[47] K G Lloyd L Schreiber D G Petersen et al ldquoPredominantarchaea in marine sediments degrade detrital proteinsrdquoNaturevol 496 no 7444 pp 215ndash218 2013

[48] I Anderson R Wirth S Lucas et al ldquoComplete genomesequence of Staphylothermus hellenicusP8Trdquo Standards inGenomic Sciences vol 5 no 1 p 12 2011

[49] C Brochier-Armanet S Gribaldo and P Forterre ldquoSpotlight onthe thaumarchaeotardquo The ISME Journal vol 6 no 2 pp 227ndash230 2012

[50] P E Galand H Fritze R Conrad and K Yrjala ldquoPathwaysfor methanogenesis and diversity of methanogenic archaea inthree boreal peatland ecosystemsrdquo Applied and EnvironmentalMicrobiology vol 71 no 4 pp 2195ndash2198 2005

[51] M Ikenaga S Asakawa Y Muraoka and M KimuraldquoMethanogenic archaeal communities in rice roots grown inflooded soil pots estimation by PCR-DGGE and sequenceanalysesrdquo Soil Science and Plant Nutrition vol 50 no 5 pp 701ndash711 2004

[52] A Spang A Poehlein P Offre et al ldquoThe genome ofthe ammonia-oxidizing Candidatus nitrososphaera gargensisinsights into metabolic versatility and environmental adapta-tionsrdquoEnvironmentalMicrobiology vol 14 no 12 pp 3122ndash31452012

[53] P P Chaudhary L Brablcova I Buriankova and M RulıkldquoMolecular diversity and tools for deciphering the methanogencommunity structure and diversity in freshwater sedimentsrdquoAppliedMicrobiology and Biotechnology vol 97 no 17 pp 7553ndash7562 2013

[54] A V Piterina and J T Pembroke ldquoUse of PCR-DGGE basedmolecular methods to analyse microbial community diversityand stability during the thermophilic stages of an ATADwastewater sludge treatment process as an aid to performancemonitoringrdquo ISRN Biotechnology vol 2013 Article ID 16264513 pages 2013

[55] T Watanabe M Kimura and S Asakawa ldquoCommunity struc-ture of methanogenic archaea in paddy field soil under doublecropping (rice-wheat)rdquo Soil Biology and Biochemistry vol 38no 6 pp 1264ndash1274 2006

[56] T Watanabe M Kimura and S Asakawa ldquoDynamics ofmethanogenic archaeal communities based on rRNA analysisand their relation to methanogenic activity in Japanese paddyfield soilsrdquo Soil Biology and Biochemistry vol 39 no 11 pp2877ndash2887 2007

[57] L Brablcova I Buriankova P Badurova P P Chaudharyand M Rulık ldquoMethanogenic archaea diversity in hyporheicsediments of a small lowland streamrdquoAnaerobe vol 32 pp 24ndash31 2015

[58] V Mach M B Blaser P Claus P P Chaudhary and M RulAkldquoMethane production potentials pathways and communitiesof methanogens in vertical sediment profiles of river SitkardquoFrontiers in Microbiology vol 6 article 506 2015

[59] GMuyzer ldquoDGGETGGE amethod for identifying genes fromnatural ecosystemsrdquoCurrent Opinion inMicrobiology vol 2 no3 pp 317ndash322 1999

[60] G Muyzer E C De Waal and A G Uitterlinden ldquoProfilingof complex microbial populations by denaturing gradient gelelectrophoresis analysis of polymerase chain reaction-amplifiedgenes coding for 16S rRNArdquo Applied and Environmental Micro-biology vol 59 no 3 pp 695ndash700 1993

[61] S J Macnaughton J R Stephen A D Venosa G A DavisY-J Chang and D C White ldquoMicrobial population changesduring bioremediation of an experimental oil spillrdquoApplied andEnvironmental Microbiology vol 65 no 8 pp 3566ndash3574 1999

[62] Y Yu C Lee J Kim and S Hwang ldquoGroup-specific primer andprobe sets to detect methanogenic communities using quanti-tative real-time polymerase chain reactionrdquo Biotechnology andBioengineering vol 89 no 6 pp 670ndash679 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

8 Archaea

References

[1] G Yvon-Durocher A P Allen D Bastviken et al ldquoMethanefluxes show consistent temperature dependence across micro-bial to ecosystem scalesrdquoNature vol 507 no 7493 pp 488ndash4912014

[2] S D Bridgham H Cadillo-Quiroz J K Keller and Q ZhuangldquoMethane emissions fromwetlands biogeochemical microbialand modeling perspectives from local to global scalesrdquo GlobalChange Biology vol 19 no 5 pp 1325ndash1346 2013

[3] J T Houghton Y Ding D J Griggs et al Climate Change2001 The Scientific Basis vol 881 Cambridge University PressCambridge Mass USA 2001

[4] S Solomon Climate Change 2007mdashThe Physical Science BasisWorkingGroup IContribution to the FourthAssessment Report ofthe IPCC vol 4 Cambridge University Press Cambridge UK2007

[5] R Angel P Claus and R Conrad ldquoMethanogenic archaea areglobally ubiquitous in aerated soils and become active underwet anoxic conditionsrdquoThe ISME Journal vol 6 no 4 pp 847ndash862 2012

[6] A R Daquiado K M Cho T Y Kim S C Kim H-H Changand Y B Lee ldquoMethanogenic archaea diversity in Hanwoo(Bos taurus coreanae) rumen fluid rectal dung and barn floormanure using a culture-independent method based on mcrAgene sequencesrdquo Anaerobe vol 27 pp 77ndash81 2014

[7] R S Oremland ldquoBiogeochemistry of methanogenic bacteriardquoin Biology of Anaerobic Microorganisms pp 641ndash705 JohnWiley amp Sons 1988

[8] S H Zinder ldquoPhysiological ecology of methanogensrdquo inMethanogenesis pp 128ndash206 Springer Berlin Germany 1993

[9] J-L Garcia B K C Patel and B Ollivier ldquoTaxonomic phy-logenetic and ecological diversity of methanogenic ArchaeardquoAnaerobe vol 6 no 4 pp 205ndash226 2000

[10] E Bapteste C Brochier and Y Boucher ldquoHigher-level clas-sification of the Archaea evolution of methanogenesis andmethanogensrdquo Archaea vol 1 no 5 pp 353ndash363 2005

[11] J N Reeve J Nolling R M Morgan and D R SmithldquoMethanogenesis genes genomes and whorsquos on firstrdquo Journalof Bacteriology vol 179 no 19 pp 5975ndash5986 1997

[12] R K Thauer A-K Kaster H Seedorf W Buckel and RHedderich ldquoMethanogenic archaea ecologically relevant dif-ferences in energy conservationrdquo Nature Reviews Microbiologyvol 6 no 8 pp 579ndash591 2008

[13] C C Mitigation IPCC Special Report on Renewable EnergySources and Climate Change Mitigation 2011

[14] D Mayumi J Dolfing S Sakata et al ldquoCarbon dioxideconcentration dictates alternativemethanogenic pathways in oilreservoirsrdquo Nature Communications vol 4 article 1998 2013

[15] S Gupta N Choudhary and B J Alappat ldquoBioreactor landfillfor MSW disposal in Delhirdquo in Proceedings of the InternationalConference on Sustainable Solid Waste Management ChennaiIndia September 2007

[16] M Rawat and A Ramanathan ldquoAssessment of methane fluxfrom municipal solid waste (MSW) landfill areas of DelhiIndiardquo Journal of Environmental Protection vol 2 no 4 pp399ndash407 2011

[17] V Talyan R P Dahiya S Anand and T R SreekrishnanldquoQuantification of methane emission from municipal solidwaste disposal in Delhirdquo Resources Conservation and Recyclingvol 50 no 3 pp 240ndash259 2007

[18] L B Hansen K Finster H Fossing and N Iversen ldquoAnaerobicmethane oxidation in sulfate depleted sediments effects ofsulfate and molybdate additionsrdquo Aquatic Microbial Ecologyvol 14 no 2 pp 195ndash204 1998

[19] A A Bloom P I Palmer A Fraser S R David and CFrankenberg ldquoLarge-scale controls of methanogenesis inferredfrom methane and gravity spaceborne datardquo Science vol 327no 5963 pp 322ndash325 2010

[20] V Singh and A Mittal ldquoToxicity analysis and public healthaspects of municipal landfill leachate a case study of OkhlaLandfill Delhirdquo in Proceedings of the 8th World Wide Workshopfor Young Environmental Scientists WWW-YES 2009 UrbanWaters Resource or Risks 2ndash5 June 2009 2011

[21] D Liu W Ding Z Jia and Z Cai ldquoThe impact of dissolvedorganic carbon on the spatial variability of methanogenicarchaea communities in natural wetland ecosystems acrossChinardquo Applied Microbiology and Biotechnology vol 96 no 1pp 253ndash263 2012

[22] B P Walter M Heimann R D Shannon and J R White ldquoAprocess-based model to derive methane emissions from naturalwetlandsrdquoGeophysical Research Letters vol 23 no 25 pp 3731ndash3734 1996

[23] L S Chasar J P Chanton P H Glaser and D I SiegelldquoMethane concentration and stable isotope distribution asevidence of rhizospheric processes Comparison of a fen andbog in the glacial Lake Agassiz Peatland complexrdquo Annals ofBotany vol 86 no 3 pp 655ndash663 2000

[24] G B Avery Jr R D Shannon J R White C S Martensand M J Alperin ldquoControls on methane production in a tidalfreshwater estuary and a peatland methane production viaacetate fermentation and CO

2reductionrdquo Biogeochemistry vol

62 no 1 pp 19ndash37 2003[25] L-N Huang Y-Q Chen H Zhou S Luo C-Y Lan and L-H

Qu ldquoCharacterization of methanogenic Archaea in the leachateof a closed municipal solid waste landfillrdquo FEMS MicrobiologyEcology vol 46 no 2 pp 171ndash177 2003

[26] W Laloui-Carpentier T Li V Vigneron L Mazeas and TBouchez ldquoMethanogenic diversity and activity in municipalsolid waste landfill leachatesrdquoAntonie van Leeuwenhoek vol 89no 3-4 pp 423ndash434 2006

[27] L M Steinberg and J M Regan ldquoPhylogenetic comparison ofthe methanogenic communities from an acidic oligotrophicfen and an anaerobic digester treating municipal wastewatersludgerdquoApplied and Environmental Microbiology vol 74 no 21pp 6663ndash6671 2008

[28] Q Ban J Li L Zhang Y Zhang and A K Jha ldquoPhylogeneticdiversity of methanogenic archaea and kinetics of methaneproduction at slightly acidic conditions of an anaerobic sludgerdquoInternational Journal of Agriculture and Biology vol 15 no 2pp 347ndash351 2013

[29] S G Tringe and EM Rubin ldquoMetagenomics DNA sequencingof environmental samplesrdquo Nature Reviews Genetics vol 6 no11 pp 805ndash814 2005

[30] R D Bardgett and W H van der Putten ldquoBelowgroundbiodiversity and ecosystem functioningrdquo Nature vol 515 no7528 pp 505ndash511 2014

[31] N R Pace ldquoNew perspective on the natural microbial worldmolecularmicrobial ecologyrdquoASMNews vol 62 no 9 pp 463ndash470 1996

[32] J L Kirk L A Beaudette M Hart et al ldquoMethods of studyingsoil microbial diversityrdquo Journal ofMicrobiologicalMethods vol58 no 2 pp 169ndash188 2004

Archaea 9

[33] R I Amann W Ludwig and K-H Schleifer ldquoPhylogeneticidentification and in situ detection of individual microbial cellswithout cultivationrdquo Microbiological Reviews vol 59 no 1 pp143ndash169 1995

[34] M Keller and K Zengler ldquoTapping into microbial diversityrdquoNature Reviews Microbiology vol 2 no 2 pp 141ndash150 2004

[35] Y F Cheng S Y Mao J X Liu and W Y Zhu ldquoMoleculardiversity analysis of rumenmethanogenic Archaea from goat ineastern China by DGGEmethods using different primer pairsrdquoLetters in AppliedMicrobiology vol 48 no 5 pp 585ndash592 2009

[36] A-D G Wright and C Pimm ldquoImproved strategy for pre-sumptive identification ofmethanogens using 16S riboprintingrdquoJournal of Microbiological Methods vol 55 no 2 pp 337ndash3492003

[37] P Ghosh A Gupta and I S Thakur ldquoCombined chemicaland toxicological evaluation of leachate from municipal solidwaste landfill sites of Delhi Indiardquo Environmental Science andPollution Research vol 22 no 12 pp 9148ndash9158 2015

[38] S Roy and A Gupta ldquoWater quality assessment of river barakand tributaries in Assam Indiardquo Pollution Research vol 31 no3 pp 445ndash450 2012

[39] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990

[40] K Tamura G Stecher D Peterson A Filipski and S KumarldquoMEGA6molecular evolutionary genetics analysis version 60rdquoMolecular Biology and Evolution vol 30 no 12 pp 2725ndash27292013

[41] M Kimura ldquoA simple method for estimating evolutionary ratesof base substitutions through comparative studies of nucleotidesequencesrdquo Journal ofMolecular Evolution vol 16 no 2 pp 111ndash120 1980

[42] T Watanabe M Kimura and S Asakawa ldquoDiversity ofmethanogenic archaeal communities in Japanese paddy fieldecosystem estimated by denaturing gradient gel electrophore-sisrdquoBiology and Fertility of Soils vol 46 no 4 pp 343ndash353 2010

[43] G Borrel H M B Harris W Tottey et al ldquoGenomesequence of lsquoCandidatusMethanomethylophilus alvusrsquo Mx1201a methanogenic archaeon from the human gut belonging to aseventh order of methanogensrdquo Journal of Bacteriology vol 194no 24 pp 6944ndash6945 2012

[44] H Juottonen Archaea Bacteria and methane production alongenvironmental gradients in fens and bogs [PhD thesis] Univer-sity of Helsinki Helsinki Finland 2008

[45] G Borrel PW OrsquoToole HM B Harris P Peyret J-F Brugereand S Gribaldo ldquoPhylogenomic data support a seventh orderof methylotrophic methanogens and provide insights into theevolution of methanogenesisrdquo Genome Biology and Evolutionvol 5 no 10 pp 1769ndash1780 2013

[46] V Iverson R M Morris C D Frazar C T BerthiaumeR L Morales and E V Armbrust ldquoUntangling genomesfrom metagenomes revealing an uncultured class of marineeuryarchaeotardquo Science vol 335 no 6068 pp 587ndash590 2012

[47] K G Lloyd L Schreiber D G Petersen et al ldquoPredominantarchaea in marine sediments degrade detrital proteinsrdquoNaturevol 496 no 7444 pp 215ndash218 2013

[48] I Anderson R Wirth S Lucas et al ldquoComplete genomesequence of Staphylothermus hellenicusP8Trdquo Standards inGenomic Sciences vol 5 no 1 p 12 2011

[49] C Brochier-Armanet S Gribaldo and P Forterre ldquoSpotlight onthe thaumarchaeotardquo The ISME Journal vol 6 no 2 pp 227ndash230 2012

[50] P E Galand H Fritze R Conrad and K Yrjala ldquoPathwaysfor methanogenesis and diversity of methanogenic archaea inthree boreal peatland ecosystemsrdquo Applied and EnvironmentalMicrobiology vol 71 no 4 pp 2195ndash2198 2005

[51] M Ikenaga S Asakawa Y Muraoka and M KimuraldquoMethanogenic archaeal communities in rice roots grown inflooded soil pots estimation by PCR-DGGE and sequenceanalysesrdquo Soil Science and Plant Nutrition vol 50 no 5 pp 701ndash711 2004

[52] A Spang A Poehlein P Offre et al ldquoThe genome ofthe ammonia-oxidizing Candidatus nitrososphaera gargensisinsights into metabolic versatility and environmental adapta-tionsrdquoEnvironmentalMicrobiology vol 14 no 12 pp 3122ndash31452012

[53] P P Chaudhary L Brablcova I Buriankova and M RulıkldquoMolecular diversity and tools for deciphering the methanogencommunity structure and diversity in freshwater sedimentsrdquoAppliedMicrobiology and Biotechnology vol 97 no 17 pp 7553ndash7562 2013

[54] A V Piterina and J T Pembroke ldquoUse of PCR-DGGE basedmolecular methods to analyse microbial community diversityand stability during the thermophilic stages of an ATADwastewater sludge treatment process as an aid to performancemonitoringrdquo ISRN Biotechnology vol 2013 Article ID 16264513 pages 2013

[55] T Watanabe M Kimura and S Asakawa ldquoCommunity struc-ture of methanogenic archaea in paddy field soil under doublecropping (rice-wheat)rdquo Soil Biology and Biochemistry vol 38no 6 pp 1264ndash1274 2006

[56] T Watanabe M Kimura and S Asakawa ldquoDynamics ofmethanogenic archaeal communities based on rRNA analysisand their relation to methanogenic activity in Japanese paddyfield soilsrdquo Soil Biology and Biochemistry vol 39 no 11 pp2877ndash2887 2007

[57] L Brablcova I Buriankova P Badurova P P Chaudharyand M Rulık ldquoMethanogenic archaea diversity in hyporheicsediments of a small lowland streamrdquoAnaerobe vol 32 pp 24ndash31 2015

[58] V Mach M B Blaser P Claus P P Chaudhary and M RulAkldquoMethane production potentials pathways and communitiesof methanogens in vertical sediment profiles of river SitkardquoFrontiers in Microbiology vol 6 article 506 2015

[59] GMuyzer ldquoDGGETGGE amethod for identifying genes fromnatural ecosystemsrdquoCurrent Opinion inMicrobiology vol 2 no3 pp 317ndash322 1999

[60] G Muyzer E C De Waal and A G Uitterlinden ldquoProfilingof complex microbial populations by denaturing gradient gelelectrophoresis analysis of polymerase chain reaction-amplifiedgenes coding for 16S rRNArdquo Applied and Environmental Micro-biology vol 59 no 3 pp 695ndash700 1993

[61] S J Macnaughton J R Stephen A D Venosa G A DavisY-J Chang and D C White ldquoMicrobial population changesduring bioremediation of an experimental oil spillrdquoApplied andEnvironmental Microbiology vol 65 no 8 pp 3566ndash3574 1999

[62] Y Yu C Lee J Kim and S Hwang ldquoGroup-specific primer andprobe sets to detect methanogenic communities using quanti-tative real-time polymerase chain reactionrdquo Biotechnology andBioengineering vol 89 no 6 pp 670ndash679 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Archaea 9

[33] R I Amann W Ludwig and K-H Schleifer ldquoPhylogeneticidentification and in situ detection of individual microbial cellswithout cultivationrdquo Microbiological Reviews vol 59 no 1 pp143ndash169 1995

[34] M Keller and K Zengler ldquoTapping into microbial diversityrdquoNature Reviews Microbiology vol 2 no 2 pp 141ndash150 2004

[35] Y F Cheng S Y Mao J X Liu and W Y Zhu ldquoMoleculardiversity analysis of rumenmethanogenic Archaea from goat ineastern China by DGGEmethods using different primer pairsrdquoLetters in AppliedMicrobiology vol 48 no 5 pp 585ndash592 2009

[36] A-D G Wright and C Pimm ldquoImproved strategy for pre-sumptive identification ofmethanogens using 16S riboprintingrdquoJournal of Microbiological Methods vol 55 no 2 pp 337ndash3492003

[37] P Ghosh A Gupta and I S Thakur ldquoCombined chemicaland toxicological evaluation of leachate from municipal solidwaste landfill sites of Delhi Indiardquo Environmental Science andPollution Research vol 22 no 12 pp 9148ndash9158 2015

[38] S Roy and A Gupta ldquoWater quality assessment of river barakand tributaries in Assam Indiardquo Pollution Research vol 31 no3 pp 445ndash450 2012

[39] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990

[40] K Tamura G Stecher D Peterson A Filipski and S KumarldquoMEGA6molecular evolutionary genetics analysis version 60rdquoMolecular Biology and Evolution vol 30 no 12 pp 2725ndash27292013

[41] M Kimura ldquoA simple method for estimating evolutionary ratesof base substitutions through comparative studies of nucleotidesequencesrdquo Journal ofMolecular Evolution vol 16 no 2 pp 111ndash120 1980

[42] T Watanabe M Kimura and S Asakawa ldquoDiversity ofmethanogenic archaeal communities in Japanese paddy fieldecosystem estimated by denaturing gradient gel electrophore-sisrdquoBiology and Fertility of Soils vol 46 no 4 pp 343ndash353 2010

[43] G Borrel H M B Harris W Tottey et al ldquoGenomesequence of lsquoCandidatusMethanomethylophilus alvusrsquo Mx1201a methanogenic archaeon from the human gut belonging to aseventh order of methanogensrdquo Journal of Bacteriology vol 194no 24 pp 6944ndash6945 2012

[44] H Juottonen Archaea Bacteria and methane production alongenvironmental gradients in fens and bogs [PhD thesis] Univer-sity of Helsinki Helsinki Finland 2008

[45] G Borrel PW OrsquoToole HM B Harris P Peyret J-F Brugereand S Gribaldo ldquoPhylogenomic data support a seventh orderof methylotrophic methanogens and provide insights into theevolution of methanogenesisrdquo Genome Biology and Evolutionvol 5 no 10 pp 1769ndash1780 2013

[46] V Iverson R M Morris C D Frazar C T BerthiaumeR L Morales and E V Armbrust ldquoUntangling genomesfrom metagenomes revealing an uncultured class of marineeuryarchaeotardquo Science vol 335 no 6068 pp 587ndash590 2012

[47] K G Lloyd L Schreiber D G Petersen et al ldquoPredominantarchaea in marine sediments degrade detrital proteinsrdquoNaturevol 496 no 7444 pp 215ndash218 2013

[48] I Anderson R Wirth S Lucas et al ldquoComplete genomesequence of Staphylothermus hellenicusP8Trdquo Standards inGenomic Sciences vol 5 no 1 p 12 2011

[49] C Brochier-Armanet S Gribaldo and P Forterre ldquoSpotlight onthe thaumarchaeotardquo The ISME Journal vol 6 no 2 pp 227ndash230 2012

[50] P E Galand H Fritze R Conrad and K Yrjala ldquoPathwaysfor methanogenesis and diversity of methanogenic archaea inthree boreal peatland ecosystemsrdquo Applied and EnvironmentalMicrobiology vol 71 no 4 pp 2195ndash2198 2005

[51] M Ikenaga S Asakawa Y Muraoka and M KimuraldquoMethanogenic archaeal communities in rice roots grown inflooded soil pots estimation by PCR-DGGE and sequenceanalysesrdquo Soil Science and Plant Nutrition vol 50 no 5 pp 701ndash711 2004

[52] A Spang A Poehlein P Offre et al ldquoThe genome ofthe ammonia-oxidizing Candidatus nitrososphaera gargensisinsights into metabolic versatility and environmental adapta-tionsrdquoEnvironmentalMicrobiology vol 14 no 12 pp 3122ndash31452012

[53] P P Chaudhary L Brablcova I Buriankova and M RulıkldquoMolecular diversity and tools for deciphering the methanogencommunity structure and diversity in freshwater sedimentsrdquoAppliedMicrobiology and Biotechnology vol 97 no 17 pp 7553ndash7562 2013

[54] A V Piterina and J T Pembroke ldquoUse of PCR-DGGE basedmolecular methods to analyse microbial community diversityand stability during the thermophilic stages of an ATADwastewater sludge treatment process as an aid to performancemonitoringrdquo ISRN Biotechnology vol 2013 Article ID 16264513 pages 2013

[55] T Watanabe M Kimura and S Asakawa ldquoCommunity struc-ture of methanogenic archaea in paddy field soil under doublecropping (rice-wheat)rdquo Soil Biology and Biochemistry vol 38no 6 pp 1264ndash1274 2006

[56] T Watanabe M Kimura and S Asakawa ldquoDynamics ofmethanogenic archaeal communities based on rRNA analysisand their relation to methanogenic activity in Japanese paddyfield soilsrdquo Soil Biology and Biochemistry vol 39 no 11 pp2877ndash2887 2007

[57] L Brablcova I Buriankova P Badurova P P Chaudharyand M Rulık ldquoMethanogenic archaea diversity in hyporheicsediments of a small lowland streamrdquoAnaerobe vol 32 pp 24ndash31 2015

[58] V Mach M B Blaser P Claus P P Chaudhary and M RulAkldquoMethane production potentials pathways and communitiesof methanogens in vertical sediment profiles of river SitkardquoFrontiers in Microbiology vol 6 article 506 2015

[59] GMuyzer ldquoDGGETGGE amethod for identifying genes fromnatural ecosystemsrdquoCurrent Opinion inMicrobiology vol 2 no3 pp 317ndash322 1999

[60] G Muyzer E C De Waal and A G Uitterlinden ldquoProfilingof complex microbial populations by denaturing gradient gelelectrophoresis analysis of polymerase chain reaction-amplifiedgenes coding for 16S rRNArdquo Applied and Environmental Micro-biology vol 59 no 3 pp 695ndash700 1993

[61] S J Macnaughton J R Stephen A D Venosa G A DavisY-J Chang and D C White ldquoMicrobial population changesduring bioremediation of an experimental oil spillrdquoApplied andEnvironmental Microbiology vol 65 no 8 pp 3566ndash3574 1999

[62] Y Yu C Lee J Kim and S Hwang ldquoGroup-specific primer andprobe sets to detect methanogenic communities using quanti-tative real-time polymerase chain reactionrdquo Biotechnology andBioengineering vol 89 no 6 pp 670ndash679 2005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology