Methylation of an ETS Site in the Intron Enhancer of the Keratin 18

MOLECULAR AND CELLULAR BIOLOGY,0270-7306/97/$04.0010

Sept. 1997, p. 4885–4894 Vol. 17, No. 9

Copyright © 1997, American Society for Microbiology

Methylation of an ETS Site in the Intron Enhancer of theKeratin 18 Gene Participates in Tissue-Specific Repression

AKIHIRO UMEZAWA,1 HIDEYUKI YAMAMOTO,2 KATHERINE RHODES,2 MICHAEL J. KLEMSZ,3

RICHARD A. MAKI,2 AND ROBERT G. OSHIMA2*

The Burnham Institute, La Jolla, California2; Keio University School of Medicine, Tokyo, Japan1;and Indiana University Medical Center, Indianapolis, Indiana3

Received 14 January 1997/Returned for modification 28 February 1997/Accepted 2 June 1997

The activities of ETS transcription factors are modulated by posttranscriptional modifications and cooper-ation with other proteins. Another factor which could alter the regulation of genes by ETS transcription factorsis DNA methylation of their cognate binding sites. The optimal activity of the keratin 18 (K18) gene isdependent upon an ETS binding site within an enhancer region located in the first intron. The methylation ofthe ETS binding site was correlated with the repression of the K18 gene in normal human tissues and in K18transgenic mouse tissues. Neither recombinant ETS2 nor endogenous spleen ETS binding activities bound themethylated site effectively. Increased expression of the K18 gene in spleens of transgenic mice by use of analternative, cryptic promoter 700 bp upstream of the enhancer resulted in modestly decreased methylation ofthe K18 ETS site and increased RNA expression. Expression in transgenic mice of a mutant K18 gene, whichwas still capable of activation by ETS factors but was no longer a substrate for DNA methylation of the ETSsite, was fivefold higher in spleen and heart. However, expression in other organs such as liver and intestinewas similar to that of the wild-type gene. This result suggests that DNA methylation of the K18 ETS site maybe functionally important in the tissue-specific repression of the K18 gene. Epigenetic modification of thebinding sites for some ETS transcription factors may result in a refractory transcriptional response even in thepresence of necessary trans-acting activities.

DNA methylation of the cytosine of CpG dinucleotides isessential for mouse development (31) and has been implicatedin differential gene regulation (11, 14, 21, 65), genomic im-printing (9, 20, 54, 62), and X chromosome inactivation (34,54). CpG dinucleotides, which are represented much less fre-quently in the mammalian genomes than expected from thenucleotide composition, are associated with CpG islandspresent on the 59 ends of many housekeeping genes, wheretheir methylation can result in gene silencing. SP-1 transcrip-tion factor binding sites are necessary for keeping CpG islandsfree of methylation (6, 33). While the methylation of CpGdinucleotides of SP-1 binding sites does not prevent the bind-ing of the transcription factor (24), other transcription factorsare sensitive to the methylation state of the binding site (19, 32,41, 66). Thus, DNA methylation provides a possible mecha-nism of altering the occupancy of regulatory elements associ-ated with developmentally regulated genes, directly by chang-ing the interaction between transcription factors and theirbinding sites or indirectly by altering chromatin conformationor competition with methyl-CpG binding proteins (4, 30, 35,38).

The conserved ETS DNA binding domain defines a largefamily of transcription factors (27, 63). ETS members generallycooperate with other transcription factors in activating or re-pressing specific genes. Thus, Ets-1 and Ets-2 cooperate withAP-1 (64) but also interact with other factors such as Pax5 (17);GABPa specifically binds its heteropolymeric partner, GABPb(7); Elk-1 interacts with SAP-1 to mediate gene activation inresponse to serum (61); and PU.1 interacts with NF-EM5 (55).Ets-1 and Ets-2 both contain a domain utilized by the Drosoph-

ila pointed gene to mediate signals of the ras signal transduc-tion pathways. Both ETS and AP-1 have been implicated in thetissue-specific expression of the keratin 18 (K18) gene (45, 50,51).

Both mouse K18 (mK18 or EndoB) and human K18 code fora type I keratin intermediate filament protein (44, 46, 57) firstexpressed at the eight-cell stage of mouse embryogenesis andsubsequently localized to the trophectoderm and extraembry-onic endoderm of blastocysts and early postimplantation stages(8, 25, 43, 47). In adults, K18 is found in most “simple” orsingle-layered epithelia, including intestine, lung, liver, mam-mary gland, and uterus, but is not normally found in skeletalmuscle, heart, or lymphoid tissues such as spleen (36). Fur-thermore, K18 expression persists in most tumors and metas-tases derived from simple epithelia, making it a useful markerfor distinguishing carcinomas (36, 46).

In transgenic mice, DNase I-hypersensitive, regulatory re-gions are found upstream of the K18 gene, near the proximalpromoter, the first intron enhancer, and the sixth exon (40).The first intron enhancer acts as an oncogene-responsive ele-ment mediating transcriptional stimulation by nonnuclear on-cogenes through the ras signal transduction pathway and mayparticipate in the persistent expression of K18 in carcinomas(50). This oncogene response element is dependent upon bothAP-1 and an ETS binding site for Fos/Jun and ETS members.Inactivation of the enhancer results in 85% less K18 RNA inthe livers of transgenic mice (55a).

While ETS and AP-1 are important for the activation of theK18 enhancer, the widespread expression of these factors doesnot coincide with the expression pattern of K18. One cis-actingmechanism which may restrict K18 expression is DNA meth-ylation. The mouse and human K18 genes have a CpG-likeisland that extends over the proximal promoter and first exon.Expression of K18 in transgenic mice is correlated with thedifferential methylation of restriction enzyme sites within the

* Corresponding author. Mailing address: The Burnham Institute,10901 North Torrey Pines Rd., La Jolla, CA 92037. Phone: (619)646-3147. Fax: (619) 646-3193. E-mail: [email protected].

4885

first intron and the sixth exon, both of which are involved in thetranscriptional regulation of the gene (40, 59). However, theCpG-rich region encompassing the first exon is not methylatedin either expressing or nonexpressing tissues. Thus, the firstintron appears to be a zone of transition from an unmethylatedCpG island to the body of the gene, in which infrequent CpGsare generally methylated. Here we present evidence for differ-ential methylation of a specific binding site for ETS transcrip-tion factors in the enhancer of the K18 first intron. The meth-ylation state of this site correlates inversely with the activity ofthe K18 gene. This correlation extends to two mutant K18genes which either are expressed higher in normally nonper-missive tissues or are silent in all tissues. The binding of bothrecombinant Ets-2 and endogenous ETS factors is sensitive tothe methylation state of the binding site. Furthermore, wetested the importance of the methylation of the K18 ETS siteby generating transgenic mice containing a K18 gene with amutation which prevents methylation of the ETS site but stillpermits binding of the Ets-2 transcription factor. Transgenicmice containing this mutation express increased K18 RNA inheart and spleen but normal levels in liver and intestine. Theseresults indicate that differential methylation of a single ETSsite within the K18 enhancer may play a pivotal and active rolein suppressing K18 activity in nonpermissive tissues.

MATERIALS AND METHODS

K18 recombinant constructions. Mutation of the CpG within the ETS bindingsite of the K18 intron enhancer was accomplished with the Promega mutagenesiskit. A PCR fragment of the first intron (bp 3254 to 3402; Genbank accessionnumber M24842) was cloned into the pAlter plasmid and mutated by using themutant primer CCACATCCTGTTAACCCTCC as instructed by the manufac-turer. The fragment was reintroduced into the K18 gene by the use of two StuIsites within the intron and the PCR fragment in two steps and without theintroduction of other changes in the nucleotide sequence. The integrity of theK18 gene was confirmed by sequencing the mutant fragment.

Oligonucleotides and DNA binding site selection. DNA binding sites for Ets-2were selected by several cycles of band-shift analysis and PCR of the boundDNA. The four oligonucleotides used for binding site selection were 59-ATCGTCGACTCTAGA(N16)GGATCCAGATCTACTAG-39, 59-GGATCCATTGCTCTG(N16)GTTAGTGTAGGAATTC-39, 59-AGACGGATCCATTGC(N16)GTFTAGGAATTCGGA-39, and 59-AGACGGATCCATTGCTCTGA(N4)GGAA(N4)GTTAGTGTAGGAATTCGGA-39, where N represents any one of thefour nucleotides.

Complementary primers for the Klenow reactions and PCRs were as indicatedby the underlined portions of the oligonucleotides described above. All oligo-nucleotides were synthesized on an Applied Biosystems (Foster City, Calif.)model 380A DNA synthesizer and purified by using Applied Biosystems purifi-cation cartridges. For binding site selection, the full-length degenerate oligonu-cleotides and the complementary 39 primers were labeled with T4 polynucleotidekinase and [g-32P]ATP, heated for 5 min at 95°C, and allowed to anneal at roomtemperature for 15 min. The full-length second strand was synthesized by usingthe Klenow fragment of DNA polymerase I. After isolation of the labeleddouble-stranded oligonucleotide from an 8% native acrylamide gel, approxi-mately 50 to 100 ng of DNA was incubated in a band-shift reaction mixturecontaining final amounts of 1 mg of poly(dI z dC), 75 mM NaCl, 20 mM HEPES(pH 7.9), 0.5 mM EDTA, 1 mM dithiothreitol, and the appropriate amount ofprotein in a volume of 30 ml. Samples were incubated for 20 min at roomtemperature and then loaded onto an 8% native acrylamide (ratio of 30:1) gelcontaining 22.5 mM Tris-borate buffer, 0.5 mM EDTA, and 5% glycerol. ForEts-2, an in vitro-transcribed and -translated minimal DNA binding domainprotein was used. In vitro translation was carried out with rabbit reticulocytelysate (Promega Biotec, Inc., Madison, Wis.) as recommended by the manufac-turer. After the gel electrophoresis, the bound and free DNAs were visualized byautoradiography. The appropriate bound complex was isolated from the gel bythe crush-soak method in Tris-EDTA for 12 to 16 h at 37°C, followed bypurification over an Elutip-D Column (Schleicher & Schuell, Inc., Keene, N.H.)according to the manufacturer’s recommendations. The purified DNA was mixedwith approximately 100 ng of the 59 and 39 primers labeled with [g-32P]ATP andT4 kinase and amplified by PCR. The conditions for PCR were 94°C for 2 min,61°C for 2 min, and 72°C for 1 min for 30 cycles with a Perkin-Elmer Cetus(Norwalk, Conn.) DNA Thermal Cycler. The PCR material was purified on an8% native acrylamide gel. One-half of the material was used either in a subse-quent round of band-shift analysis or at the end of three cycles, restrictiondigested with the appropriate enzymes, and ligated into the sequencing vectorBluescript KS1 (Stratagene, La Jolla, Calif.) for sequence analysis.

Transgenic mice. K18TG1 and K18TG2 transgenic mice have been character-ized previously (1, 40, 60). K18dP1 and K18dP6 mice were generated from K18genes containing either 376-bp (bp 2282 to 2688) or 447-bp (bp 2211 to 2688)deletions, respectively, and will be described fully elsewhere (55a). Transgenicmice carrying a 2-bp change in the ETS binding site of the K18 gene (K18m2Ets)were generated as previously described by microinjection of the K18m2Ets con-struct into the pronucleus of FVB/N fertilized mouse embryos by standardmethods (1). Digestion with HindIII was used to free the gene from the plasmidbackbone sequences. Founder animals were identified by dot blot analysis withthe first exon on the K18 cDNA as a probe. Founder animals were bred at leastonce to eliminate mosaic founder animals.

Genomic sequencing. Genomic sequencing was carried out as previously de-scribed (53). DNAs from different tissues were subjected to the Maxam-Gilbertsequencing reaction chemistry. Ligation-mediated PCR (LMPCR) was per-formed as described previously (37). After 18 cycles of exponential amplificationof the ligation products, one or two cycles were performed with a radioactiveprimer to visualize the products. DNA fragments were separated on a sequenc-ing gel consisting of 6% polyacrylamide and 7 M urea and revealed by autora-diography. Oligonucleotide primers were used for the Sequenase extension re-action (primer 1), the PCR amplification reaction (primer 2), and the labelingreaction (primer 3). All of the primers were purified by use of an oligonucleotidepurification cartridge (Applied Biosystems Inc.). Primer 3 was also purified froman acrylamide gel after electrophoresis. Primer set B was used for analysis of theupper strand, while primer set C was used for the lower strand. The positions ofthe primers, relative to the start of transcription (GenBank bp 2533 5 11), areas follows: B-1, 1682 GGACAGGGTTGAGAGCTTTAC; B-2, 1714 ACAGCATGGAGGGAGGTAAGGAAAGG; B-3, 1714 ACAGCATGGAGGGAGGTAAGGAAAGGCCTG; C-1, 1964 CTGCCTGCCCAGAAGTGAGTC; C-2,1923 CTGGCCCTCTCCTGGCATTTTTTCC; and C-3, 1923 CTGGCCCTCTCCTGGCATTTTTTCCCTA.

CpG methylation status determination by bisulfite chemical modification.DNA, purified by standard methods, was subjected to modification by bisulfite asdescribed previously (10, 18). The plus-strand, sense primer was TGA TAT GGAGGG AGG TAA GGA AAG GT (bp 1715 to 1740), and the antisense primerwas ACA CCT AAT CAC TCT AAA CCC CCT AC (bp 1893 to 1868); thus,the amplified product is from bp 1715 to 1893. The amplified DNA was clonedinto plasmid pGEM-T (Promega), and multiple independent isolates were se-quenced with an A.L.F. DNA sequencer (Pharmacia). In this reaction, all un-modified C residues are converted to signals for T, while methylated C residuesare resistant to modification and result in C signals.

Gel mobility shift assay. Gel mobility shift assays were performed as describedpreviously (23, 51). Annealed double-stranded oligonucleotides were labeled bythe fill-in reaction of Sequenase version 2 (U.S. Biochemicals) in the presence ofradioactive dCTP on the AGCT extensions added to each of the oligonucleo-tides. The upper strand of the oligonucleotide was: agctGGGTTAAGmCGGATGTGGC, where methylated C is represented by mC and the lowercase nucleo-tides were used for labeling. Methylated nucleotides containing 5-methylcytosinewere synthesized by Ransom Hill Bioscience, Inc. (Ramona, Calif.) and bySci-Media, Ltd. (Tokyo, Japan). Liver and spleen nuclear extracts were preparedas described previously (23). Preliminary experiments determined the optimalconcentration of poly(dI z dC) nonspecific competitor used with each probe.Reaction mixtures were separated by electrophoresis in 5% nondenaturing poly-acrylamide gels and visualized by autoradiography.

RNA analysis. RNA was prepared from dissected frozen tissues as previouslydescribed (1, 58). K18 RNA was measured with the use of an RNase protectionmethod utilizing a probe containing 218 nt of the K18 cDNA (nucleotides [nt]868 to 1081). The ScaI-BamHI fragment of the cDNA was cloned into pGEM1,digested with EcoRI, and transcribed with SP6 polymerase. Preparation of syn-thetic standard K18 RNA has been described previously (48). L32 ribosomalgene RNA was measured simultaneously. A 147-bp fragment of the L32-4A gene(nt 103 to 250) (15) was amplified by PCR with primers containing EcoRI andBamHI sites and cloned into pGEM1. Digestion with EcoRI and transcription bySP6 polymerase yields a 187-nt probe. The inclusion of the L32 probe permittedstandardization of the amount of RNA of any one particular organ. However, theexpression of L32 RNA varies significantly in different organs, so K18 signalswere standardized only to all samples of the same organ and not between organs.

RESULTS

Unlike most transgenes, K18 is expressed in all appropriatetissues of every transgenic animal, indicating that its expressionis independent of presumed random sites of integration. Ec-topic expression of the transgene in brain was one of the fewexceptions to concordance of the tissue specificity of the mouseand transgenic human K18 genes (58, 59). The level of K18RNA in a variety of adult tissues is directly proportional to thenumber of transgenes integrated. The RNA is expressed atlevels per gene equivalent to those for endogenous mouse K18

4886 UMEZAWA ET AL. MOL. CELL. BIOL.

genes (1, 39). Furthermore, all of the multiple copies of theK18 gene in transgenic mice contain DNase-hypersensitivesites within the first intron (59) which have been correlatedpreviously with the intron enhancer element (40, 50). Thissupports the view that all or nearly all of the multiple, tandemlyarranged copies of the K18 gene in transgenic mice are active.Thus, analyses of the chromatin and methylation state of thegene are not seriously complicated by silent copies of thetransgene.

CpG methylation of the intron enhancer. The method ofLMPCR combined with the resistance of methylated C resi-dues to chemical modification by the hydrazine reaction usedin the Maxam-Gilbert method of DNA sequencing was used todetermine the methylation status of all C residues within agenomic sequence (52, 53). Purified tissue DNA is reacted with

hydrazine, cleaved by the subsequent action of piperidine, am-plified and labeled by LMPCR, and displayed on a sequencinggel. The absence of expected C residues indicates resistance tocleavage and thus complete methylation of the sequence in allcopies of the gene of interest. The first intron of the transgenicK18 gene represents a transition zone between an unmethyl-ated CpG island and fully methylated CpG sites within thebody of the gene (40). Within the first intron of the K18 genethere are only six CpG dinucleotides (Fig. 1). The methylationstates of the first three sites (nt 1569, 1602, and 1604) havebeen assessed previously by sensitivity to restriction enzymedigestion. The HpaII site at nt 568 is cut to completion, andthus is not modified, in DNAs from both transgenic liver, inwhich K18 is expressed, and spleen, in which K18 is silent (40).However, the second site, an HhaI site (nt 603), was sensitive

FIG. 1. (A) Map of the K18 gene, with exons represented by filled boxes. Vertical arrows refer to DNase-hypersensitive sites detected in K18 transgenic liver butnot spleen. Positions of the primers used for LMPCR are indicated in the expanded portion of the first intron with the ETS and AP-1 sites of the enhancer. Belowthe map is indicated the usage of CpG dinucleotides over the sequenced portion of the gene. (B) Sequence of the first intron, with CpG dinucleotides in boldface. The47-bp sequence conserved between the human and mouse gene is underlined, as are known regulatory elements of the intron. N-a, N-b, and N-g, positions of threenegative regulatory elements which function in embryonic cells. Nucleotide numbers are relative to the start of transcription. (C) Changes in the K18 intron ETS siteare shown in boldface. The mETS mutation abolishes Ets-2 binding and greatly diminishes the activity of the enhancer (50). The m2Ets mutation preserves Ets-2 bindingbut destroys the C-797 methylation site. WT, wild type.

VOL. 17, 1997 REGULATION OF K18 BY METHYLATION OF AN ETS SITE 4887

to digestion only when the DNA was isolated from liver, butnot spleen, indicating that either or both of the CpG dinucle-otides overlapping this site are differentially methylated. Ad-ditional HpaII and HhaI sites within the remainder of the geneare completely resistant, with the exception of the regulatoryelement located within exon 6, which is partially methylated(40). Within the first intron, two additional CpGs lie within the100-bp transcriptional enhancer (nt 1770 and 1797), and oneadditional CpG is present at nt 1942 in a portion of the intronwhich has no known regulatory function.

The two CpGs within the enhancer fragment were examinedin detail by the LMPCR method. Both C residues were meth-ylated in DNA from K18 transgenic spleen but not liver (Fig-ures 2A and B and 3). The reciprocal C residues of the CpGdinucleotides of the opposite strands were also methylated(Fig. 2C). The same pattern was also found in a second, inde-pendent K18 transgenic line. Thus, the less methylated state ofboth CpGs was found in a tissue that expressed the transgene.The low signal of the methylated C within the ETS site oftransgenic spleen DNA indicates that most or all copies of theK18 transgene are similarly methylated.

In order to assess whether a quantitative estimate of thedegree of methylation could be made, different proportions ofK18TG2 liver and spleen DNAs were mixed, subjected tochemical treatment, and analyzed by LMPCR with Vent poly-merase. As the amount of K18TG2 spleen DNA becamegreater, the relative intensities of C-770 and C-797 decreased(Fig. 3A, lanes 2 to 6) relative to those of neighboring Cresidues not found in CpG dinucleotides (Fig. 3A, C1, C2, andC3). This reconstruction and repeated analysis of samples (Fig.3B, compare lanes 2 and 7 and lanes 6 and 8) indicated thatdifferences of about 10% were distinguishable.

The generation of two other types of K18 transgenic micehas permitted the extension of the correlation between expres-

sion and methylation of the two CpGs of the intron enhancer.K18dP1 transgenic mice express 10- to 30-fold-higher levels ofK18 RNA per gene due to an alternative promoter and itsinteraction with the intron enhancer (55a). The elevated levelof expression also results in easily detectable levels of K18RNA in spleen. The DNA methylation patterns of the twoCpGs in the intron enhancer of transgenic K18dP1 liver andspleen are shown in Fig. 3A, lanes 9 and 10. DNA fromK18dP1 liver (lane 9), like K18 liver DNA, had strong signalsfor both C-770 and C-797 residues, indicating a relatively un-methylated state. However, the K18dP1 spleen DNA resultedin a signal about twofold stronger than that of K18TG2 spleenor K18dP6 spleen DNA (Fig. 3, lane 10 and bar 10, comparedto lanes and bars 6, 8, and 12). This indicates substantially lessDNA methylation. The elevated signal of C-797 in K18dP1spleen correlated well with increased RNA expression inspleens of these mice.

A third type of transgenic mouse contains an inactivatedK18 gene and is represented by K18dP6. This gene is tran-scriptionally silent in all tissues due to the deletion of thepromoter region (55a). K18dP6 spleen DNA was nearly fullymethylated, resulting in a weak C-797 signal similar to that inK18TG2 spleen samples (Fig. 3, lane 12 and bar 12). In theabsence of active transcription, the degree of methylation ofliver DNA increased, resulting in a decreased C-797 signal(Fig. 3, lane 11 and bar 11). However, interestingly, eventhough no K18 RNA is detectable in the livers of these mice,the methylation of C-797 was not complete. Transcriptionalsilence results in increased but not complete methylation inliver. The incomplete methylation of C-797 may reflect partialprotection by transcription factor binding in K18dP6 liver,even in the absence of a promoter. Furthermore, in analysis ofK18TG2 heart DNA, the LMPCR method detected a signifi-cant signal for C-797 which when normalized to that of neigh-

FIG. 2. LMPCR analysis of cytosine methylation in the enhancer region of the K18 first intron. (A) LMPCR products of hydrazine- and piperidine-reacted liverand spleen DNAs from K18TG1 transgenic mice. Arrows indicate the positions of CpG dinucleotides. C-specific reactions were performed on plasmid DNA containingthe K18 first intron for an unmethylated control (lane 1), genomic DNA from TG1 liver (lanes 2 and 3, duplicate reactions), and genomic DNA from TG1 spleen (lanes4 and 5, duplicate reactions). LMPCR on the plus strand was performed with primers C-1 to C-3 with Taq DNA polymerase. Two cytosines (C-770 and C-797) failedto produce signals from transgenic spleen DNA, which is indicative of extensive methylation. Additional signals flanking C-770 and C-797 were usually observed whenthe target C was methylated (53). (B) LMPCR products of hydrazine- and piperidine-reacted liver and spleen DNAs from K18TG2 transgenic mice. Arrows indicatethe positions of CpG dinucleotides. (C) C-specific reactions were performed on plasmid DNA containing K18 intron 1 (lane 1), genomic DNA from K18TG1 liver (lane2), and genomic DNA from K18TG1 spleen (lane 3). Genomic sequencing on the minus strand was done by using primers B-1 to B-3 with Taq DNA polymerase. TwoCpG sites were found to be methylated in spleen DNA (indicated on the right), while these were unmethylated in liver DNA.


boring C residues corresponded to approximately 50% meth-ylation (data not shown). Thus, while there is a goodcorrelation between the degree of methylation of C-797 andthe level of expression of the K18 transgene, this correlation isnot universal, as a silent gene in permissive liver is not fullymethylated and a competent wild-type K18 gene is not fullymethylated in a tissue which expresses little K18 RNA.

Methylation of C-797 in normal, nontransgenic tissues. Inorder to examine the status of the K18 gene in its endogenousstate, and to confirm the accuracy of the LMPCR method,human and K18 transgenic mouse tissues were analyzed by thebisulfite chemical modification method (10, 18), in which meth-ylated C residues result in a positive sequencing signal ofindividual cloned PCR products. The results for the methyl-ation status of C-770 and C-797 are shown in Table 1. Liverhad the least methylation of the tissues analyzed. Only 1 clone

of 11 derived from human liver DNA was found to be meth-ylated. In contrast, human heart, spleen, and brain DNAs weresubstantially methylated on C-797. Thus, the methylation sta-tus of C-797 and, to a lesser extent, C-770 was also inverselycorrelated with K18 expression in endogenous tissues. Theintermediate status of kidney may be influenced by the com-posite nature of this tissue, which includes both epithelial andnonepithelial components. Analysis of K18TG2 transgenicspleen DNA by this method confirmed that C-797 of the trans-gene was highly methylated and that K18TG2 liver DNA waslargely unmethylated at C-797. However, transgenic K18 heartDNA was found to be less methylated than in human tissue.This result was confirmed with the LMPCR analysis of trans-genic DNA. The inefficient expression of K18 RNA in trans-genic heart must reflect additional mechanisms of K18 repres-sion. However, a primary role in some tissues such as spleen ispossible.

Decreased binding of ETS to a methylated K18 enhancerETS site. To determine if binding of ETS factors to the K18enhancer was sensitive to methylation of the site, electro-phoretic mobility shift experiments were performed with dou-ble-stranded synthetic oligonucleotides containing either awild-type or a methylated CpG. The recombinant Ets-2 DNAbinding domain bound to the control unmethylated oligonu-cleotide and was specifically competed with unlabeled oligo-nucleotide (Fig. 4A). The methylated oligonucleotide com-peted with the unmethylated oligonucleotide much lessefficiently. This indicates that methylation of the ETS site de-creases the affinity of binding of the recombinant Ets-2 DNAbinding domain. Endogenous ETS binding activity was alsodetected in spleen nuclear extracts (Fig. 4B), and this activitywas also competed effectively by unlabeled ETS oligonucleo-tide and much less effectively by methylated ETS oligonucle-otide.

The use of a radiolabeled methylated ETS oligonucleotideas a probe revealed specific binding of spleen nuclear proteinsto the methylated oligonucleotide, which was competed by themethylated ETS oligonucleotide (Fig. 4C). The same bands donot appear to represent normal spleen ETS activity, becauseunmethylated ETS oligonucleotide did not compete with themethylated ETS probe. This suggests that activities present inspleen may specifically recognize the methylated ETS site and

FIG. 3. Analysis of the methylation state of C residues in the intron enhancerregions of K18TG2, K18dP1, and K18dP6 transgenic mice. (A) DNA from liverand spleen of the indicated mouse strain was reacted with hydrazine, treated withpiperidine, and subjected to LMPCR with primers C-1 to C-3 and Vent poly-merase. Lane 1, products of recombinant K18 DNA, in which none of the CpGsare methylated. Lanes 2 to 6, results of mixing different amounts of the K18TG2liver and spleen DNAs before analysis. Lane 2, 100% liver DNA; lane 3, 75%liver and 25% spleen DNAs; lane 4, 50% of each type; lane 5, 25% liver and 75%spleen DNAs; lane 6, 100% spleen DNA. Lanes 7 to 12 products of the liver (L)and spleen (S) DNAs of K18TG2 (K18), K18dP1 (dP1), and K18dP6 (dP6)transgenic mice. (B) The signals of the ETS CpG (nt 797) were measured byphosphorimager analysis and normalized to that of the three neighboring Cresidues indicated at the right in panel A (C1, C2, and C3). Values represent theaverages for all three standard C residues. Note that K18dP1 mice express K18RNA in spleen (lane 10) and K18dP6 mice do not express K18 RNA in eithertissue (lanes 11 and 12).

TABLE 1. Methylation of C-770 and C-797 in human and K18transgenic mouse tissuesa

Speciesand organ

No. of DNAs with the followingmethylation (C-770, C-797)b: % C-797

methylation1, 1 2, 1 1, 2 2, 2 Total

HumanLiver 1 0 0 10 11 9Kidney 6 0 0 6 12 50Heart 8 1 0 1 10 90Spleen 7 2 0 3 12 75Brain 9 1 1 0 11 91

MouseLiver 1 0 1 8 10 10Spleen 6 2 0 1 9 89Heart 3 3 1 9 15 38

a Human or K18 transgenic mouse DNA derived from the indicated organ wastreated with bisulfite, subjected to PCR amplification of the plus strand, andcloned. Multiple individual clones were sequenced.

b The numbers of DNAs which generated a C signal at position C-770 orC-797, respectively (and were thus resistant to bisulfite modification due tomethylation), are indicated. 1, methylated; 2, not methylated.


compete with ETS activities for occupancy of the enhancer.Methylated DNA binding activities such as MeCP2 (38), whichrecognize even a single methylated CpG, may represent themethylated ETS binding activity.

Mutation of the CpG of the K18 intron ETS binding site.The correlation of the methylation of the CpG of the ETSbinding site with decreased activity or inactivity of the K18gene does not reveal whether these modifications are a causeor a reflection of the activity of the gene. In order to test theimportance of the methylation of C-797, we wished to alter theETS site to one which is no longer a substrate for methylationbut still retains the ability to mediate transcriptional activationby ETS factors. The DNA binding specificity of ETS2 wasdetermined by sequencing oligonucleotides selected from amixture of random sequences by binding the Ets-2 DNA bind-ing domain. In one series of experiments, a 16-bp degenerateoligonucleotide was used, while in the second series of exper-iments, an oligonucleotide containing a central core sequence,59-GGAA-39, flanked on each side by four bases of degeneratesequence was used. A total of 51 independent sequences werecombined from both experiments and used to define the con-sensus Ets-2 binding site. By using the 16-bp degenerate oli-gonucleotide, 21 independent clones were isolated. Fourteencontained the central core sequence 59-GGAA-39, while sevencontained the sequence 59-GGAT-39 (Fig. 5). The two nucle-otides flanking the core element (positions 23, 24, 13, and14) were nearly invariant. Preferential recognition was evidenteven at positions 5 or 6 nt distal from the center of the coreelement. The consensus binding sequence for Ets-2 was essen-tially identical to those determined for Ets-1 (42) and GABPa(7) (Fig. 5C). The CpGs at positions 23 and 22 are prefer-entially recognized by multiple ETS family members. Becausethe K18 ETS binding site contained a G at position 24, whichdid not appear to be favored, it was likely that two nucleotidechanges would be necessary to preserve high-affinity bindingand still abolish the CpG dinucleotide.

A mutant form of the ETS binding site of the K18 intronenhancer was constructed and tested in transient-transfectionanalysis for its sensitivity to transactivation by Ets-2 and coop-eration with the neighboring AP-1 site. The mutant sequences(Fig. 1C) were inserted into the XKCAT vector, which isdriven by the proximal 250-bp promoter of the K18 gene, andcompared to the wild-type intron sequence (XKCATIs) anda mutant ETS site which abolishes transactivation by Ets-2(XKCATIsmEts) (50, 51). Figure 6 shows representativeresults of transient-transfection experiments. The XKCATIsvector containing the wild-type K18 intron is activated by bothcoexpressed Ets-2 and c-Jun. Mutation of the core Ets-2 bind-ing site (mETS) abolishes transactivation by Ets-2, but themutant site retains a residual capability for activation by c-Jun.The substitution of the CA dinucleotide in positions 23 and24 of the ETS binding site (m2Ets) abolishes the CpG meth-ylation target but results in an intron fragment which retainstransactivation characteristics similar to those of the wild-typesequence. This result indicated that the mutant with the 2-bpmutation, m2Ets, retains ETS-dependent enhancer activity.

Transgenic mice containing the m2Ets mutation. The m2Etsmutant intron sequence was introduced into the 10-kb K18gene without any other changes by the use of appropriaterestriction enzyme sites within the intron. Transgenic micewere generated by the injection of the K18m2Ets gene intofertilized mouse eggs. Two independent, nonmosaic mouselines were identified and established. Southern blot analysisand quantitative dot blot analysis indicated that the two strainscontained 12 and 3 copies of the K18m2Ets gene, respectively.The arrangements of the integrated copies of both genes werehead-to-tail arrays, as normally found in transgenic mice (datanot shown).

RNase protection assays were performed to measure thelevels of K18m2Ets RNA in various organs. The results forliver, spleen, heart, and muscle are shown in Fig. 7. The twoK18m2Ets strains had normal levels of K18 RNA in liver,

FIG. 4. Binding activities of unmethylated (unme) and methylated (me) ETS double-stranded oligonucleotides detected by the gel shift assay. Complexes wereformed between the unmethylated (A and B) or methylated (C) ETS probe and nuclear proteins extracted from spleen (B and C) or the recombinant Ets-2 DNAbinding domain (A). (A) Lanes: 1, probe alone; 2 to 6, 15 mg of spleen nuclear protein; 3 and 4, competition with a 50- or 250-fold molar excess of nonradioactiveoligonucleotide; 5 and 6, competition with a 50- or 250-fold molar excess of nonradioactive methylated oligonucleotide. (B) Lanes: 1, probe alone; lanes 2 to 6, 15 mgof spleen nuclear protein; 3 and 4, competition with a 50- or 250-fold molar excess of unlabeled unmethylated probe; 5 and 6, competition with a 50- or 250-fold molarexcess of unlabeled unmethylated probe. (C) The methylated ETS oligonucleotide was used as probe with spleen nuclear proteins as indicated. Two bands (arrows)are observed to be competed by the unlabeled oligonucleotide, while the unmethylated oligonucleotide competes poorly.


which were proportional to the copy number. The values for allthree lines were very close to the average for five independentK18 transgenic lines (11.9 6 4.0 pg/10 mg of RNA/gene) (58)(Fig. 8A). Expression in intestines of the K18 m2Ets mice wasalso similar to that for wild-type K18 transgenic mice on aper-gene basis (Fig. 8B). In kidney, expression in one of theK18m2Ets lines was higher than that in K18 transgenic mice.Increased expression in K18m2Ets mice may reflect the com-posite nature of this organ, involving both epithelial and con-nective tissue contributions. Thus, the 2-bp mutation of theK18 ETS site did not greatly alter the expression of the K18gene in permissive tissues. While previous analysis by Northernblotting methods detected only occasional trace levels of K18RNA in spleens and hearts of K18 transgenic mice (1, 58), theRNase protection assay detected K18 RNA in spleen, heart,and muscle (Fig. 7 and 8B). Both K18m2Ets lines showedelevated expression in spleen and heart. In spleen, expressionin one line of transgenic K18m2Ets was nearly equivalent tothe signal for homozygous K18TG2 mice even though thenumber of integrated copies was 10-fold less (Fig. 7, comparelanes 9 and 11). After correction for the RNA load and num-ber of integrated genes, average expression in the K18m2Etsmice was at least fivefold higher than that in K18TG2 mice inspleen and higher to a similar degree in heart (Fig. 8B). Theseresults indicate that the 2-bp mutation that abolished the po-tential for methylation of the ETS element results in partialrelief of the restricted expression of the K18 gene in spleen andheart but in little or no change in normally permissive liver andintestine.

DISCUSSION

DNA methylation had been implicated in the regulation ofthe mouse K18 gene by the previous observation that treat-ment of a cultured myoblast cell line with 5-azacytidine, aninhibitor of DNA methyltransferase, resulted in the inductionof the gene (13, 56). However, the global methylation of themK18 gene observed in cultured fibroblast and myoblast celllines (49) is not observed in mouse tissues. The CpG-rich firstexon of the gene remains unmethylated in nonexpressingmouse tissues (40). Restriction enzyme sites within the firstintron of the K18 transgene are differentially methylated inexpressing and nonexpressing mouse tissues (40). This inves-tigation shows that the transcriptional repression of K18 iscorrelated with the methylation of a CpG within the bindingsite for ETS transcription factors in the first intron enhancerelement in nonpermissive human tissues. This relationship isalso observed in K18 transgenic mice, with the possible excep-tion of transgenic heart DNA. Furthermore, a mutant K18gene which cannot be methylated at this site is expressed muchhigher in normally nonpermissive tissues.

The correlation between transgenic K18 expression andmethylation of C-797 extends beyond the difference betweenhigh- and low-expressing tissues in K18 transgenic mice. C-797was found to be less methylated in the spleens of K18dP1 mice,which have increased levels of K18 RNA due to the very activecombination of an alternative promoter and the intron en-hancer. The alternative promoter is located 250 bp upstream ofthe normal proximal promoter, while the enhancer lies 784 bpdownstream of the transcriptional start site and is essential forefficient expression driven by the cryptic promoter (55a). How-ever, the profile of relative K18 RNA expression in different

FIG. 5. Consensus binding site for Ets-2. (A and B) After three rounds ofband-shift analysis and PCR with either a completely degenerate oligonucleotide(A) or a partially degenerate oligonucleotide (B), the resulting DNA was clonedinto the vector pBLCAT2 or Bluescript KS1. Forty-eight individual clones weresequenced with each oligonucleotide, and the independent sequences were com-piled. The numbers represent the nucleotide selected at each position of degen-eracy. The consensus binding site for Ets-2 is highlighted at the bottom. (C)Comparison of the Ets-2 consensus sequence to those for Ets-1 (42) and GABPa(7). Also shown is an Ets-1 binding site within the Moloney murine leukemiavirus enhancer (rfLVb) (22), the K18 ETS binding site, and the m2Ets mutationof the K18 site. Lowercase letters indicate nucleotide substitutions which wereless strongly selected.

FIG. 6. Enhancer activity of the m2Ets mutation of the K18 enhancer. Con-structs were derived from XKCATspa vector, which contains the 250-bp K18proximal promoter upstream of the chloramphenicol acetyltransferase (CAT)gene and the simian virus 40 splice and polyadenylation signals. All three con-structs have the K18 first intron inserted downstream of the gene in the senseorientation. XKCATIs, wild-type K18 intron. mEts contains the mutated ETSsite, which abolishes the ability of the intron enhancer to bind and be activatedby Ets-2. m2Ets contains the 2-bp mutation indicated in Fig. 1C, which destroysthe potential for methylation of C-797. The constructs were transfected into F9cells either alone or with vectors expressing Ets-2, c-Jun, or both as indicated.Values indicate the CAT activities of duplicate samples. Additional independentexperiments resulted in similar values. All samples receiving the same DNAswere normalized to a human b-actin promoter-driven b-galactosidase gene forcorrection of transfection efficiency.


tissues of K18dP1 mice remains very similar to that in wild-typeK18 transgenic mice, with much higher expression in liver thanin spleen. Elevated transcriptional activity of the K18dP1transgene may partially protect the ETS site from DNA meth-ylation in spleen, or, conversely, partial methylation of the ETSsite may restrict the potential expression of the K18dP1 gene inspleen. The absolute level of expression in a particular tissue iscontrolled by both the particular combination of regulatoryelements and the mixture, levels, and activity states of tran-scription factors which can act upon the gene. Thus, in theabsence of methylation of the ETS site, K18 RNA levels in thespleens of K18m2Ets mice were still only about 35% of thevalues found in liver. Given the extreme differences in geneexpression in liver and spleen, which to a great extent are likelydue to different trans-acting factors, this elevation appearsquite reasonable. The remaining difference between liver andspleen may be attributable to the transcription factor environ-ment. It remains possible that the 2-bp change in the K18 ETSsite results in higher-affinity binding of particular ETS familymembers expressed in spleen, thus resulting in elevated expres-sion. However, the similarities in binding site specificity ofmany of the ETS family members (7, 22, 42) and their generaldependence upon interaction with other factors (5, 7, 17, 55,64) suggest that the absence of DNA methylation may be animportant contribution to overcoming tissue-specific repres-sion of the K18 gene in spleen.

In spleen cells, the methylation of the ETS site may result inits recognition by methylated DNA binding proteins, as de-tected in the gel shift experiments (Fig. 6C). These activitiesmay represent known proteins such as MeCP-2, which bindsDNA with a single CpG methylation and can inhibit transcrip-tion (35). The association of MeCP-2 with heterochromatin,and the recent demonstration that sequences affected by posi-tion effect variegation are physically associated with hetero-chromatin domains of chromosomes (12), suggest that recog-nition of the K18 intron enhancer may play a role in thecis-acting, tissue-specific repression of the K18 gene.

While the methylation of C-797 is nearly complete in the

spleens of mice containing the inactive K18dP6 gene, it isinteresting that the sequence is not fully methylated in thelivers of the same animals. Thus, methylation of C-797 inK18dP6 mice is not simply a reflection of transcriptional inac-tivity. The SP-1 transcription factor protects both its bindingsites and neighboring CpGs from DNA methylation (6, 33) inCpG islands. This protection does not appear to require activetranscription, because small fragments containing SP-1 sitesare similarly protected from methylation when transfected intocells (6). However, it is not clear whether other transcriptionfactors, such as ETS members, protect DNA from methylation.It is possible that binding of factors to the enhancer in liverprotects the sequence from full methylation even when nocompetent promoter is linked to the enhancer.

The partial methylation of C-797 in the hearts of K18 trans-genic mice is an apparent exception to the inverse correlationof DNA methylation and K18 RNA expression. Evidently,other factors also restrict expression of the K18 gene in heart.One contribution to this restriction may be the antagonismbetween transcription factors such as myoD and AP-1 (3).AP-1 activity is important for the efficient expression of theK18 gene (45, 50, 51). In addition, the developing heart is oneof the few tissues which have documented differences in K18

FIG. 7. RNase protection analysis of K18 RNAs from different tissues ofK18TG2 transgenic mice, which contain approximately 20 copies of the wild-typeK18 gene, and the K18m2Ets-1 and K18m2Ets-2 mouse lines, which containapproximately 12 and 3 copies, respectively, of the K18 gene with the 2-bp m2Etsmutation. Lane 1, size markers; lane 2, a mixture of probes for K18 (upper band)and L32 (lower band); lanes 3 to 5, signals from synthetic K18 RNAs of approx-imately 20, 40, and 80 pg of standard RNAs; lanes 6 to 17, signals from approx-imately 10 mg of total RNA from the indicated organ and transgenic mousestrain. W, K18TG2 homozygous transgenic mice (copy number, 20); M1, strain1 of K18m2Ets mice; M2, strain 2 of K18m2Ets mice.

FIG. 8. K18 RNA expression by K18m2Ets transgenic mice. Values for K18RNA derived from the experiment shown in Fig. 7 were corrected for the amountof RNA by comparison to the signal for the L32 ribosomal protein RNA anddivided by gene copy number. Values are compared to those for expression byK18TG2 mice in liver. (A) Liver, kidney, and intestine; (B) spleen, heart, andskeletal muscle.


expression in different species (29). During fetal development,but not in adults, the endogenous mouse K18 gene is expressedin the epicardium layer but not the myocardium layer (59).Thus, K18 expression in the heart is variable between speciesand during development. It is possible that DNA methylationof the Ets site is important in restricting expression of trans-genic K18 in only a portion of the heart. Nevertheless, if theelevated expression of the K18m2Ets gene in heart is due onlyto lack of methylation of C-797, there must be additionallimiting or repressing factors to account for the low expressionwhen C-797 methylation is not complete in wild-type K18transgenic heart. In situ hybridization methods will be neces-sary to evaluate K18m2Ets expression within different parts oftransgenic heart.

The binding of both Ets-2 and GABP, two members of theETS family of transcription factors, is sensitive to the methyl-ation state of the CpG adjacent to the GGAA/T core recog-nition element shared by ETS family members (19, 41). How-ever, in the case of the Surf-1 gene, mutation of position 23 ofthe ETS binding site from C to A, thus removing the potentialfor methylation of the site, did not relieve the inhibition of thepromoter (19). Apparently, other sites within the Surf-1 and -2promoter region are also sensitive to inhibition by DNA meth-ylation. In the case of the K18 gene, methylation of C-797appears to be particularly important for repression of the K18gene in spleen. The preference of multiple ETS family mem-bers for CpG at the 23 and 22 positions of the ETS bindingsite suggests that DNA methylation may modulate the use ofETS sites in other genes. However, the time at which methyl-ation of the ETS CpG is first accomplished is not known andcould be as early as primary mesoderm formation when K18expression is repressed. Epigenetic transmission of the meth-ylated state during subsequent development may result in thepresentation of a K18 Ets site which is bound poorly by ETSactivities found in, for example, lymphoid cells. Release fromthe combination of DNA methylation of the ETS site and thepossible association of methylated DNA binding proteins maybe the basis of ectopic expression of K18 which occurs inmultiple normal biological situations (2, 16, 26, 28, 29, 46). IfDNA methylation is functionally important in specifying thetissue-specific expression of K18 or other genes, a key questionis what determines the specificity of this modification. Doesthis information reside only in the local DNA sequence, or isthe location of this sequence between a CpG island and thebody of the K18 gene important?

We have demonstrated a correlation between K18 repres-sion and DNA methylation of a conserved CpG within an ETSbinding site in the K18 gene. Because ETS family membersexpressed in spleen bind a methylated ETS site poorly and the2-bp mutation of the K18 intron enhancer, which precludesDNA methylation, results in an increase of K18 RNA inspleen, we suggest that DNA methylation may play an impor-tant role in modulating the transcriptional activity of ETS-regulated genes. In the future, it will be of interest to identifythe DNA binding activities which recognize the methylatedform of the ETS site.

ACKNOWLEDGMENTS

We are grateful for the expert technical assistance of Grace Cecena.This work was supported by grants from the National Institutes of

Health, National Cancer Institute (R01 CA42302 to R.G.O. and 5 R01AI20194 to R.M.) and by Cancer Research Center grant P30 CA30199.K.R. was supported by National Research Service award F32CA66305.

REFERENCES

1. Abe, M., and R. G. Oshima. 1990. A single human keratin 18 gene isexpressed in diverse epithelial cells of transgenic mice. J. Cell Biol. 111:1197–1206.

2. Bader, B. L., L. Jahn, and W. W. Franke. 1988. Low level expression ofcytokeratins 8, 18 and 19 in vascular smooth muscle cells of human umbilicalcord and in cultured cells derived therefrom, with an analysis of the chro-mosomal locus containing the cytokeratin 19 gene. Eur. J. Biochem. 47:300–319.

3. Bengal, E., L. Ransone, R. Scharfmann, V. J. Dwarki, S. J. Tapscott, Wein-traub, H, and I. M. Verma. 1992. Functional antagonism between c-Jun andMyoD proteins: a direct physical association. Cell 68:507–519.

4. Bird, A. 1986. CpG-rich islands and the function of DNA methylation.Nature 321:209–213.

5. Bradford, A. P., K. E. Conrad, C. Wasylyk, B. Wasylyk, and A. Gutierrez-Hartmann. 1995. Functional interaction of c-Ets-1 and GHF-1/Pit-1 medi-ates ras activation of pituitary-specific gene expression: mapping of theessential c-Ets-1 domain. Mol. Cell. Biol. 15:2849–2857.

6. Brandeis, M., D. Frank, I. Keshet, Z. Siegfried, M. Mendelsohn, A. Nemes,V. Temper, A. Razin, and H. Cedar. 1994. Sp1 elements protect a CpG islandfrom de novo methylation. Nature 371:435–438.

7. Brown, T. A., and S. L. McKnight. 1992. Specificities of protein-protein andprotein-DNA interaction of GABPa and two newly defined ets-related pro-teins. Genes Dev. 6:2502–2512.

8. Brulet, P., C. Babinet, R. Kemler, and F. Jacob. 1980. Monoclonal antibodiesagainst trophectoderm-specific markers during mouse blastocyst formation.Proc. Natl. Acad. Sci. USA 77:4113–4117.

9. Chaillet, J. R. 1994. Genomic imprinting: lessons from mouse transgenes.Mutat. Res. 307:441–449.

10. Clark, S. J., J. Harrison, C. L. Paul, and M. Frommer. 1994. High sensitivitymapping of methylated cytosines. Nucleic Acids Res. 22:2990–2997.

11. Cross, S. H. and A. P. Bird. 1995. CpG islands and genes. Curr. Opin. Genet.Dev. 5:309–314.

12. Csink, A. K., and S. Henikoff. 1996. Genetic modification of heterochromaticassociation and nuclear organization in Drosophila. Nature 381:529–531.

13. Darmon, M. 1985. Coexpression of specific acid and basic cytokeratins interatocarcinoma-derived fibroblasts treated with 5-azacytidine. Dev. Biol.110:47–52.

14. Doerfler, W. 1993. Patterns of de novo DNA methylation and promoterinhibition: studies on the adenovirus and the human genomes. Exper. Suppl.(Basel) 64:262–299.

15. Dudov, K. P., and R. P. Perry. 1984. The gene family encoding the mouseribosomal protein L32 contains a uniquely expressed intron-containing geneand an unmutated processed gene. Cell 37:457–468.

16. Ferretti, P., D. M. Fekete, M. Patterson, and E. B. Lane. 1989. Transientexpression of simple epithelial keratins by mesenchymal cells of regeneratingnewt limb. Dev. Biol. 133:415–424.

17. Fitzsimmons, D., W. Hodsdon, W. Wheat, S.-M. Maira, B. Wasylyk, and J.Hagman. 1996. Pax-5 (BSAP) recruits Ets proto-oncogene family proteins toform functional ternary complexes on a B-cell-specific promoter. Genes Dev.10:2198–2211.

18. Frommer, M., L. E. McDonald, D. S. Millar, C. M. Collis, F. Watt, G. W.Grigg, P. L. Molloy, and C. L. Paul. 1992. A genomic sequencing protocolthat yields a positive display of 5-methylcytosine residues in individual DNAstrands. Proc. Natl. Acad. Sci. USA 89:1827–1831.

19. Gaston, K., and M. Fried. 1995. CpG methylation has differential effects onthe binding of YY1 and ETS proteins to the bi-directional promoter of thesurf-1 and surf-2 genes. Nucleic Acids Res. 23:901–909.

20. Gold, J. D., and R. A. Pedersen. 1994. Mechanisms of genomic imprinting inmammals. Curr. Top. Dev. Biol. 29:227–280.

21. Graessmann, M., and A. Graessmann. 1993. DNA methylation, chromatinstructure and the regulation of gene expression. Exper. Suppl. (Basel) 64:404–424.

22. Gunther, C. V., and B. J. Graves. 1994. Identification of ETS domain pro-teins in murine T lymphocytes that interact with the Moloney murine leu-kemia virus enhancer. Mol. Cell. Biol. 14:7569–7580.

23. Hattori, M., A. Tugores, L. Veloz, M. Karin, and D. Brenner. 1990. Asimplified method for the preparation of transcriptionally active liver nuclearextracts. DNA Cell Biol. 9:777–781.

24. Holler, M., G. Westin, J. Jiricny, and W. Schaffner. 1988. Sp1 transcriptionfactor binds DNA and activates transcription even when the binding site isCpG methylated. Genes Dev. 2:1127–1135.

25. Jackson, B. W., C. Grund, E. Schmid, K. Burke, W. Franke, and K. Ill-mensee. 1980. Formation of cytoskeletal elements during mouse embryogen-esis: intermediate filaments of the cytokeratin type and desmosomes inpreimplantation embryos. Differentiation 17:161–179.

26. Jahn, L., B. Fouquet, K. Rohe, and W. W. Franke. 1987. Cytokeratins incertain endothelial and smooth muscle cells of two taxonomically distantvertebrate species, Xenopus laevis and man. Differentiation 36:234–254.

27. Karim, F. D., L. D. Urness, C. S. Thummel, M. J. Klemsz, S. R. McKercher,A. Celada, C. VanBeveren, and R. A. Maki. 1990. The ETS domain: a new


DNA binding motif that recognizes a purine-rich core DNA sequence.Genes Dev. 4:1451–1453.

28. Knapp, A. C., and W. W. Franke. 1989. Spontaneous losses of control ofcytokeratin gene expression in transformed, non-epitheilial human cells oc-curring at different levels of regulation. Cell 59:67–79.

29. Kuruc, N., and W. W. Franke. 1988. Transient coexpression of desmin andcytokeratins 8 and 18 in developing myocardial cells of some vertebratespecies. Differentiation 38:177–193.

30. Lewis, J. D., R. R. Meehan, W. J. Henzel, I. Maurer-Fogy, P. Jeppesen, F.Klein, and A. Bird. 1992. Purification, sequence, and cellular localization ofa novel chromosomal protein that binds to methylated DNA. Cell 69:905–914.

31. Li, E., T. H. Bestor, and R. Jaenisch. 1992. Targeted mutation of the DNAmethyltransferase gene results in embryonic lethality. Cell 69:915–926.

32. List, H. J., V. Patzel, U. Zeidler, A. Schopen, G. Ruhl, J. Stollwerk, and G.Klock. 1994. Methylation sensitivity of the enhancer from the human pap-illomavirus type 16. J. Biol. Chem. 269:11902–11911.

33. Macleod, D., J. Charlton, J. Mullins, and A. P. Bird. 1994. Sp1 sites in themouse aprt gene promoter are required to prevent methylation of the CpGisland. Genes Dev. 8:2282–2292.

34. McBurney, M. W. 1993. X chromosome inactivation: the feminine mystiquecontinues. Bioessays 15:825–826.

35. Meehan, R. R., J. D. Lewis, and A. P. Bird. 1992. Characterization ofMeCP2, a vertebrate DNA binding protein with affinity for methylatedDNA. Nucleic Acids Res. 20:5085–5092.

36. Moll, R., W. W. Franke, D. L. Schiller, B. Geiger, and R. Krepler. 1982. Thecatalog of human cytokeratins: patterns of expression in normal epithelia,tumors and cultured cells. Cell 31:11–24.

37. Mueller, P. R., and B. Wold. 1989. In vivo footprinting of a muscle specificenhancer by ligation mediated PCR. Science 246:780–786.

38. Nan, X., P. Tate, E. Li, and A. Bird. 1996. DNA methylation specifieschromosomal localization of MeCP2. Mol. Cell. Biol. 16:414–421.

39. Neznanov, N., I. S. Thorey, G. Cecena, and R. G. Oshima. 1993. Transcrip-tional insulation of the human keratin 18 gene in transgenic mice. Mol. Cell.Biol. 13:2214–2223.

40. Neznanov, N. S., and R. G. Oshima. 1993. cis regulation of the keratin 18gene in transgenic mice. Mol. Cell. Biol. 13:1815–1823.

41. Nickel, J., M. L. Short, A. Schmitz, M. Eggert, and R. Renkawitz. 1995.Methylation of the mouse M-lysozyme downstream enhancer inhibits het-erotetrameric GABP binding. Nucleic Acids Res. 23:4785–4792.

42. Nye, J. A., J. M. Petersen, C. V. Gunther, M. D. Jonsen, and B. J. Graves.1992. Interaction of murine Ets-1 with GGA-binding sites establishes theETS domain as a new DNA-binding motif. Genes Dev. 6:975–990.

43. Oshima, R. G. 1982. Developmental expression of murine extra-embryonicendodermal cytoskeletal proteins. J. Biol. Chem. 257:3414–3421.

44. Oshima, R. G. 1992. Intermediate filament molecular biology. Curr. Opin.Cell Biol. 4:110–116.

45. Oshima, R. G., L. Abrams, and D. Kulesh. 1990. Activation of an intronenhancer within the keratin 18 gene by expression of c-fos and c-jun inundifferentiated F9 embryonal carcinoma cells. Genes Dev. 4:835–848.

46. Oshima, R. G., H. Baribault, and C. Caulin. 1996. Oncogenic regulation andfunction of keratin 8 and 18. Cancer Metastasis Rev. 15:445–471.

47. Oshima, R. G., W. E. Howe, F. G. Klier, E. D. Adamson, and L. H. Shevinsky.1983. Intermediate filament protein synthesis in preimplantation murineembryos. Dev. Biol. 99:447–455.

48. Oshima, R. G., J. L. Millan, and G. Cecena. 1986. Comparison of mouse andhuman keratin 18: a component of intermediate filaments expressed prior to

implantation. Differentiation 33:61–68.49. Oshima, R. G., K. Trevor, L. H. Shevinsky, O. A. Ryder, and G. Cecena.

1988. Identification of the gene coding for the Endo B murine cytokeratinand its methylated, stable inactive state in mouse nonepithelial cells. GenesDev. 2:505–516.

50. Pankov, R., A. Umezawa, R. Maki, C. J. Der, C. A. Hauser, and R. G.Oshima. 1994. Keratin 18 activation by Ha-ras is mediated through Ets andJun binding sites. Proc. Natl. Acad. Sci. USA 91:873–877.

51. Pankov, T., N. Neznanov, A. Umezawa, and R. G. Oshima. 1994. AP-1, ETS,and transcriptional silencers regulate retinoic acid-dependent induction ofkeratin 18 in embryonic cells. Mol. Cell. Biol. 14:7744–7757.

52. Pfeifer, G. P., S. D. Steigerwald, R. S. Hansen, S. M. Gartler, and A. D.Riggs. 1990. Polymerase chain reaction-aided genomic sequencing of an Xchromosome-linked CpG island: methylation patterns suggest clonal inher-itance, CpG site autonomy, and an explanation of activity state stability.Proc. Natl. Acad. Sci. USA 87:8252–8256.

53. Pfeifer, G. P., S. D. Steigerwald, P. R. Mueller, B. Wold, and A. D. Riggs.1989. Genomic sequencing and methylation analysis by ligation mediatedPCR. Science 246:810–813.

54. Pfeifer, K., and S. M. Tilghman. 1994. Allele-specific gene expression inmammals: the curious case of the imprinted RNAs. Genes Dev. 8:1867–1874.

55. Pongubala, J. M., C. VanBeveren, S. Nagulapalli, M. J. Klemsz, S. R.McKercher, R. A. Maki, and M. L. Atchison. 1993. Effect of PU.1 phosphor-ylation on protein interation, DNA binding, and transcriptional activation byNF-EM5. Science 259:1622–1625.

55a.Rhodes, K., and R. G. Oshima. Submitted for publication.56. Semat, A., P. Duprey, M. Vasseur, and M. Darmon. 1986. Mesenchymal-

epithelial conversions induced by 5-azacytidine: appearance of cytokeratinendo-A messenger RNA. Differentiation 31:61–66.

57. Steinert, P. M., and D. R. Roop. 1988. Molecular and cellular biology ofintermediate filaments. Annu. Rev. Biochem. 57:593–625.

58. Thorey, I. S., G. Cecena, W. Reynolds, and R. G. Oshima. 1993. Alu se-quence involvement in transcriptional insulation of the keratin 18 gene intransgenic mice. Mol. Cell. Biol. 13:6742–6751.

59. Thorey, I. S., J. Meneses, N. Neznanov, D. Kulesh, R. Pedersen, and R. G.Oshima. 1993. Embryonic expression of human keratin 18 and K18-beta-galactosidase fusion genes in transgenic mice. Dev. Biol. 160:519–534.

60. Thorey, I. S., R. A. Pedersen, E. Linney, and R. G. Oshima. 1992. Parent-specific expression of a human keratin 18/beta-galactosidase fusion gene intransgenic mice. Dev. Dyn. 195:100–112.

61. Treisman, R. 1992. The serum response element. Trends Biochem. Sci.17:423–426.

62. Tucker, K. L., C. Beard, J. Dausmann, L. Jackson-Grusby, P. W. Laird, H.Lei, E. Li, and R. Jaenisch. 1996. Germ-line passage is required for estab-lishment of methylation and expression patterns of imprinted but not ofnonimprinted genes. Genes Dev. 10:1008–1020.

63. Wasylyk, B., S. L. Hahn, and A. Giovane. 1993. The Ets family of transcrip-tion factors. Eur. J. Biochem. 211:7–18.

64. Wasylyk, B., C. Wasylyk, P. Flores, A. Begue, D. Leprince, and D. Stehelin.1990. The c-Ets proto-oncogenes encode transcription factors that cooperatewith c-Fos and c-Jun for transcriptional activation. Nature 346:191–193.

65. Yeivin, A., and A. Razin. 1993. Gene methylation patterns and expression.Exper. Suppl. (Basel) 64:523–568.

66. Yokomori, N., R. Kobayashi, R. Moore, T. Sueyoshi, and M. Negishi. 1995.A DNA methylation site in the male-specific P450 (Cyp 2d-9) promoter andbinding of the heteromeric transcription factor GABP. Mol. Cell. Biol.15:5355–5362.


Documents

Methylation of an ETS Site in the Intron Enhancer of the Keratin 18