Metabolic Engineering for Enhancement of Itaconic Acid · Na tentativa de aumentar a produção de AI, eliminou-se o gene XXX por recombinação homologa. Adicionalmente, três transportadores

Metabolic Engineering for Enhancement of Itaconic Acid

Production in Ustilago including Introduction of the QDR3

Gene from Saccharomyces cerevisiae

Ana Catarina Rodrigues Lóia

Thesis to obtain the Master of Science Degree in

Biological Engineering

Supervisors: Prof. Dr. Nuno Gonçalo Pereira Mira and Dr. Nick Wierckx

Examination Committee

Chairperson: Prof. Dr. Arsénio do Carmo Sales Mendes Fialho

Supervisor: Prof. Dr. Nuno Gonçalo Pereira Mira

Prof. Dr. Frederico Castelo Alves Ferreira

October 2017

I

AKNOWLEDGEMENTS

First of all, I would like to thank Prof. Dr. -Ing Lars M. Blank for the opportunity to write my master thesis

at the Institute of Applied Microbiology of the RWTH-Aachen University (Aachen, Germany).

Secondly, I would like to thank both my supervisors Prof. Dr. Nuno Mira and Dr. Nick Wierckx for their

support, suggestions and overall help during these months.

I would also like to address a word of appreciation to Hamed H. Tehrani for the motivation and invaluable

support during the entire project. In particular, thank you for the patience and for being available

whenever I needed guidance either in the laboratory or while writing this thesis.

Moreover, I would like to address all the members of iAMB for the great working atmosphere and for

making me feel welcome and turning this months into a very positive experience.

Last but not the least, I would like to say to my parents and my family how much I appreciate and value

their care through these years. Without their support this wouldn’t be possible. To my friends, the old

and new ones, either nearby or far away while doing this thesis: thank you for the everyday support and

also for sharing all the new experiences, the good times and also the motivation and for being there

whenever I needed.

II

ABSTRACT

Itaconic acid is an unsaturated dicarboxylic acid that can be used as a building block to produce several

value-added products. IA and its derivatives have a wide range of applications in textile, pharmaceutical

and chemical industries. Ustilago maydis is a natural IA producer and a promising candidate for

industrial production of this acid. IA production in U. maydis has already improved by optimizing the

fermentation process and media but also by strain improvement using metabolic engineering

approaches. Despite the higher IA concentration in the media the yields obtained are still below the ones

obtained with A. terreus, leaving room for further metabolic engineering.

Aiming to enhance itaconate production of the best-producing U. maydis strain obtained so far, the XXX

gene was deleted by homologous recombination. Moreover, mitochondrial transporters from natural

itaconate producers (At_mttA, Um_mtt1 and UcN_mtt1) were overexpressed. The combined effect of

XXX deletion and At_mttA overexpression led to a 56% increase in the final itaconate concentration and

37% increase in yield when compared to the best-producing strain at the starting point of this thesis.

Moreover, the qrd3 gene which encodes for an MFS transporter responsible for MDR in S. cerevisiae

was overexpressed in various U. maydis strains. The results showed that Qdr3 does not complement

itp1 function in U. maydis.

Keywords: Itaconic acid, XXX, mitochondrial transporters, QDR3

III

RESUMO

O ácido itacónico (AI) é um ácido dicarboxílico insaturado que pode ser usado como “building block”

para produzir diversos produtos de valor acrescentado. Este ácido e seus derivados têm uma vasta

gama de aplicações nas industrias têxtil, farmacêutica e química. Ustilago maydis é produtor natural de

AI. A produção de AI em U. maydis foi melhorada optimizando o processo de fermentação e meio de

cultura e utilizando estratégias de engenharia metabólica. No entanto, apesar do aumento da

concentração de AI no meio, os rendimentos obtidos foram inferiores aos de A. terreus, sendo ainda

necessário continuar a optimizar as estirpes.

Na tentativa de aumentar a produção de AI, eliminou-se o gene XXX por recombinação homologa.

Adicionalmente, três transportadores mitocondriais de outros produtores naturais (AT_mttA, Um_mtt1,

UcN_mtt1) foram sobre expressos. O efeito combinado da eliminação do XXX e sobre expressão do

AT_mttA levou a um aumento de 56% na concentração final e de 37% no rendimento quando

comparado com a melhor estirpe disponível no início desta tese. Também o gene QDR3, que codifica

para um transportador da MFS responsável por MDR em S. cerevisiae, foi sobre expresso. Os

resultados obtidos indicam que este gene não complementa a função do itp1 em U. maydis.

Palavras-chave: Ácido itacónico, XXX, transportadores mitocondriais, QDR3

IV

List of contents

AKNOWLEDGEMENTS ...................................................................................................................... I

ABSTRACT ........................................................................................................................................II

RESUMO ........................................................................................................................................... III

LIST OF FIGURES .......................................................................................................................... VII

LIST OF TABLES ............................................................................................................................. IX

LIST OF ACRONYMS ........................................................................................................................ X

1. INTRODUCTION .........................................................................................................................1

2. MOTIVATION AND AIMS OF THE THESIS .................................................................................7

3. MATERIALS AND METHODS .....................................................................................................8

3.1. Chemicals and enzymes ......................................................................................................8

3.2. Microorganisms ...................................................................................................................8

3.3. Media ..................................................................................................................................9

3.3.1. Lysogeny broth (LB-medium) ...........................................................................................9

3.3.2. Yeast extract peptone medium (YEPS-medium) ............................................................. 10

3.3.3. Regeneration agar (REG-agar) ...................................................................................... 10

3.3.4. Screening medium ......................................................................................................... 10

3.4. Solutions ........................................................................................................................... 11

3.5. Growth Conditions ............................................................................................................. 11

3.5.1. Cultivation of Escherichia coli (E. coli) ............................................................................ 11

3.5.2. Cultivation of Ustilago maydis (U. maydis)...................................................................... 11

3.5.3. Cryocultures .................................................................................................................. 11

3.6. Oligonucleotides ................................................................................................................ 12

3.7. Plasmids............................................................................................................................ 13

3.7.1. Plasmid Petef_qdr3.......................................................................................................... 13

3.7.2. Plasmid Petef_cbx_A_ter_mttA ........................................................................................ 13

3.7.3. Plasmid Petef_cbx_05079 ............................................................................................... 14

3.7.4. Plasmid Petef_cbx_05079#6 ............................................................................................ 15

3.7.5. Plasmid pJET1.2_Um_FRT-KO-XXX construction for XXX deletion in U. maydis using

FLP/FRT recombination system ..................................................................................................... 16

3.8. Isolation of genomic DNA from U. maydis .......................................................................... 17

V

3.9. Production of chemically competent E. coli cells ................................................................ 18

3.10. Transformation of chemically competent E. coli cells .......................................................... 18

3.11. Plasmid isolation from E. coli ............................................................................................. 18

3.12. Gibson assembly ............................................................................................................... 18

3.13. Colony PCR ...................................................................................................................... 18

3.13.1. Colony PCR in E. coli ..................................................................................................... 18

3.13.2. Colony PCR in U. maydis ............................................................................................... 18

3.14. Production of U. maydis protoplasts ................................................................................... 18

3.15. Transformation of U. maydis via protoplasts ....................................................................... 19

3.16. Optical density measurement ............................................................................................. 19

3.17. Polymerase chain reaction (PCR) ...................................................................................... 19

3.18. Purification of PCR products .............................................................................................. 19

3.19. Determination of DNA concentration .................................................................................. 19

3.20. Agarose gel electrophoresis ............................................................................................... 20

3.21. High-performance liquid chromatography (HPLC) analysis ................................................. 20

3.22. Microscopy ........................................................................................................................ 20

3.23. pH measurement ............................................................................................................... 20

3. RESULTS ..................................................................................................................................... 21

4.1. Enhancement of Itaconate Production in U. maydis ........................................................... 21

4.1.1. Strategy 1 in U. maydis .................................................................................................. 21

4.1.1.1. XXX deletion in U. maydis KO-cyp3+Petef using FLP/FRT recombination system ............ 21

4.1.1.2. Cultivation studies in U. maydis KO-cyp3 + KO-XXX + Petef #6 ....................................... 26

4.1.2. Overexpression of Mitochondrial Transporters in U. maydis KO-cyp3 + KO-XXX + Petef .. 30

4.1.2.1. Overexpression of AT_mttA, Um_mtt1 and UcN_mtt1 in U. maydis KO-cyp3 + KO-XXX +

Petef 30

4.1.2.2. Cultivation studies in U. maydis ...................................................................................... 32

4.1.2.2.1. Itaconate Production Screening.................................................................................. 32

4.1.2.2.2. Itaconate Production Screening: Sampling Method with HCl addtion .......................... 34

4.2. Characterization of Qdr3 function in U. maydis ................................................................... 39

4.2.1. Heterologous expression of MDR transporter Qdr3 from S. cerevisiae ........................... 39

4.2.2. Cultivation studies in U. maydis ...................................................................................... 40

5. DISCUSSION ............................................................................................................................ 42

VI

6. CONCLUSION AND FUTURE PERSPECTIVES ....................................................................... 46

7. REFERENCES.......................................................................................................................... 47

VII

LIST OF FIGURES

Figure 1 - 2D structure of itaconic acid: Source: KEGG Pathway Database (3/07/2017).......................1

Figure 2 – Biosynthetic pathway for itaconate production in U. maydis ................................................3

Figure 3 – Multidrug resistance transporters in yeast: MFS-MDR transporters drug-H+ antiporter from

the 12-spanner DHA1 family. ..............................................................................................................5

Figure 4 – Map of the plasmid Petef_qdr3 ........................................................................................... 13

Figure 5 - Map of the plasmid Petef_cbx_A_ter_mtt ............................................................................ 14

Figure 6 - Map of the plasmid Petef_cbx_05079 .................................................................................. 15

Figure 7 - Map of the plasmid Petef_cbx_05079#6 .............................................................................. 16

Figure 8 - Map of the plasmid pJET1.2_Um_FRT-KO-XXX ................................................................ 17

Figure 9 - Agarose gel of DNA fragments for pJET1.2_Um_FRT-KO-XXX assembly ......................... 22

Figure 10 - Agarose gel of knockout construct for XXX deletion ......................................................... 23

Figure 11 - Schematic representation of the cloning strategy used to construct the pJET1.2_Um_FRT-

KO-XXX plasmid, followed by amplification of the KO construct for subsequent transformation in U.

maydis. ............................................................................................................................................. 24

Figure 12 - Representation of the PCR’s performed for verifying the correct integration of the knockout

construct in U. maydis Δcyp3 + Petef genome ..................................................................................... 25

Figure 13 - Agarose gel of colony PCR with primers HT-210a and HT-4a (left; expected band: 2048 bps)

and HT-203 and HT-220 (right; expected band: 1963 bps) for verification of correct integration of the

knockout construct ............................................................................................................................ 25

Figure 14 – SystemDuetz® plate after 96h of fermentation ................................................................ 26

Figure 15 - Optical density profiles in MES 30mM and MES 100mM buffered media over 96h cultivation

in SystemDuetz® plates .................................................................................................................... 26

Figure 16 - pH profiles in MES 30mM, MES 100mM and CaCO3 99 g L-1 buffered media over 96h

cultivation in SystemDuetz® plates ................................................................................................... 27

Figure 17 - Itaconate concentration measured during cultivation of U. maydis KO-cyp3 + Petef (control

strain, red lines) and U. maydis KO-cyp3 + KO-XXX + Petef (blue lines) in SystemDuetz® plates ....... 28

Figure 18 - Glucose concentration measured during cultivation of U. maydis KO-cyp3 + Petef (control

strain, red lines) and U. maydis KO-cyp3 + KO-XXX + Petef (blue lines) in SystemDuetz® plates ....... 29

Figure 19 - Itaconate yield after 96h cultivation in SystemDuetz® plates ............................................ 29

Figure 20 - Agarose gel of restricted plasmids with SspI-HF® ........................................................... 31

Figure 21 - Agarose gel of colony PCR of U. maydis KO-cyp3 + KO-XXX + Petef after transformation with

mitochondrial transporters using three different primer pairs. ............................................................. 31

Figure 22 - Itaconate yield after 72h cultivation in SystemDuetz® plates in CaCO3 medium with 100 g L-

1 glucose ........................................................................................................................................... 32

Figure 23 - Itaconate concentration profile during cultivation in SystemDuetz® plates in 99 g L-1 CaCO3

buffered media with 50 g L-1 glucose. ................................................................................................ 33

Figure 24 – Photo of the 96-well plates stored at -20°C without HCl addition ..................................... 34

Figure 25 - Optical density profiles during cultivation in SystemDuetz® plates in 99 g L-1 CaCO3 buffered

media with 50 g L-1 glucose ............................................................................................................... 35

VIII

Figure 26 - Itaconate concentration measured in samples without HCl stored at 4°C (full lines) and with

HCl stored at - 20°C (dotted lines). Cultivation was performed in SystemDuetz® plates in 99 g L-1 CaCO3

buffered media with 50 g L-1 glucose ................................................................................................. 35

Figure 27 - Glucose consumption profile measured in samples without HCl stored at 4°C. Cultivation

was performed in SystemDuetz® plates in 99 g L-1 CaCO3 buffered media with 50 g L-1 glucose ....... 36

Figure 28 – Malate concentration measured in samples without HCl stored at 4°C. Cultivation was

performed in SystemDuetz® plates in 99 g L-1 CaCO3 buffered media with 50 g L-1 glucose. ............. 37

Figure 29 - Itaconate yield obtained in the samples stored at 4°C without HCl after 96h cultivation in

SystemDuetz® plates. ...................................................................................................................... 38

Figure 30 - Agarose gel of restricted Petef_qdr3 plasmid with SspI-HF® ............................................. 39

Figure 31 - Agarose gel of Colony PCR after transformation of Petef_qdr3 in U. maydis MB215 (A), U.

maydis KO-itp1 (D), U. maydis KO-cyp3 + KO-XXX + Petef (C) and U. maydis KO-cyp3 + Petef (B). .... 40

Figure 32 - Itaconate concentration after 72h cultivation in SystemDuetz® plates in MES 100 mM

medium with 50 g L-1 glucose ............................................................................................................ 41

IX

LIST OF TABLES

Table I - List of microorganisms used and created during this work .....................................................8

Table II - Primers used and their sequences (the small letters represent non-binding regions) ........... 12

Table III – Itaconate concentrations of U. maydis KO-cyp3 + Petef #6 and U. maydis KO-cyp3 + KO-XXX

+ Petef strain after 96h of cultivation in MES 30 mM, MES 100 mM and 99 g L-1 CaCO3 buffered media.

......................................................................................................................................................... 28

X

LIST OF ACRONYMS

A. terreus – Aspergillus terreus

Amp - Ampicilin

Cbx – Carboxin

E. coli – Escherichia coli

FLP – Flippase

FRT – Flippase recognition target

Hyg - Hygromycin

HPLC – High Performance Liquid Chromatography

IA – Itaconic acid

KO – Knock-out

MAA – Methacrylic acid

MDR – Multidrug Resistance

MES - 2-(N-morpholino)ethanesulfonic acid

MFS – Major Facilitator Superfamily

PCR – Polymerase Chain Reaction

PEG – Polyehtylene glycol

SAP – Superabsorvent polymers

SCS – Sorbitol Sodium Citrate

STC – Sorbitol Tris-HCl Sodium Chloride

TCA – Tricarboxylic acid

U. cynodontis – Ustilago cynodontis

U. maydis – Ustilago maydis

UPR – Unsaturated polyester resins

WT – Wild-type

1

1. INTRODUCTION

Itaconic acid (C5H6O4) has been gaining increasing interest since it was identified as one of the most

promising and flexible building blocks derived from biomass (Werpy & Petersen, 2004) that can replace

petrochemical-based monomers and therefore contribute to the sustainable development of the

chemical industry (Willke & Vorlop, 2001).

Figure 1 - 2D structure of itaconic acid: Source: KEGG Pathway Database (3/07/2017)

This unsaturated dicarboxylic acid has a molecular weight of 130,1 g mol-1 and in solid state it forms

white crystals which dissolve in water up to 80,1 g L-1 (Klement & Büchs, 2012). Carboxylic acids can

be used in several organic reactions like acetylation, acylation, redox reactions, and many others due

to the functional carboxyl group (COOH). If the molecule has more than one carboxyl group or other

functional groups like hydroxyl (OH) then the range of possible synthetic routes is even wider

(Sandström et al., 2014). IA has two carboxyl groups and a conjugated double bond that make this acid

an effective intermediate for the synthesis of more complex organic molecules (Kuenz, Gallenmüller,

Willke, & Vorlop, 2012).

The commercial uses of IA in particular include plastics, adhesives, elastomers and coatings that result

from the polymerisation of methyl, ethyl or vinyl esters of IA (Willke & Vorlop, 2001). The use of alkali

salts of the homopolymer of this acid in detergents (Lancashire, 1969) and sequestrants (Carter & Irani,

1970) has also been recommended. For example, IA can substitute sodium tripolyphosphate to produce

phosphate-free detergent builders (Global Industry Analysts Inc., 2016). Moreover, IA is easily

convertible into 3-methyltetrahydrofuran (3-MTHF), a fuel with outstanding physical and chemical

combustion properties (Geilen et al., 2010; Geiser et al., 2015) and can replace petrol-based chemical

compounds such as acetone cyanohydrin in the production of methacrylic acid (MAA) in industry (Global

Industry Analysts Inc., 2016; Lee, Kim, Choi, Yi, & Lee, 2011). More examples of applications of IA as

a direct substitute of chemical compounds include the replacement of acrylic acid and maleic anhydride

in the synthesis of superabsorvent polymers (SAP) and unsaturated polyester resins (UPR), respectively

(Global Industry Analysts Inc., 2016).

In terms of size, IA market surpassed 75 million US$ in 2015 (Global Market Insights, 2016) and is

expected to grow, exceeding 216 million US$ in just five years (2020) (Global Industry Analysts Inc.,

2016) and surpassing 290 million US$ by 2024 (Global Market Insights, 2016). Such market growth is

associated to several causes like growing concerns regarding the use of fossil fuels and IA

advantageous characteristics such as biodegrability and non-toxicity (Global Market Insights, 2016). In

particular, production of MMA is projected to be the IA application with the biggest growth, with an

2

expected market size of 80 million US$ in 2024 due to new applications of MMA in LCD, monitors and

other types of screens (Global Market Insights, 2016). Another key potential application of IA is in

synthetic latex as a polymer stabilizer that improves final quality. Synthetic latex represented 50% of the

global market for IA in 2015 and is expected to grow due to increasing demand of paints, coatings,

adhesives and sealants in the construction industry (Global Market Insights, 2016).

Despite the wide range of applications and market growth opportunities, the high cost of production of

IA is still limiting its applications (Global Market Insights, 2016) and remains an obstacle to be tackled

in face of the availability of cheap substitutes like acetone cyanohydrins (Global Industry Analysts Inc.,

2016).

Among the natural itaconic acid producing organisms there are Aspergillus terreus and Ustilago maydis

(Guevarra & Tabuchi, 1990; Klement & Büchs, 2012).

The current status in commercial production of IA is submerged fermentation with A. terreus. Although

in early development stages the concentrations obtained were of only around 25 g L-1 (Kane et al., 1945),

nowadays this fungus can yield an itaconate concentration of up to 86 g L-1 when the process is

optimized (Kuenz et al., 2012). Moreover, this organisms has high tolerance to low pH which is

advantageous not only because it helps to create auto-sterile conditions (Klement & Büchs, 2012) but

also in terms of downstream processing since formation of by-products is supressed (Batti, 1964) and

acidic conditions allow direct separation of IA by crystallization. This is the most commonly used method

for recovery of IA from the fermentation broth despite the fact that it does not separate by-products like

succinic and malic acid which results in lower purity of the final product (Klement & Büchs, 2012; Okabe,

Lies, Kanamasa, & Park, 2009). Regardless of the many advantages, A. terreus is a filamentous fungi

which brings several challenges during fermentation such as high viscosity of the broth, clogging and a

difficult balance between enough agitation power input for sufficient oxygen transfer and the mechanical

stress caused by stirring that can break the mycelia (Geiser et al., 2015; Klement & Büchs, 2012).

Alternatively, U. maydis provides a major advantage in submerged fermentations due to its single-cell

(yeast-like) morphology. This morphology not only avoids the well-known problems caused by

filamentous growth during fermentation but also simplifies the inoculation process since the mycelial

pellets are difficult to characterize and its size strongly influences itaconate production (Gyamerah,

1995). Furthermore, it is a model organism for mating, pathogenicity, signal transduction and genomics

having therefore its genome well-characterized (Martı́nez-Espinoza, Garcı́a-Pedrajas, & Gold, 2002).

The rising biotechnological interest in U. maydis is also a result of the natural production of several

secondary metabolites such as organic acids like itaconic, l-itatartaric and l-2-hydroxyparaconic acid

(Guevarra & Tabuchi, 1990), glycolipids, siderophores and tryptophan-derived compounds (Bölker,

Basse, & Schirawski, 2008). Moreover, certain strains achieve high concentrations of the previously

mentioned organic acids as well as malate, succinate and erythritol (Guevarra & Tabuchi, 1990;

Maassen et al., 2014)

As a plat pathogen, this fungus has a unique set of enzymes essential for breaking down lignocellulosic

biomass (Couturier et al., 2012) that, in theory, enable utilization of cellulose, xylan, pectin and lignin

3

(Couturier et al., 2012; Maassen et al., 2014; Mueller et al., 2008). Moreover, these cells are robust in

the presence of impurities from crude biomass feedstock although the biomass pre-treatment should be

carefully chosen to minimize influence in the subsequent fermentation process and avoid interference

with the required nitrogen limitation (Klement et al., 2012; Maassen et al., 2014). Furthermore, IA

production in U. maydis appears to be favoured by low initial concentrations of glucose which is

interesting for a process based on lignocellulosic hydrolysate where a high dilution is used to lower

inhibitory compounds concentration (Maassen et al., 2014; Wierckx, Koopman, Ruijssenaars, & de

Winde, 2011). U. maydis can also consume xylose (Geiser et al. 2013; Maassen et al. 2014). The fact

that the price of the raw-materials, especially glucose, is one of the main factors compromising the

profitability of IA production (Klement & Büchs, 2012) and the previously described characteristics make

U. maydis a promising organism for production of value-added chemicals like itaconic acid using

lignocellulosic biomass as raw material (Geiser et al., 2013).

Nevertheless, itaconate production titers in U. maydis are lower than the ones obtained with A. terreus

and the cells are more sensitive to low pH with itaconate being produced at moderate pH values between

4,5 and 6 (Klement & Büchs, 2012).

The pathway towards itaconic acid is compartmentalized between the mitochondria and the cytosol

(Geiser et al., 2015; Steiger, Punt, Ram, Mattanovich, & Sauer, 2016) and had been previously

elucidated in A. terreus and in human macrophages. In both organisms itaconic acid is generated by

decarboxylation of the tricarboxylic acid cycle (TCA) intermediate cis-aconitate. Recently, all genes

involved in the itaconate pathway in U. maydis have been identified as a cluster by Geiser et al. (Geiser

et al., 2016).

Figure 2 – Biosynthetic pathway for itaconate production in U. maydis: cis-aconitate is transported to the cytoplasm by Mtt1 where it is isomerised to the unusual intermediate trans-aconitate by Adi1. Itaconate is formed by decarboxylation of trans-aconitate by Tad1. Once itaconate is in the cytoplasm, it can be either directly exported by Itp1 or further converted to 2-hydroxyparaconate by Cyp3 which is then exported by the same transporter. Source: (Geiser et al., 2016).

4

The metabolic pathway starts with the transport of cis-aconitate to the cytoplasm via the mitochondrial

tricarboxylate transporter Mtt1. Unlike A. terreus, the basidiomycetous fungus U. maydis produces

itaconic acid via decarboxylation of the toxic intermediate trans-aconitate, the thermodynamically

favoured isomer of cis-aconitate (Geiser et al., 2015). This unusual intermediate is the

thermodynamically favoured isomer of cis-aconitate and results from its isomerization by aconitate-Δ-

isomerase (Adi1). Then trans-aconitate is decarboxylated by the critical enzyme trans-aconitate

decarboxylase (Tad1) which is remarkably different from A. terreus key-enzyme cis-aconitic acid

decarboxylase (CadA) (Geiser et al., 2015). Once itaconate is formed in the cytoplasm and one of two

things can happen: itaconate can be directly exported by Itp1, the itaconate transport protein, or it can

be further converted to 2-hydroxyparaconate by the P450 monooxygenase (Cyp3) and then exported

also by Itp1. Another important gene in the cluster is ria1, which codes for a transcription factor that

regulates all the genes in the cluster (Geiser et al., 2016). Itaconate yield improved more than twofold

when cluster genes mtt1 and ria1 were overexpressed. Since ria1 is probably upregulating all cluster

genes including mtt1 this results suggest that the mitochondrial transporter Mtt1 is likely a bottleneck for

itaconate production in U. maydis (Geiser et al., 2015). The function of rdo1 is still unknown however,

its closest homolog is a macrophage colonization factor of Salmonella enterica (Geiser et al., 2015).

The identification and characterization of itaconate pathway genes and enzymes layed ground for

metabolic engineering of homologous and heterologous itaconate producing strains. In fact, the initial

experiments already led to an increase in itaconate production. Simultaneous deletion of the cyp3 gene

and overexpression of the cluster regulator ria1 (U. maydis MB215 Δcyp3 Petef ria1) not only drastically

increased itaconate production by almost 4-fold when compared to the wildtype (U. maydis MB215) but

also ceased the production of 2-hydroxyparaconate (Geiser et al., 2016). Although the conversion of

itaconate to 2-hydroxyparaconate was blocked by the deletion of cyp3 itaconate degradation was still

verified which indicates the existence of other pathways of itaconate degradation in U. maydis (Geiser

et al., 2016). Recently, a itaconate degradation pathway consisting of an itaconyl-CoA transferase,

itaconyl-CoA-hydratase, and citralmalyl-CoA-lyase was reported in A. terreus (Chen, Huang, Zhong, Li,

& Lu, 2016). This indicates a putative itaconate degradation pathway in U. maydis 521 since it contains

similar proteins, with 27-34% sequence identity on protein level (Geiser et al., 2016). Moreover, the

malate titer of the engineered strain decreased 42% when compared to the wild-type. This reduction

was associated with the upregulation of Mtt1 due to overexpression of the cluster regulator ria1 since

this transporter is likely to antiport malate with cis-aconitate into the mitochondria and therefore reverting

the malate flux from export to mitochondrial import (Geiser et al., 2016). In A. terreus the homologous

transporter MttA had already been identified as a probable cis-aconitate/malate antiporter (Jaklitsch,

Kubicek, & Scrutton, 1991).

Further metabolic engineering of U. maydis MB215 Δcyp3 Petef ria1 (Geiser et al., 2016) would imply

considerable efforts since it contains the two most common markers available for U. maydis: hygromycin

and carboxin. Therefore, a marker-free strain was designed using CRISPR/Cas9 system with cyp3

deletion and ria1 overexpression under control of the constitutive etef promoter: U. maydis KO-cyp3 Petef

ria1. However, there was no significant enhancement in itaconate production when compared to the

5

strain U. maydis MB215 Δcyp3 Petef ria1 by Geiser et al. Moreover, the new marker-free strain and

several other engineered strains by Bator showed always the same maximum itaconate titers of around

20 g L-1.

As stated before, the pathway towards itaconic acid is compartmentalized between the mitochondria

and the cytosol which gives foremost importance to the transport reactions. This compartmentalization

is used by the cell as a strategy to promptly transport cis-aconitate to cytosol and prevent the

spontaneous formation of trans-aconitate in the mitochondria due to its inhibitory effect on the

mitochondrial enzymes aconitase and fumarase (Steiger et al., 2016). In A. terreus this transport is done

by the mitochondrial carrier protein MttA and in U. maydis by its homolog Mtt1 with 35% sequence

similarity on protein level (Steiger et al., 2016). Previous unpublished studies by Tehrani showed a 50%

and 35% increase in itaconate production when mtt1 and mttA, respectively, are overexpressed in U.

maydis.

The other transporter involved in itaconate biosynthesis is the itaconate transport protein Itp1 that is

responsible for the export of itaconate to the extracellular space and is annotated as a transporter of the

major facilitator superfamily (MFS) (Geiser et al., 2015). The MFS includes a family of drug-H+

antiporters that confer multi-drug resistance (MDR) and several of this transporters have been

associated to yeast response to weak acid toxicity by exporting the counter ions RCOO- (Sá-Correia,

dos Santos, Teixeira, Cabrito, & Mira, 2009a).

Figure 3 – Multidrug resistance transporters in yeast: MFS-MDR transporters drug-H+ antiporter from the 12-spanner DHA1 family. Adapted from (Sá-Correia et al., 2009a).

The molecular mechanisms underlying carboxylic acid toxicity in fungi have been clarified in S.

cerevisiae and are greatly dependent on external pH: if it is below the weak acid pKa value the

undissociated form of the acid (RCOOH) is predominant and is able to permeate the membrane by

simple diffusion. Once in the cytoplasm, that has an almost neutral pH, the acid dissociates releasing

protons (H+) and the respective counter-ion (RCOO-) that accumulate inside the cell due to their electric

charge that prevents their transport across the hydrophobic lipid layer of the plasma membrane (Mira,

Teixeira, & Sá-Correia, 2010). For itaconate, this occurs at pH values lower than 3,65 which is this acid’s

6

pKa (YMDB/Compounds/Itaconic acid, 2017) The consequences of weak acid counter-ion accumulation

include increase in turgor pressure, oxidative stress, protein aggregation, lipid peroxidation, inhibition of

membrane trafficking among other deleterious effects. As stated before, the reduction of the internal

accumulation of acid counter-ions relies on the activity of specific inducible transporters, several of them

are MFS transporters involved in MDR in yeast (Mira et al., 2010). Many of the mechanisms underlying

MDR are apparently conserved among phylogenetically distant organisms (Tenreiro, Vargas, Teixeira,

Magnani, & Sá-Correia, 2005).

In S. cerevisiae a protein was identified for conferring resistance to quinidine and barban. This protein

was identified as a transporter of the MFS required for MDR and the gene named QDR3 for quinidine

resistance. This gene codes for a drug:H+ antiporter that belongs to the cluster I of the DHA12 drug

efflux family, according to the classification of (Nelissen, De Wachter, & Goffeau, 1997). YBR043c

expression is required for increased tolerance of S. cerevisiae to a broad range of cytotoxic compounds,

structurally and functionally unrelated (Tenreiro et al., 2005). This transporter was identified, by

chemogenomic analysis, as a determinant of resistance to itaconic acid in S. cerevisiae. Further studies

showed that internal accumulation of IA in Δqdr3 mutants is 1,5-fold higher when compared to the WT

and that overexpression of this transporter leads to a substantial reduction in IA accumulation. Moreover,

QDR3 is up-regulated about 2,5 fold when the cells are suddenly exposed to the acid after which the

transcription levels tend to reduce indicating that this is an adaptive response. Nevertheless, the

transcription level of QDR3 is kept high even 19,5h after exposure which indicates its crucial role is for

the survival of the cells in the presence of IA (Nicole Martins Rodrigues, 2014). As a MFS transporter,

Qdr3 is possibly reducing internal accumulation of IA by directly exporting the counter-ion (C5H4O42-) to

the cytosol. Alternatively, and has it was demonstrated before for other MFS-MDR transporters, there is

a possibility that Qdr3 translocates natural substrates whose homeostasis influences the accumulation

of itaconate inside the cells (Sá-Correia, dos Santos, Teixeira, Cabrito, & Mira, 2009b).

7

2. MOTIVATION AND AIMS OF THE THESIS

At the start point of this thesis the best producing strain was a KO strain for the cyp3 gene, meaning

that there is no 2-hydroxyparaconate production. As a result, there was an increase in the flux of

itaconate being exported. This strain also had the native ria1 promoter substituted by the constitutive

etef promoter therefore upregulating all genes in the cluster. The combined effect of these genetic

modifications raised the itaconate production of this strain up to 20 g L-1. Considering the bottlenecks of

this strain and the state of the art at the time, two aims were defined:

The first aim was to increase itaconate production in this strain. For this, two strategies were designed:

The first is to delete the XXX gene. Moreover, previous unpublished work showed that XXX deletion

leads to the expected result in U. cynodontis. The second strategy involves engineering of the metabolic

pathway by overexpressing mitochondrial transporters associated with the transport of cis-aconitate

from the mitochondria to the cytosol. The motivation for this strategy was the fact that Mtt1 had been

previously identified as a probable bottleneck (Geiser et al., 2015) and that previous work by Tehrani

(unpublished) showed that overexpression of mtt1 and mttA improve itaconic acid production in U.

maydis by 50%.

The second aim of this work is to characterize the function of QDR3 transporter in U. maydis. The

objectives inside each of the two aims are described as follow:

1. Enhance Itaconic Acid Production in U. maydis.

• XXX deletion using FLP/FRT recombination system

• Expression of mitochondrial transporter mttA from A. terreus under control of etef promoter

• Overexpression of mitochondrial transporter mtt1 from U. maydis under control of etef promoter

• Expression of mitochondrial transporter UcNmtt from U. cynodontis under control of etef

promoter

2. Characterize QDR3 function in U. maydis.

• Expression of multidrug resistance transporter qdr3 from S. cerevisiae under control of etef

promoter

8

3. MATERIALS AND METHODS

3.1. Chemicals and enzymes

If not mentioned otherwise, all chemicals and enzymes were ordered from Carl Roth GmbH & Co. KG

(Karlsruhe, Germany), Sigma Aldrich Chemie GmbH (Taufkirchen, Germany) and New England

BioLabs GmbH (Frankfurt a.M., Germany).

3.2. Microorganisms

All organisms used and created during this work are hereby listed with their respective genotypes and

source.

Table I - List of microorganisms used and created during this work

Organism Strain Genotype Source

Escherichia coli DH5α

fhuA2 Δ(argF‐lacZ)U169 phoA glnV44 Φ80

Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi‐1

hsdR17

Strain collection iAMB, RWTH Aachen (2382)

Escherichia coli DH5α + pStorI-1rh wt DH5α + properties of

integrated pStorI-1rh wt Strain collection iAMB, RWTH Aachen (3261)

Escherichia coli Top10 + Petef

_cbx_A_ter_mtt

Top10 + properties of integrated Petef _cbx_A_ter_mtt


Escherichia coli DH5α + Petef _cbx_05079 DH5α + properties of

integrated + Petef _cbx_05079


Escherichia coli DH5α + Petef _cbx_05079#6 DH5α + properties of

integrated Petef _cbx_05079#6


Ustilago maydis MB215 2229 a2b13 Prof. Dr. Michael Bölker,

University Marburg (3048)

Ustilago maydis MB215 KO-cyp3 + Petef#6 MB215 ΔUMAG_05074

+ properties of integrated Petef


Ustilago maydis MB215 KO-itp1 MB215 ∆UMAG_11777

#23 Strain collection iAMB, RWTH Aachen (2329)

9

Ustilago maydis MB215 KO-cyp3 + KO-

XXX + Petef

MB215 ΔUMAG_05074 ΔUMAG_XXX +

properties of integrated Petef

This thesis (4186)

Ustilago maydis MB215 + Petef qdr3 #1, #3,

#4 and #7 WT + properties of

integrated Petef_qdr3 This thesis

Ustilago maydis MB215 KO-itp1 + Petef qdr3

#4, #5, #9 and #11

MB215 ∆UMAG_11777 + properties of integrated

Petef_qdr3 This thesis

Ustilago maydis MB215 KO-cyp3 + Petef#6

+ Petef qdr3 #1-4

MB215 ΔUMAG_05074 + properties of integrated

Petef_qdr3 This thesis

Ustilago maydis MB215 KO-cyp3 KO-XXX + Petef + Petef qdr3 #1, #2, #8

and #9


properties of integrated Petef_qdr3

This thesis

Ustilago maydis MB215 KO-cyp3 KO-XXX + Petef + Petef_cbx_A_ter_mtt

#4, #14 and #15


properties of integrated Petef_cbx_A_ter_mtt

This thesis

Ustilago maydis MB215 KO-cyp3 + KO-XXX + Petef + Petef _cbx_05079

#2-5


properties of integrated Petef_cbx_05079

This thesis

Ustilago maydis MB215 KO-cyp3 KO-XXX + Petef + Petef _cbx_05079#6

#1, #5, #7 and #9


properties of integrated Petef_cbx_05079#6

This thesis

3.3. Media

3.3.1. Lysogeny broth (LB-medium)

Peptone 1% (w/v)

Sodium chloride 1% (w/v)

Yeast extract 0,5% (w/v)

Agar (for solid medium) 2% (w/v)

Demineralized water

10

3.3.2. Yeast extract peptone medium (YEPS-medium)

Sucrose 1% (w/v)

Peptone 1% (w/v)

Yeast extract 1% (w/v)

Agar (for solid medium) 2% (w/v)

Demineralized water

3.3.3. Regeneration agar (REG-agar)

Sorbitol 1 M

Peptone 1% (w/v)

Yeast extract 1% (w/v)

Sucrose 1% (w/v)

Agar (for solid medium) 1,5% (w/v)

Demineralized water

Preparation of REG-agar plates was done in two steps. The first one consisted in preparing the bottom

agar by pouring 10mL of REG-agar containing two-fold antibiotic concentration for selection into a petri

dish. Finally, after solidification of the bottom agar and not too long before inoculation, 10mL REG-agar

antibiotic-free were added as top layer.

3.3.4. Screening medium

Glucose 50 or 100 g L-1

MES (pH 6.5) 30 or 100 mM

NH4Cl 0,8 g L-1

Vitamin solution (1000x) 1 mL L-1

Trace element solution (1000x) 1 mL L-1

MgSO4 • 7 H2O 0,2 g L-1

FeSO4 • 7 H2O 0,01 g L-1

KH2PO4 0,5 g L-1

Demineralized water

The vitamin solution contained (per liter): 0,05 g D-biotin, 1 g D-calcium penthotenate, 1 g nicotinic acid,

25 g myo-inositol, 1 g thiamine hydrochloride, 1 g pyridoxol hydrochloride and 0,2 g para-aminobenzoic

acid. The trace element solution contained (per liter): 1,5 g EDTA, 0,45 g ZnSO4 • 7 H2O, 0,1 g MnCl2 •

4 H2O, 0,03 g CoCl2 • 6 H2O, 0,03 g CuSO4 • 5 H2O, 0,04 g Na2MoO4 • 2 H2O, 0,45 g CaCl2 • 2 H2O,

0,3 g FeSO4 • 7 H2O, 0,1 g H3BO3 and 0,01 g KI (Geiser et al. 2014). If CaCO3 buffer (pH 6,5) was used

instead of MES buffer (pH 6,5), final concentration was 99 g L-1.

11

3.4. Solutions

SCS pH 5,8

Sorbitol 1 M

Sodium Citrate 20 mM

Demineralized water

STC pH 7,5

Calcium Chloride 100 mM

Sorbitol 1 M

Tris-HCl pH 7,5 10 mM

Demineralized water

Lysis Buffer

TritonX-100 7% (w/v)

SDS 1% (w/v)

Tris-HCl pH 8,0 10 mM

NaCl 100 mM

EDTA 1 mM

Demineralized water

3.5. Growth Conditions

3.5.1. Cultivation of Escherichia coli (E. coli)

For E. coli strains, LB liquid medium or LB-agar plates were used for incubation at 37°C. In shake flasks

E. coli strains were shaken at 250 rpm (shaking diameter = 25 mm) with a filling volume of 10%. If the

strains contained a plasmid with an ampicillin resistance cassette then 100 µg mL-1 ampicillin was added

to the medium to avoid loss of the plasmid.

3.5.2. Cultivation of Ustilago maydis (U. maydis)

For U. maydis strains YEPS medium or YEPS-agar plates were used for incubation at 30°C. In shake

flasks U. maydis strains were shaken at 200 rpm (shaking diameter = 25 mm) with a filling volume of

10%. For cultivation in SystemDuetz® (24 well plates) screening media was used with a filling volume of

1,5 mL, agitation at 300 rpm (shaking diameter = 50 mm), 30°C and 80% air humidity. If the strains

contained a plasmid with a carboxin (cbx) or hygromycin (hyg) resistance cassette then 2 μg mL-1 cbx

and 200 μg mL-1 hyg, respectively, were added to the medium to avoid loss of the plasmid.

3.5.3. Cryocultures

For long-term storage, 500 µL of glycerol (80% (v/v)) was added to 500 µL of overnight culture, the

mixture was then vortexed and kept in aliquots at -80°C.

12

3.6. Oligonucleotides

All the PCR primers were designed with Clone Manager and order from Eurofins Genomics GmbH

(Ebersberg, Germany) and are listed in the following table. The small letters represent overhanging

regions.

Table II - Primers used and their sequences (the small letters represent non-binding regions)

Primer name Sequence 5’ -> 3’

HT-4a ACAGACGTCGCGGTGAGTTC

HT-33 CACCCATCCCAGCGATGTAG

HT-130 TCGTTAGAACGCGGCTAC

HT-149 TGAGTATTCAACATTTCCGTG

HT-202 TCCTGCGTCAGTCGTCCAAC

HT-203 GTCCGAGGGCAAAGGAATAG

HT-204 -

HT-205 -

HT-206 acgtttcacgGGCCAGAAGTTCCTATTC

HT-207 tctcagtcggGGCCAGAAGTTCCTATAC

HT-208 -

HT-209 -

HT-210 -

HT-210a -

HT-211 CCGTGTACCTGGCTGTGTAG

HT-220 -

HT-223 GCTCCAACTGCTCGGACAAC

HT-224 CGTAGTTCTCGCGCCAGTAG

HT-227 GCTATTGTGCGGTACGCAAC

Potef fwd CCAATAAAGGGCGCTGTCTC

Tnos rev CAAGACCGGCAACAGGATTC

13

3.7. Plasmids

3.7.1. Plasmid Petef_qdr3

Plasmid Petef_qdr3 was ordered from ThermoFischer Scientific (Schwerte, Germany) and transformed

in E. coli chemically competent cells according to 3.10. After overnight incubation, a master plate was

inoculated with isolated colonies of transformants and incubated overnight. Transformants from the

master plate were chosen and inoculated in LB medium with ampicillin as described in 3.5.1. After

approximately 24h of incubation the plasmid was isolated according to 3.11 and its concentration was

determined according to 3.19. The plasmid was then restricted overnight with SspI® (New England

Biolabs GmbH, Frankfurt a.M., Germany) and purified (as described in 3.18). The restricted plasmid

was run on agarose gel for size verification: 7617 bps. For transformation in U. maydis MB215, U.

maydis MB215 KO-mtt1, U. maydis MB215 KO-cyp3 + Petef#6 and U. maydis MB215 KO-cyp3 + KO-

XXX + Petef 500 ng of restricted, purified plasmid were used.

Figure 4 – Map of the plasmid Petef_qdr3: Petef – constitutive etef promoter, QDR3 – S. cerevisiae QDR3 codon optimized gene for expression in U. maydis. , Tnos – Poly(A) tail, ori ColE1 – origin of replication for E. coli, ampR – ampicillin resistance cassette, cbx – carboxin resistance cassette.

3.7.2. Plasmid Petef_cbx_A_ter_mttA

Plasmid Petef_cbx_A_ter_mttA was stored in E. coli DH5α, corresponding to strain number 3010 of the

iAMB, RWTH Aachen strain collection. Biomass from the cryoculture of this strain was streaked out on

a fresh LBA plate and incubated overnight. The freshly grown cells were then inoculated in 25 mL of LB

medium with ampicillin as described in 3.5.1. After approximately 24h of incubation the plasmid was

isolated according to 3.11 and its concentration was determined according to 3.19. The plasmid was

then restricted overnight with SspI® (New England Biolabs GmbH, Frankfurt a.M., Germany) and

purified (as described in 3.18). The restricted plasmid was run on agarose gel for size verification: 6453

bps. For transformation in U. maydis MB215 KO-cyp3 + KO-XXX + Petef 500 ng of restricted purified

plasmid were used.

14

Figure 5 - Map of the plasmid Petef_cbx_A_ter_mtt: Petef – constitutive etef promoter, mttA – A. terreus mttA codon optimized gene for expression in U. maydis, Tnos – Poly(A) tail, ori ColE1 – origin of replication for E. coli,

ampR – ampicillin resistance cassette, cbx – carboxin resistance cassette.

3.7.3. Plasmid Petef_cbx_05079

Plasmid Petef_cbx_05079 was stored in E. coli DH5α, corresponding to strain number 3181 of the iAMB,

RWTH Aachen strain collection. Biomass from the cryoculture of this strain was streaked out on a fresh

LBA plate and incubated overnight. The freshly grown cells were then inoculated in 25 mL of LB medium

with ampicillin as described in 3.5.1. After approximately 24h of incubation the plasmid was isolated

according to 3.11 and its concentration was determined according to 3.19. The plasmid was then

restricted overnight with SspI® (New England Biolabs GmbH, Frankfurt a.M., Germany) and purified (as

described in 3.18). The restricted plasmid was run on agarose gel for size verification: 6784 bps. For

transformation in U. maydis MB215 KO-cyp3 + KO-XXX + Petef, 500 ng of restricted purified plasmid

were used.

15

Figure 6 - Map of the plasmid Petef_cbx_05079: Petef – constitutive etef promoter, Mtt1 – U. maydis mtt1 gene, Tnos – Poly(A) tail, ori ColE1 – origin of replication for E. coli, ampR – ampicillin resistance cassette, cbx – carboxin

resistance cassette.

3.7.4. Plasmid Petef_cbx_05079#6

Plasmid Petef_cbx_05079#6 was stored in E. coli DH5α, corresponding to strain number 3906 of the

iAMB, RWTH Aachen strain collection. Biomass from the cryoculture of this strain was streaked out on

a fresh LBA plate and incubated overnight. The freshly grown cells were then inoculated in 25 mL of LB

medium with ampicillin as described in 3.5.1. After approximately 24h of incubation the plasmid was

isolated according to 3.11 and its concentration was determined according to 3.19. The plasmid was

then restricted overnight with SspI® (New England Biolabs GmbH, Frankfurt a.M., Germany) and

purified (as described in 3.18). The restricted plasmid was run on agarose gel for size verification: 6718

bps. For transformation in U. maydis MB215 KO-cyp3 + KO-XXX + Petef, 500 ng of restricted purified

plasmid were used.

16

Figure 7 - Map of the plasmid Petef_cbx_05079#6: Petef – constitutive etef promoter, UcN_05079 – U. cynodontis mtt gene, Tnos – Poly(A) tail, ori ColE1 – origin of replication for E. coli, ampR – ampicillin resistance cassette, cbx

– carboxin resistance cassette.

3.7.5. Plasmid pJET1.2_Um_FRT-KO-XXX construction for XXX deletion in U.

maydis using FLP/FRT recombination system

Plasmid pJET1.2_Um_FRT-KO-XXX was created by Gibson assembly of four DNA fragments: 1) the

backbone plasmid pJET1.2 from CloneJET PCR Cloning Kit Mix (ThermoFischer Scientific, Schwerte,

Germany), 2) hygromycin cassette and FRT sites, 3) flanking region 1 and 4) flaking region 2.

The fragment containing the FRT sites and the hyg cassette was amplified by PCR using the primers

HT-206 and HT-207 (Table II). Annealing temperature was set on 60°C and extension time was 84

seconds. As template, plasmid pStorI-1rh was used. This plasmid was isolated from E.coli DH5α (3261)

(Table I) using Monarch Plasmid Miniprep Kit (New England BioLabs, Frankfurt a.M., Germany).

Both flanks were also amplified by PCR. As template, genomic DNA from U. maydis MB215 isolated

according to 3.8 was used. For flanking region 1 primers HT-204 and HT-205 (Table II) were used and

annealing temperature set on 64°C whereas for flanking region 2 primers HT-208 and HT-209 (Table II)

were used and the annealing temperature was 63°C. These primers were designed using U. maydis

genome sequence so that both flanking regions have 1030 bps. Extension time was set on 30 seconds

for both flanks.

For all three PCR reactions mentioned above Q5® High-Fidelity Polymerase was used according to the

supplier’s manual. All PCR products were purified using GenepHlowTN Gel/PCR Kit (GeneAid, New

Taipei, Taiwan). The concentration of each PCR product was measured at 260/280 nm with NanoDrop

One UV Vis Spectrophotometer (ThermoFischer Scientific, Schwerte, Germany) and their size was also

verified in agarose gel (3.20). Finally, the purified fragments were assembled with pJET1.2 as backbone

plasmid by Gibson Assembly using Gibson Assembly® Cloning Kit (New England BioLabs, Frankfurt

a.M., Germany). For this, 50 ng of backbone plasmid pJET1.2 was mixed with the purified fragments

17

(using a 1:3 mass ratio in pmol, as described in the Cloning Kit manual), the Cloning Kit master mix

(10µL) and nuclease-free water, so that the total volume was of 20 µL. The mixture was then incubated

for 2h at 50°C. The assembled plasmid was then transformed in E.coli as detailed in 3.10. Colonies

containing the pJET1.2_Um_FRT-KO-XXX plasmid showed a single band at 4776 bps after colony PCR

as described in 3.13.1. For colony PCR primers HT-210 and HT-211 were used and annealing

temperature set in 52°C and 288 seconds extension time. Finally, and after inoculation of successfully

transformed colonies, plasmid pJET1.2_Um_FRT-KO-XXX was isolated using Monarch Plasmid

Miniprep Kit (New England BioLabs, Frankfurt a.M., Germany)

Figure 8 - Map of the plasmid pJET1.2_Um_FRT-KO-XXX: Flanks 1 and 2 – flanking regions (1030 bps) for homologous recombination, FRT-site – flippase recognition target, HygR – hygromycin resistance cassette

3.8. Isolation of genomic DNA from U. maydis

The protocol followed for isolation of genomic DNA from U. maydis was shortened from the one

described by Hoffman and Winston 1987 by minor modifications. Cells from overnight cultures were

collected after centrifugation at 13000 rpm for 1 minute. The supernatant was then decanted and the

pellet resuspended in 500 µL Lysis buffer (7% (w/v) TritonX-100, 1% (w/v) SDS, 100 mM NaCl, 10 mM

Tris‐HCl pH 8.0, 1 mM EDTA). Subsequently, 300 mg of glass beads and 500 µL phenol/chloroform (50

%(v/v)) were added and the cells were disrupted in a vortex for 10 minutes followed by 10 minutes of

centrifugation at 13000 rpm. The upper aqueous phase was transferred into a new tube and 1 ml of ice

cold ethanol (100%) was added. The tube was then centrifuged again at 13000 rpm for 10 minutes. The

resulting supernatant was discarded and the pellet resuspended in 1ml of ice cold ethanol (70%). The

resulting solution was centrifuged one last time at 13000 rpm for 10 minutes and the resulting pellet was

dried for 15 minutes at 65°C. The dried pellet was then dissolved in 50 µL TE buffer (1 mM EDTA, 10mM

Tris-HCl, pH8) containing RNAase A (10 mg mL-1) and stored at 4°C.

18

3.9. Production of chemically competent E. coli cells

Chemically competent cells used were DH5αTM (New England BioLabs, Frankfurt a.M., Germany)

3.10. Transformation of chemically competent E. coli cells

After being thawed on ice 50 µL of chemical competent cells (DH5α) were transferred to a 1,5 ml micro-

centrifuge tube after which up to 5 µL of assembled product or plasmid were added. The mixture was

gently mixed by pipetting before being placed on ice for 30 minutes. Subsequently the mixture was

subjected to a heat shock at 42°C for 30 seconds and then placed back on ice for 2 more minutes.

Afterwards, 950 µL of LB media at room temperature was added to each tube. The cells were then

incubated at 37°C and 250 rpm (shaking diameter 25 mm) for 60 minutes. After this time, 50 µL and 100

µL of the suspension were platted on LB medium with ampicillin and incubated overnight at 37 °C.

3.11. Plasmid isolation from E. coli

For plasmid isolation from E. coli the Monarch Plasmid Miniprep Kit (New England BioLabs, Frankfurt

a.M., Germany) was used following its instruction manual.

3.12. Gibson assembly

Gibson assembly was performed using Gibson Assembly® Cloning Kit (New England BioLabs, Frankfurt

a.M., Germany) according to the manual.

3.13. Colony PCR

3.13.1. Colony PCR in E. coli

Colony PCR was performed according to the method described by Chomczynski and Rymaszewski

(Chomczynski & Rymaszewski, 2006) and using OneTaq® 2X Master Mix with Standard Buffer (New

England BioLabs, Frankfurt a.M., Germany) according to the supplied manual.

3.13.2. Colony PCR in U. maydis

Colony PCR was carried out according to Blount, Driessen, and Ellis with minor modifications (Blount

et al., 2016). Cell material from agar plates was added to 1,5 mL microcentrifuge tubes containing 100

µL Chelex (5% (w/v)) and glass beads. The tubes were then vortexed for ten minutes and incubated at

100°C for six minutes. Finally, the tubes were centrifuged at maximum rpm for one minute. Finally, 1 µL

of the supernatant was used as template for PCR using Phire Plant Direct PCR Master Mix

(ThermoFischer Scientific, Schwerte, Germany) according to the supplied manual. For storing the tubes

were kept at 4°C.

3.14. Production of U. maydis protoplasts

Production of protoplasts was carried out according to Schulz et al. with minor modifications (Schulz et

al., 1990). An overnight culture of U. maydis was inoculated in 50 mL preheated YEPS-medium to an

19

OD600 of 0,2. After an OD600 of 0,8 was reached the culture was centrifuged for ten minutes at 4000 rpm

and 4 °C. The resulting pellet was then resuspended in 25 mL SCS (1M sorbitol, 20mM sodium citrate,

pH 5,8) and afterwards centrifuged for ten minutes at 4000 rpm and 4 °C. The resulting pellet was

resuspended in 2 mL SCS containing 20 mg mL-1 Lysing Enzyme (from Trichoderma harzianum; Sigma

Aldrich Chemie GmbH, Taufkirchen, Germany) and left at room temperature for incubation while the

protoplastation process was followed on the microscope. After five to ten minutes after, when 80 % of

the cells were in state of protoplasts, cells were washed three times with 10 mL SCS (10 minutes at

2300 rpm and 4 °C) to stop the reaction. After the final washing step, the pellet was resuspended in 500

μl STC (100mM calcium chloride, 1M sorbitol in 10 mM Tris-HCl, pH 7,5) and distributed in aliquots of

50 μL that were stored at ‐80°C.

3.15. Transformation of U. maydis via protoplasts

Transformation of U. maydis via protoplasts was carried out according to Tsukuda et al . (Tsukuda et

al., 1988). Aliquots of 50 μL containing the protoplasts to be transformed were thawed on ice for ten

minutes before adding 500 ng of DNA. Afterwards ten minutes of incubation on ice took place. After this

500 μL of STC‐PEG solution (40 % (w/v) PEG 4000 in STC) was added followed by ten more minutes

of incubation on ice. After incubation, the whole suspension was spread on a freshly prepared REG-

agar plate with the selection antibiotic. Colonies were obtained after two to three days of incubation at

30°C.

3.16. Optical density measurement

Optical density of cells was measured as absorbance at 600 nm (OD600) with an Ultrospec 10 Cell

Density Meter (Amersham Biosciences, Chalfont St Giles, UK).

3.17. Polymerase chain reaction (PCR)

For all PCR reactions FlexCycler (Analytik Jena, Jena, Germany) was used. The polymerases used

were either OneTaq® 2X Master Mix with Standard Buffer, Q5® High‐Fidelity DNA Polymerase (New

England BioLabs, Frankfurt a.M., Germany) or Phire Plant Direct PCR Master Mix (ThermoFischer

Scientific, Schwerte, Germany) according to the supplied manuals.

3.18. Purification of PCR products

For PCR product purification GenepHlowTN Gel/PCR Kit (GeneAid, New Taipei, Taiwan) was used

according to the supplied manual.

3.19. Determination of DNA concentration

The concentration and purity of genomic DNA was determined using NanoDrop One UV Vis

Spectrophotometer (ThermoFischer Scientific, Schwerte, Germany). Concentration was measured at

260/280 nm.

20

3.20. Agarose gel electrophoresis

For separation and visualization of DNA fragments, 1 % (w/v) agarose gels stained with 50 µL L-1 Roti®-

Safe GelStain in 1x TAE-buffer (40 mM Tris, 2 mM EDTA, pH 8) were used.

3.21. High-performance liquid chromatography (HPLC) analysis

Glucose and organic acid concentrations in the supernatants were analysed in a Beckmann Coulter

System Gold High Performance Liquid Chromatography (Beckmann Coulter GmbH, Germany) with an

Organic Acid Resin 300 x 8 mm column (CS-Chromatography, Germany) and a differential refractometer

LCD 201 (MELZ, Germany). As eluent, 5 mM H2SO4, with a flow rate of 0,6 mL min-1 and a temperature

of 40°C was used. All samples were filtered with Rotilabo® syringe filters (CA, 0,2 μm, Ø 15 mm) and

afterwards diluted 1:4 with bidistilled water.

3.22. Microscopy

For culture observation microscope Leica DM750 was used (Leica Microsystems, Wetzlar, Germany)

with 10x, 40x, 63x and 100x oil immersion objectives.

3.23. pH measurement

For measuring pH the pH electrode InLab® semi-micro (Mettler Toledo, Zaventem, Belgium) was used

connected to HI 2211 pH/ORP Meter (HANNA instruments, Rhode Island, USA).

21

3. RESULTS

4.1. Enhancement of Itaconate Production in U. maydis

4.1.1. Strategy 1 in U. maydis

Previous strain improvement studies with Ustilago showed that the deletion of the cyp3 gene and ria1

overexpression leads to higher itaconate production (Geiser et al., 2016). This resulted in high itaconic

acid concentrations in the media and low pH.

Consequently, more studies became crucial for strain improvement. Therefore, XXX deletion is a

promising strategy in U. maydis.

4.1.1.1. XXX deletion in U. maydis KO-cyp3+Petef using FLP/FRT

recombination system

For deletion of XXX in U. maydis the plasmid pJET1.2_Um_FRT-KO-XXX (3.7.5) was created by Gibson

assembly, as described in 3.12, of four DNA fragments: 1) the backbone plasmid pJET1.2 from

CloneJET PCR Cloning Kit Mix (ThermoFischer Scientific, Schwerte, Germany), 2) hygromycin cassette

and FRT sites, 3) flanking region 1 and 4) flaking region 2.

The fragment containing the FRT sites and the hyg cassette was amplified in 50µL PCR reaction using

the primers HT-206 and HT-207 (Table II) and plasmid pStorI-1rh as template. Annealing temperature

was set on 60°C and extension time was 84 seconds. To isolate StorI-1rh and use it as template,

cryocultures of E. coli cells harbouring this plasmid were streaked out on LBA plates and incubated

overnight. The freshly grown cells were then inoculated in LB medium with ampicillin as described in

3.5.1. After approximately 24h of incubation the plasmid was finally isolated according to 3.11 and was

ready to be used as PCR template.

Both flanks were also amplified in 50µL PCR reactions using U. maydis MB215 genomic DNA as

template. For flanking region 1 primers HT-204 and HT-205 (Table II) were used and annealing

temperature set on 64°C whereas for flanking region 2 primers HT-208 and HT-209 (Table II) were used

and the annealing temperature was 63°C. These primers were designed using U. maydis genome

sequence so that both flanking regions have 1030 bps. Extension time was set on 30 seconds for both

flanks. To isolate U. maydis MB215 genomic DNA cells from overnight cultures were centrifuged and

the pellet resuspended in 500 µL Lysis buffer (7% (w/v) TritonX-100, 1% (w/v) SDS, 100 mM NaCl, 10

mM Tris‐HCl pH 8.0, 1 mM EDTA). Subsequently, cells were disrupted by being placed on a vortex for

10 minutes with glass beads and 500 µL phenol/chloroform (50 %(v/v)) followed by 10 minutes of

centrifugation at 13000 rpm. The aqueous phase was recovered and 1 ml of ice cold ethanol (100%)

was added. After new centrifugation at 13000 rpm for 10 minutes the supernatant was discarded, and

the pellet resuspended in 1ml of ice cold ethanol (70%). The resulting solution was centrifuged one last

time in the same conditions as before and the resulting pellet was dried for 15 minutes at 65°C. The

dried pellet was then dissolved in 50 µL TE buffer (1 mM EDTA, 10mM Tris-HCl, pH8) containing

RNAase A (10 mg mL-1) and stored at 4°C.

22

For all three PCR reactions mentioned above Q5® High-Fidelity Polymerase was used according to the

supplier’s manual. All PCR products were purified using GenepHlowTN Gel/PCR Kit (GeneAid, New

Taipei, Taiwan) (3.18) and their concentration was measured at 260/280 nm using NanoDrop One UV

Vis Spectrophotometer (ThermoFischer Scientific, Schwerte, Germany) (3.19). PCR product size was

verified in agarose gel (3.20). As expected PCR to amplify the flanking regions resulted in single bands

at 1030 bps and amplification of hyg cassette plus FRT sites resulted in a single band at 2808 bps

(Figure 9).

Figure 9 - Agarose gel of DNA fragments for pJET1.2_Um_FRT-KO-XXX assembly: Lanes L – GeneRuler 1 Kb DNA Ladder; Lanes A-B – Flanking region 1 (expected band size: 1000 bps); Lanes C-D – Flanking region 2 (expected band size: 1000 bps); Lanes E-F – hyg cassette + FRT sites (expected band size: 2808 bps)

After verification in agarose gel, the three fragments (Hyg+FRT sites, flanking region 1 and flanking

region 2) were assembled together with pJET1.2 as backbone plasmid by Gibson Assembly using

Gibson Assembly® Cloning Kit (New England BioLabs, Frankfurt a.M., Germany). For this, 50 ng of

backbone plasmid pJET1.2 was mixed with the purified fragments (using a 1:3 mass ratio in pmol, as

described in the Cloning Kit manual), the Cloning Kit master mix (10µL) and nuclease-free water, so

that the total volume was of 20 µL. The mix was then incubated for 2h at 50°C. After the assembly, the

plasmid was transformed in E.coli competent cells. For this, ice 50 µL of chemical competent cells

(DH5α) were thawed on ice and then transferred to a 1,5 ml micro-centrifuge tube and gently mixed by

pipetting with 5 µL of assembled product. The mixture was placed on ice for 30 minutes and then

subjected to a heat shock at 42°C for 30 seconds. After the heat shock, it was placed back on ice for 2

more minutes. Afterwards, 950 µL of LB media at room temperature was added to each tube. The cells

were then incubated at 37°C and 250 rpm (shaking diameter 25 mm) for 60 minutes. After this time, 50

µL and 100 µL of the suspension were platted on LB medium with ampicillin and incubated overnight at

37 °C. After overnight incubation two master plates were inoculated. After overnight incubation of the

master plates colony PCR was performed as described in 3.13.1 using primers HT-210 and HT-211

(Table I) and OneTaq® 2X polymerase. Annealing temperature was set on 52°C and extension time on

288 seconds. Finally, the PCR products were run on agarose gel. Colonies containing the knockout

construct, and therefore the assembled plasmid (pJET1.2_Um_FRT-KO-XXX) showed a single band at

4776 bps (data not shown).

A B C D E F L L

1000

3000

6000

23

Finally, and after inoculation of successfully transformed colonies, the plasmid pJET1.2_Um_FRT-KO-

XXX containing the knockout construct for XXX deletion was isolated using Monarch Plasmid Miniprep

Kit (New England BioLabs, Frankfurt a.M., Germany). As mentioned before, the KO construct is

composed by two flanking regions (upstream and downstream of XXX), a hyg cassette and FRT sites

for subsequent removal of the resistance cassette. Plasmid pJET1.2_Um_FRT-KO-XXX was used as

template for amplification of the knockout construct using primer pair HT-210 and HT-211 (Table II) and

Q5® High-Fidelity Polymerase. Annealing temperature was set in 66°C and extension time of 144

seconds. As expected, the PCR resulted in a single band at 4776 bps (Figure 10).

Figure 10 - Agarose gel of knockout construct for XXX deletion: Lanes L – GeneRuler 1 Kb DNA Ladder; Lanes A-B – Knockout construct for XXX deletion (expected band size: 4776 bps). The extra bands (two bands above the

construct and one below) are due to the presence of plasmid (supercoiled structure)

24

Figure 11 - Schematic representation of the cloning strategy used to construct the pJET1.2_Um_FRT-KO-XXX plasmid, followed by amplification of the KO construct for subsequent transformation in U. maydis.

Finally, the amplified knockout construct was purified using GenepHlowTN Gel/PCR Kit (GeneAid, New

Taipei, Taiwan) (3.18) and transformed in U. maydis KO-cyp3+Petef protoplasts. For this, aliquots of 50

μL containing the protoplasts were thawed on ice before adding 500 ng of KO construct. Afterwards, ten

minutes of incubation on ice took place. After this 500 μL of STC‐PEG solution (40 % (w/v) PEG 4000

in STC) was added followed by ten more minutes of incubation on ice. After incubation, the whole

suspension was spread on a freshly prepared REG-agar plate with hyg as selection antibiotic. Colonies

were obtained after two to three days of incubation at 30°C.

The success of the knockout construct integration was verified by colony PCR (3.13.2) using two sets

of primers (Figure 12): HT-210a with HT-4a (annealing temperature 68°C and 41 seconds extension

time) and HT-203 with HT-220 (annealing temperature 62°C and 40 seconds extension time). For this

reaction Phire Plant polymerase was used. As a negative control genome isolated from the wildtype

was used. The agarose gels obtained are in Figure 13.

25

Figure 13 - Agarose gel of colony PCR with primers HT-210a and HT-4a (left; expected band: 2048 bps) and HT-203 and HT-220 (right; expected band: 1963 bps) for verification of correct integration of the knockout construct: Lanes L – GeneRuler 1 Kb DNA Ladder; Lane A – wildtype (negative control, no band expected); Lane B – transformant #12(2); Lane C – transformant #12(3); Lane D – transformant #16(2); Lane E – transformant

#16(3); .

Transformant U. maydis KO-cyp3 + KO-XXX + Petef #12(2) was chosen for cultivation and further studies.

Figure 12 - Representation of the PCR’s performed for verifying the correct integration of the knockout construct in U. maydis Δcyp3 + Petef genome

26

4.1.1.2. Cultivation studies in U. maydis KO-cyp3 + KO-XXX + Petef #6

In order to investigate the effect of XXX deletion in itaconate production, cultivation studies in screening

medium with 50 g L-1 glucose (3.3.4) were performed. The cultivation was performed in triplicates in

SystemDuetz® plates over 96h using U. maydis KO-cyp3 + Petef #6 as control. Samples were taken

every 24h for HPLC analysis according to 3.21 and OD and pH measurements. Three different buffers

were used: 30 mM MES, 100 mM MES and 99 g L-1 CaCO3.

As expected (oral speech, H. Tehrani) the control strain (U. maydis KO-cyp3+Petef #6) (Figure 14 – lanes

1 and 2) has high standard deviations in the OD values. Unlike the wells inoculated with U. maydis KO-

cyp3 + KO-XXX + Petef (Figure 14 – lanes 3 and 4).

Figure 15 - Optical density profiles in MES 30mM and MES 100mM buffered media over 96h cultivation in SystemDuetz® plates: Red lines correspond to KO-cyp3 + Petef #6 (control strain) and blue lines correspond to KO-cyp3 + KO-XXX + Petef. Full lines with triangles correspond to media buffered with 30mM MES, dotted lines with circles correspond to media buffered with 100mM MES. Error bars indicate deviation from the mean (n=3)

As mentioned before, for the control strain, the OD measurment nearly impossible (Figure 15 - blue

lines). Therefore, it is hard to compare the two strains since U. maydis KO-cyp3 + KO-XXX + Petef

cultures show a typical profile (Figure 15 - red lines).

t im e (h )

0 2 4 4 8 7 2 9 6

0

1 0

2 0

3 0

4 0

5 0

K O -c y p 3 + P e t e f# 6 - 3 0 m M

K O -c y p 3 + P e t e f# 6 - 1 0 0 m M

K O -c y p 3 + K O -xxx + P e t e f-3 0 m M

K O -c y p 3 + K O -xxx + P e t e f-1 0 0 m M

OD

60

0

3

4

A B C D E F

1

2

Figure 14 – SystemDuetz® plate after 96h of fermentation: Lines 1-2 - U. maydis KO-cyp3+Petef #6 (control); Lines 3-4 - U. maydis KO-cyp3 + KO-XXX + Petef; Columns A-C – MES 30mM (lines 1,3) and CaCO3 (lines 2,4); Columns D-F – MES 100mM

27

In terms of pH, the same profile was observed for both strains in all three differently buffered medias

(Figure 16). As expected, media buffered with MES 30mM showed lower pH values than when buffered

with MES 100mM or CaCO3 during the entire cultivation due to its lower buffer capacity.

Figure 16 - pH profiles in MES 30mM, MES 100mM and CaCO3 99 g L-1 buffered media over 96h cultivation in SystemDuetz® plates: Red lines correspond to KO-cyp3 + Petef #6 (control strain) and blue lines correspond to KO-cyp3 + KO-XXX + Petef. Full lines with triangles correspond to media buffered with 30mM MES, dotted lines with circles correspond to media buffered with 100mM MES and dotted lines with rhombus to media buffered with 99 g L-1 CaCO3. Error bars indicate deviation from the mean (n=3)

Furthermore, pictures of both strains amplified 10x, 40x, 63x and 100x were taken under the microscope

every 24h in all three media. The he same results were obtained at 24h, 48h, 72h and 96h.

The results regarding itaconate production can be analysed in Figure 17. After 96h of fermentation the

itaconate concentration in screening medium buffered with 30 Mm MES was 8,2 g L-1 for U. maydis KO-

cyp3 + Petef #6 (control) and 10,6 g L-1 for the XXX knockout strain. With 100 mM MES, the final itaconate

concentrations were of 14,1 g L-1 for the control strain and 15,6 g L-1 for U. maydis KO-cyp3 + KO-XXX

+ Petef cultures. The highest final itaconate concentrations were achieved in the medium buffered with

CaCO3: 20,4 g L-1 for the control strain and 19,1 g L-1 for the KO-cyp3 + KO-XXX + Petef strain (Figure

17). However, itaconate degradation was registered in the last 24h of cultivation of the XXX knockout

strain in the medium buffered with CaCO3 (Figure 17 – dotted blue line with rhombus. 2-

hydroxyparaconate was absent in every condition tested for both strains (data not shown). Also in the

media buffered with CaCO3 there is a striking difference between the itaconate production rate of the

control strain and the XXX KO in the first 48h of cultivation: at this time point, the itaconate concentration

are of 9,89 g L-1 and 13,36 g L-1, respectively.

t im e (h )

0 2 4 4 8 7 2 9 6

0

2

4

6

8

K O -c y p 3 + P e t e f# 6 - 3 0 m M

K O -c y p 3 + P e t e f# 6 - 1 0 0 m M

K O -c y p 3 + P e t e f# 6 - C a C O 3



K O -c y p 3 + K O -x xx + P e t e f - C a C O 3

pH

28

Table III – Itaconate concentrations of U. maydis KO-cyp3 + Petef #6 and U. maydis KO-cyp3 + KO-XXX + Petef strain after 96h of cultivation in MES 30 mM, MES 100 mM and 99 g L-1 CaCO3 buffered media.

Strain Itaconate (g L-1)

MES 30 mM MES 100 mM CaCO3 99 g L-1

KO-cyp3 + Petef #6 8,17 14,09 20,42

KO-cyp3 + KO-XXX + Petef 10,61 15,59 19,07

Figure 17 - Itaconate concentration measured during cultivation of U. maydis KO-cyp3 + Petef (control strain, red lines) and U. maydis KO-cyp3 + KO-XXX + Petef (blue lines) in SystemDuetz® plates: triangles correspond itaconate concentration in media with MES 30 mM, circles to media with MES 100 mM and rhombus to media with CaCO3. Error bars indicate deviation from the mean (n=3).

Furthermore, by the data shown in Figure 18, it is noticeable that the deletion of the XXX gene led to a

significant increase in the glucose consumption rate (blue lines) when compared to the control strain

(red lines) also during the first 48h of fermentation (Figure 18). In the medium where more itaconate

was produced (buffered with CaCO3), the XXX KO consumed all available glucose after only 48h while

a concentration of 20,17 g L-1 was measured for the control strain, which means that only 65% of the

glucose available was consumed.

t im e (h )

0 2 4 4 8 7 2 9 6

0

5

1 0

1 5

2 0

2 5

K O -c y p 3 + P e t e f# 6 - 3 0 m M

K O -c y p 3 + P e t e f# 6 - 1 0 0 m M

K O -c y p 3 + P e t e f# 6 - C a C O 3



K O -c y p 3 + K O -x xx + P e t e f C a C O 3

Ita

co

na

te (

g L

-1)

29

Figure 18 - Glucose concentration measured during cultivation of U. maydis KO-cyp3 + Petef (control strain, red lines) and U. maydis KO-cyp3 + KO-XXX + Petef (blue lines) in SystemDuetz® plates: triangles correspond itaconate concentration in media with MES 30 mM, circles to media with MES 100 mM and rhombus to media with CaCO3. Error bars indicate deviation from the mean (n=3).

Figure 19 - Itaconate yield after 96h cultivation in SystemDuetz® plates: red bars correspond to the control strain (U. maydis KO-cyp3 + Petef #6) and blue bars correspond to the ΔXXX strain (U. maydis KO-cyp3 + KO-XXX

+ Petef). Error bars indicate deviation from the mean (n=3).

The yield obtained after 96h follows the same pattern as the itaconate concentration, with the XXX KO

strain achieving slightly higher values in media buffered with MES 30 mM and 100 mM. The highest

yields measured correspond to the medium with CaCO3 buffer. However, in this medium the control

strain reached 0,36 gitaconate gglucose-1 which was slightly higher than the KO-cyp3 + KO-XXX + Petef strain

with 0,33 gitaconate gglucose-1 (Figure 19), in agreement with the itaconate concentration results (Figure 17).

t im e (h )

0 2 4 4 8 7 2 9 6

0

2 0

4 0

6 0

8 0

K O -c y p 3 + P e t e f# 6 - 3 0 m M

K O -c y p 3 + P e t e f# 6 - 1 0 0 m M

K O -c y p 3 + P e t e f# 6 - C a C O 3



K O -c y p 3 + K O -x xx + P e t e f - C a C O 3

Glu

co

se

(g

L-1)

KO

-cyp3+

Pete

f#6 -

30m

M

KO

-cyp3+

KO

-xxx+

Pete

f-30m

M

KO

-cyp3+

Pete

f#6 -

100m

M

KO

-cyp3+

KO

-xxx+

Pete

f-100m

M

KO

-cyp3+P

ete

f#6 -

CaC

O3

KO

-cyp3+K

O-x

xx+P

ete

f - C

aC

O3

0 .0

0 .1

0 .2

0 .3

0 .4

Yie

ld (

git

ac

on

ate

gg

luc

os

e

-1)

30

4.1.2. Overexpression of Mitochondrial Transporters in U. maydis KO-cyp3 + KO-

XXX + Petef

One of the main factors to consider when engineering the itaconate cluster is the fact that the pathway

is partially compartmentalized in the mitochondria and therefore cis-aconitate must be efficiently

transported to the cytosol by the mitochondrial transporter Mtt1. This step has been previously identified

as a likely bottleneck in the production of itaconic acid in U. maydis (Geiser et al., 2016). Moreover,

unpublished studies by Tehrani showed that overexpression of mtt1 and heterologous expression of the

mitochondrial transporter from A. terreus (AT_mttA) improved itaconic acid production in U. maydis up

to 50%. Consequently, overexpression of mitochondrial transporters from natural itaconate producing

organisms appears to be a promising metabolic engineering strategy to improve itaconate production in

U. maydis KO-cyp3 + KO-XXX + Petef strain.

In this study, mitochondrial transporters from A. terreus (MttA), U. cynodontis (UcN_Mtt1) and from U.

maydis itself (Um_mtt1) were overexpressed in the best-producing strain U. maydis KO-cyp3 + KO-XXX

+ Petef.

4.1.2.1. Overexpression of AT_mttA, Um_mtt1 and UcN_mtt1 in U. maydis

KO-cyp3 + KO-XXX + Petef

Plasmids Petef_cbx_A_ter_mttA (Figure 5), Petef_cbx_05079 (Figure 6) and Petef_cbx_05079#6 (Figure

7) containing the mitochondrial transporters AT_MttA, Um_Mtt1 and UcN_Mtt1, respectively, were

stored in E. coli DH5α strains corresponding to strain numbers 3010, 3181 and 3906, respectively of the

iAMB, RWTH Aachen strain collection. Biomass from the cryocultures of these strains was streaked out

on a fresh LBA plate and incubated overnight. The freshly grown cells were then inoculated in 25 mL of

LB medium with ampicillin as described in 3.5.1. After approximately 24h of incubation the plasmids

were isolated using Monarch Plasmid Miniprep Kit (New England BioLabs, Frankfurt a.M., Germany).

The concentration of the isolated plasmids was determined using NanoDrop One UV Vis

Spectrophotometer (ThermoFischer Scientific, Schwerte, Germany) at 260/280 nm. The purified

plasmids were then restricted overnight with SspI® (New England Biolabs GmbH, Frankfurt a.M.,

Germany) and purified again using GenepHlowTN Gel/PCR Kit (GeneAid, New Taipei, Taiwan). The size

of the restricted purified plasmids was verified in agarose gel (Figure 20).

31

Finally, 500 ng of each of the restricted purified plasmids were used for transformation in U. maydis KO-

cyp3 + KO-XXX + Petef protoplasts. For this, aliquots of 50 μL containing the protoplasts were thawed

on ice before adding 500 ng of each plasmid. Afterwards, ten minutes of incubation on ice took place.

After this 500 μL of STC‐PEG solution (40 % (w/v) PEG 4000 in STC) was added followed by ten more

minutes of incubation on ice. After incubation, the whole suspension was spread on a freshly prepared

REG-agar plate with cbx as selection antibiotic. Single colonies were visible after three to four days of

incubation at 30°C. The success of the transformation and ip-locus integration was confirmed by colony

PCR (3.13.2) using specific primers for each transporter (Figure 21). Transformant colonies that

depicted one single band with the predicted size were streaked out again in YEPS media with cbx and

further submitted to another colony PCR using the same primer sets as before.

Figure 21 - Agarose gel of colony PCR of U. maydis KO-cyp3 + KO-XXX + Petef after transformation with mitochondrial transporters using three different primer pairs: PCR A – Primers HT-202 and Tnos rev, annealing temperature of 69°C and extension time of 15 seconds; PCR B – Primers HT-33 and Potef fwd, annealing temperature of 66°C and extension time of 15 seconds; PCR C – Primers HT-149 and HT-227, annealing temperature of 61°C and extension time of 54 seconds; Lanes A, B, C - U. maydis KO-cyp3 + KO-XXX + Petef; Lanes A4-A15 (control, no band expected) – U. maydis KO-cyp3 + KO-XXX + Petef + Petef_cbx_A_ter_mtt (expected band: 446 bps); Lanes B1-B9 - U. maydis KO-cyp3 + KO-XXX + Petef + Petef_cbx_05079#6 (expected band: 638 bps); Lanes C2-C5 - U. maydis KO-cyp3 + KO-XXX + Petef + Petef_cbx_05079 (expected band: 2743 bps).

Figure 20 - Agarose gel of restricted plasmids with SspI-HF®: Lane L – GeneRuler 1 Kb DNA Ladder; Lane A - Petef_cbx_A_ter_mtt (expected band: 6453 bps); Lane B - Plasmid Petef_cbx_05079#6 (expected band: 6718 bps);

Lane C - Petef_cbx_05079 (expected band: 6784 bps)

32

Transformants U. maydis KO-cyp3 + KO-XXX + Petef + Petef _mttA #4, #14, #15, U. maydis KO-cyp3 +

KO-XXX + Petef + Petef _Um_mtt1 #2-5 and U. maydis KO-cyp3 + KO-XXX + Petef + Petef _UcN_mtt1 #1,

#5, #7, #9 were chosen for cultivation and further itaconate production study.

4.1.2.2. Cultivation studies in U. maydis

In order to choose the best-producing transformants, cultivation studies in screening medium (3.3.4)

buffered with 99 g L-1 CaCO3 were performed. The cultivation was performed in triplicates in

SystemDuetz® plates during 72h using U. maydis KO-cyp3 + KO-XXX + Petef as control. Two different

glucose concentrations were used: 50 g L-1 and 100 g L-1 because it was known from the previous

cultivation (4.1.1.2) that the control strain (U. maydis KO-cyp3 + KO-XXX + Petef) can deplete 50 g L-1

glucose in 48h. Samples were taken after 72h of cultivation for HPLC analysis according to 3.21 and

OD and pH measurements.

Figure 22 - Itaconate yield after 72h cultivation in SystemDuetz® plates in CaCO3 medium with 100 g L-1 glucose: full blue bar corresponds to the control strain (U. maydis KO-cyp3 + KO-XXX + Petef). Blue bars with pattern correspond to transformants with AT_mttA gene, green bars with pattern to transformants with the transporter from U. cynodontis and black and grey bars with patterns to the transformants with Um_mtt1 gene

overexpression. Error bars indicate deviation from the mean (n=3).

As expected cultures in CaCO3 media with 50 g L-1 glucose depleted all sugar before 72h of cultivation

(data not shown). Therefore, the yields obtained in CaCO3 media with 100 g L-1 glucose were the criteria

used to choose the best producing strains (Figure 22). Overall, the transformants of the three different

transporters show increased capacity to produce itaconate when compared to the control strain (0,23

gitaconate gglucose-1). Since previous unpublished studies by Tehrani showed that AT_mttA overexpression

leads to a 50% increase in itaconate production, all three AT_mttA transformants were chosen for further

studies along with the best UcN_mtt1 (U. maydis KO-cyp3 + KO-XXX + Petef + Petef _UcN_mtt1#1 that

achieved a yield of 0,26 gitaconate gglucose-1) and Um_mtt1 (U. maydis KO-cyp3 + KO-XXX + Petef + Petef

_Um_mtt1#3 that achieved a yield of 0, 26 gitaconate gglucose-1) transformants.

4.1.2.2.1. Itaconate Production Screening

The chosen transformants were cultivated again for 96h in SystemDuetz® plates with screening medium

(3.3.4) buffered with 99 g L-1 CaCO3 and 50 g L-1 of glucose. The cultivation was performed in triplicates.

0 .0

0 .1

0 .2

0 .3

Yie

ld

(git

ac

on

ate

gg

luc

os

e

-1)

K O -c y p 3 + K O -x x x + P e te f+ P e t e f_ U c N _ m tt1 # 9

K O -c y p 3 + K O -xxx + P e t e f

K O -c y p 3 + K O -x x x + P e te f+ P e t e f_ A T _ m ttA # 4

K O -c y p 3 + K O -x x x + P e te f+ P e t e f_ A T _ m ttA # 1 4

K O -c y p 3 + K O -x x x + P e te f+ P e t e f_ A T _ m ttA # 1 5




K O -c y p 3 + K O -x x x + P e te f+ P e t e f_ U m _ m tt1 # 2




33

Three control strains were used: the WT (U. maydis MB215), U. maydis KO-cyp3 + Petef #6 and U.

maydis KO-cyp3 + KO-XXX + Petef. In this cultivation study and in order to further evaluate the itaconate

production profile, especially in the first 48h of cultivation during which the control strain U. maydis KO-

cyp3 + KO-XXX + Petef had already shown high rates of itaconate production (4.1.1.2) a new sampling

frequency was planned in which samples for OD, pH and glucose and itaconate quantification were

taken approximately every 6h.

The results obtained in terms of itaconate concentration (Figure 23) show that overexpression of any of

the mitochondrial transporters leads to higher itaconate concentrations than any of the control strains at

any time during the 96h cultivation, with the dotted lines (control strains) staying always below the full

lines (transformants). Moreover, the itaconate production rates of the transformants in the first 48h is

remarkably higher than the WT and U. maydis KO-cyp3 + Petef #6 and exceeded the already high rates

achieved by U. maydis KO-cyp3 + KO-XXX + Petef. The itaconate production rates decline after 48h of

fermentation, time at which glucose is almost entirely depleted (data not shown).

Figure 23 - Itaconate concentration profile during cultivation in SystemDuetz® plates in 99 g L-1 CaCO3 buffered media with 50 g L-1 glucose: dotted lines correspond to the control strains (WT in orange, U. maydis KO-cyp3 + Petef #6 in red and U. maydis KO-cyp3 + KO-XXX + Petef in blue) and full lines to the selected transformants of the three different mitochondrial transporters (AT_mttA transformants in blue, Um_mtt1 transformant in black and UcN_mtt1 transformant in green). Error bars indicate deviation from the mean (n=3).

By the end of the cultivation, every transformant had reached higher itaconate concentrations than the

control strains. The AT_mttA transformants stand out by having the higher itaconate concentration

throughout the entire cultivation but also because are the only strains were itaconate degradation is

observed in the last hours of cultivation as depicted in Figure 23.

However, this cultivation had some problems mainly the abnormal itaconate concentration drop

registered in almost every strain after 58h of cultivation as well as the formation of a white precipitate in

the 96 well-plates used to store the filtered samples for HPLC measurements after storage of this plates

at -20⁰C. One possible explanation for this fact could be the precipitation of itaconate in the form of a

salt of calcium Ca2-- C5H4O42- due to the lower solubility at this temperature. This possibility is supported

by the fact that there was no precipitate in the wells containing samples taken in the first hours of

fermentation when itaconate concentration was lower. To assess the veracity of this theory a new

t im e (h )

0 1 2 2 4 3 6 4 8 6 0 7 2 8 4 9 6

0

5

1 0

1 5

2 0

2 5

W T

K O -c y p 3 + P etef# 6

K O -c y p 3 + K O - x x x + P etef

K O -c y p 3 + K O - x x x + P etef+ P etef_ A T _ m ttA # 4

K O -c y p 3 + K O - x x x + P etef+ P etef_ A T _ m ttA # 1 4

K O -c y p 3 + K O - x x x + P etef+ P etef_ A T _ m ttA # 1 5

K O -c y p 3 + K O - x x x + P etef+ P etef_ U m _ m tt1 # 3

K O -c y p 3 + K O - x x x + P etef+ P etef_ U c N _ m tt1 # 1

Ita

co

na

te (

g L

-1)

34

protocol for HPLC sampling was established in which HCl was added to promote solubilization of

itaconate and therefore assure that it is susceptible to quantification by HPLC.

4.1.2.2.2. Itaconate Production Screening: Sampling Method

with HCl addtion

The cultivation described in 4.1.2.2.1 was repeated in the exact same conditions. However, this time

only the best of the AT_mttA transformant used in the previous screen (U. maydis KO-cyp3 + KO-XXX

+ Petef + Petef _mttA#14) was chosen. The new sampling method consisted in adding HCl 37% (50%(v/v))

to the cultures previously to OD and HPCL measurements. Therefore, in this screening the HPLC

samples were prepared and stored in four ways: with and without adding HCl and stored at either 4⁰C

or -20⁰C.

Figure 24 – Photo of the 96-well plates stored at -20°C without HCl addition

All the 96-well plates were left at room temperature and the occurrence of precipitation was verified only

in the plate without HCl that was stored at -20⁰C. No precipitate was formed if HCl was added or if the

plates were stored at 4°C. Furthermore, precipitation occurred mainly in the wells corresponding to the

final hours of cultivation (Figure 24). Only the samples without HCl stored at 4⁰C and with HCl stored at

-20⁰C were used for sugar and itaconate quantification by HPLC. All OD values were measured after

adding HCl according to new sampling method, unlike pH that was measured beforehand.

35

Figure 25 - Optical density profiles during cultivation in SystemDuetz® plates in 99 g L-1 CaCO3 buffered media with 50 g L-1 glucose: Three control strains were used (WT in orange, U. maydis KO-cyp3 + Petef #6 in red and U. maydis KO-cyp3 + KO-XXX + Petef in blue) and are represented in dotted lines. The transformants screened are the AT_mttA transformant in light blue, Um_mtt1 transformant in black and UcN_mtt1 transformant in green

and are represented in full lines. Error bars indicate deviation from the mean (n=3)

In Figure 25 it is observable that the cyp3 KO strain has very low OD values when compared to the

other control strains and the transformants. Regarding the double KO, the WT and the three

transformants, the data shows quick growth during the first 54h hours, except for the AT_mttA

transformant that slows down at 30h of cultivation, followed by a decrease in the optical density values.

Although the decline of the OD values is observable in some strains, it is more substantial in the AT_mttA

transformant.

Figure 26 - Itaconate concentration measured in samples without HCl stored at 4°C (full lines) and with HCl stored at - 20°C (dotted lines). Cultivation was performed in SystemDuetz® plates in 99 g L-1 CaCO3 buffered media with 50 g L-1 glucose: Three control strains were used (WT in orange, U. maydis KO-cyp3 + Petef #6 in red and U. maydis KO-cyp3 + KO-XXX + Petef in blue). The transformants screened are the AT_mttA transformant in light blue, Um_mtt1 transformant in black and UcN_mtt1 transformant in green. Error bars indicate deviation from

the mean (n=3).

The results obtained regarding itaconate concentration using the readapted sampling method show the

same tendency observed in the previous screening (4.1.2.2.1): Figure 26 shows that all the

t im e (h )

0 1 2 2 4 3 6 4 8 6 0 7 2 8 4 9 6

0

1 0

2 0

3 0

4 0

5 0

W T

K O -c y p 3 + P e t e f # 6


A T _ m ttA # 1 4

U m _ m tt1 # 3

U c N _ m tt1 # 1

OD

t im e (h )

0 2 0 4 0 6 0 8 0 1 0 0

0

1 0

2 0

3 0

Ita

co

na

te (

g L

-1)

W T (+ H C l_ -2 0 ºC )

K O -c y p 3 + P etef # 6 (+ H C l_ -2 0 ºC )

K O -c y p 3 + K O - fu z 7 + P etef (+ H C l_ -2 0 ºC )

A T _ m ttA # 1 4 (+ H C l_ -2 0 ºC )

U m _ m tt1 # 3 (+ H C l_ -2 0 ºC )

U c N _ m tt1 # 1 (+ H C l_ -2 0 ºC )

W T (w .H C l_ + 4 º C )

K O -c y p 3 + P etef # 6 (w .H C l_ + 4 ºC )

K O -c y p 3 + K O - fu z 7 + P etef (w .H C l_ + 4 ºC )

A T _ m ttA # 1 4 (w .H C l_ + 4 ºC )

U m _ m tt1 # 3 (w .H C l_ 4 ºC )

U c N _ m tt1 # 1 (w .H C l_ + 4 ºC )

36

transformants achieve higher itaconate concentrations than any of the control strains throughout the

96h of cultivation and higher itaconate production rates in the first 60h. At this time point the AT_mttA,

Um_mtt1 and UcN_mtt1 transformants already reached itaconate concentrations of 26,9 g L-1, 20,1 g L-

1 and 18,1 g L-1, respectively. Since the itaconate concentration achieved by the XXX KO after 96h is of

19,0 g L-1 it means that at 60h of cultivation the transformants overexpressing the transporters AT_mttA

and Um_mtt1 have already produced more itaconate than the control strain after 96h. The transformant

where AT_mttA is overexpressed reached a final itaconate concentration of 26,1 g L-1 after 96h followed

by the one with Um_mtt1 overexpression (25,6 g L-1) and the transformant expressing the mitochondrial

transporter from U. cynodontis with 22,8 g L-1. These values correspond to an increase of 38%, 35%

and 21% when compared to U. maydis KO-cyp3 + KO-XXX + Petef (19,0 g L-1), respectively. All the

values indicated before correspond to the samples stored at 4°C and where no HCl was added since

the data also showed that the addition of HCl influences negatively the quantification of itaconate. In

fact, this effect is amplified by the amount of itaconate in the media: for example, for the WT strain whose

itaconate concentration never exceeds 3 g L-1 the difference between the orange full line (without HCl)

and orange dotted line (with HCl) is barely noticeable whereas for all the other strains the difference

between methods is small only in the first 48h. The following results correspond only to the samples

stored at 4°C without HCl.

Regarding glucose consumption, the graph in Figure 27 shows that all strains except the cyp3 KO strain

have high glucose consumption rates in the first 48h of fermentation and deplete all the glucose in the

media after 61h of cultivation.

Figure 27 - Glucose consumption profile measured in samples without HCl stored at 4°C. Cultivation was performed in SystemDuetz® plates in 99 g L-1 CaCO3 buffered media with 50 g L-1 glucose: Three control strains were used (WT in orange, U. maydis KO-cyp3 + Petef #6 in red and U. maydis KO-cyp3 + KO-XXX + Petef in blue). The transformants screened are the AT_mttA transformant in light blue, Um_mtt1 transformant in black and

UcN_mtt1 transformant in green. Error bars indicate deviation from the mean (n=3).

Malate concentration was also measured (Figure 28). Data shows that malate is produced by the wild-

type during the first 62h of cultivation, time at which it reaches a maximum of 13,3 g L-1. After this the

concentration drops to 12,7 g L-1 at 96h. U. maydis KO-cyp3 + Petef #6 cultures depict the lowest final

concentration (0,54 g L-1). All three transformants showed lower final malate concentration than the U.

t im e (h )

0 1 2 2 4 3 6 4 8 6 0 7 2 8 4 9 6

0

2 0

4 0

6 0

W T

K O -c y p 3 + P e t e f # 6


A T _ m ttA # 1 4

U m _ m tt1 # 3

U c N _ m tt1 # 1

Co

ns

um

ed

glu

co

se

(g

L-1)

37

maydis KO-cyp3 + KO-XXX + Petef strain that reached 2,37 g L-1. Comparing the transformants, the one

overexpressing the AT_mttA gene had the lowest final concentration (0,94 g L-1) followed by Um_mtt1

(1,39 g L-1) and finally the one overexpressing the transporter from U. cynodontis (1,64 g L-1).

Figure 29 shows the yield obtained after 96h. This data shows that overexpression of the mitochondrial

transporters resulted in a final yield increase for all three transformants that were screened. The most

significant increase was due to AT_mttA overexpression, reaching a final yield of 0,48 gitaconate gglucose-1

which corresponds to a 37% increase when compared to the XXX KO strain (U. maydis KO-cyp3 + KO-

XXX + Petef). The transformants overexpressing Um_mtt1 and UcN_mtt1 increased the itaconate yield

in 34% and 20%, respectively, comparing to the same control strain.

t im e (h )

0 1 2 2 4 3 6 4 8 6 0 7 2 8 4 9 6

0

5

1 0

1 5

W T

K O -c y p 3 P e t e f# 6

K O -c y p 3 + K O - fu z 7 + P e t e f

A T _ m ttA # 1 4

U m _ m tt1 # 3

U c N _ m tt1 # 1Ma

late

(g

L-1)

Figure 28 – Malate concentration measured in samples without HCl stored at 4°C. Cultivation was performed in SystemDuetz® plates in 99 g L-1 CaCO3 buffered media with 50 g L-1 glucose: Three control strains were used (WT in orange, U. maydis KO-cyp3 + Petef #6 in red and U. maydis KO-cyp3 + KO-XXX + Petef in blue). The transformants screened are the mttA transformant in light blue, Um_mtt1 transformant in black and

UcN_mtt1 transformant in green. Error bars indicate deviation from the mean (n=3).

38

Figure 29 - Itaconate yield obtained in the samples stored at 4°C without HCl after 96h cultivation in SystemDuetz® plates: control strains: U. maydis MB215 (WT) in orange, U. maydis KO-cyp3 + Petef in red and U. maydis KO-cyp3 + KO-XXX + Petef in blue. Best producing transformants: AT_mttA in light blue, Um_mtt1 in black and UcN_mtt1 in green. Error bars indicate deviation from the mean (n=3).

WT

KO

-cyp3 +

Pete

f #6

KO

-cyp3 +

K

O-x

xx +

Pete

f

mttA

#14

Um

_m

tt1#3

UcN

_m

tt1#1

0 .0

0 .2

0 .4

0 .6

Yie

ld

( g

ita

co

na

teg

glu

co

se

-1)

39

4.2. Characterization of Qdr3 function in U. maydis

4.2.1. Heterologous expression of MDR transporter Qdr3 from S. cerevisiae

To study the putative function of Qdr3 in U. maydis, four strains of this species were chosen: U. maydis

MB215 (WT), U. maydis KO-itp1, U. maydis KO-cyp3 + Petef #6 and U. maydis KO-cyp3 + KO-XXX +

Petef.

Plasmid Petef_qdr3 (Figure 4) was ordered from ThermoFischer Scientific (Schwerte, Germany) and

transformed in E. coli chemically competent cells. For this, 50 µL of chemical competent cells (DH5α)

were thawed on ice and transferred to a 1,5 ml micro-centrifuge tube. Up to 5 µL of plasmid were added

and the mixture was gently mixed by pipetting before being placed on ice for 30 minutes. The mixture

was then subjected to a heat shock at 42°C for 30 seconds and placed back on ice for 2 more minutes.

Afterwards, 950 µL of LB media at room temperature was added to each tube. The cells were then

incubated at 37°C and 250 rpm (shaking diameter 25 mm) for 60 minutes. After this time, 50 µL and 100

µL of the suspension were platted on LB medium with ampicillin and incubated overnight at 37 °C. After

overnight incubation, a master plate was inoculated with single colonies of transformants and incubated

overnight. Transformants from the master plate were chosen and inoculated in LB medium with

ampicillin as described in 3.5.1.

After approximately 24h of incubation the plasmids were isolated using Monarch Plasmid Miniprep Kit

(New England BioLabs, Frankfurt a.M., Germany). The concentration of the isolated plasmid was

determined using NanoDrop One UV Vis Spectrophotometer (ThermoFischer Scientific, Schwerte,

Germany) at 260/280 nm. The purified plasmid was then restricted overnight with SspI® (New England

Biolabs GmbH, Frankfurt a.M., Germany) and purified again using GenepHlowTN Gel/PCR Kit (GeneAid,

New Taipei, Taiwan). The size of the restricted purified plasmid was verified in agarose gel (Figure 30).

Finally, 500 ng of restricted purified plasmid were used for transformation in U. maydis MB215, U.

maydis MB215 KO-itp1, U. maydis MB215 KO-cyp3 + Petef#6 and U. maydis MB215 KO-cyp3 + KO-

XXX + Petef protoplasts. For this, aliquots of 50 μL containing the protoplasts were thawed on ice before

adding 500 ng of plasmid. Afterwards, ten minutes of incubation on ice took place. After this 500 μL of

Figure 30 - Agarose gel of restricted Petef_qdr3 plasmid with SspI-HF®: Lane L – GeneRuler 1 Kb DNA Ladder; Lane A - Petef_qdr3 (expected band: 7617 bps)

40

STC‐PEG solution (40 % (w/v) PEG 4000 in STC) was added followed by ten more minutes of incubation

on ice. After incubation, the whole suspension was spread on a freshly prepared REG-agar plate with

cbx as selection antibiotic. Colonies were visible after three to four days of incubation at 30°C. The

success of the transformation and ip-locus integration was confirmed by colony PCR (3.13.2) using the

primers HT-223 and HT-224, both located in the QDR3 gene. Annealing temperature was set in 65°C

and extension time in 45 seconds. Colonies that depicted one single band with 1998 bp (Figure 31) were

streaked out again in YEPS media with cbx and further submitted to another colony PCR using the same

primer pair and same conditions.

Finally, four transformant colonies of each strain presenting the expected band were selected for further

examination.

4.2.2. Cultivation studies in U. maydis

The selected transformants were inoculated in MES 100 mM media, which has weaker buffer effect and

therefore is more appropriate for tolerance screenings, with 50g L-1 of glucose for 72h and OD and pH

were measured and glucose and itaconate quantified on HPLC at the end of the cultivation. Strains U.

maydis MB215 (WT), U. maydis KO-itp1, U. maydis KO-cyp3 + Petef and U. maydis KO-cyp3 + KO-XXX

+ Petef were used as control. Pictures of every control and transformant were taken under the microscope

Figure 31 - Agarose gel of Colony PCR after transformation of Petef_qdr3 in U. maydis MB215 (A), U. maydis KO-itp1 (D), U. maydis KO-cyp3 + KO-XXX + Petef (C) and U. maydis KO-cyp3 + Petef (B): PCR was performed with primers HT-223 and HT-224 (both located in the QDR3 gene), annealing temperature was set on 65°C and extension time on 40 seconds. No band was expect on the negative controls (A, B, C, D), although unspecific bands can be observed. As for the transformants (A1-7, D1-4, C1-11, B1-4) one single band of 1998 bps was expected as well as in the positive control (+) corresponding to linearized Petef_qdr3.

41

with four different ampliations (10x, 40x, 63x and 100x). Cultivation was performed in SystemDuetz®

plates in triplicates (n=3).

The analytic results depicted in Figure 32 show that there was no improvement in itaconate production

by the transformants. In fact, the itaconate concentration even decreased in all transformants of the

strain U. maydis KO-cyp3 + Petef + Petef qdr3 when compared to the control (U. maydis KO-cyp3 + Petef).

Moreover, the transformants of the KO strain for the Itp1 transporter show residual levels of itaconate

just like the control strain U. maydis KO-itp1 which indicates that Qdr3 does not complement Itp1

function. Regarding glucose consumption, expression of QDR3 in the WT resulted in lower final glucose

concentration for all three transformants when compared to the control (WT). On the other hand, it had

the opposite effect on the U. maydis KO-cyp3 + Petef strain, in which the control had 5,85 g L-1 glucose

after 72h while the transformants registered higher glucose concentration values: between 14,6 g L-1

and 17,5 g L-1.

Figure 32 - Itaconate concentration after 72h cultivation in SystemDuetz® plates in MES 100 mM medium with 50 g L-1 glucose: Black and grey bars correspond to WT, green bars to itp1 KO, red bars to cyp3 KO nad blue bars to cyp3 and XXX double-KO. First bar of each color corresponds to the control and the following four bars correspond to the

transformants. Error bars indicate deviation from the mean (n=3).

0

5

1 0

1 5

2 0

2 5

Glu

co

se

(g

L

-1)

0

5

1 0

1 5

2 0

Ita

co

na

te

(g

L-1)

W T

W T _ P e t e fq d r 3 # 1

W T _ P e t e fq d r 3 # 3

W T _ P e t e fq d r 3 # 4

W T _ P e t e fq d r 3 # 7

K O - i tp 1

K O - i tp 1 _ P e t e fq d r 3 # 4

K O - i tp 1 _ P e t e fq d r 3 # 5

K O - i tp 1 _ P e t e fq d r 3 # 9

K O - i tp 1 _ P e t e fq d r 3 # 1 1

K O -c y p 3 _ P e t e f# 6

K O -c y p 3 _ P e t e f# 6 _ P e t e fq d r 3 # 1




K O -c y p 3 _ K O - fu z 7 _ P e t e f_ P e t e fq d r 3

K O -c y p 3 _ K O - fu z 7 _ P e t e f_ P e t e fq d r 3 # 1




0

5

1 0

1 5

2 0

Ita

co

na

te

(g L

-1)

W T

W T + P e t e f q d r 3 # 1

W T + P e t e f q d r 3 # 3

W T + P e t e f q d r 3 # 4

W T + P e t e f q d r 3 # 7

K O - i tp 1

K O - i tp 1 + P e t e f q d r 3 # 4

K O - i tp 1 + P e t e f q d r 3 # 5

K O - i tp 1 + P e t e f q d r 3 # 9

K O - i tp 1 + P e t e f q d r 3 # 1 1

K O -c y p 3 + P e t e f# 6

K O -c y p 3 + P e te f# 6 + P e t e f q d r 3 # 1





K O -c y p 3 + K O -xxx + P e t e f + P e t e f q d r 3 # 1




42

5. DISCUSSION

Among the natural producers of itaconate, U.maydis was identified as an interesting substitute for A.

terreus in industrial itaconic acid production due to its yeast-like growth, production of several secondary

metabolites and well carachterized genome. Recently, all the genes involved in itaconate production in

U.maydis were identified as a cluster and initial metabolic engineering experiments already led to an

increase in itaconate production (Geiser et al., 2016). However, strain improvement was still needed to

make the industrial use of this organism sustainable.

The aims of this thesis were the enhancement of IA production in U. maydis using strategy 1 and

metabolic engineering strategies and to characterize the function of the QDR3 gene from S. cerevisiae

in U. maydis. Regarding the first aim, two strategies were used: strategy 1 by deleting the XXX gene

and improving itaconate production by overexpressing mitochondrial transporters of itaconate producing

organisms: AT_mttA from A. terreus, Um_mtt1 from U. maydis and UcN_mtt1 from U. cynodontis.

To create the XXX KO strain, FLP/FRT system was used. By using this system, the hyg cassette can

be easily removed using a recombinant FLP. The creation of marker-free strains is important for

consecutive rounds of gene deletion since there is a very limited number of selection markers available

in U. maydis (Khrunyk, Münch, Schipper, Lupas, & Kahmann, 2010). As expected, deletion of XXX gene

from the best producing strain (U. maydis KO-cyp3+Petef #6) resulted in success of strategy 1.

In terms of IA production, there was a striking difference in the itaconate production rate in the CaCO3

buffered media over the first 48h with the XXX KO strain achievieng as much as 13,96 g L-1 while the

KO-cyp3+Petef #6 strain only produced 9,89 g L-1. This production rate enhancement is likely the result

of sucessful implementation of strategy 1. Such high production rate had also a great impact on glucose

consumption by the KO strain, that depleted all glucose in the media in the first 48h. Consequently, the

abscence of glucose can be a plausible explanation for the activation of possible itaconate degradation

pathways that caused the decrease in itaconate concentration in the last 24h of cultivation. The same

behaviour had already been acknowledged in U. cynodontis (Guevarra & Tabuchi, 1990).

A possible strategy to maintain the production rates high and avoid itaconate degradation is to use a

fed-batch fermentation to keep glucose above critical values. Recently, a itaconate degradation pathway

was identified in A. terreus by Chen et al. and whose proteins involved share 27-34% sequence identity

on protein level to similar proteins in U. maydis 521 (Chen et al., 2016; Geiser et al., 2016). The study,

identification and deletion of the genes involved in this possible itaconate degradation pathways could

also be a plausible strategy to avoid IA degradation.

Since the newly engineered strain U. maydis KO-cyp3 + KO-XXX + Petef was the best producing strain

this was the selected strain for overexpression of AT_mttA, Um_mtt1 and UcN_mtt1 under the control

of the constitutive etef promoter. Standard plasmids were used for specific integration in the ip-locus by

homologous recombination which leads to cbx resistance therefore allowing transformant selection

(Keon, Broomfield, White, & Hargreaves, 1994). This integration can result in single or multiple insertions

of the linearized construct (Loubradou, Brachmann, Feldbrügge, & Kahmann, 2001). From all the clones

43

obtained, three to four of each transporter were selected for a screening in order to choose the best

producing transformants.

As expected, most of the transformants expressing any of the three transporters reached higher

itaconate yields than U. maydis KO-cyp3 + KO-XXX + Petef, except only for one AT_mttA and one

UcN_mtt1 transformant. The variance regarding itaconate production of the tested transformants can

be explained by the different number of copies that might have been integrated in their genomes

(Loubradou et al., 2001). The relation between the number of copies and itaconate production can be

studied by performing a southern blot analysis. After selecting the best transformants according to the

yields obtained, a new screening was performed aiming to study the itaconate production profile in more

detail. However, the 96-well plates where the HPLC samples used for this screening were stored

contained a white precipitate that was formed after storage at -20°C. A possible explanation for this

could be that at such low temperature the itaconate solubility limit was reached and it precipitated as a

salt of calcium (CaC5H4O4) in which Ca comes from the CaCO3 used to buffer the medium. This is a

likely possibility since the solubility of IA is highly dependent on temperature: it lowers from 83,1 g L-1

at 20 °C to 36,5 g L-1 at 4 °C (Magalhães, de Carvalho, Medina, & Soccol, 2017). To test this possibility,

the supernatant of the samples was removed and HCl was added to the precipitate. The precipitate was

easily solubilized after adding HCl, which indicates that it was indeed calcium itaconate that reacted with

the strong acid to form itaconate (C5H6O4) and calcium chloride (CaCl2).

As a result, the screening was repeated but a new sampling method was adopted whit HCl being added

to all samples prior to any measurement to assure that all itaconate was dissolved and accurately

quantified by HPLC. For comparison purposes, the previous sampling method was also performed, and

two storage temperatures used: 4°C and -20°C. By using these different sampling and storing conditions

it was possible to conclude that if no HCl is added to the samples, itaconate precipitation occurs bellow

4°C. The addition of HCl negatively influenced the itaconate quantification by HPLC when compared to

the duplicate samples stored at 4°C without HCl. Moreover, the higher the itaconate concentration the

bigger the difference between the values obtained by the two sampling methods. Up to this date, no

explanation was found for this discrepancy. For analysis of the results and discussion purposes, only

the HPCL measurements of the samples without HCl stored at 4°C were used.

Regarding the OD profiles obtained a typical profile is observable in all strains used except KO-

cyp3+Petef #6. Furthermore, the OD values of some strains start dropping at around 54h of fermentation

which can be explained by the low glucose values in the media at that time: 85-93% of the glucose

available had already been consumed after 54h and at 61h there was no more glucose available for

some of the strains tested. Interestingly, the OD values drop much quicker for the transformants than

for the WT and XXX KO, especially the AT_mttA and Um_mtt1 that after 96h have an OD that is 58%

and 30% lower than the maximum OD obtained, respectively, while the control strains and the UcN_mtt1

transformant drop only around 19%. This can be caused wither by lack of glucose in the media or due

to itaconate.toxicity.

In terms of itaconate production all transformants showed very high production rates in the first 48h,

slowing down after but maintaining high rates until 61h of cultivation. During the last 24h, and has it was

44

observed in the previous screening, the itaconate concentration of some cultures drops, namely for the

AT_mttA transformant and KO-cyp3+Petef #6 control strain. As discussed for the previous screening

experiment, the production rates are strongly connected with the glucose concentration: once glucose

concentration reaches values as low as 10 g L-1 or less the itaconate production rate drops and if glucose

is absent from the medium itaconate concentration can drop probably due to still unknown itaconate

degradation pathways in U. maydis. As expected, the overexpression of the transformants led to higher

itaconate production rates than the one achieved by the XXX KO strain but also to higher final itaconate

concentrations, namely 38%, 35% and 21% increase when AT_mttA, Um_mtt1 and UcN_mtt1 are

overexpressed, respectively. These results proved that Mtt1 was in fact a bottleneck for IA production

in U. maydis and that the flux of cis-itaconate crossing the mitochondrial membrane, which is the first

reaction in the itaconate pathway, was in fact limiting the entire IA biosynthesis.

The yield is an important parameter for evaluating process efficiency and profitability especially because

of the high cost of the substrate (Klement & Büchs, 2012). The yields obtained after 96h of cultivation

were of 0,48 gitaconate gglucose-1 for the AT_mttA transformant, 0,47 gitaconate gglucose

-1 for the Um_mtt1 and

0,42 gitaconate gglucose-1 for the UcN_mtt1. Assuming zero growth, the maximum theoretical product to

substrate yield is 0,72 gitaconate gglucose-1. Therefore, the best-producing strain obtained in this study (U.

maydis MB215 KO-cyp3+KO-XXX+Petef+ Petef_cbx_A_ter_mtt #14) reached 67% of the theoretical

maximum. Since it is impossible to reach 100% of the theoretical yield because part of the glucose must

be used for cell growth there is not much room for further metabolic engineering of the strains. As a

result, optimization of the fermentation conditions and feeding strategies might be the next step. The

best yield obtained in this study in DuetzPlates® (0,48 gitaconate gglucose-1 ) is already more than 2-fold

higher when compared to the last published results obtained in a fed-batch reactor (Geiser et al., 2016)

and corresponds to 84% of the industrial yields obtained in IA fermentation with A. terreus (up to 0,57

gitaconate gglucose-1) (Klement & Büchs, 2012). By running a fermentation with this high-yield strain in a fed-

batch reactor with optimized conditions for itaconate productions such as low initial glucose

concentrations and phosphate limitation (Maassen et al., 2014) it should be possible to increase the

already high yields. This associated with the advantages of strategy 1 can be the final step to make

industrial IA production with U. maydis viable.

The overexpression of the mitochondrial transporters also affected the malate production: all

transformants have lower final malate concentrations than the XXX KO strain, that reached 2,27 g L-1.

Comparing between the three different transformants there seems to be an opposite relation between

the amount on itaconate produced and the amount of malate in the media: AT_mttA was the best

itaconate producer but has final lower malate concentration than Um_mtt1 and UcN_mtt1 which reached

the highest value among the transformants (1,64 g L-1). This supports the theory that mttA from A.

terreus is probably a cis-aconitate/malate transporter (Jaklitsch et al., 1991): while itaconate is exported

and its concentration in the media increases, malate is migrates from the media to the mitochondria,

where it stays compartmentalized. Moreover, this shows that the homolog transporters from U. maydis

(Um_mtt1) and U. cynodontis (UcN_mtt1) share the same function therefore reverting the malate flux:

from the cytoplasm to the interior of the mitochondria, as suggested by Geiser at al. (Geiser et al., 2016).

45

As stated before, the second aim of this thesis was to characterize the function of the QDR3 gene from

S. cerevisiae in U. maydis. For this purpose, a codon-optimized version of the gene under the control of

the constitutive etef promoter was used. Once again, integration was specific in the ip-locus by

homologous recombination leading to cbx resistance and generating single or multiple insertions of the

linearized construct. Four transformants of each of the strains used were screened for itaconate

tolerance in MES 100 mM buffered medium. Unlike the previous screenings that aimed to study

itaconate production this one was designed to study tolerance to itaconate which is why a buffer with

lower buffer effect was chosen.

Since Qdr3 and Itp1 are both MFS transporters (Geiser et al., 2015; Tenreiro et al., 2005), it was

expected that the first could complement the function of the latter in the itp1 KO strain. However,

itaconate concentration of all U. maydis KO-itp1 + Petef qdr3 transformants was residual, just like the

respective control strain (U. maydis KO-itp1) which means that Qdr3 does not complement Itp1 function

being unable to transport itaconate from the cytoplasm and across the membrane. Interestingly, the

overexpression of QDR3 in the KO-cyp3+Petef #6 strain led to lower itaconate concentrations: from 14,96

g L-1 in the control to between 11,11 g L-1 and 12,29 when QDR3 is overexpressed. Moreover, it also

affected negatively the glucose uptake: the concentration in the transformants was approximately 3-fold

higher than in the KO-cyp3+Petef #6 strain although the transformants produce less itaconate. However,

for the WT, the opposite impact on glucose uptake was observed since the control strain (WT) consumed

less glucose than the transformants overexpressing QDR3 (WT+Petef qdr3 #1, #3, #4 and #7) with

glucose concentrations after 72h of 19,25 L-1 for the control and 6,54 L-1 and 12,84 L-1 for the

transformants. Possible explanations could be the fact that Qdr3 is transporting itaconate into the

cytoplasm and not the opposite with the transformants therefore achieving lower itaconate

concentrations. Another possibility could be that itaconate was used as carbon source. In any case,

further research is needed to understand the effects of QDR3 expression in U. maydis.

46

6. CONCLUSION AND FUTURE PERSPECTIVES

In this thesis it was shown that it is possible to implement strategy 1 in U. maydis regardless of the pH

values or itaconate concentrations by deleting the XXX gene. Furthermore, it was confirmed that Mtt1

was in fact a bottleneck in itaconate production and that overexpression of Um_mtt1 or mitochondrial

transporters from A. terreus (AT_mttA) or U. cynodontis (UcN_mtt1) result in higher itaconate production

rates, final concentration and product to substrate yield. It was also confirmed that Mtt1, MttA and

UcN_Mtt are cis-aconitate/itaconate antiporters. The combined effect of XXX deletion and AT_mttA

overexpression increased itaconate final concentration to 26 g L-1 and yield to 0,48 gitaconate gglucose-1 which

is 67% of the theoretical maximum yield (assuming zero growth). Therefore, and taking into account that

part of the glucose has to be used for cell growth, there might be little room for further metabolic

engineering improvements. A possible strategy to further improve the yield can be avoiding itaconate

degradation either by using a glucose fed-batch or by investigating and deleting genes associated with

this degradation pathway.

By overexpressing QDR3 in a itp1 KO strain and verifying that itaconate concentration is kept in residual

levels, it was proved that Qdr3 does not complement Itp1 function of itaconate export probably due to

low homology (27% on protein level). However, it could be interesting to test the influence of Qdr3 in pH

and itaconate tolerance in U. maydis. For this, a new screening where media buffered with higher and

lower buffer effects and itaconate concentrations, respectively, should be performed and the effect of

Qdr3 evaluated. Moreover, to test if Qdr3 is transporting itaconate into the cytoplasm and if itaconate is

being used as carbon source, a new screening with glucose-free media and to which itaconate is added

could be performed in order to evaluate itaconate concentration profile over time.

47

7. REFERENCES

Batti, M. A. (1964). Process for the production of itaconic acid.

Blount, B. A., Driessen, M. R. M., & Ellis, T. (2016). GC Preps: Fast and Easy Extraction of Stable Yeast

Genomic DNA. Scientific Reports, 6(1), 26863. https://doi.org/10.1038/srep26863

Bölker, M., Basse, C. W., & Schirawski, J. (2008). Ustilago maydis secondary metabolism—From

genomics to biochemistry. Fungal Genetics and Biology, 45(Suppl.1), S88–S93.

https://doi.org/10.1016/j.fgb.2008.05.007

Brefort, T., Doehlemann, G., Mendoza-Mendoza, A., Reissmann, S., Djamei, A., & Kahmann, R. (2009).

Ustilago maydis as a Pathogen. Annual Review of Phytopathology, 47(1), 423–445.

https://doi.org/10.1146/annurev-phyto-080508-081923

Carter, J. R. P., & Irani, R. R. (1970). Sequestration of metal ions. United States Patent 3405060 A.

Chen, M., Huang, X., Zhong, C., Li, J., & Lu, X. (2016). Identification of an itaconic acid degrading

pathway in itaconic acid producing Aspergillus terreus. Applied Microbiology and Biotechnology,

100(17), 7541–7548. https://doi.org/10.1007/s00253-016-7554-0

Chomczynski, P., & Rymaszewski, M. (2006). Alkaline polyethylene glycol-based method for direct PCR

from bacteria, eukaryotic tissue samples, and whole blood. BioTechniques, 40(4), 454–458.

https://doi.org/10.2144/000112149

Couturier, M., Navarro, D., Olivé, C., Chevret, D., Haon, M., Favel, A., … Berrin, J.-G. (2012). Post-

genomic analyses of fungal lignocellulosic biomass degradation reveal the unexpected potential

of the plant pathogen Ustilago maydis. BMC Genomics, 13(1), 57. https://doi.org/10.1186/1471-

2164-13-57

Geilen, F. M. A., Engendahl, B., Harwardt, A., Marquardt, W., Klankermayer, J., & Leitner, W. (2010).

Selective and Flexible Transformation of Biomass-Derived Platform Chemicals by a Multifunctional

Catalytic System. Angewandte Chemie International Edition, 49(32), 5510–5514.

https://doi.org/10.1002/anie.201002060

Geiser, E., Przybilla, S. K., Engel, M., Kleineberg, W., Büttner, L., Sarikaya, E., … Wierckx, N. (2016).

Genetic and biochemical insights into the itaconate pathway of Ustilago maydis enable enhanced

production. Metabolic Engineering, 38(August), 427–435.

https://doi.org/10.1016/j.ymben.2016.10.006

Geiser, E., Przybilla, S. K., Friedrich, A., Buckel, W., Wierckx, N., Blank, L. M., & Bölker, M. (2015).

Ustilago maydis produces itaconic acid via the unusual intermediate trans -aconitate. Microbial

Biotechnology, 9(1), 116–126. https://doi.org/10.1111/1751-7915.12329

Geiser, E., Wierckx, N., Zimmermann, M., & Blank, L. M. (2013). Identification of an endo-1,4-beta-

xylanase of Ustilago maydis. BMC Biotechnology, 13(1), 59. https://doi.org/10.1186/1472-6750-

13-59

48

Global Industry Analysts Inc. (2016). “Itaconic acid (IA) - A Global Strategic Business Report.” Retrieved

from http://www.strategyr.com/MarketResearch/Itaconic_Acid_IA_Market_Trends

Global Market Insights. (2016). Itaconic Acid Market. Retrieved from

https://www.gminsights.com/industry-analysis/itaconic-acid-market

Guevarra, E. D., & Tabuchi, T. (1990). Accumulation of itaconic, 2-hydroxyparaconic, itatartaric, and

malic acids by strains of the genus Ustilago. Agricultural and Biological Chemistry, 54(9), 2353–

2358. https://doi.org/10.1271/bbb1961.54.2353

Gyamerah, M. (1995). Factors affecting the growth form of Aspergillus terreus NRRL 1960 in relation to

itaconic acid fermentation. Applied Microbiology and Biotechnology, 44(3–4), 356–361.

https://doi.org/10.1007/BF00169929

Hoffman, C. S., & Winston, F. (1987). A ten-minute DNA preparation from yeast efficiently releases

autonomous plasmids for transformaion of Escherichia coli. Gene, 57(2–3), 267–272.

https://doi.org/10.1016/0378-1119(87)90131-4

Jaklitsch, W. M., Kubicek, C. P., & Scrutton, M. C. (1991). Intracellular location of enzymes involved in

citrate production by Aspergillus niger. Canadian Journal of Microbiology, 37(11), 823–7.

https://doi.org/10.1139/m91-142

Kämper, J., Kahmann, R., Bölker, M., Ma, L.-J., Brefort, T., Saville, B. J., … Birren, B. W. (2006). Insights

from the genome of the biotrophic fungal plant pathogen Ustilago maydis. Nature, 444(7115), 97–

101. https://doi.org/10.1038/nature05248

Kane, J. H., City, G., Fin, A. C., City, L. I., Amann, P. F., & Chas, P. (1945). Production of itaconic acid.

Pfizer & Co C.

Keon, J. P., Broomfield, P. L., White, G. A., & Hargreaves, J. A. (1994). A mutant form of the succinate

dehydrogenase iron-sulphur protein subunit confers resistance to carboxin in the maize smut

pathogen Ustilago maydis. Biochemical Society Transactions, 22(1), 234–7. Retrieved from

http://www.ncbi.nlm.nih.gov/pubmed/8206239

Khrunyk, Y., Münch, K., Schipper, K., Lupas, A. N., & Kahmann, R. (2010). The use of FLP-mediated

recombination for the functional analysis of an effector gene family in the biotrophic smut fungus

Ustilago maydis. New Phytologist, 187(4), 957–968. https://doi.org/10.1111/j.1469-

8137.2010.03413.x

Klement, T., & Büchs, J. (2012). Itaconic acid – A biotechnological process in change. Bioresource

Technology, 135, 422–431. https://doi.org/10.1016/j.biortech.2012.11.141

Klement, T., Milker, S., Jager, G., Grande, P. M., Dominguez de Maria, P., & Buchs, J. (2012). Biomass

pretreatment affects Ustilago maydis in producing itaconic acid. Microbial Cell Factories, 11(1), 43.

https://doi.org/10.1186/1475-2859-11-43

Kuenz, A., Gallenmüller, Y., Willke, T., & Vorlop, K.-D. (2012). Microbial production of itaconic acid :

49

developing a stable platform for high product concentrations. Appl Microbiol Biotechnol, 96.

Lancashire, F. (1969). Soap compositions having improved curd-dispersing properties. United States

Patent 3454500.

Lee, J. W., Kim, H. U., Choi, S., Yi, J., & Lee, S. Y. (2011). Microbial production of building block

chemicals and polymers. Current Opinion in Biotechnology, 22(6), 758–767.

https://doi.org/10.1016/j.copbio.2011.02.011

Maassen, N., Panakova, M., Wierckx, N., Geiser, E., Zimmermann, M., Bölker, M., … Blank, L. M.

(2014). Influence of carbon and nitrogen concentration on itaconic acid production by the smut

fungus Ustilago maydis. Engineering in Life Sciences, 14(2), 129–134.

https://doi.org/10.1002/elsc.201300043

Magalhães, A. I., de Carvalho, J. C., Medina, J. D. C., & Soccol, C. R. (2017). Downstream process

development in biotechnological itaconic acid manufacturing. Applied Microbiology and

Biotechnology, 101(1), 1–12. https://doi.org/10.1007/s00253-016-7972-z

Martı́nez-Espinoza, A. D., Garcı́a-Pedrajas, M. D., & Gold, S. E. (2002). The Ustilaginales as Plant Pests

and Model Systems. Fungal Genetics and Biology, 35(1), 1–20.

https://doi.org/10.1006/fgbi.2001.1301

Mira, N. P., Teixeira, M. C., & Sá-Correia, I. (2010). Adaptive Response and Tolerance to Weak Acids

in Saccharomyces cerevisiae : A Genome-Wide View. OMICS: A Journal of Integrative Biology,

14(5), 525–540. https://doi.org/10.1089/omi.2010.0072

Mueller, O., Kahmann, R., Aguilar, G., Trejo-Aguilar, B., Wu, A., & de Vries, R. P. (2008). The secretome

of the maize pathogen Ustilago maydis. Fungal Genetics and Biology, 45(Suppl. 1), S63–S70.

https://doi.org/10.1016/j.fgb.2008.03.012

Nelissen, B., De Wachter, R., & Goffeau, A. (1997). Classification of all putative permeases and other

membrane plurispanners of the major facilitator superfamily encoded by the complete genome of

Saccharomyces cerevisiae. FEMS Microbiology Reviews, 21(2), 113–134.

https://doi.org/10.1016/S0168-6445(97)00053-3

Nicole Martins Rodrigues. (2014). MsC thesis: Exploring Saccharomyces cerevisiae to improve

microbe-based production of itaconic acid.

Okabe, M., Lies, D., Kanamasa, S., & Park, E. Y. (2009). Biotechnological production of itaconic acid

and its biosynthesis in Aspergillus terreus. Applied Microbiology and Biotechnology, 84(4), 597–

606. https://doi.org/10.1007/s00253-009-2132-3

Sá-Correia, I., dos Santos, S. C., Teixeira, M. C., Cabrito, T. R., & Mira, N. P. (2009a). Drug:H+

antiporters in chemical stress response in yeast. Trends in Microbiology, 17(1), 22–31.

https://doi.org/10.1016/j.tim.2008.09.007

Sá-Correia, I., dos Santos, S. C., Teixeira, M. C., Cabrito, T. R., & Mira, N. P. (2009b). Drug:H+

50

antiporters in chemical stress response in yeast. Trends in Microbiology, 17(1), 22–31.

https://doi.org/10.1016/j.tim.2008.09.007

Sandström, A. G., Almqvist, H., Portugal-Nunes, D., Neves, D., Lidén, G., & Gorwa-Grauslund, M. F.

(2014). Saccharomyces cerevisiae: A potential host for carboxylic acid production from

lignocellulosic feedstock? Applied Microbiology and Biotechnology.

https://doi.org/10.1007/s00253-014-5866-5

Schulz, B., Banuett, F., Dahl, M., Schlesinger, R., Schäfer, W., Martin, T., … Kahmann, R. (1990). The

b alleles of U. maydis, whose combinations program pathogenic development, code for

polypeptides containing a homeodomain-related motif. Cell, 60(2), 295–306.

https://doi.org/10.1016/0092-8674(90)90744-Y

Steiger, M. G., Punt, P. J., Ram, A. F. J., Mattanovich, D., & Sauer, M. (2016). Characterizing MttA as

a mitochondrial cis-aconitic acid transporter by metabolic engineering. Metabolic Engineering, 35,

95–104. https://doi.org/10.1016/j.ymben.2016.02.003

Tenreiro, S., Vargas, R. C., Teixeira, M. C., Magnani, C., & Sá-Correia, I. (2005). The yeast multidrug

transporter Qdr3 (Ybr043c): Localization and role as a determinant of resistance to quinidine,

barban, cisplatin, and bleomycin. Biochemical and Biophysical Research Communications, 327(3),

952–959. https://doi.org/10.1016/j.bbrc.2004.12.097

Tsukuda, T., Carleton, S., Fotheringham, S., & Holloman, W. K. (1988). Isolation and characterization

of an autonomously replicating sequence from Ustilago maydis. Molecular and Cellular Biology,

8(9), 3703–3709. https://doi.org/10.1128/MCB.8.9.3703

Werpy, T., & Petersen, G. (2004). Results of Screening for Potential Candidates from Sugars and

Synthesis Gas. Top Value Added Chemicals from Biomass, I.

Wierckx, N., Koopman, F., Ruijssenaars, H. J., & de Winde, J. H. (2011). Microbial degradation of furanic

compounds: biochemistry, genetics, and impact. Applied Microbiology and Biotechnology, 92(6),

1095–1105. https://doi.org/10.1007/s00253-011-3632-5

Willke, T., & Vorlop, K.-D. (2001). Biotechnological production of itaconic acid. Applied Microbiology and

Biotechnology, 56(3–4), 289–295. https://doi.org/10.1007/s002530100685

Documents

Metabolic Engineering for Enhancement of Itaconic Acid · Na tentativa de aumentar a produção de AI, eliminou-se o gene XXX por recombinação homologa. Adicionalmente, três transportadores