miR-193a-3p is a Key Tumor Suppressor in Ulcerative ...dysplasia, and outcome, few studies have mechanistically examined the pathogenesis of neoplasia in IBD using human samples. In

Biology of Human Tumors

miR-193a-3p is a Key Tumor Suppressor inUlcerative Colitis–Associated Colon Cancer andPromotes Carcinogenesis through Upregulationof IL17RDJoel Pekow1, Katherine Meckel1, Urszula Dougherty1, Yong Huang1, Xindi Chen1,Anas Almoghrabi1, Reba Mustafi1, Fatma Ayaloglu-Butun1, Zifeng Deng1,Haider I. Haider1, John Hart2, David T. Rubin1, John H. Kwon3, and Marc Bissonnette1

Abstract

Purpose: Patients with ulcerative colitis are at increased riskfor colorectal cancer, although mechanisms underlying neo-plastic transformation are poorly understood. We sought toevaluate the role of microRNAs in neoplasia development inthis high-risk population.

Experimental Design: Tissue from 12 controls, 9 ulcerativecolitis patients without neoplasia, and 11 ulcerative colitis patientswith neoplasia was analyzed. miRNA array analysis was performedand selectmiRNAs assayedby real-timePCRon thediscovery cohortand a validation cohort. DNAmethylation of miR-193a was assess-ed. Following transfection of miR-193a-3p, proliferation, IL17RDexpression, and luciferase activity of the 30UTR of IL17RD weremeasured. Tumor growth in xenografts as well as EGFR signalingwere assessed in HCT116 cells expressing IL17RD with either amutant 30 untranslated region (UTR) or wild-type (WT) 30UTR.

Results:miR-31, miR-34a, miR-106b, and miR-193a-3p weresignificantly dysregulated in ulcerative colitis-neoplasia and

adjacent tissue. Significant down-regulation of miR-193a-3pwas also seen in an independent cohort of ulcerative colitiscancers. Changes in methylation of miR-193a or expression ofpri-miR-193a were not observed in ulcerative colitis cancer.Transfection of miR-193a-3p resulted in decreased prolifera-tion, and identified IL17RD as a direct target of miR-193a-3p.IL17RD expression was increased in ulcerative colitis cancers,and miR-193a-3p treatment decreased growth and EGFR sig-naling of HCT116 cells in xenografts expressing both IL17RDwith WT 30UTR compared with cells expressing IL17RD withmutant 30UTR.

Conclusions: miR-193a-3p is downregulated in ulcerativecolitis neoplasia, and its loss promotes carcinogenesis throughupregulation of IL17RD. Thesefindings provide novel insight intoinflammation-driven colorectal cancer and could suggest newtherapeutic targets in this high-risk population. Clin Cancer Res;23(17); 5281–91. �2017 AACR.

IntroductionPatients with long-standing ulcerative colitis are at increased

risk for colorectal cancer (1, 2). Although many mechanisms ofcarcinogenesis in IBD remain unknown, neoplastic lesions likelyresult from a combination of genetic alterations, inflammatorymediators, and activation of cell signaling pathways. Discovery ofnovel genomic mediators of these pathways could greatly facil-itate risk stratification as well as treatment and chemopreventionstrategies.

Gene expression is regulated in part by a class of non-codingRNAs, termed microRNAs (miRNA). These small RNAs regulategene expression by binding to the 30 untranslated region (UTR) ofmessenger RNA (mRNA) and either inhibit protein translation ordestabilize target mRNA (3). Changes in miRNA expression havebeen implicated in the pathogenesis of many cancer types,including colon cancer (4–7). miRNAs control the expression ofsignaling molecules and play important roles in cell growth (8).As such, growth promoting or cell death inhibiting miRNAs, ifupregulated, could act as gain-of-function oncogenes, whereasgrowth suppressing or cell death enhancing mRNAs, if down-regulated, could act as loss-of-function tumor suppressors (9).

Prior studies, including analyses from our group, indicate thatthemiRNAprofile changes in chronic ulcerative colitis–associatedinflammation (10–13). Several small studies have also demon-strated dysregulation of multiple miRNAs, including miR-31,miR-21, and miR-224, in IBD-associated neoplastic tissue(14–17). However, alterations in miRNA expression have notbeen examined globally in a large subset of patients withadvanced ulcerative colitis–associated neoplasia, nor havemiRNA changes been described in non-dysplastic tissue adjacentto a neoplastic lesion. In addition, there has been limited eval-uation of the functional role of miRNAs dysregulated in

1University of Chicago, Section of Gastroenterology, Hepatology, and Nutrition,Chicago, Illinois. 2University of Chicago, Department of Pathology, Chicago,Illinois. 3University of Texas Southwestern, Digestive and Liver Disease Division,Dallas, Texas.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

CorrespondingAuthor: Joel Pekow, University of Chicago, KCBD, 900East 57thStreet, MB #9, Chicago, IL 60637. Phone: 773-702-7895; Fax: 773-702-2180;E-mail: [email protected]

doi: 10.1158/1078-0432.CCR-17-0171

�2017 American Association for Cancer Research.

ClinicalCancerResearch

www.aacrjournals.org 5281

on March 5, 2021. © 2017 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst June 9, 2017; DOI: 10.1158/1078-0432.CCR-17-0171

http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-17-0171&domain=pdf&date_stamp=2017-8-9

http://clincancerres.aacrjournals.org/

inflammatory bowel disease (IBD)-carcinogenesis. In this study,we describe miRNA changes occurring in both IBD-neoplasia aswell as adjacent non-dysplastic tissue and investigate the func-tional role of the tumor suppressor, miR-193a-3p, and a putativetargetwhichpotentiates EGFR signaling, interleukin17 receptorD(IL17RD), in ulcerative colitis–associated cancer.

Materials and MethodsTissueDiscovery cohort. The study was approved by the institutionalreview board at the University of Chicago (IRB# 11-0411 and 10-209A). Archived formalin-fixed paraffin-embedded tissues(FFPET) were obtained from normal controls and patients withulcerative colitis who underwent a colectomy. Three groups ofpatients were examined: Normal controls (N, n ¼ 12), ulcerativecolitis patients without neoplasia (ulcerative colitis, n ¼ 9), andulcerative colitis patients with neoplasia (n ¼ 11). From theulcerative colitis patients with neoplasia, two separate tissueswere analyzed, ulcerative colitis–associated neoplastic tissue(UCN, n ¼ 10; high-grade dysplasia [HGD]-4, colorectal cancer[CRC]-6), and nondysplastic ulcerative colitis tissue adjacent to aneoplastic lesion (nUCaN, n ¼ 10). The tissue adjacent to theneoplastic lesion was obtained from the archived FFPET in closestproximity to the neoplastic lesion. Baseline demographics, site ofsample collection, and medication usage for each group is pre-sented in Supplementary Table S1. Additional information on thepatient groups, inclusion, and exclusion criteria are included inthe Supplementary Materials and Methods.

Validation cohort. Flash-frozen tissue was obtained by theUniversity of Chicago Human Tissue Resource Center usingmucosal stripping after surgical resection from 11 patientswith sporadic colon cancer and 11 patients with ulcerativecolitis–associated colon cancer. Comparison in this group wasperformed between normal-appearing tissue adjacent to spo-radic colon cancers (normal controls, n ¼ 11), ulcerativecolitis–associated cancer (n ¼ 11), and non-dysplastic mucosaadjacent to the ulcerative colitis cancers (n ¼ 11). Individualsand samples were matched by age and colon location,respectively.

RNA and DNA extractionRNA and DNA were extracted from FFPET and fresh-frozen

samples as described in the Supplementary Materials andMethods.

Nanostring analysismiRNA analysis was performed using theNanostring nCounter

expression assay v1 per the manufacturer's specifications. Detailsregarding the analysis of array data are presented in the Supple-mentary Materials and Methods.

Real-time PCRQuantitative real-time PCR was performed to assess expression

of miR-31, miR-34a, miR-106b, miR-193a-3p, miR-376, miR-497, pri-miR-193a, and IL17RD as detailed in the SupplementaryMaterials and Methods. Results were normalized to beta-actin,comparisons made between groups using the 2�DDCT method(18), and significance calculated using the Student t test.

Genomic bisulfite sequencingDNA bisulfite treatment was carried out using the Qiagen

Epitect Bisulfite Kit per the manufacturer's directions. Primersfor miR-193a designed with methprimer software (L: TTTGAGG-GATATTTAGAGTTT, R: AACCTAAAAAACAACCTAACC). PCR,subcloning of products, and sequencing were carried out asdescribed in the Supplementary Materials and Methods. Analysisand visualization of CpG dinucleotide methylation were per-formed using BISMA software (http://services.ibc.uni-stuttgart.de/BDPC/BISMA; ref. 19).

ImmunohistochemistryImmunohistochemistry was carried out as previously described

using antigen retrieval with a citrate buffer and primary antibodyfor IL17RD at a concentration of 1:15 (R & D Systems; ref. 20).

Colonocyte IsolationColon biopsies (n ¼ 6-12/subject) were collected from the

sigmoid colon and stored for up to 6 hours at þ4�C in transportmedia which consists of Mg2þ and Ca2þ-free PBS containing 50IU/mL penicillin, 50 mg/mL streptomycin and 0.5 mg/mL genta-mycin. Isolation of colonocyte and stromal fractions was per-formed as detailed in the Supplementary Materials and Methods.

Cell CultureHCT116, DLD-1, LoVo, and HT29 colon cancer cells, as well as

human umbilical vein endothelial cells (HUVEC) and humancolonic fibroblasts (CCD-18co) were obtained from the ATCC.HCT116 luciferase–expressing cells were obtained from Dr. TongChuan He (University of Chicago) for xenograft experiments. Weroutinely authenticate cell lines by short tandem repeat analysis(21). The most recent date of authentication was 2/2017 by theUniversity of Arizona Genetics Core. miRNA transfection experi-ments were conducted on preconfluent HUVEC and HCT116cells. Cells were seeded on 6-well plates and transfected thefollowing day with 6.25 and 12.5 nmol/L mimics of maturemiR-193a-3p (Life Technologies; assay ID: MC11123, catalog #4464066) or control oligonucleotides (Life Technologies assayID: AM17110, AM17111) and cells harvested 72 hours later toexamine protein and RNA expression.

Translational Relevance

Approximately 1.6 million Americans have inflammatorybowel disease (IBD), which is comprised of Crohn's diseaseand ulcerative colitis. Patients with long-standing colonicinflammation related to IBD have a high-risk of developingcolonic neoplasia. Although cancer in IBD differs from spo-radic colon cancer in clinical presentation, progression fromdysplasia, and outcome, few studies have mechanisticallyexamined the pathogenesis of neoplasia in IBD using humansamples. In this study, we investigated miRNA expression inulcerative colitis–associated cancer and report that loss of thetumor suppressor, miR-193a-3p, promotes colon carcinogen-esis in patients with ulcerative colitis. These findings uncover anovel mechanism of inflammation-associated colon cancerthat has the potential to be used as a target for chemopreven-tion and treatment in this high-risk population.

Pekow et al.

Clin Cancer Res; 23(17) September 1, 2017 Clinical Cancer Research5282



http://services.ibc.uni-stuttgart.de/BDPC/BISMA

http://services.ibc.uni-stuttgart.de/BDPC/BISMA


Preconfluent HCT116, LoVo, HT29, and DLD1 cells weretreated with 0, 5, or 10 mmol/L 5-aza-20-deoxycytidine daily for5 days. The cells were harvested 24 hours after the last treatmentand pri–miR-193a as well as maturemiR-193a-3p weremeasuredby qPCR.

Three seed matches for miR-193a-3p are contained in the30UTR of IL17RD at positions 128-134, 964-970, and 5378-5384. A 910 bp oligonucleotide flanking the first 2 seed sequencesand a mutant construct, in which both seed sequences weredeleted, were constructed by Origene and inserted downstreamfrom a luciferase encoding cDNA in the pMirTarget DestinationVectors (Origene; Supplementary Materials and Methods).HCT116 cells were co-transfected with the vector coding for fireflyluciferase regulated bywild-type ormutant IL17RD 30UTR togeth-er with a Renilla luciferase regulated by a CMV to control fortransfection efficiency. Cells were then transfected with a maturemimic of miR-193a-3p or scrambled probe (Life Sciences) andharvested 48 hours later. Firefly luciferase activity regulated byIL17RD-30UTRwas normalized to renilla expression for each well.Eight wells for each condition were evaluated and mean expres-sion between each group compared using a Student t test.

To assess cellular proliferation, preconfluent (5,000–7,500cells/96-well plate) HCT116, HT29, or CCD18co cells weretransfected with 25 nmol/L miR-193a-3p or control miRNA andproliferation assessed 48 hours later using a WST-1 proliferationassay. Raw optical density was obtained in 12 replicates, normal-ized, percent proliferation calculated as compared with a scram-bled controlmiRNA, and significance assessedusing a two-samplet test.

hSEF (IL17RD) plasmid was obtained from Dr. Chang (Tsin-ghua University; ref. 22). The plasmid was transiently transfectedinto HCT-116 or HT-29 cells and proliferation assessed byWST-1proliferation assay 96 hours later. In separate experiments, HT29cells were transiently transfected with the IL17RD encoding plas-mid, and 24 hours later cells were either treated with 10 ng/mL ofEGF or untreated. Cells were harvested for protein 15 and 30minutes after EGF treatment. WST-1 proliferation assay wasperformed72hours after EGF treatment of cells seeded on12-wellplates containing 2,000–2,500 cells per well.

IL17RD with either the 910 bp wild-type 30UTR or mutant30UTR on the 30 end of IL17RD were stably transfected intoHCT116 cells. A polyclonal population of IL17RD-30UTR–stabletransfectants were untreated or treated with a 20 nmol/L of ascrambled probe or 5, 10, or 20 nmol/L of miR-193a-3p for 24hours and harvested for protein extraction. In separate experi-ments,HCT116 cells expressing IL17RDwithWT30UTRormutant30UTR were transfected with similar doses of a miR-193a-3pantagomir (Life Technologies; assay ID: MH11123, catalog#4464088).

Animal StudiesAnimal studies were approved by the University of Chicago

Institutional Animal Care and Use Facility (#59771). Nod ScidGamma (NSG�/�) mice were obtained from The Jackson Labo-ratory. Amixed population of 2.5million HCT116 cells that werestably transfected with IL17RD with WT 30UTR were injected inone flank, and a comparable number of cells expressing IL17RDwith mutant 30UTR were injected into the opposite flank in 15nine-week-old male mice. Ten mg of mature miR-193a-3p wasmixed with in vivo jetPEI (Polyplus) for intraperitoneal injectionper the manufacturer's specifications. The mice were treated with

miR-193a-3p (n ¼ 10) or vehicle alone (n ¼ 5, jetPEI alone) ondays 5 and 8 after implantation of HCT116 cells. Tumor growthwas measured three times weekly for 3 weeks and the mice weresacrificed 25 days after implantation of tumors. Tumor volumeswere compared at each time point using a Wilcoxon signed ranktest. In separate experiments, 10 mg of anti–miR-193a-3p wasinjected into 9-week-oldmale and femaleNSG�/�mice (n¼ 9) orvehicle (n¼ 6)withHCT 116 cells containing IL17RD and theWT30UTR in one flank. Injections of anti–miR-193a-3pwere initiated12 days after tumor implantation and continued twice weekly for3 weeks. Tumor growth was measured after the final injection(35 days after initial cell injection) and the animals were sacrificed3 days later. Tumor volumes were compared between groupsevery 3 days using a Student t test. Immunohistochemistry wasperformed for ki67 with a concentration of 1:500 (ThermoScientific) on formalin-fixed paraffin-embedded tissues. Nuclearstaining was assessed on these samples using ImmunoRatiosoftware to evaluate cellular proliferation (23). Percent of positivestaining was compared between tumors expressing the MT or WT30UTR in both vehicle and miR-193a-3p–treated animals using apaired Student t test.

Western BlottingProtein extraction and Western blotting were performed as

previously described (24). Primary antibodies against IL17RD,FLAG, pAKT, pERK, pERBB2 EGFR, pEGFR, and beta-actin wereused with a dilution of 1:500 for IL17RD (R and D systems),1:1,000 for FLAG (Clontech),1:500 pAKT (Cell Signaling Tech-nology), 1:500 for EGFR (Cell Signaling Technology), 1:100 forpEGFR (SantaCruzBiotechnology), 1:2,500 for pERK (SantaCruzBiotechnology), 1:200 for pERBB2 (Santa Cruz Biotechnology),and 1:5,000 for beta-actin (Sigma-Aldrich). Mean expressionbetween treatment group was compared using a Student t test.

ResultsMicroarray analysis identifies 13 miRNAs that are significantlydysregulated in both ulcerative colitis neoplasia and adjacenttissue compared with ulcerative colitis without neoplasia

Using RNA extracted from FFPET, we comparedmiRNA expres-sion levels quantified withNanostring technology among normalcontrols, ulcerative colitis without neoplasia, ulcerative colitis–associated neoplasia and mucosa adjacent to the neoplasticlesion. Following normalization, 11 samples were removed fromthe analysis as they demonstrated a "batch effect," clusteringtogether in two-way unsupervised hierarchical clustering analysis.miRNA expression was analyzed from arrays in the remaining 30patients, including 9 normal controls, 7 ulcerative colitis patientswithout neoplasia (ulcerative colitis), 7 ulcerative colitis–associ-ated neoplastic tissues (UCN), and 7 nondysplastic ulcerativecolitismucosa adjacent to a neoplastic lesion (nUCaN). As shownin the multidimensional scaling analysis in Fig. 1A, there wasclustering by miRNA expression between UCN and ulcerativecolitis (P¼0.003) aswell as betweennUCaNandulcerative colitis(P ¼ 0.056). Compared with normal controls, there were 39significantly dysregulated miRNAs in ulcerative colitis patientswithout neoplasia, 10 significantly dysregulatedmiRNAs in ulcer-ative colitis neoplastic tissues, and 11 dysregluated miRNAs innondysplastic ulcerative colitis tissue adjacent to a neoplasticlesion (LogFC>1 and P < 0.01; Fig. 1C). Comparedwith ulcerativecolitis without neoplasia, there were 59miRNAswith a significant

Role of miR-193a-3p in UC-Associated Neoplasia

www.aacrjournals.org Clin Cancer Res; 23(17) September 1, 2017 5283




change in expression in UCN, and 18 miRNAs with a significantchange in expression in nUCaN (Fig. 1D; Supplementary DataTables S2–S6). Thirteen miRNAs were significantly dysregulatedin both UCN and nUCaN compared with ulcerative colitiswithout neoplasia. Microarray Data: Available at Geo DataSets.Accession GSE68306.

Real-time PCR validates array findings that miR-31, miR-34a,miR-106b are upregulated and miR-193a-3p is downregulatedin ulcerative colitis–associated neoplasia and adjacent tissue

Six miRNAs (miR-31, miR-34a, miR-106b, miR-193a-3p, miR-376c, and miR-476) that were significantly dysregulated in bothUCN and nUCaN compared with ulcerative colitis without neo-plasia, and previously described to be dysregulated in othercancers were analyzed by qPCR in all samples (n ¼ 41). miR-31 demonstrated significant upregulation in UCN and nUCaNcompared with both normal controls and ulcerative colitis with-out neoplasia (UCN vs. N: 9.7-fold, P < 0.001; nUCaN vs. N: 8.2-fold, P < 0.001; UCN vs. ulcerative colitis: 4.7-fold, P ¼ 0.01;nUCaN vs. ulcerative colitis: 4.0-fold, P ¼ 0.05). Similarly, miR-106b was significantly upregulated in both UCN and nUCaNcompared with both normal controls and ulcerative colitis with-out neoplasia (UCN vs. N: 1.8-fold, P ¼ 0.04; nUCaN vs. N: 3.4-fold, P ¼ 0.005; UCN vs. ulcerative colitis: 2.2-fold, P ¼ 0.04;nUCaN vs. ulcerative colitis: 4.1-fold, P ¼ 0.009). miR-34a wassignificantly upregulated in UCN and nUCaN compared withulcerative colitis without neoplasia (UCN vs. ulcerative colitis:3.3-fold, P ¼ 0.03; nUCaN vs. ulcerative colitis: 5.3-fold, P ¼0.006) although did not demonstrate a significant change inexpression compared with normal controls (UCN vs. N: 1.2-fold,P¼ 0.7; nUCaN vs. N: 1.9-fold, P¼ 0.2). In contrast tomicroarrayfindings, expression of miR-376c and miR-497 were not upregu-

lated in UCN by qPCR (Fig. 2A). miR-193a-3p expression wasdownregulated 2.9-fold in ulcerative colitis (P¼ 0.04), 3.3-fold innUCaN (P ¼ 0.03), and 5.3-fold in UCN (P ¼ 0.003) comparedwith normal controls. Compared with ulcerative colitis withoutdysplasia, miR-193a-3p was downregulated 1.2-fold in nUCaN(P ¼ 0.7) and 1.9-fold in UCN (P ¼ 0.05; Fig. 2B).

DNA methylation of miR-193a is not increased in ulcerativecolitis–associated colon cancer

Because miR-193a-3p was downregulated in IBD-associatedcancer and is located in a CpG island (Fig. 3A), DNAmethylationof the gene was analyzed. Bisulfite genomic sequencing wasperformed in 3 normal controls, 2 quiescent ulcerative colitistissues, and 3 ulcerative colitis–associated cancers. As shownin Fig. 3B, there was a heterogeneous pattern of methylationacross all samples without significant differences in total meth-ylation between phenotypic groups (Normal: 62%, ulcerativecolitis: 42%, ulcerative colitis cancer: 46%) (Fig. 3B). Likewise,there was no association between miRNA expression and per-centage of methylation across these samples.

In vitro, pri–miR-193a expression was significantly increas-ed following treatment with 5-AZA in LoVo cells, although therewere no differences inmaturemiR-193a-3p expression. In contrast,5-AZA did not induce changes in expression of pri–miR-193a ormature miR-193a-3p in HCT116, DLD-1, or HT29 cells (Fig. 3C).

Expression of the primary transcript ofmiR-193a is unchanged,although miR-193a-3p is significantly downregulated in avalidation set of ulcerative colitis cancers

pri–miR-193a and miR-193a-3p were assessed by qPCR in anindependent cohort of normal controls, ulcerative colitis–asso-ciated colon cancers, and non-dysplastic mucosa adjacent to

Figure 1.

miRNA microarray analysisdemonstrates differential expressionof miRNAs in normal, ulcerative colitis,ulcerative colitis (UC) neoplasia, andadjacent tissue. Clustering of miRNAexpression using non-metricmultidimensional scaling in ulcerativecolitis versus ulcerative colitisneoplasia (A); nUCaN versusulcerative colitis (B). Each circlerepresents a single subject in theindicated group. C, Venn diagramdisplaying the number of significantlyupregulated (red) and downregulated(green) miRNAs between ulcerativecolitis and normal controls, UCN andnormal controls, as well as nUCaN andnormal controls (LogFC>1,P <0.01).D,Venn diagram displaying the numberof significantly dysregulated miRNAsbetween UCN and ulcerative colitis aswell as nUCaN and ulcerative colitis(LogFC>1, P < 0.01).

Pekow et al.





ulcerative colitis–associated cancers (n ¼ 11/group). As shownin Fig. 4A, there were no differences in primary transcript expres-sion levels of pri–miR-193a in ulcerative colitis cancer (P¼ 0.49)or adjacent tissue (P ¼ 0.75) compared with normal controls.There was a significant decrease, however, in expression ofmaturemiR-193a-3p in ulcerative colitis cancers (5.6-fold, P ¼ 0.03)and adjacent non-dysplastic tissue (4.8-fold, P ¼ 0.05) com-pared with normal controls. These findings paired with themethylation analysis support the conclusion that downregula-tion of miR-193a-3p in IBD-cancer involves posttranscriptionaldysregulation.

Relative expression of miR-193a-3p is higher in stromal cellsthan colonocytes in normal controls

To explore the cell specificity of miR-193a-3p, we isolatedcolonocytes from stromal cells in biopsies obtained from colo-noscopy in 13 normal controls. To confirm separation of stromalcells from colonocytes, we measured expression of vimentin,which is specific for stromal cells, and CK20, which is specificfor colonocytes (Fig. 4B). miR193a-3p was detected in both

isolated colonocytes and stromal cells. Compared with wholebiopsy specimens, however,miR193a-3pwas enriched in isolatedstromal cells and decreased in isolated colonocytes (P <0.001; Fig. 4B).

IL17RD transcript and protein expression are increased inulcerative colitis–associated neoplasia and discordant toexpression of miR-193a-3p

As IL17RDhas the second highest weighted contextþþ score asa target of miR-193a-3p in TargetScan (www.targetscan.org) andwe theorized that it has an oncogenic role in colitis-associatedcancer, we evaluated transcript and protein expression of IL17RDin ulcerative colitis and ulcerative colitis–associated neoplasia(25). Real-time PCRwas carried out in normal controls, ulcerativecolitis–associated cancers, and non-dysplasticmucosa adjacent tothe cancer from samples in the validation cohort (n¼ 7 samples/group). Six of the seven ulcerative colitis–associated cancers hadactive inflammation in the surrounding mucosa. Compared withnormal controls, IL17RD was increased in ulcerative colitis–asso-ciated cancer 3.2-fold (P ¼ 0.04), and in nondysplastic mucosa

Figure 3.

miR-193a does not have increased DNA methylation in ulcerative colitis-associated neoplasia. A, Genomic structure of miR-193a-3p. Location of miR-193a(gray rectangle) with respect to CpG sites (vertical lines) and region examined by bisulfite genomic sequencing. The analyzed genomic region had 27 CpGdinucleotides as shown in red. The genomic sequence of pre–miR-193a is underlined. B, Bisulfite genomic sequencing in eight subjects, including threenormal controls, two ulcerative colitis without dysplasia, and three ulcerative colitis–associated cancers. Red boxes represent methylated CpG sites and blueboxes unmethylated sites. C, Real-time PCR of pri–miR-193a and miR-193a-3p following treatment with 0, 5 mmol/L, or 10 mmol/L of 5-aza-20-deoxycytidine dailyfor 5 days in the indicated colon cancer cell lines (�, P < 0.05).

Figure 2.

Real-time PCR results validatemicroarray finding that miR-31, miR-34a, miR-106b, and miR-193a-3p aredifferentially expressed in bothulcerative colitis (UC)-neoplasia andadjacent tissue compared withulcerative colitis without neoplasia.miRNAs that were significantlydysregulated in both ulcerative colitisneoplasia and adjacent mucosacompared with ulcerative colitiswithout neoplasia in the array analysis,and had a previously describedputative functional role incarcinogenesis were quantified byreal-time PCR. Upregulated miRNAs(A); miR-193a-3p (B).





www.targetscan.org


adjacent to the cancers 2.7-fold (P ¼ 0.03; Fig. 4C). In subjectswho had expression of miR-193a-3p and IL17RD analyzed in thesame sample, there was an inverse correlation betweenmiR-193a-3p and IL17RD (R2¼-0.23; Fig. 4D). By immunohistochemistry,IL17RD expression was present in malignant colonocytes in IBD-associated cancers, whereas expressionwas seen predominately inendothelial and other stromal cells in normal controls, activeulcerative colitis, and quiescent ulcerative colitis. In a tissue arrayof 24 ulcerative colitis–associated cancers, 19 of 24 had strongpositive staining and 5 of 24 had weak positive staining (Fig. 4E).

miR-193a-3p decreases colon cancer cell proliferation anddirectly targets IL17RD

To examine the growth phenotype of miR-193a-3p, HT-29,HCT-116 colon cancer cells, and CCD-18co colonic fibroblasts (astromal cellular component) were transfected withmaturemimicof miR-193a-3p and proliferation was assessed. As shown in Fig.5A, upregulation of miR-193a-3p significantly decreased prolif-eration in both colon cancer cell lines as well as cultured fibro-blasts. At 48 hours, miR-193a-3p upregulation resulted in a 34%decrease in proliferation of HCT116 (P < 0.001), 19.5% decreasein proliferation of HT-29 cells (P¼ 0.002), and 14.1% decrease inproliferation of CCD-18co cells (P ¼ 0.03).

We next carried out cell culture studies to investigate regulationof IL17RD bymiR-193a-3p. To assess a direct interaction betweenmiR-193a-3p and IL17RD, a 910bp oligonucleotide containing2 predicted binding sites for the miR-193a-3p seed sequencesin the 30UTR of IL17RD and a mutant IL17RD 30UTR with the

seed complement sequences deleted were cloned into a lucif-erase vector regulated by IL17RD 30UTR. Compared with ascrambled oligonucleotide control, miR-193a-3p decreasedexpression of luciferase regulated by wild-type 30UTR constructby 42% (P < 0.001). Luciferase activity was also decreased 37%with transfection of miR-193a-3p in cells containing the wild-type 30UTR compared with the mutated 30UTR (P ¼ 0.001). Inuntreated cells, luciferase activity was decreased 13% in cellscontaining luciferase regulated by IL17RD wild-type 30 UTRcompared with the mutated 30UTR, likely related to endoge-nous miR-193a-3p activity in these colon cancer cells (P ¼0.02; Fig. 5B).

HCT116 and HUVEC cells were also transfected with 6.25 or12.5 nmol/L mature mimic of miR-193a-3p or a scrambledRNA oligonucleotide and cells were harvested 72 hours later tomeasure IL17RD protein and gene expression. HUVEC cellswere selected because of high baseline expression of IL17RD(26). Following transfection with 6.25 nmol/L in HUVEC,there was a decrease in IL17RD RNA expression (2.1-fold;P ¼ 0.03), but no differences in IL17RD protein expressioncompared with the scrambled control. With transfection of12.5 nmol/L of mature miR-193a-3p, there was downregula-tion of both IL17RD protein (2.5-fold) and transcript expres-sion (3.1-fold; P < 0.001; Fig. 5C). In HCT116 cells, baselineIL17RD protein expression was too low to detect a band onWestern blot. Similar to the HUVEC cells, however, IL17RDRNA expression in HCT116 was minimally decreased (1.2-fold, P ¼ 0.2) following transfection with 6.25 nmol/L of the

2.5A B E a b c

fed

g h i

lkj

DC

2

1.5

Fold

cha

nge

in e

xpre

ssio

n

Fold

cha

nge

in e

xpre

ssio

n

1

0.5

0pri-miR-193a-3p miR-193a-3p

NormalUC CancerAdjacent mucosaP = 0.03

P = 0.045

6

0

1

2

3

4Whole biopsy

NormalUC CancerAdjacent mucosa

Colonocytes

P < 0.001

P = 0.05

P = 0.03

P = 0.001

P < 0.001

Stromal cells

CK20 VimentinmiR-193a-3p

5

4

3

2

1

00 1 2 3 4 5

4

3

2

1

0IL17RD IL17RD (Fold-adjacent)

r = −0.29

miR

-193

a-3p

(Fol

d-ad

jace

nt)

Fold

cha

nge

in e

xpre

ssio

n

Figure 4.

miR-193a-3p is downregulated and IL17RD upregulated in ulcerative colitis-associated cancer. A, Expression of the primary transcript of miR-193aand mature miR-193a-3p in an independent validation cohort of ulcerative colitis–associated cancers and adjacent tissue as compared with normal controls(n ¼ 11/group). B, Expression of miR-193a-3p, in whole colon biopsies, the fractionated colonocytes, and stroma from the same normal control patients (n ¼ 13).Vimentin, which is highly expressed in colonic fibroblasts, and CK20 that is expressed in colonocytes but not stromal cells, were measured as cell puritycontrols. C, Expression of IL17RD in ulcerative colitis–associated cancers and adjacent tissue as compared with normal controls (n ¼ 7/group). D, Correlationbetween miR-193a-3p and IL17RD transcripts. Individual sample expression of miR-193a-3p as compared with expression IL17RD with logarithmic trend linein IBD cancers and adjacent tissue (fold change of expression as compared with normal controls). Samples included had expression data available for bothmiR-193a-3p and IL17RD (n ¼ 12, ulcerative colitis cancer¼6, adjacent tissue¼6). E, Immunohistochemistry of IL17RD at 10x magnification [a, normal control;b, quiescent ulcerative colitis; c, active ulcerative colitis; d and e, nondysplastic mucosa adjacent to a cancer; f and g, ulcerative colitis cancer; h and i,sporadic colon cancer; j, k, and l, representative images from ulcerative colitis cancers in tissue array demonstrating positive staining in epithelial cancer cells.

Pekow et al.





miRNA although there was a greater decrease in expressionfollowing transfection with 12.5 nmol/L miR193a-3p (1.7-fold, P ¼ 0.06; Fig. 5D).

IL17RD increases EGF-induced colon cancer cell proliferationand EGFR signaling

In previous studies, IL17RD prevented degradation of EGFRand potentiated EGF signaling in HEK293T human embryonickidney cells (27). As such, we explored the effect of IL17RD over-expression on proliferation of colon cancer cells with or withoutEGF treatment. Without EGF treatment, IL17RD overexpressionresulted in a decrease in cell proliferation at 96 hours in HT-29cells (12.1%, P < 0.001), which have a p53 mutation, and nochange in proliferation of HCT116 cells, which do not carry a p53mutation (Supplementary Fig. S1A). In contrast, in colon cancercells that were treated with EGF, IL17RD significantly increasedproliferation of both HT-29 cells (16%, P < 0.001) and HCT116cells (53%, P < 0.001) 96 hours following transfection (Supple-mentary Fig. S1B). We also examined pAKT, pERK pEGFR, andpan-EGFR in EGF-treated cells transfected with a plasmid codingfor IL17RD or an empty vector (EV) plasmid. In HT-29 cellstransfected with IL17RD, EGFR and ERK were activated 15 min-utes after treatment of EGF, and AKT was activated by 30 minutes(Supplementary Fig. S1C and 1D). As expected, short-term EGFtreatment led to a decrease of pan-EGFR in both IL17RD trans-fected and control cells, although EGF-treated IL17RD and con-trols were not different with respect to pan-EGFR (SupplementaryFig. S1C). However, IL17RD transfection into HT29 cells nottreated with EGF exhibited a trend toward an increase in totalEGFR expression compared with cells treated with an emptyvector 96-hours after transfection of IL17RD (P ¼ 0.1; Supple-mentary Fig. S1E).

miR-193a-3p regulates IL17RD controlled EGFR signalingTo explore the interaction between miR-193a-3p, IL17RD, and

EGFR signaling, HCT116 cells stably transfected with the WT30UTR and IL17RD or the mutant 30UTR and IL17RDwere treatedwith miR-193a-3p. As shown in Fig. 6A and B, miR-193a-3presulted in significant downregulation of pAKT and pERK in cellsexpressing the WT 30UTR at 5, 10, and 20 nmol/L. In addition,there was downregulation of pERBB2 with treatment of 20 nmol/L of miR-193a-3p in cells expressing the WT 30UTR. In contrast,expression of pAKT and pERK were increased in cells expressingthe WT 30UTR and IL17RD compared with those expressing themutant 30UTR and IL17RD following treatment with amiR-193a-3p antagomir (Fig. 6C and D). We did not observe differences inEGFR expression between WT 30UTR and mutant 30UTR-expres-sing cells following treatment with miR-193a-3p or its inhibitor.

miR-193a-3p suppression of colon cancer growth is mediatedthrough IL17RD

To explore the interaction between miR-193a-3p, IL17RD, andtumor growth, HCT116 cells were stably transfected with theplasmid coding for IL17RD controlled by either wild-type ormutant 30 UTR for the IL17RD gene. NSG�/� mice were injectedon contralateral flanks with cells expressing IL17RD regulated byeither wild-type or mutant 30UTR. Intraperitoneal treatment ofmice with miR-193a-3p significantly decreased growth of tumorsexpressing IL17RD with wild type 30UTR compared with tumorsin vehicle treated mice expressing IL17RD with WT 30UTR ortumors in mice expressing IL17RD with mutant 30UTR (Fig. 6E).Similarly, in miRNA treated mice cellular proliferation was sig-nificantly decreased in tumors expressing IL17RD with wild-type30UTR compared with tumors with cells expressing IL17RD withmutant 30UTR (Fig. 6F and G). In separate experiments,

Figure 5.

miR-193a-3p decreases cellularproliferation and targets IL-17RD. A,Cellular proliferation at 48 hours in theindicated cell lines followingtransfection with 25 nmol/L of miR-193a-3p or scrambled control. B,Activity of luciferase regulated bymutated or wild type IL17RD 30-UTRfollowing transfection with maturemiR-193a-3p or a scrambled controloligonucleotide. Results are expressedas the ratio of firefly to Renillaluciferase activity and normalized toempty vector. C, Expression of IL17RDbyWestern blot following transfectionwith 6.25 or 12.5 nmol/L of miR-193a-3p in HUVEC cells. D, RNA transcriptexpression of IL17RD followingtransfection of 6.25 or 12.5 nmol/L ofIL17RD in HUVEC or HCT116 cells.






intraperitoneal injection of anti–miR-193a-3p resulted in signif-icantly increased growth of tumors expressing wild-type 30 UTR ofIL17RD (Fig. 6H).

Discussion

This report highlights the importance of miRNAs in thepathogenesis of IBD-associated colon cancer. We identifiedseveral miRNAs that were dysregulated in IBD-associated neo-plasia, which may contribute causally to cancer development inthis high-risk population. In addition, this study establishedthat changes in miRNAs occur in non-dysplastic mucosa adja-cent to a neoplastic lesion as a "field effect." We also demon-strated downregulation of miR-193a-3p in IBD-associated neo-plasia, validated changes in an independent cohort, and iden-tified a possible key mechanism of carcinogenesis in IBDinvolving IL17RD. Although miR-193a-3p has been reportedas downregulated in several cancers, this is the first studyto report downregulation of miR-193a-3p in IBD-associatedneoplasia.

Previous miRNA analyses in IBD-associated cancers havefocused on the upregulation of miR-31, miR-21, miR-155,miR-224, let-7e, miR-17, and miR-122 (14–17, 28). In concor-dancewith these studies, we confirmed upregulation ofmiR-31 in

ulcerative colitis–associated neoplasia. The fact that we did notidentify changes in several other miRNAs found to be dysregu-lated in prior studies may be related to differences in patientpopulations and methodological differences including miRNAplatforms.Our investigations had the advantage of controlling forinflammation and location of tissue biopsies among samplegroups aswell as having amore homogeneous patient populationthat included only ulcerative colitis patients. In addition todemonstrating changes in miR-31, we also identified significantupregulation miR-34a and miR-106b, as well as downregulationof miR-193a-3p in IBD-associated neoplasia and adjacent tissue.miR-106b, like miR-31, has been ascribed an oncogenic role incolon cancer previously (29, 30). In contrast to our findings inIBD-cancer, however, previous studies indicate that miR-34a isdecreased in a subset of sporadic colon cancers (31). As the impactof miR-34a on cancer cell proliferation is dependent on p53 andits expression is associatedwith that of p53 (32), the upregulationobserved in neoplasia in our analysis may be linked to the tumor-suppressor gene status. However, we did not directlymeasure p53expression in our cohort. In this study, we chose to focus mech-anistic investigations onmiR-193a-3p given the fact that itmay beintegral to bowel inflammation and is known to function as atumor suppressor in other cancers, but had not been investigatedfunctionally in colorectal cancer (33–35). Adding to the strength

Figure 6.

IL17RD mediates the impact of miR-193a-3p on tumor growth and EGFR signaling. A, Western blots demonstrating protein expression followingtransfection with the indicated doses of miR-193a-3p or a scrambled probe in HCT116 cells stably transfected with a vector containing IL17RD with wild-type30UTR or IL17RD with mutant 30UTR. Images represent one of two blots using the same conditions. B, Quantitation of protein expression followingtransfection with the indicated doses of miR-193a-3p or a scrambled probe in HCT116 cells stably transfected with a vector containing IL17RD with wild-type30UTR or IL17RD with mutant 30UTR. � , P < 0.05. C, Western blots demonstrating protein expression in parental HCT116 cells (par) or followingtreatment with a scrambled probe or miR-193a-3p inhibitor (Inh) at the indicated doses in HCT116 cells stably transfected with a vector containingIL17RD with wild-type 30UTR or IL17RD with mutant 30UTR. Images represent one of two blots using the same conditions. D, Quantitation of proteinexpression following transfection with the indicated doses of a miR-193a-3p antagomir or a scrambled probe in HCT116 cells stably transfected with avector containing IL17RD with wild-type 30UTR or IL17RD with mutant 30UTR; � , P < 0.05. E, Time course of tumor growth of HCT116 cells stablytransfected with a vector coding for IL17RD with wild-type 30UTR or mutant 30UTR with mutations in the seed-binding sites for IL17RD and treated withintraperitoneal injection of miR-193a-3p (n ¼ 10 mice containing one cell line in each flank) or vehicle (n ¼ 5). F, Representative images of Ki67staining of tumor xenografts of cells expressing IL17RD with wild-type or mutant 30UTR in mice treated with miR-193a-3p. G, Quantification of KI67staining from tumors consisting of HCT116 cells expressing IL17RD with wild-type 30UTR. Mice were treated with miR-193a-3p or vehicle as indicated(n ¼ 5/group). H, Tumor volume by day in tumor xenografts containing HCT116 cells stably transfected with a vector containing IL17RD, and a wild-type30UTR treated with intraperitoneal injection of anti–miR-193a-3p (n ¼ 9) or vehicle (n ¼ 6).

Pekow et al.





of our studies, we confirmed and thereby validated changes ofmiR-193a-3p in an independent cohort. Although miR-193a-3phas not been reported as downregulated in previous studiesexamining IBD-neoplasia, a direct real time PCR analysis ofthis miRNA was not performed in the majority of prior analyses(16, 28, 15).

miR-193a is located on chromosome 17. During processing,the hairpin precursor miRNA is cleaved intomaturemiR-193a-3pand miR-193a-5p. miR-193a-3p has been reported as downregu-lated in breast,medullary thyroid cancer, aswell as non–small celland squamous cell lung cancer (34–38). Although there arelimited data on expression of this miRNA in colon cancer, aprevious study demonstrated that overexpression of miR-193adecreased cell proliferation and tumor growth inHT-29 andHCT-116 tumor xenograft experiments (39). We confirmed the anti-proliferative effects of miR-193a-3p in HCT116 tumor xenograftsfurther supporting the tumor-suppressor role of this miRNA.Additional support for the role of miR-193a-3p in IBD comesfrom a recent publication, which demonstrated that downregula-tion of this miRNA occurs in active ulcerative colitis and intra-colonic delivery of miR-193a-3p ameliorated dextran sodiumsulfate–induced colitis (33).

miR-193a is located in a CpG island. In other cancer types,including leukemia, oral cancer, and non–small cell lung cancer,hypermethylation at the DNA loci of miR-193a has been associ-ated with decreased expression of this miRNA (40–42). In con-trast with other cancers, we did not identify changes in methyl-ation associated with decreased expression of this miRNA in IBD-associated neoplasia. In fact, expression of the primary transcriptof miR-193a was not different between normal controls and IBD-associated cancer. These results indicate that downregulation ofthismiRNA in IBD-associated cancer occurs posttranscriptionally,most likely secondary to dysregulation of processing or stability ofthe mature miRNA in neoplastic tissue.

IL17RD (aka hSEF) is a predicted target miR-193a-3p based onthree possible binding sites in the 30UTR of IL17RD that com-plement the miRNA seed sequence. Prior studies have concludedthat IL17RD has several mechanistic properties, including func-tioning as an orphan receptor to potentiate IL17 signaling (43).Interestingly, IL17RDhas been described to inhibit tumorigenesisin vitro through antagonistic effects on fibroblast growth factor(FGF) signaling and inhibition of MAP kinase (MAPK) signaling(22, 26, 44). In contrast with this tumor-suppressing mechanism,Ren and colleagues (27) demonstrated a dual role of IL17RDwhereby IL17RD potentiates EGF-mediated MAPK signaling inthe presence of EGF, whereas it exerts opposing effects in thepresence of FGF. Our findings support this mechanism as basalcell proliferation was inhibited by IL17RD in the absence of EGFtreatment, but IL17RD transfection increased cell proliferation inthe presence of EGF. In addition, in cells stably transfected with aplasmid coding for IL17RD with wild-type 30UTR miR-193a-3pdecreased pAKT, pERK, and pERBB2 in vitro and reduced tumorxenograft growth in vivo compared with cells expressing IL17RDwithmutant 30UTR. Taken together, our data support the hypoth-esis that by preventing EGFR degradation and enhancing EGFRsignaling, IL17RD upregulationmediated by loss ofmiR-193a-3pmay be an important mechanism driving colon cancer growth inpatients with IBD.

Only one previous study has examined the impact of IL17RD incolon cancer (45). The authors of this in vitro study demonstratedthat RAS downregulation of IL17RD in colon cancers results in

aberrant nuclear localization of MEK 1 and 2 leading to carcino-genesis. They also reported low baseline levels of IL17RD in coloncancer cell lines, adenomas, and invasive carcinoma (45).Although we found similar low baseline expression of IL17RDin HCT116 cells and low immunohistochemical staining innormal controls, we identified markedly elevated IL17RD expres-sion inmalignant colonocytes in IBD and sporadic colon cancers.This discrepancy may be explained from the fact that the previousanalysis only examined one cancer, and we demonstrate that insome cancers staining is minimal or patchy. The finding thatIL17RD upregulation in the presence of EGF promotes cellularproliferation, combined with demonstration that IL17RD isupregulated in a large number of IBD-cancers as assessed by bothreal-time PCR and immunohistochemistry, supports our conten-tion of its oncogenic role in IBD-associated colon cancer.

Even though we were able to demonstrate concomitant down-regulation of miR-193a-3p in association with upregulation ofIL17RD in the same tissues, the cell-specific localization of miR-193a-3p regulation of IL17RD remains uncertain. Although miR-193a-3p is expressed in the epithelial cell, expression levels arehigher in stroma cells of normal colons. By immunohistochem-istry, IL17RD is expressed primarily in the stromal cells in normalcontrols, although over-expression of IL17RD in IBD-cancerappears to be predominantly in malignant colonocytes. For thisreason, we hypothesize that colonocyte miR-193a-3p downregu-lation contributes to IL17RD upregulation in epithelial cells(colonocytes) of IBD-cancers. Other factors are also likely drivingIL17RD upregulation in cancer cells. In this regard, stromal cell-and colonocyte-specific regulation of IL17RDbymiR193a-3pwillrequire further study.

In conclusion, we identified several dysregulated miRNAs,including downregulation of the tumor-suppressor miR-193a-3p, in IBD-associated colon cancer and adjacent non-dysplasticmucosa. In addition, we were able to demonstrate a novelmechanism of carcinogenesis whereby loss of miR-193a-3p upre-gulates expression of IL-17RD. Despite the fact that we focusedour investigations on miR-193a-3p, it is likely that additionalmiRNA-regulated pathways are important in inflammation asso-ciated colon cancer. AlthoughmiRNAs have not beenwidely usedclinically for therapeutics to date, several in vivo deliveryapproaches have been developed and are currently being inves-tigated in clinic trials (46, 47). Using these or alternativemethods,the miR-193a-3p-IL17RD pathway is a potential target for futurechemopreventive approaches in this high-risk population.

Disclosure of Potential Conflicts of InterestJ.H. Kwon reports receiving speakers bureau honoraria from Takeda Phar-

maceuticals and is a consultant/advisory board member for Pfizer Pharmaceu-ticals. No potential conflicts of interest were disclosed by the other authors.

Authors' ContributionsConception and design: J. Pekow, J.H. Kwon, M. BissonnetteDevelopment of methodology: J. Pekow, K. Meckel, U. Dougherty, X. Chen,A. Almoghrabi, Z. Deng, H.I. Haider, M. BissonnetteAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): J. Pekow, K. Meckel, X. Chen, A. Almoghrabi,F. Ayaloglu-Butun, Z. Deng, J. Hart, J.H. KwonAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): J. Pekow, K. Meckel, Y. Huang, X. Chen, R. Mustafi,D.T. Rubin, M. BissonnetteWriting, review, and/or revision of the manuscript: J. Pekow, K. Meckel,D.T. Rubin, M. Bissonnette






Administrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): J. Pekow, K. Meckel, X. Chen, H.I. Haider,D.T. Rubin, J.H. KwonStudy supervision: J. Pekow, M. Bissonnette

Grant SupportThe Valerie and Lee Shapiro Family, NIH K08DK090152 (to J. Pekow), NIH

P40K42086 (University of Chicago DDRCC).

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received January 19, 2017; revised May 2, 2017; accepted June 5, 2017;published OnlineFirst June 9, 2017.

References1. Eaden JA, AbramsKR,Mayberry JF. The risk of colorectal cancer inulcerative

colitis: a meta-analysis. Gut 2001;48:526–35.2. Rutter MD, Saunders BP, Wilkinson KH, Rumbles S, Schofield G, Kamm

MA, et al. Thirty-year analysis of a colonoscopic surveillance program forneoplasia in ulcerative colitis. Gastroenterology 2006;130:1030–8.

3. Bartel DPMicroRNAs: genomics, biogenesis, mechanism, and function.Cell 2004;116:281–97.

4. Schetter AJ, Leung SY, Sohn JJ, Zanetti KA, Bowman ED, Yanaihara N, et al.MicroRNA expression profiles associated with prognosis and therapeuticoutcome in colon adenocarcinoma. JAMA 2008;299:425–36.

5. Schepeler T, Reinert JT, Ostenfeld MS, Christensen LL, Silahtaroglu AN,Dyrskjot L, et al. Diagnostic and prognostic microRNAs in stage II coloncancer. Cancer Res 2008;68:6416–24.

6. Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, et al. AmicroRNA expression signature of human solid tumors defines cancer genetargets. Proc Natl Acad Sci U S A 2006;103:2257–61.

7. Michael MZ, SM OC, van Holst Pellekaan NG, Young GP, James RJ.Reduced accumulation of specific microRNAs in colorectal neoplasia. MolCancer Res 2003;1:882–91.

8. Liu W, Mao SY, Zhu WY. Impact of tiny miRNAs on cancers. World JGastroenterol 2007;13:497–502.

9. Ambros V.The functions of animal microRNAs. Nature 2004;431:350–5.10. O'Connell RM, Taganov KD, Boldin MP, Cheng G, Baltimore D. Micro-

RNA-155 is induced during the macrophage inflammatory response. ProcNatl Acad Sci U S A 2007;104:1604–9.

11. Wu F, ZikusokaM, TrindadeA,Dassopoulos T,HarrisML, Bayless TM, et al.MicroRNAs are differentially expressed in ulcerative colitis and alterexpression of macrophage inflammatory peptide-2 alpha. Gastroenterol-ogy 2008;135:1624–35 e24.

12. Pekow JR,DoughertyU,MustafiR, ZhuH,KocherginskyM,RubinDT, et al.miR-143 and miR-145 are downregulated in ulcerative colitis: putativeregulators of inflammation and protooncogenes. Inflamm Bowel Dis2012;18:94–100

13. Pekow JR, Kwon JH. MicroRNAs in inflammatory bowel disease. InflammBowel Dis 2012;18:187–93.

14. Olaru AV, Selaru FM, Mori Y, Vazquez C, David S, Paun B, et al. Dynamicchanges in the expression of MicroRNA-31 during inflammatory boweldisease-associated neoplastic transformation. Inflamm Bowel Dis2011;17:221–31.

15. Kanaan Z, Rai SN, EichenbergerMR, Barnes C,Dworkin AM,Weller C, et al.Differential microRNA expression tracks neoplastic progression in inflam-matory bowel disease-associated colorectal cancer. Hum Mutat2012;33:551–60.

16. SvrcekM, El-MurrN,Wanherdrick K,Dumont S, Beaugerie L, Cosnes J, et al.Overexpression of microRNAs-155 and 21 targeting mismatch repairproteins in inflammatory bowel diseases. Carcinogenesis 2013;34:828–34.

17. Olaru AV, Yamanaka S, Vazquez C, Mori Y, Cheng Y, Abraham JM, et al.MicroRNA-224 negatively regulates p21 expression during late neoplasticprogression in inflammatory bowel disease. Inflammatory Bowel Dis2013;19:471–80.

18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods2001;25:402–8.

19. RohdeC, Zhang Y, Reinhardt R, Jeltsch A. BISMA–fast and accurate bisulfitesequencing data analysis of individual clones from unique and repetitivesequences. BMC Bioinformatics 2010;11:230.

20. Pekow J, Dougherty U, Huang Y, Gometz E, Nathanson J, Cohen G, et al.Gene signature distinguishes patients with chronic ulcerative colitis harbor-ing remote neoplastic lesions. Inflammatory Bowel Dis 2013;19:461–70.

21. Reid Y, Storts D, Riss T, Minor L. Authentication of human cell lines by STRDNAprofiling analysis. In:SittampalamGS, Coussens NP, NelsonH, ArkinM,AuldD,AustinC, et al. , editors.AssayGuidanceManual. Bethesda (MD)2004.

22. Xiong S, Zhao Q, Rong Z, Huang G, Huang Y, Chen P, et al. hSefinhibits PC-12 cell differentiation by interfering with Ras-mitogen-activated protein kinase MAPK signaling. J Biol Chem 2003;278:50273–82.

23. Tuominen VJ, Ruotoistenmaki S, Viitanen A, Jumppanen M, Isola J.ImmunoRatio: a publicly available web application for quantitative imageanalysis of estrogen receptor (ER), progesterone receptor (PR), and Ki-67.Breast Cancer Res 2010;12:R56.

24. Pekow JR,DoughertyU,MustafiR, ZhuH,KocherginskyM,RubinDT, et al.miR-143 and miR-145 are downregulated in ulcerative colitis: putativeregulators of inflammation and protooncogenes. Inflammatory Bowel Dis2012;18:94–100.

25. Agarwal V, Bell GW, Nam JW, Bartel DP. Predicting effective microRNAtarget sites in mammalian mRNAs. Elife 2015;4.

26. Yang RB, Ng CK,Wasserman SM, Komuves LG, GerritsenME, Topper JN. Anovel interleukin-17 receptor-like protein identified in human umbilicalvein endothelial cells antagonizes basic fibroblast growth factor-inducedsignaling. J Biol Chem 2003;278:33232–8.

27. Ren Y, Cheng L, Rong Z, Li Z, Li Y, Zhang X, et al. hSef potentiates EGF-mediated MAPK signaling through affecting EGFR trafficking and degra-dation. Cellular signalling 2008;20:518–33.

28. Ludwig K, Fassan M, Mescoli C, Pizzi M, Balistreri M, Albertoni L, et al.PDCD4/miR-21 dysregulation in inflammatory bowel disease-associatedcarcinogenesis. Virchows Arch 2013;462:57–63.

29. Cekaite L, Rantala JK, Bruun J, Guriby M, Agesen TH, Danielsen SA, et al.MiR-9, -31, and -182 deregulation promote proliferation and tumor cellsurvival in colon cancer. Neoplasia 2012;14:868–79.

30. Hu S, Dong TS, Dalal SR, Wu F, Bissonnette M, Kwon JH, et al. Themicrobe-derived short chain fatty acid butyrate targets miRNA-depen-dent p21 gene expression in human colon cancer. PLoS ONE 2011;6:e16221.

31. Tazawa H, Tsuchiya N, Izumiya M, NakagamaH. Tumor-suppressive miR-34a induces senescence-like growth arrest through modulation of the E2Fpathway in human colon cancer cells. Proc Natl Acad Sci U S A2007;104:15472–7.

32. Gao J, Li N, Dong Y, Li S, Xu L, Li X, et al. miR-34a-5p suppresses colorectalcancer metastasis and predicts recurrence in patients with stage II/IIIcolorectal cancer. Oncogene 2015;34:4142–52.

33. Dai X, Chen X, Chen Q, Shi L, Liang H, Zhou Z, et al. MicroRNA-193a-3preduces intestinal inflammation in response to microbiota via down-regulation of colonic PepT1. J Biol Chem 2015;290:16099–115.

34. Yang Y, Li X, YangQ,WangX, ZhouY, Jiang T, et al. The role ofmicroRNA inhuman lung squamous cell carcinoma. Cancer Genet Cytogenet2010;200:127–33.

35. Tahiri A, Leivonen SK, Luders T, Steinfeld I, Ragle Aure M, Geisler J, et al.Deregulation of cancer-related miRNAs is a common event in bothbenign and malignant human breast tumors. Carcinogenesis 2014;35:76–85.

36. UhlmannS,MannspergerH, Zhang JD,Horvat EA, SchmidtC, KublbeckM,et al. Global microRNA level regulation of EGFR-driven cell-cycle proteinnetwork in breast cancer. Mol Syst Biol 2012;8:570.

37. Yu T, Li J, Yan M, Liu L, Lin H, Zhao F, et al. MicroRNA-193a-3p and -5psuppress the metastasis of human non–small cell lung cancer by down-regulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway. Oncogene2015;34:413–23.

Pekow et al.





38. Santarpia L, Calin GA, Adam L, Ye L, Fusco A, Giunti S, et al. A miRNAsignature associated with humanmetastatic medullary thyroid carcinoma.Endocr Relat Cancer 2013;20:809–23.

39. IliopoulosD, RotemA, Struhl K. InhibitionofmiR-193a expressionbyMaxand RXRalpha activates K-Ras and PLAU to mediate distinct aspects ofcellular transformation. Cancer Res 2011;71:5144–53.

40. Gao XN, Lin J, Li YH, Gao L, Wang XR, Wang W, et al. MicroRNA-193arepresses c-kit expression and functions as a methylation-silenced tumorsuppressor in acute myeloid leukemia. Oncogene 2011;30:3416–28.

41. Kozaki K, Imoto I, Mogi S, Omura K, Inazawa J. Exploration of tumor-suppressive microRNAs silenced by DNA hypermethylation in oral cancer.Cancer Res 2008;68:2094–105.

42. Heller G, Weinzierl M, Noll C, Babinsky V, Ziegler B, Altenberger C, et al.Genome-wide miRNA expression profiling identifies miR-9–3 and miR-193a as targets for DNA methylation in non–small cell lung cancers. ClinCancer Res 2012;18:1619–29.

43. Rong Z,Wang A, Li Z, Ren Y, Cheng L, Li Y, et al. IL-17RD (Sef or IL-17RLM)interacts with IL-17 receptor and mediates IL-17 signaling. Cell Res2009;19:208–15.

44. Ren Y, Cheng L, Rong Z, Li Z, Li Y, Li H, et al. hSef co-localizes and interactswith Ras in the inhibition of Ras/MAPK signaling pathway. BiochemBiophys Res Commun 2006;347:988–93.

45. Duhamel S, Hebert J, Gaboury L, Bouchard A, Simon R, Sauter G, et al. Sefdownregulation by Ras causes MEK1/2 to become aberrantly nuclearlocalized leading to polyploidy and neoplastic transformation. CancerRes 2012;72:626–35.

46. Chapman CG, Pekow J. The emerging role of miRNAs ininflammatory bowel disease: a review. Therap Adv Gastroenterol 2015;8:4–22.

47. Christopher AF, Kaur RP, Kaur G, Kaur A, Gupta V, Bansal P. MicroRNAtherapeutics: discovering novel targets and developing specific therapy.Perspect Clin Res 2016;7:68–74.






2017;23:5281-5291. Published OnlineFirst June 9, 2017.Clin Cancer Res Joel Pekow, Katherine Meckel, Urszula Dougherty, et al. Upregulation of IL17RDAssociated Colon Cancer and Promotes Carcinogenesis through

−miR-193a-3p is a Key Tumor Suppressor in Ulcerative Colitis

Updated version

10.1158/1078-0432.CCR-17-0171doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2017/06/09/1078-0432.CCR-17-0171.DC1

Access the most recent supplemental material at:

Cited articles

http://clincancerres.aacrjournals.org/content/23/17/5281.full#ref-list-1

This article cites 45 articles, 15 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/23/17/5281.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/23/17/5281To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-17-0171

http://clincancerres.aacrjournals.org/content/suppl/2017/06/09/1078-0432.CCR-17-0171.DC1

http://clincancerres.aacrjournals.org/content/23/17/5281.full#ref-list-1

http://clincancerres.aacrjournals.org/content/23/17/5281.full#related-urls

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/23/17/5281


Documents

miR-193a-3p is a Key Tumor Suppressor in Ulcerative ...dysplasia, and outcome, few studies have mechanistically examined the pathogenesis of neoplasia in IBD using human samples. In