Embed Size (px)
Citation preview
Crime Lab
A SCienceLab activity
Dr. Rekha C. Patel and Dr. Bert Ely Department of Biological Sciences
University of South Carolina715 Sumter St.
Columbia, SC [email protected]
Additional Contributors: Brice Gill, Teresa Pizzuti, Karen Walton, and Jonathon Singer
Background
DNA restriction analysis is a technique with applications in medicine, research, and forensics. For example, in Dr. Patel’s research laboratory, we use restriction analysis of DNA for many different reasons. One of the main uses is to create recombinant DNA molecules. We use restriction enzymes to cut the genes of interest from the human genome and clone them into plasmid vectors so that we can study their function at the molecular level. Cloning involves splicing the gene we want into plasmid DNA. In this way, we create chimeric DNA molecules, in which DNA obtained from two different organisms is joined to give a single molecule. This new DNA molecule can be transformed into a bacterial cell where it is replicated to produce many copies of the gene under study. We work on genes whose expression is induced by interferons. Interferons are antiviral and anticancer proteins produced in our bodies, and we are trying to find out how they do their job by studying the way interferons affect gene expression.
In this laboratory activity, students will learn how DNA restriction analysis can be used for forensic applications in this case to analyze evidence from a fictitious crime scene. Restriction enzymes bind to specific sequences of bases and then cut the DNA at that site. For example, restriction enzyme Apa L1 recognizes the sequence GTGCAC cuts between the first G and the T. The DNA fragments resulting from a restriction digest can be separated by size using agarose gel electrophoresis. Since DNA fragments have a negative charge they are pulled through the gel by the electric current. The gel is full of holes that are different sizes so it sorts the pieces of DNA by size as they move toward the positive electrode. The larger the DNA fragment, the more slowly it will pass through the gel since there will be a greater number of holes that are too small for it to pass through. Therefore, the smaller fragments will travel farther through the gel than the larger pieces.
Pre-Lab Activities
In preparation for the laboratory, students will work in groups to simulate DNA restriction analysis using a DNA sequence written on paper. The paper sequence will be cut at the restriction enzyme recognition site, and the resulting DNA fragments will be placed on a diagram of a gel to simulate gel electrophoresis. This activity provides students with the opportunity to investigate the use of restriction enzymes and gel electrophoresis to see similarities and differences among DNA molecules. The objectives are:• To model DNA restriction analysis.• To demonstrate how DNA restriction analysis can be used to identify DNA fragments.• To analyze how to analyze the results of a DNA restriction analysis.
Materials per team
• A pairs of scissors• Five sets of base sequences ( paper DNA strips)• One roll of tape• A piece of poster paper
Pre-Lab Engagement (5 minutes)Tell the students that they are now part of a forensics team and that their job is to solve the crime on the basis of the evidence that will be given to them.
Pre-Lab Exercise (20 minutes)Instruct each group to give a name to each of the suspect DNAs and then circle the Apa LI restriction enzyme recognition sites (GTGCAC) on each DNA strip. Tell the students to cut between the first G and the T of the recognition site and to label each piece with the name given to that DNA. (Keeping all of the pieces labeled is an important part of the exercise.) Provide each group with a piece of poster paper to serve as a gel for displaying the DNA fragments according to their size. The DNA fragments should be taped on the gel at positions corresponding to their size with all the fragments that are cut from one DNA strip displayed in a single lane of the gel.
Pre-Lab Explanation (20-30 minutes)Provide a "Final Report" handout to each group. After each group has finished putting the DNA fragments on the chart, have each team fill out the Final Report Form. Lead a class discussion about their conclusions, and the process they employed to obtain evidence based on the DNA restriction analysis. Possible discussion questions include:
• This process is often referred to as DNA fingerprinting. Why do you think this term isused? (because different DNAs have their own unique pattern)
• Why use DNA as evidence? (because it is available and each persons DNA is unique to them)• What purpose do the restriction enzymes serve? (they cut specific DNA sequences)• Does a match of the suspect DNA fragments with the crime DNA fragments mean the
suspect is guilty? Why or why not? (You need to do multiple DNA tests to get a fingerprint that matches only one person. Also, the suspect may have left his DNA at the crime scene before the crime was committed.)
Emphasize that the distinguishing characteristic of DNA is the sequence of nucleotide bases. Note that the technique modeled does not involve sequencing the DNA. The technique, DNA restriction analysis, provides indirect evidence that sequences of DNA samples are the same or different from one another. If the restriction enzymes cut the DNA samples into identical size fragments, the DNA samples are probably the same. If the restriction enzymes cut the DNA samples into different size fragments, the DNA samples are definitely different.AssessmentGive an index card to each student. Have them describe in their own words what they learned today and discuss briefly other applications for which DNA restriction analysis could be used.
Predicted ResultsSuspect 1: 12, 39, 9Suspect 2: 29, 31Suspect 3: 8, 24, 19, 13Suspect 4: 20, 20, 24Crime Scene: 20, 20, 24
Suspect 1ATGGCTGAACAGTGCACTCCTCAGGCTTTGTATTTGAGCAATATGCGGAAGTGCACGAAGTACCGACTTGTCACGTGAGGAGTCCGAAACATAAACTCGTTATACGCCTTCACGTGCTTC
Suspect 2AAAACCATGCACCGATACACACTGGAAAGTGCACGAACTTGCCAGTTTTGTCCTCAGTTTTTTTGGTACGTGGCTATGTGTGACCTTTCACGTGCTTGAACGGTCAAAACAGGAGTCAAA
Suspect 3ATAGTGCACAGAACTCCAGAAGACATTGTGCACCCTACTAATGGGAGTGCACATCATTTTTATCACGTGTCTTGAGGTCTTCTGTAACACGTGGGATGATTACCCTCACGTGTAGTAAAA
Suspect 4CGGGAGATCATCCACGTGCACTCATCGACAGAAACGTGCACGCCACCCTGGAAAGCCAGAGCCCTCTAGTAGGTGCACGTGAGTAGCTGTCTTTGCACGTGCGGTGGGACCTTTCGGTCT
Crime SceneCGGGAGATCATCCACGTGCACTCATCGACAGAAACGTGCACGCCACCCTGGAAAGCCAGTGCCCTCTAGTAGGTGCACGTGAGTAGCTGTCTTTGCACGTGCGGTGGGACCTTTCGGTCA
Suspect 1ATGGCTGAACAGTGCACTCCTCAGGCTTTGTATTTGAGCAATATGCGGAAGTGCACGAAGTACCGACTTGTCACGTGAGGAGTCCGAAACATAAACTCGTTATACGCCTTCACGTGCTTC
Suspect 2AAAACCATGCACCGATACACACTGGAAAGTGCACGAACTTGCCAGTTTTGTCCTCAGTTTTTTTGGTACGTGGCTATGTGTGACCTTTCACGTGCTTGAACGGTCAAAACAGGAGTCAAA
Suspect 3ATAGTGCACAGAACTCCAGAAGACATTGTGCACCCTACTAATGGGAGTGCACATCATTTTTATCACGTGTCTTGAGGTCTTCTGTAACACGTGGGATGATTACCCTCACGTGTAGTAAAA
Suspect 4CGGGAGATCATCCACGTGCACTCATCGACAGAAACGTGCACGCCACCCTGGAAAGCCAGAGCCCTCTAGTAGGTGCACGTGAGTAGCTGTCTTTGCACGTGCGGTGGGACCTTTCGGTCT
Crime SceneCGGGAGATCATCCACGTGCACTCATCGACAGAAACGTGCACGCCACCCTGGAAAGCCAGTGCCCTCTAGTAGGTGCACGTGAGTAGCTGTCTTTGCACGTGCGGTGGGACCTTTCGGTCA
DNA Instructions1. Make up a name for each of your DNA samples. One sample is already labeled “Evidence”. Turn the paper strip with the DNA base sequences over so the side with the bases is facing you. Use your scissors (restriction enzymes are molecular scissors) to cut your DNA samples only where you see this base pattern GTGCAC on the top strand. Cut between the first G and the T. Label each of the pieces with the name of that DNA sample so that you can keep track of the source of each fragment.
2. A base pair consists of two complementary bases. Record the number of base pairs in each piece on the blank side of the DNA fragment.3. Make a chart like the one below for your group. Tape your DNA sequences on the chart according to the number of base pairs. Follow the example below.
Sample1 Sample 2 Evidence Sample 3 Sample 4 Size
30
29
28
27
26
////
5
4
3
2
1
Crime Lab Report
Names of investigators:
Name of the DNA matching the evidence:
Explain how you came to this conclusion.
Crime Lab Visit
During the visit to the University of South Carolina SCienceLab, students will have the opportunity to perform a restriction enzyme digest and separate the resulting DNA fragments by agarose gel electrophoresis. The class will be given a crime scenario and asked how they can use DNA technology to determine which suspect’s DNA matches the evidence.
I. Restriction Enzyme DigestAdd the two suspect DNAs and the DNA from the evidence to separate microcentrifuge tubes containing water, buffer, and enzyme. Incubate the samples at 37°C for 60 minutes.
II. Gel Preparation
1) Add 50 ml of electrophoresis buffer to a flask containing 0.6 g of agarose.
2) Dissolve the agarose by boiling the mixture in a microwave oven. One of the staff will melt the agarose for you and give it back to you when it has cooled enough to use.
3) Place the gel tray in the gel box so that the gaskets are pressed tight against the sides of the gel box.
4) Pour all 50 ml of melted agarose into the gel tray and place a comb in the slot at one end to form the sample wells.
III. Prepare the gel electrophoresis box1) After the gel hardens, turn the gel in the electrophoresis box so that the sample wells are
closer to the negative (black) pole.
2) Slowly pour DNA electrophoresis buffer into the electrophoresis box. Fill the electrophoresis box until the tops of the sample wells are just covered with buffer.
IV. Practice Loading Samples and running a gel
1) Practice loading food coloring into the wells of a test gel. Notice that it is easier to keep the food coloring in the tubes labeled with a G (containing glycerol) in the wells of the gel.
2) Put the lid in place and turn on the power. Set the voltage at 100 and watch how the dyes migrate at different rates.
V. Prepare and load the samples1) Add 2 µl of loading dye to each of the DNA samples.
2) Carefully pipette all of the digested crime DNA and the two suspect’s DNA into separate wells of the gel.
3) Connect the cables and run the gels at 100 volts until the blue portion of the loading dye migrates about 30 mm from the wells.
VI. See the DNARemove the gel from the electrophoresis box and place it on a light box to see the DNA.
InterpretationResults will vary since two different DNAs were used as the evidence. In either case, one pattern of DNA bands resulting from the restriction analysis of the suspects should match the pattern derived from the crime scene evidence. To facilitate discussion, discuss a representative gel. Some sample questions include: "What can be inferred from the results of the tests?" and "Can you presume guilt by showing that the bands of DNA match after restriction analysis?"
Sample Preparation
A) DNA Sample Preparation
Pipette 0.5 µl of DNA (pBR322 or pUC19) into a microfuge tube containing 4.5 µl of distilled water. Prepare one of each type per group as the two suspect DNAs. Prepare the DNA for the evidence in the same manner. Half of the groups should get pBR322 DNA as the DNA from the evidence and half should get pUC19 DNA.
B ) Restriction Enzyme CocktailPipette 1 µl of NEB Buffer 4 and 0.5 µl of ApaL1 restriction enzyme into a microfuge tube containing 3.5 µl of distilled water. Each group will need 3 tubes.
Laboratory Station Set-Up
• gel box with 2 combs and tray• DNA electrophoresis buffer• yellow tips• micropipette• used tip container• tubes containing food coloring with and without added glycerol (labeled with a G)
Data/Observation sheetI. Restriction Digest
1. What is the function of the restriction enzyme?
2. Why are the samples put into the incubator?
II. Preparation of the Agarose Gel
1. What is the function of the agarose gel?
2. Predict what would happen if you used 0.06 g of agarose instead of 0.6 g. What effect would that have on your experiment?
3. What is the function of the gel comb?
IV. Preparation of the Gel Electrophoresis Box:
1. Predict what would happen if you put the wells of the gel at the positive pole.
2. What is the function of the electrophoresis buffer?
V. Loading the Samples:
1. What would happen if you did not add dye to the samples?
2. Describe what is occurring in the gel when the electric current is applied.
VI. Results:Draw a picture of the gel to record where you loaded each sample and the DNA bands that you observed.
Data/Observation sheet with possible answersI. Restriction Digest1. What is the function of the restriction enzyme?
To cut the DNA at specific places in the DNA sequence
2. Why are the samples put into the incubator?
Because the restriction enzyme works better at 37 C
II. Preparation of the Agarose Gel
1. What is the function of the agarose gel?
To provide a way of separating the DNA fragments by size
2. Predict what would happen if you used 0.06 g of agarose instead of 0.6 g. What effect would that have on your experiment?
The gel would not harden so you could not load your DNA samples
3. What is the function of the gel comb? To make the sample wells
IV. Preparation of the Gel Electrophoresis Box:
1. Predict what would happen if you put the wells of the gel at the positive pole.
The DNA would go the wrong direction and migrate off of the gel
2. What is the function of the electrophoresis buffer? To conduct the electricity
V. Loading the Samples:
1. What would happen if you did not add dye to the samples?
The dye makes the DNA heavy so that it does not float away
2. Describe what is occurring in the gel when the electric current is applied. The DNA is pulled through the gel by the electric current.
Crime Lab Post-Laboratory Activities
THE GREAT DEBATE
SHOULD SOUTH CAROLINA HAVE A FORENSIC GENETIC DATABANK?
Issues:
Should all convicted criminals be included in the forensic genetic database?
Should everyone in the state be included in the forensic genetic database?
Should there be a forensic genetic database at all? When should a sample of DNA be taken? (At arrest or conviction).
Panel Discussion:Choose one of the following roles and take the point of view you believe the person you represent would actually take on the issues:
Public defender Prosecutor ACLU Spokesperson SLED Investigator Coroner Mother Civil Rights Protector
You Decide:
1. Explain the problem of deciding who should have access to genetic test results.
2. Examine the pros and cons of keeping genetic test results private. List reasons to maintain privacy. List reasons why test results should be shared.
3. Create a list of rules to control access to genetic information. Who should have access, and under what circumstances? Explain your reasoning.
Crime Lab Post-Laboratory Activities
Deducing Family Relationships from Genetic DataShort tandem repeat (STR or microsatellite) data are often used in paternity and missing persons cases. Below you will find some actual STR data from 7 different people at 9 different loci. See if you can deduce any family relationships among the subjects. Remember that each person gets one allele from their mother and one from their father. Also, in a paternity case, if the child and the possible father do not match at even one locus, then the father son relationship is false.
LocusPerson Sex Age 1 2 3 4 5 6 7 8 9M F 76 15,16 16,18 22,26 13,14 29,33 14,14 11,12 12,13 7,8Y F 57 15,15 17,17 21,22 13,15 31,32 13,18 9,11 10,14 9,11N M 36 15,18 17,17 22,23 12,13 27,31 12,18 9,12 12,14 11,12L F 37 15,16 17,17 21,22 11,13 32,33 14,18 11,11 9,14 7,11S M 38 15,18 16,18 21,22 11,13 28,31 12,17 11,13 12,12 8,11B M 20 14,15 15,17 22,24 11,13 32,33 14,21 11,13 9,12 7,10J M 16 15,15 16,17 21,22 11,11 31,33 14,17 11,11 9,12 7,11
Discussion of Family Relationships from STR Data
Based on age, you might hypothesize that M is the mother of Y. However, this hypothesis is proven false by the data at locus 2, 5, 6, 8, and 9. In each case, M could not have provided one of the alleles observed in Y. In fact, locus 2 indicates that M could not be the parent of anyone except S and J. However, locus 5 excludes S and locus 4 excludes J. Thus, M is not the parent of anyone on the list.
In contrast, the age and STR data are consistent with Y being the parent of N and L. At each locus, one of the Y alleles matches one of the N alleles and one of the L alleles. Similarly, L could be the mother of B and J. Also, S could be the father of J but not B.
Could L and S be the parents of J? In this case, J would have to have inherited one allele at each locus from each of the presumptive parents. Careful inspection reveals that this condition did occur. For instance, at locus one J would have inherited allele 15 from each of his parents. At locus 2, J would have inherited a 16 from S and a 17 from L and so on. Thus, there is a good chance that J is the son of L and S.
Crime Lab Post-Laboratory Activities
Cloning a short tandem repeat (STR) sequence
Short tandem repeat sequences mutate at a high frequency because they have a repeated sequence that causes mistakes in DNA replication. The most common mistakes are to add or delete a repeat unit (a GT in the sequence in this exercise). If you were easily able to sequence the region containing the STR, you could accurately determine the number of repeats and also determine if any other base changes were present in the population. You have a cloning vector that contains a BamHI site. How could you clone a fragment of the sequence below that contains the containing the STR?
1 AATCGGATGAATTCGCATTTAGCTGTTATGTAGATCTAATTGGGGCCCCAATTTGGCAAT
61 CGTGCAATCCCGGGTTAAGCTTTGTGTGTGTGTGTGTGTGTGTGTGTGACTTGAAAAATT
121 ACTTGGCATGCCTAGTGAATTCGGATACACTAGGACTAGGATCGAACCCGGGATTCCCC
181 TTTGATTAAAAGAGATCTTTAACCCAAGCTTTTACCAGTCATGACTGACCTTACCCATTC
Here are the restriction enzymes that you have available in the laboratory:
Enzyme Site Enzyme Site Enzyme Site
EcoRI G’AATTC BamHI G’GATCC SmaI CCC’GGG CTTAA’G CCTAG’G GGG’CCC
HindIII A’AGCTT BglII A’GATCT DraI TTT’AAA TTCGA’A TCTAG’A AAA’TTT
SphI GCATG’C C’GTACG
Procedure:
Find the STR sequence and mark it to highlight its position.Find and label all the restriction sites that correspond to the enzymes listed above.Devise a strategy for cloning a fragment of DNA containing the STR into a vector containing
a BamHI site.Draw a diagram showing how the two sticky ends would fit together.
SOUTH CAROLINA SCIENCE STANDARDS MET BY THIS UNIT
UNIT OF STUDY: GENETICS
CLASS DESCRIPTION: HIGH SCHOOL
Science Standards addressed: (Day one and two)I. InquiryII.a.1.d. Discuss uses of technologies that enable in-depth studies of the cell such as microscopes, ultracentrifuge techniques, and radioscopy studies.II.a.2.a. Explain the role of enzymes in chemical reactions within the cell.II.B.1.d. Evaluate the impact of DNA technology on society (e.g., bioengineering, forensics, genome project, DNA fingerprinting).II.B.2.c. Discuss advancements in the study of heredity since Mendel including the chromosome theory.
English and Social Studies Standards.
Objectives: Identify a need for DNA restriction analysis Model the concept of DNA restriction analysis. Apply DNA restriction analysis to the identification of DNA fragments. Work cooperatively to analyze the results of the DNA restriction analysis.
DAY ONE: Restriction EnzymesActivity 1: Case of the Crown Jewels Dry Lab
DAY TWO:Activity 2: Visit to the University Crime Lab
DAY THREE:Activity 3: Follow-up from University Crime Lab visit to include one or more debates or Socratic Discussion.
DAY FOUR:Activity 4: Cloning
SOUTH CAROLINA SCIENCE STANDARDS MET BY THIS UNIT
UNIT OF STUDY: GENETICS
CLASS DESCRIPTION: MIDDLE SCHOOL
Science Standards addressed: (Day one and two)I. InquiryII.c.4.e. Discuss advantages and disadvantages of selective breeding, genetic engineering, and biomedical research.II.c.3.c. Analyze how traits are passed from parents to offspring through pairs of genes.English and Social Studies Standards.
Objectives: Identify a need for DNA restriction analysis Model the concept of DNA restriction analysis. Apply DNA restriction analysis to the identification of DNA fragments. Work cooperatively to analyze the results of the DNA restriction analysis.
DAY ONE: Restriction EnzymesActivity 1: Case of the Crown Jewels Dry Lab
DAY TWO:Activity 2: Visit to the University Crime Lab
DAY THREE:Activity 3: Follow-up from University Crime Lab visit to include one or more debates or Socratic Discussion.
DAY FOUR:Activity 4: Cloning
