media.nature.com€¦ · Web viewFor quantitative RT-PCR assays, complementary DNA (cDNA) was retro-transcribed with High Capacity cDNA Reverse Transcription Kit (Life Technologies)

Supplemental Material file: Mutations in TP53 and JAK2 are independent prognostic biomarkers in B-cell precursor acute lymphoblastic leukemia

Table of Contents

Supplemental Patients and Methods....................................................................................................................................2

Data collection.................................................................................................................................................................2

Amplicon library pooling and purification......................................................................................................................2

Emulsion PCR and sequencing........................................................................................................................................3

Data processing and analysis...........................................................................................................................................3

CRLF2 gene expression analysis.....................................................................................................................................4

Statistical methods...........................................................................................................................................................5

Supplemental Tables............................................................................................................................................................6

Table S1. PCR primers used for next-generation sequencing studies.............................................................................6

Table S2. Summary of the clinical data of patients with mutations in any of the genes analyzed..................................7

Table S3. Global frequency of secondary somatic mutations in any of the genes analyzed by primary chromosomal abnormalities in children and adult patients with B-ALL................................................................................................11

Table S4. Frequency of secondary somatic mutations in hot spot regions of TP53, JAK2, PAX5, LEF1, CRLF2 and IL7R genes by primary chromosomal abnormalities in children and adult patients with B-ALL....................................12

Table S5. Summary of primary chromosomal abnormalities and secondary somatic mutations observed in children and adult patients with B-ALL.........................................................................................................................................13

Table S6. Description of 30 somatic mutations observed in B-ALL patients...............................................................18

Table S7. Mutations identified in 11 B-ALL patients who concomitantly harbored more than one mutation.............20

Table S8. Association of mutations with prognostic factors, risk stratification parameters and response to frontline therapy in children with B-ALL (n=211).........................................................................................................................21

Table S9. Association of mutations with prognostic factors, risk stratification parameters and response to frontline therapy in adults (n=129) with B-ALL.............................................................................................................................23

Table S10. Univariate overall survival, event-free survival and relapse rates analysis of pediatric patients with B-ALL..................................................................................................................................................................................25

Table S11. Univariate overall survival, event-free survival and relapse rates analysis of adult patients with B-ALL.27

Supplemental figures.........................................................................................................................................................30

Figure S1. Somatic mutations observed in pediatric B-ALL patients...........................................................................30

Figure S2. Somatic mutations observed in adult B-ALL patients.................................................................................31

Figure S3. Two patients with double mutation in the JAK2-E16 gene identified by amplicon-based NGS.................32

Figure S4. Identification of clonal heterogeneity in the PAX5-E03 gene by amplicon-based NGS.............................33

Figure S5. Identification of clonal heterogeneity in the JAK2 gene by amplicon-based NGS......................................34

Figure S6. Identification of clonal heterogeneity in the TP53 gene by amplicon-based NGS......................................35

References......................................................................................................................................................................36

1

Supplemental Patients and Methods

Data collection

Conventional cytogenetic analyses using G-banding were carried out as part of the routine work-up.

Fluorescent in situ hybridization (FISH) studies were carried out on the same fixed cells from bone

marrow (BM) and/or peripheral blood samples collected at the time of diagnosis.

The presence of risk factors such as age group, genetic subtype, white blood cell count (WBC), LDH

level, Eastern Cooperative Oncology Group (ECOG) clinical status, Minimal Residual Disease

(MRD) levels measured during remission induction therapy and outcome were recorded. MRD levels

in bone marrow at the end of induction therapy was estimated by flow cytometry (Neale et al, 2004).

For cytogenetic categorization, pediatric and adult patients were classified into cytogenetic

subgroups according to the recurring aneuploidies and chromosomal translocations in ALL: low

hyperdiploidy (47-50 chromosomes), high hyperdiploidy (>50 chromosomes), low hypodiploidy (30-

39 chromosomes), high hypodiploidy (44-45 chromosomes), near-triploidy (69±, 58-80), t(12;21)

(p12,q22) ETV6-RUNX1 (TEL-AML1) fusion, t(9;22)(q34;q11) BCR-ABL1 fusion, t(1;19)(q23;p13)

TCF3(E2A)-PBX1 fusion, t(11;v)(q23;v) KMT2A(MLL) rearrangement, normal karyotype and/or

normal FISH and other miscellaneous abnormalities (pseudo-diploid karyotype, other single or

double chromosomal abnormalities, and complex karyotype with three or more abnormalities)

(Forero-Castro et al, 2016; Harrison, 2011; Harrison et al, 2004; Holmfeldt et al, 2013).

Amplicon library pooling and purification

An amplicon library pool was generated in equivalent amounts and was purified with Agencourt

AMPure magnetic beads (Beckman Coulter, Krefeld, Germany) in order to remove small amplicons

(<100 bp) and to separate those amplicons with optimal size for high-throughput sequencing. The

purified amplicon pooling was quantified by dsDNA HS Qubit® Fluorometric Quantitation Assay

Kit (Life Technologies, Carlsbad, CA, USA). The quality of amplicon pool was evaluated with a

2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA).

2

Emulsion PCR and sequencing

The amplicon library pooling was diluted to a concentration of 2x106 molecules per µl and was

subjected to emulsion PCR using a GS Junior Titanium emPCR Kit (Lib-A) (Roche Applied

Science, Penzberg, Germany). Forward and reverse bead reactions were carried out using 2x106

beads per emulsion oil tube. The copy/bead ratio was 1:1. The diluted PCR amplicons were mixed

with beads under conditions that favored one fragment per bead. The amplification reaction,

breaking of the emulsions and enrichment of beads carrying amplified DNA were performed using

the workflow recommended by the manufacturer (Roche Applied Science). Bidirectional sequencing

was carried out for 200 cycles using full processing mode for amplicons on a GS Junior platform

(454 Life Sciences, Branford, CT, USA).

Data processing and analysis

Sequencing reads in SFF (standard flowgram format) file format obtained from the 454 GS Junior

sequencing run were analyzed using GS Variant Analyzer Software 2.5.3 (454 Life Sciences, Roche

Applied Science) and Sequence Pilot version 3.4.2 (JSI Medical Systems, Kippenheim, Germany)

software. Sequence alignment and variant detection was performed using the following reference

sequences: JAK2 (Transcript-ID ENST00000381652), PAX5 (ENST00000358127), LEF1

(ENST00000265165), CRLF2 (ENST00000400841), IL7R (ENST00000303115) and TP53

(ENST00000269305). The quality control (QC) was included to reach a coverage of more than 140

reads per amplicon (70 minimum reads in forward and reverse directions). The variants were filtered

to display sequence variants occurring in more than 2% of bidirectional reads per amplicon in at least

one patient (Grossmann et al, 2013; Kohlmann et al, 2011; Weissmann et al, 2013). All somatic

mutations were searched in the online COSMIC database

(http://cancer.sanger.ac.uk/cancergenome/projects/cosmic) and the IARC TP53 database

3

(http://p53.iarc.fr/p53Sequences.aspx) (Leroy et al, 2014). Variants previously reported as germline

polymorphisms in the Single Nucleotide Polymorphism database (dbSNP build 138) were excluded.

The sequence variations identified by NGS were independently validated using conventional Sanger

sequencing from a second new PCR from original DNA, and/or a separate setup of NGS PCR,

emPCR and re-sequencing run, and/or the Proton sequencer system (Applyed Biosystem, Waltham,

MA, USA) following manufacturer indications.

CRLF2 gene expression analysis

For quantitative RT-PCR assays, complementary DNA (cDNA) was retro-transcribed with High

Capacity cDNA Reverse Transcription Kit (Life Technologies) from 1 µg RNA isolated from

diagnostic leukemic cells. Quantification of CRLF2 (Hs00845692_m1) and the endogenous control

GADPH (Hs03929097_g1) expression were evaluated using the TaqMan Gene Expression and

Master Mix (Applied Biosystems) in an Abiprism 7900 (Applied Biosystems). Averages of duplicate

assays were used to establish ΔCt values relative to the endogenous control. Relative quantification

of CRLF2 expression was achieved using the comparative Ct method, in which the amount of the

target gene is expressed as 2exp-ΔCt. CRLF2-overexpressed samples were identified as previously

described (Yoda et al, 2010), whereby a bimodal distribution of CRLF2 overexpression pattern was

assumed: one peak including the low expression samples and another including the overexpressed

ones. A cut-point was established in the median value of this distribution, allowing the projection of

the left tail to the right side of the median. Thus, the median can be considered to be a pseudomean

of a symmetric distribution. The cut-off is the pseudomean plus five SDs, values above this point are

considered to be overexpressed.

Statistical methods

4

The OS was defined as the period from diagnosis of the disease to death; patients who were alive at

the last contact were treated as censored for OS analysis. EFS was defined as the time from diagnosis

to first event, including death during induction therapy, failure to achieve remission, relapse at any

site, death during remission, or the development of a second malignant neoplasm. RR was measured

as the time from achieving CR to relapse; patients who were still alive were censored at the date of

last follow-up. Observations of patients without events were censored at the date of last contact

(Ribera et al, 2013; Xicoy et al, 2014).

5

Supplemental Tables

Table S1. PCR primers used for next-generation sequencing studies

Gene Strand Exon Amplicon Forward Sequence 5' -> 3' Reverse Sequence 5' -> 3' Length (bp)

TP53 − E04 1 ACCTGGTCCTCTGACTGCTC CAGGCATTGAAGTCTCATGG 361

TP53 − E05 2 CACTTGTGCCCTGACTTTCA CACTCGGATAAGATGCTGAGG 343

TP53 − E06 3 CAGATAGCGATGGTGAGCAG TTGCACATCTCATGGGGTTA 335

TP53 − E07 4 GCACTGGCCTCATCTTGG AAGAGGTCCCAAAGCCAGAG 334

TP53 − E08 5 GGACAGGTAGGACCTGATTTC TCTCCATCCAGTGGTTTCTTC 346

TP53 − E09 6 AAAGGGGAGCCTCACCAC TGTCTTTGAGGCATCACTGC 342

TP53 − E10 7 GCTGTATAGGTACTTGAAGTGCAG CTGCCTTTGACCATGAAGG 349

TP53 − E11 8 AGGGAAAAGGGGCACAG CCCCACAACAAAACACCAGT 339

JAK2 + E12 1 CCTCTTTGGAGCAATTCATAC TTGCTAACATCTAACACAAGGT 357

JAK2 + E13 2 CGTTCTCCATCTTTACTCATTCTTT CCCACAAGAATGTATCCTCAGA 357

JAK2 + E14 3 TTATGGACAACAGTCAAACAACAA TGTTTGGGCATTGTAACCTTC 357

JAK2 + E15 4 AAAGTTGTGAGTTTTGCCAAT CACCTAACACAGACTATTTTACATG 357

JAK2 + E16 5 CTCAATGCATGCCTCCAA ACAACATGCCCTTTACACC 357

IL7R + E06 1 TGCATGGCTACTGAATGCTC GGACAGCGTTTGCCTAATGT 349

PAX5 − E02 1 GGGGCTCTGGGTCCTCAC TCAAGGGAAGCCTCGAGCT 284

PAX5 − E03 2 TTTCCTGGCCAGAGTAGCCCGT CCCAACCCCCACAGGCACGA 315

LEF1 − E02 1 GTTGCCCCTAAACCTCTTCC GCCATAAGTTTCCTGCGTTT 335

LEF1 − E03 2 GCATCATTGATTGTTCTTTGGA TTAAGGTGGCCATTCCTCAT 361

CRLF2 − E06 1 CGCACGTCATGTTGAAAACT CCATCATAAGAGTGGGCATTG 304

6

Table S2. Summary of the clinical data of patients with mutations in any of the genes analyzed

Patient ID

Children

/Adul

t

Age (years)/

Sex

Risk Group

Frontline Therapy EGIL Cytogenetic

subgroupDown

syndrome

Number of

mutations

Gene-exon mutated Mutations AA change

Mutational

Burden (%)

CRLF2 overexpre

ssion

Relapse

SCT

Overall

survival

(months)

Clinical status

1 C 1/M HR LAL-AR/SHOP-2005 ALL-B II Hyper (>50) N 1 JAK2-E14 c.1849G>T p.V617F 23 N N N 47 CCR-A

2 C 2/M HR UNKN ALL-B Normal N 1 IL7R-E06c.726_729delinsGTGC

CCC

p.L242_L243delinsLCP 2 ND UNK

UNK

2 UNK

3 C 3/F UNKSEHOP/

LAL/SHOP-99

ALL-B III Hyper (47-50) N 1 LEF1-E03 c.327delG p.S109fs 8 N Y Y 37 Rel-D

4 C 4/F LRSEHOP/

LAL-SHOP/1999

ALL-B II Normal N 1 TP53-E04 c.332T->C p.L111P 14 ND N N 138 CCR-A

5 C 4/F UNKSEHOP/

LAL/SHOP-2005

ALL-B II Hyper (47-50) N 2

JAK2-E16 c.2049A>T p.R683S 4 Y Y N 59 Rel-D

JAK2-E16

c.2044_2045insGGACCTCCTCC

CTCC

p.L681_I682insGPPPS 12

6 C 4/M HR

LAL/SEHOP-

PETHEMA 2013

ALL-B II Normal Y 1 JAK2-E16 c.2049A>T p.R683S 16.5 ND N N 32 CCR-A

7 C 7/F IR PETHEMA LAL-RI/96 ALL-B III Others N 1 JAK2-E16 c.2047A>G p.R683G 2.5 Y N N 39 CCR-A

8 C 9/M IR UNKN ALL-B II Normal N 1 CRLF2-E06 c.695T>G p.F232C 48.5 Y N Y 40 CCR-A

9 C 9/F HRSEHOP/

LAL/SHOP-99

ALL-B III Hypo (30-39) N 1 TP53-E07 c.711G>A p.M237I 71 ND Y N 16 Rel-D

10 C 12/F HRPETHEMA LAL-AR/20

03ALL-B II TCF3(E2A)-

PBX1 N 1 TP53-E08c.817_821delinsGACC

C

p.R273_V274delinsDP 53 ND Y Y 11 Rel-D

11 C 12/M LR SEHOP/LAL/SHOP- ALL-B II Normal N 1 JAK2-E16 c.2047A>G p.R683G 31 ND Y Y 43 Rel-D

7

97

12 C 13/F HR LAL-AR/SHOP-2005 ALL-B III Hyper (>50) N 1 TP53-E04 c.328C>T p.R110C 14 Y UNK

UNK

4 UNK

13 C 14/F HR UNKN ALL-B I KMT2A(MLL)-R N 1 PAX5-E03 c.399T>G p.S133R 44.5 N N N 37 CCR-A

14 C 15/F IR PETHEMA LAL-RI/96 ALL-B II Others N 1 TP53-E08 c.832C>T p.P278S 11 ND Y Y 96 Rel-D

15 C 16/F HRPETHEMA LAL-AR/20

03ALL-B II Normal N 1 PAX5-E03 c.239C>G p.P80R 88 ND N N 25 CCR-A

16 C 16/M HR

LAL/SEHOP-

PETHEMA 2013

ALL-B II Others N 1 PAX5-E03 c.239C>G p.P80R 97 N N N 15 CCR-A

17 A 20/M HR PETHEMA LAL-AR/93 ALL-B II Normal N 2

CRLF2-E06 c.695T>G p.F232C 22 ND Y Y 11 Rel-D

JAK2-E16 c.2049A>T p.R683S 14

18 A 21/F HRPETHEMA LAL-AR/20

03ALL-B II Normal N 1 CRLF2-

E06 c.695T>G p.F232C 33 ND Y Y 49 Rel-CCR-A

19 A 22/M HRPETHEMA LAL-AR/20

03ALL-B II Normal N 2

CRLF2-E06 c.695T>G p.F232C 19 ND N Y 29 CCR-A

LEF1-E03 c.327delG p.S109fs 5

20 A 23/F IRPETHEMA LAL-RI/200

8ALL-B III Others N 1 PAX5-E02 c.197G>C p.S66T 16.5 N Y Y 36 Refr-Rel-D


03ALL-B II Normal N 2

CRLF2-E06 c.695T>G p.F232C 75 ND Y Y 30

Refr-Rel-CCR-A

JAK2-E16 c.2047A>G p.R683G 6

22 A 29/M IR UNKN ALL-B IIINear-

triploidy (69±)

N 1 TP53-E05 c.403T>C p.C135R 57 ND N NA 1 CCR-ED


03ALL-B II Others N 1 JAK2-E16 c.2047A>G p.R683G 46 ND Y Y 38 Rel-CCR-A

24 A 31/F IR UNKN ALL-B IINear-

triploidy (69±)

N 1 TP53-E09 c.993+1G>A

Splice_Intron 9 SD 77 ND NA N

A 0 ED

8

25 A 31/F HR UNKN ALL-B I KMT2A(MLL)-R N 2 PAX5-E03 c.399T>A p.S133R 20 ND Y N 22 Rel-D

TP53-E08 c.818G> C p.R273P 3.5


03ALL-B I KMT2A(ML

L)-R N 2 TP53-E08 c.841G>A p.D281N 10 N UNK N 9 CCR-D

TP53-E08 c.845G>C p.R282P 7


03ALL-B I Hypo (30-

39) N 2 PAX5-E03 c.215A>G p.Y72C 55 ND N Y 53 CCR-A

PAX5-E03 c.239C>G p.P80R 40

28 A 40/M HR No therapy ALL-B II Normal Y 1 CRLF2-E06 c.695T>G p.F232C 33 ND NA N

ANA-NT NT-D

29 A 43/F HR UNKN ALL-B I Normal N 1 PAX5-E03 c.239C>G p.P80R 35 ND N Y 153 CCR-A

30 A 43/M HR PETHEMA LAL-AR/93 ALL-B III Normal N 1 PAX5-E02 c.113G>A p.R38H 52.5 N UNK N 45 D

31 A 48/F HRPETHEMA LAL-AR/20

03ALL-B III Others N 3

CRLF2-E06 c.695T>G p.F232C 10 ND NA Y 14 Refr-PR-

Rel-D

JAK2-E16 c.2047A>G p.R683G 26

JAK2-E16 c.2049A>T p.R683S 2


03ALL-B II Hyper (>50) N 1 TP53-E06 c.613T>G p.Y205D 68 ND Y Y 48 Rel-CCR-D

33 A 58/M HR PETHEMA LAL-AR/93 ALL-B II Hyper (47-

50) N 1 CRLF2-E06 c.695T>G p.F232C 16 ND Y N 60 Rel-D


03ALL-B I KMT2A(ML

L)-R N 1 CRLF2-E06 c.660G>T p.E220D 76 ND N N 1 CCR-ED

35 A 61/M HR UNKN ALL-B II Hyper (>50) N 1 TP53-E05 c.535C>G p.H179D 82 ND Y N 4 Rel-D


03ALL-B II Normal N 1 JAK2-E16 c.2047A>G p.R683G 12 ND Y Y 35 Rel-CCR-A

37 A 63/F HRPETHEMA

LAL-07OLD

ALL-B II Normal N 1 JAK2-E16 c.2047A>G p.R683G 40 ND Y N 7 Rel-D

38 A 71/F HR PETHEMA LAL/89 ALL-B III Hypo (30-

39) N 1 TP53-E05 c.560-1G>A Splice_Intron 5 SA 41 ND Y N 7 Rel-D

39 A 72/F HR No therapy ALL-B I Normal N 2 TP53-E04 c.374C>G p.T125R 80 ND NA N NA- NT-ED

9

A NTTP53-E06 c.659A>G p.Y220C 5

40 A 74/F HR PETHEMA LAL-AR/93 ALL-B II Normal N 2 JAK2-E16 c.2047A>G p.R683G 38 ND NA N

A 0 ED

JAK2-E16 c.2049A>T p.R683S 4

41 A 77/M HR No therapy ALL-B Others N 1 TP53-E08 c.824G> T p.C275F 28 ND NA NA

NA-NT NT-ED

42 A 82/F HR No therapy ALL-B II Normal N 2CRLF2-

E06 c.695T>G p.F232C 3 ND NA NA

NA-NT NT-ED

JAK2-E16 c.2047A>G p.R683G 36

Abbreviations: M, male; F, female, LR, low risk; IR, intermediate risk; HR, high risk; Hyper (>50), high hyperdiploidy (>50 chromosomes); Hyper (47-50), low hyperdiploidy (47-50 chromosomes); Hypo (30-39), low hypodiploidy (30-39 chromosomes); Near-triploidy (69±), near-triploidy (69±, 58-80), more specifically within the hypotriploidy group (58-68 chromosomes); ND, not done; UNK, unknown; N: no; Y: yes, CCR, continuous complete remission; ED, early death; Refr, refractory; Rel, relapse; D, death; A, alive; NT, no therapy.

10

Table S3. Global frequency of secondary somatic mutations in any of the genes analyzed by primary chromosomal abnormalities in children and adult patients with B-ALL

Primary chromosomal abnormality Whole cohort Children <18

years Adults ≥ 18 years p

N % n % n %Normal 18 42.9 6 37.5 12 46.2 0.002

Hyper (>50) 4 9.5 2 12.5 2 7.7 0.076Hyper (47-50) 3 7.1 2 12.5 1 3.8 1.0Hypo (30-39) 3 7.1 1 6.3 2 7.7 1.0

Near-triploidy (69±) 2 4.8 0 0 2 7.7 NCTEL-AML1 0 0.0 0 0 0 0.0 NCE2A-PBX1 1 2.4 1 6.3 0 0.0 1.0KMT2A-R 4 9.5 1 6.3 3 11.5 0.616BCR-ABL1 0 0.0 0 0 0 0.0 NC

Others 7 16.7 3 18.8 4 15.4 0.184

Total of patients with mutations in any of the

analyzed genes42 100 16 100 26 100

Abbreviations: Hyper (>50), high hyperdiploidy (>50 chromosomes); Hyper (47-50), low hyperdiploidy (47-50 chromosomes); Hypo (30-39), low hypodiploidy (30-39 chromosomes); Near-triploidy (69±), near-triploidy (69±, 58-80) more specifically within the hypotriploidy group (58-68 chromosomes). NC: Not calculated

11

Table S4. Frequency of secondary somatic mutations in hot spot regions of TP53, JAK2, PAX5, LEF1, CRLF2 and IL7R genes by primary chromosomal abnormalities in children and adult patients with B-ALL

Children Adults

Primary chromosomal abnormality

CRLF2mut IL7Rmut PAX5mut LEF1mut JAK2mut TP53mut CRLF2mut IL7Rmut PAX5mut LEF1mut JAK2mut TP53mut

n % n % n % n % n % n % n % n % n % n % n % n %Normal 1 100 1 100 1 33 0 0 2 40 1 20 6 67 0 0 2 40 1 100 6 75 1 11

Hyper (>50) 0 0 0 0 0 0 0 0 1 20 1 20 0 0 0 0 0 0 0 0 0 0 2 22Hyper (47-50) 0 0 0 0 0 0 1 100 1 20 0 0 1 11 0 0 0 0 0 0 0 0 0 0Hypo (30-39) 0 0 0 0 0 0 0 0 0 0 1 20 0 0 0 0 1 20 0 0 0 0 1 11

Near-triploidy (69±) 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 22

TEL-AML1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0E2A-PBX1 0 0 0 0 0 0 0 0 0 0 1 20 0 0 0 0 0 0 0 0 0 0 0 0KMT2A-R 0 0 0 0 1 33 0 0 0 0 0 0 1 11 0 0 1 20 0 0 0 0 2 22BCR-ABL1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Others 0 0 0 0 1 33 0 0 1 20 1 20 1 11 0 0 1 20 0 0 2 25 1 11Total* 1 1 3 1 5 5 9 0 5 1 8 9*Eleven of the 42 patients with mutations (26.2%) concomitantly harbored more than one mutation, which were more frequently observed in adult than in pediatric patients (38.5% vs. 6.3%, p=0.030). Ten cases had two and one adult case had three mutations in the genes investigated. Abbreviations: Hyper (>50), high hyperdiploidy (>50 chromosomes); Hyper (47-50), low hyperdiploidy (47-50 chromosomes); Hypo (30-39), low hypodiploidy (30-39 chromosomes); Near-triploidy (69±), near-triploidy (69±, 58-80) more specifically within the hypotriploidy group (58-68 chromosomes). NC: Not calculated

12

Table S5. Summary of primary chromosomal abnormalities and secondary somatic mutations observed in children and adult patients with B-ALL

Patient ID

Children/Adult

Age (years)/S

ex

Risk Grou

p

Cytogenetic

subgroup

Down syndrome

Karyotype

FISH LSI*TEL/AML

1

FISH LSI BCR/ABL

FISH LSI KMT2A (MLL)

FISH LSI TCF3/PBX1

CRLF2oe

Number of

mutations

Gene-exon

mutatedMutations AA change

Mutational Burden (%)

1 C 1/M HR Hyper (>50) N Hyper (>50)

TEL/AML1 fusion Negative(21q22/AML1 gain)

ND ND ND N 1 JAK2-E14 c.1849G>T p.V617F 23

2 C 2/M HR Normal N 46,XY[12] Normal Normal Normal ND ND 1 IL7R-E06 c.726_729delinsGTGCCCC

p.L242_L243delinsLCP 2

3 C 3/F UNK Hyper (47-50) N 48,XX,+5,+10[18]/

49,XX,idem,+mar[2] ND ND ND ND N 1 LEF1-E03 c.327delG p.S109fs 8

4 C 4/F LR Normal N 46,XX[21] ND ND Normal ND ND 1 TP53-E04 c.332T->C p.L111P 14

5 C 4/F UNK Hyper (47-50) N 48,XX,+21x2[17]/

46,XX[2] ND ND ND ND Y 2

JAK2-E16 c.2049A>T p.R683S 4

JAK2-E16

c.2044_2045insGGACCTCCTCCC

TCC

p.L681_I682insGPPPS 12

6 C 4/M HR Normal Y 46,XY,der(14;21)(q10;q10),+21c

TEL/AML1 fusion Negative(21q22/AML1 gain-84%)

ND Normal ND ND 1 JAK2-E16 c.2049A>T p.R683S 16.5

7 C 7/F IR Others N 46,XX,?der(21)[4]/46,XX[17] ND ND ND ND Y 1 JAK2-E16 c.2047A>G p.R683G 2.5

8 C 9/M IR Normal N 46,XY ND ND ND ND Y 1 CRLF2-E06 c.695T>G p.F232C 48.5

13

9 C 9/F HR Hypo (30-39) N

36,X,-2,-3,-6,-7,-12,-15,-17[cp

5]/46,XX[15]ND ND ND ND ND 1 TP53-E07 c.711G>A p.M237I 71

10 C 12/F HR TCF3(E2A)-PBX1 N 46,XX[15] Normal Normal Normal

LSI TCF3/PBX1 fusion 89%

(19p13.3/TCF3 loss-89%)

ND 1 TP53-E08 c.817_821delinsGACCC

p.R273_V274delinsDP 53

11 C 12/M LR Normal N 46,XY[13] ND ND ND ND ND 1 JAK2-E16 c.2047A>G p.R683G 31

12 C 13/F HR Hyper (>50) N

54,XX,+4,+8,+10,+11,+21,-16,-17,+5mar[13]/

46,XX[12]

TEL/AML1 fusion Negative (21q22/AML1 gain)

Normal

t(v;11q23)-Rearrangeme

nt MLL Negative

(11q23/MLL gain)

ND Y 1 TP53-E04 c.328C>T p.R110C 14

13 C 14/F HR KMT2A(MLL)-R N 46,XX,t(4;11)

(q21;q23) ND ND ND ND N 1 PAX5-E03 c.399T>G p.S133R 44.5

14 C 15/F IR Others N46,XX,t(7;15)(p13;q12)[3] /46,XX[7]

Normal Normal ND ND ND 1 TP53-E08 c.832C>T p.P278S 11

15 C 16/F HR Normal N NM Normal Normal Normal ND ND 1 PAX5-E03 c.239C>G p.P80R 88

16 C 16/M HR Others N 92,XXYY[1]/46,XY[7]

TEL/AML1 fusion Negative (12p13.2/ETV6 gain, 21q22.12/RUNX1 gain)

ND


nt MLL Negative

(11q23/MLL gain)

ND N 1 PAX5-E03 c.239C>G p.P80R 97

17 A 20/M HR Normal N NM ND Normal Normal ND ND 2

CRLF2-E06 c.695T>G p.F232C 22

JAK2-E16 c.2049A>T p.R683S 14

18 A 21/F HR Normal N 46,XX[15] ND Normal Normal ND ND 1 CRLF2-E06 c.695T>G p.F232C 33

14


CRLF2-E06 c.695T>G p.F232C 19

LEF1-E03 c.327delG p.S109fs 5

20 A 23/F IR Others NComplex

hyperdiploid with i(17q), del(20q)

ND ND ND ND N 1 PAX5-E02 c.197G>C p.S66T 16.5


CRLF2-E06 c.695T>G p.F232C 75

JAK2-E16 c.2047A>G p.R683G 6

22 A 29/M IRNear-

triploidy (69±)

N 57-66,XY[2]/46,XY[18] ND

BCR/ABL fusion Negative (22q11.2/BCR

gain-71%)


nt MLL Negative

(11q23/MLL gain-68%)

ND ND 1 TP53-E05 c.403T>C p.C135R 57

23 A 29/M HR Others N45,XY,-

8,der(20)t(8;20)(p11;q13)[20]

NDND (BCR/ABL negative by RT-

PCR)ND ND ND 1 JAK2-E16 c.2047A>G p.R683G 46

24 A 31/F IRNear-

triploidy (69±)

N

58-62,XX,+1,+2,+3,+5,+10,+10,+11,+12,+14,+16,+20,+21,+21,+22[17]

/46,XX[3]

ND

BCR/ABL fusion Negative

(9q34/ABL gain-71%,)


nt MLL Negative


ND ND 1 TP53-E09 c.993+1G>A Splice_Intron 9 SD 77

25 A 31/F HR KMT2A(MLL)-R N 46,XX,t(4;11)

(q21;q23)[10] ND Normal ND ND ND 2PAX5-

E03 c.399T>A p.S133R 20

TP53-E08 c.818G> C p.R273P 3.5

26 A 31/M HR KMT2A(MLL)-R N 47,XXY,t(4;11)

(q21q23) ND ND ND ND N 2TP53-E08 c.841G>A p.D281N 10

TP53-E08 c.845G>C p.R282P 7

27 A 34/M HR Hypo (30-39) N 39-42,XY[cp12] ND Normal Normal ND ND 2

PAX5-E03 c.215A>G p.Y72C 55

PAX5-E03 c.239C>G p.P80R 40

28 A 40/M HR Normal Y NM ND Normal Normal ND ND 1 CRLF2- c.695T>G p.F232C 33

15

E06

29 A 43/F HR Normal N NM ND Normal ND ND ND 1 PAX5-E03 c.239C>G p.P80R 35

30 A 43/M HR Normal N 46,XY ND ND ND ND N 1 PAX5-E02 c.113G>A p.R38H 52.5

31 A 48/F HR Others N46,XX,del(6)

(q23q27),-14,+mar[3]/46,XX[4]

ND ND ND ND ND 3

CRLF2-E06 c.695T>G p.F232C 10

JAK2-E16 c.2047A>G p.R683G 26

JAK2-E16 c.2049A>T p.R683S 2

32 A 58/M HR Hyper (>50) N NM ND


gain-42%,)


nt MLL Negative


ND 1 TP53-E06 c.613T>G p.Y205D 68

33 A 58/M HR Hyper (47-50) N 47,XY,+18[4]/

46,XY[16] ND ND ND ND ND 1 CRLF2-E06 c.695T>G p.F232C 16

34 A 60/M HR KMT2A(MLL)-R N NM ND Normal (t(v;11q23)

73%) ND ND 1 CRLF2-E06 c.660G>T p.E220D 76

35 A 61/M HR Hyper (>50) N NM ND


gain-79%)


nt MLL Negative

(11q23/MLL gain-85.5%)

ND ND 1 TP53-E05 c.535C>G p.H179D 82

36 A 61/M HR Normal N 46,XY[13] ND Normal Normal ND ND 1 JAK2-E16 c.2047A>G p.R683G 12

37 A 63/F HR Normal N NM ND Normal Normal ND ND 1 JAK2-E16 c.2047A>G p.R683G 40

38 A 71/F HR Hypo (30-39) N 33-40,XX,add(4)

(q33)[9] /46,XX[1] ND ND ND ND ND 1 TP53-E05 c.560-1G>A Splice_Intron 5 SA 41

39 A 72/F HR Normal N 46,XX[14]ND

ND ND ND ND 2 TP53-E04 c.374C>G p.T125R 80

TP53-E06 c.659A>G p.Y220C 5

40 A 74/F HR Normal N NM ND Normal ND ND ND 2 JAK2-E16

c.2047A>G p.R683G 38

16

JAK2-E16 c.2049A>T p.R683S 4

41 A 77/M HR Others N47,XY,+4,-6,i(6)

(p10),add(11)(q23),+mar[8]/46,XY[12]

ND ND Normal ND ND 1 TP53-E08 c.824G> T p.C275F 28

42 A 82/F HR Normal N 46,XX[18] ND Normal Normal ND ND 2

CRLF2-E06 c.695T>G p.F232C 3

JAK2-E16 c.2047A>G p.R683G 36

Abbreviations: M, male; F, female, LR, low risk; IR, intermediate risk; HR, high risk; Hyper (>50), high hyperdiploidy (>50 chromosomes); Hyper (47-50), low hyperdiploidy (47-50 chromosomes); Hypo (30-39), low hypodiploidy (30-39 chromosomes); Near-triploidy (69±), near-triploidy (69±, 58-80) more specifically within the hypotriploidy group (58-68 chromosomes). LSI (Locus Specific Identifier), ND, not done; UNK, unknown; N: no; Y: yes, CRLF2 oe: CRLF2 overexpression

17

Table S6. Description of 30 somatic mutations observed in B-ALL patients

n Gene Type of mutation Mutation AA change Protein domain

Number of patients with mutation Database

Children Adults Whole

cohort

1 CRLF2-E06 Missense c.695T>G p.F232C Extracellular juxtamembrane 1 8 9 COSM41268

2 JAK2-E14 Missense c.1849G>T p.V617F Pseudokinase 1 0 1 COSM12600

3 JAK2-E16 Missense c.2047A>G p.R683G Pseudokinase 2 7 9 COSM29300

4 JAK2-E16 Missense c.2049A>T p.R683S Pseudokinase 2 3 5 COSM29302

5 PAX5-E03 Missense c.239C>G p.P80R DNA-binding 2 2 4 COSM85953

6 LEF1-E03 Frameshift c.327delG p.S109fs Activation domain 1 1 2 Undescribed

7 PAX5-E03 Missense c.399T>A p.S133R Paired DNA-binding 0 1 1 Undescribed

8 CRLF2-E06 Missense c.660G>T p.E220D Extracellular juxtamembrane 0 1 1 Undescribed

9 IL7R-E06 delins c.726_729delinsGTGCCCC p.L242_L243delinsLCP Transmembrane 1 0 1 Undescribed

10 JAK2-E16 ins c.2044_2045insGGACCTCCTCCCTCC

p.L681_I682insGPPPS Pseudokinase 1 0 1 Undescribed

11 PAX5-E02 Missense c.113G>A p.R38H Paired DNA-binding 0 1 1 COSM4989863

12 PAX5-E02 Missense c.197G>C p.S66T Paired DNA-binding 0 1 1 Undescribed

13 PAX5-E03 Missense c.215A>G p.Y72C Paired DNA-binding 0 1 1 COSM455949

14 PAX5-E03 Missense c.399T>G p.S133R Paired DNA-binding 1 0 1 Undescribed

15 TP53-E04 Missense c.332T->C p.L111P DNA binding 1 0 1 COSM437626/TP53 website http://p53.fr

16 TP53-E04 Missense c.374C->G p.T125R HCD II - DNA binding 0 1 1 TP53 website http://p53.fr

17 TP53-E04 Missense c.328C>T p.R110C DNA binding 1 0 1 COSM247949

18 TP53-E05 Missense c.535C>G p.H179D HCD III - DNA binding 0 1 1 COSM44776/TP53 website http p53.fr

19 TP53-E05 Missense c.403T>C p.C135R HCD II - DNA binding 0 1 1 COSM10684/TP53 website http p53.fr

20 TP53-E05 Splicing c.560-1G->A (splicing Intron 5 SA) Splice_Intron 5 SA NA* (Intron 5 SA) 0 1 1 TP53 website http://p53.fr

21 TP53-E06 Missense c.613T>G p.Y205D DNA binding 0 1 1 COSM43844/TP53 website http p53.fr

18

22 TP53-E06 Missense c.659A>G p.Y220C DNA binding 0 1 1 COSM99720/TP53 website http://p53.fr

23 TP53-E07 Missense c.711G>A p.M237I HCD IV - DNA binding 1 0 1 COSM99648/TP53 website http://p53.fr

24 TP53-E08 delins c.817_821delinsGACCC p.R273_V274delinsDP HCD V - DNA binding 1 0 1 Undescribed

25 TP53-E08 Missense c.832C>T p.P278S HCD V - DNA binding 1 0 1 COSM10939/TP53 website http p53.fr

26 TP53-E08 Missense c.818G> C p.R273P HCD V - DNA binding 0 1 1 COSM165077/TP53 website http://p53.fr

27 TP53-E08 Missense c.824G> T p.C275F HCD V - DNA binding 0 1 1 COSM99932/TP53 website http p53.fr

28 TP53-E08 Missense c.841G>A p.D281N HCD V - DNA binding 0 1 1 COSM146336/TP53 website http p53.fr

29 TP53-E08 Missense c.845G>C p.R282P HCD V - DNA binding 0 1 1 COSM117157/TP53 website http p53.fr

30 TP53-E09 Splicing c.993+1G->A (splicing Intron 9 SD) Splice_Intron 9 SD NA* (Intron 9 SD) 0 1 1 TP53 website http://p53.fr* Not applicable

19

Table S7. Mutations identified in 11 B-ALL patients who concomitantly harbored more than one mutation

In four cases (ID5, ID40, ID27 and ID26), indicated in red, the mutations occurred in the same gene and in the same amplicon ( JAK2, PAX5 or TP53). In one case (ID39),

shown in blue, two different mutations occurred in separate amplicons of the same gene (TP53). In five cases (shown in green), mutations were identified in two genes: three

patients (ID17, ID21 and ID42) harbored concomitant JAK2 and CLFR2 mutations, while one patient (ID25) had TP53/PAX5 mutations, and another (ID19) had CRFL2/LEF1

mutations. Finally, one patient (ID31), indicated in gray, harbored three concomitant mutations in JAK2 and CRLF2, of which two mutations were detected in the same

amplicon in JAK2. Exons (E) and mutations are specified below the gene name. The clinical data for these patients are shown in Table S2.

Patient ID Children/Adult

CRLF2 JAK2 LEF1 PAX5 TP53

E06 E16 E03 E03 E04 E06 E08

c.695T>Gc.2044_2045insGGACCTCCTC

CCTCCc.2047A>G c.2049A>T c.327delG c.215A>G c.239C>G c.399T>A c.374C>G c.659A>G c.818G>

C c.841G>A c.845G>C

5 Child

40 Adult

27 Adult

26 Adult

39 Adult

17 Adult

21Adult

42 Adult

25Adult

19 Adult

31 Adult

20

Table S8. Association of mutations with prognostic factors, risk stratification parameters and response to frontline therapy in children with B-ALL (n=211)

Parameter and categorymut wt

pTP53 mut TP53wt

pJAK2mut JAK2wt

pn n n n n n

Risk group1

0.018 0.338 0.6High risk 9 48 3 54 2 55Low risk/Intermediate risk 5 106 2 109 2 109Total 14 154 5 163 4 164Response to frontline therapy2

0.082 0.032 0.293Poor response to frontline therapy 6 34 3 37 2 38Good response to frontline therapy 8 138 1 145 3 143Total 14 172 4 182 5 181MRD response after induction

0.747 0.172 0.609MRD ≥0.01% 4 39 2 41 2 41MRD <0.01% 9 110 1 118 3 116Total 13 149 3 159 5 157WBC count

1.0 0.177 0.307WBC <30 x 109/L 10 114 5 119 4 120WBC ≥30 x 109/L 5 54 0 59 0 59Total 15 168 5 178 4 179LDH level

0.1 0.503 1.0Elevated LDH (U/L) level, (%) 8 114 3 119 2 120Normal LDH (U/L) level, (%) 4 19 1 22 0 23Total 12 133 4 141 2 143Cytogenetics3

0.624 0.346 1.0Poor risk cytogenetic 2 15 1 16 0 17Good risk cytogenetic 14 180 4 190 5 189Total 16 195 5 206 5 206Duration of first remission4

1.0 0.483 1.0CR < 1 year 1 7 1 7 0 8CR ≥ 1 year 4 17 1 20 2 19Total 5 24 2 27 2 27Time of relapse5

1.0 1.0 0.534Very early/Early relapse 4 18 2 20 1 21Late relapse 2 8 1 9 1 9

21

Total 6 26 3 29 2 30Cytogenetic group

0.047 0.586 0.586ETV6-RUNX1 positive 0 43 0 43 0 43ETV6-RUNX1 negative 16 152 5 163 5 163Total 16 195 5 206 5 206Age of children

0.024 0.059 1.01-10 years 9 151 2 158 4 156> 10 years 7 34 3 38 1 40Total 16 185 5 196 5 196Phenotype

1.0 1.0 1.0Pro-B B-ALL 1 19 0 20 0 20Common or Pre-B B-ALL 14 155 5 164 5 164Total 15 174 5 184 5 184

1Risk group stratification was mainly established according to PETHEMA protocols based on age, WBC and cytogenetic subgroup.2Poor response to frontline therapy due to refractoriness or relapse events 3Includes t(9;22), t(v;11q23) and hypodiploidy4Applies to patients who suffered relapse5Time of relapse criteria: very early, earlier than 18 months after initial diagnosis and less than 6 months after cessation of frontline treatment; early, more than 18 months after initial diagnosis, but less than 6 months after cessation of frontline treatment; late, more than 6 months after cessation of frontline treatment.

Abbreviations: mut, mutated; wt, wild type; WBC, white blood cell; LDH, lactate dehydrogenase; ECOG, Eastern Cooperative Oncology Group; MRD, minimal residual disease; CR complete remission. Statistically significant results (p<0.05) are indicated in bold.

22

Table S9. Association of mutations with prognostic factors, risk stratification parameters and response to frontline therapy in adults (n=129) with B-ALL

Parameter and categorymut WT

pCRLF2mu

tCRLF2

WT pPAX5mu

t PAX5wtp

TP53mut TP53wt

pJAK2mu

t JAK2wtp

n n n n n n n n n n

Risk Group1

1.0 0.597 0.469 0.284 0.595High risk 23 90 9 104 4 109 7 106 8 105Low risk/Intermediate risk 3 12 0 15 1 14 2 13 0 15Total 26 102 9 119 5 123 9 119 8 120Response to frontline therapy2

0.107 0.454 1.0 0.376 0.031Poor response to frontline therapy 13 40 5 48 2 51 4 49 6 47Good response to frontline therapy 5 38 2 41 2 41 1 42 0 43Total 18 78 7 89 4 92 5 91 6 90MRD response after induction

0.519 0.638 1.0 0.555 1.0MRD ≥0.01% 6 23 2 27 1 28 2 27 1 28MRD <0.01% 6 40 2 44 2 44 1 45 1 45Total 12 63 4 71 3 72 3 72 2 73ECOG Status

0.325 1.0 NC 0.137 0.452ECOG score ≥2, (%) 6 11 2 15 0 17 2 15 4 13ECOG score <2, (%) 6 22 4 24 0 28 0 28 4 24Total 12 33 6 39 0 45 2 43 8 37WBC count

0.653 0.312 1.0 0.272 0.154WBC <30 x 109/L (B-ALL) 14 42 3 53 3 53 6 50 2 54WBC ≥30 x 109/L (B-ALL) 11 42 6 47 2 51 2 51 6 47Total 25 84 9 100 5 104 8 101 8 101LDH level

0.261 0.07 1.0 1.0 0.192Elevated LDH (U/L) level, (%) 17 65 6 76 3 79 6 76 5 77Normal LDH (U/L) level, (%) 4 7 3 8 0 11 0 11 2 9Total 21 72 9 84 3 90 6 87 7 86Cytogenetics3

0.001 0.033 1.0 0.493 0.006Poor cytogenetic risk 5 58 1 62 2 61 3 60 0 63Good cytogenetic risk 21 45 8 58 3 63 6 60 8 58

23

Total 26 103 9 120 5 124 9 120 8 121Duration of first remission4

0.478 0.609 0.359 1.0 0.636CR <1 year 6 19 2 23 0 25 2 23 4 21CR ≥1 year 5 9 2 12 1 13 1 13 1 13Total 11 28 4 35 1 38 3 36 5 34Time of relapse5

0.651 0.542 1.0 1.0 0.567Very early/Early relapse 11 23 3 31 2 32 4 30 5 29Late relapse 1 6 1 6 0 7 0 7 0 7Total 12 29 4 37 2 39 4 37 5 36Cytogenetic group

<0.0001 0.028 0.165 0.028 0.05BCR-ABL1 positive 0 44 0 44 0 44 0 44 0 44BCR-ABL1 negative 26 59 9 76 5 80 9 76 8 77Total 26 103 9 120 5 124 9 120 8 121Age in adults

0.496 1.0 0.159 0.281 0.457<55 years 15 67 6 76 5 77 4 78 4 78≥55 years 11 35 3 43 0 46 5 41 4 72Total 26 102 9 119 5 123 9 119 8 120Phenotype

0.793 0.681 0.074 0.776 0.195Pro-B B-ALL 6 19 1 24 3 22 3 22 0 25Common or Pre-B B-ALL 19 67 8 78 2 84 5 81 8 78Total 25 86 9 102 5 106 8 103 8 103

1Risk group stratification was mainly established according to PETHEMA protocols based on age, WBC and cytogenetic subgroup2Poor response to frontline therapy due to refractoriness or relapse events 3Includes t(9;22), t(v;11q23) and hypodiploidy4Apply for patients who suffered relapse5Time of relapse criteria: very early, earlier than 18 months after initial diagnosis and less than 6 months after cessation of frontline treatment; early, more than 18 months after initial diagnosis, but less than 6 months after cessation of frontline treatment; late, more than 6 months after cessation of frontline treatment.

Abbreviations: mut, mutated; wt, wild type; WBC, white blood cell; LDH, lactate dehydrogenase; ECOG, Eastern Cooperative Oncology Group; MRD, minimal residual disease; CR complete remission. Statistically significant results (p<0.05) are indicated in bold.

24

Table S10. Univariate overall survival, event-free survival and relapse rates analysis of pediatric patients with B-ALL

Parameter and category

OS EFS RR

Patients Death5-year rate

p Patients Events5-year rate

p Patients Relapse5-year rate p

n n (Log-rank) n n (Log-rank) n n

TP53mut 4 2 50.0

0.002

4 2 50

0.009

3 1 33.3

0.037TP53wt 186 26 86.0 184 40 78.3 165 26 18.6

Total 190 29 188 42 168 27

JAK2mut 5 2 60

0.174

5 2 60

0.469

5 1 20.0

0.208JAK2wt 185 26 85.9 183 40 78.1 163 25 15.3

Total 190 28 188 42 168 26

Risk group1

<0.0001 <0.0001 0.002High risk 50 18 64.0 48 22 54.2 41 13 31.7

Low risk/Intermediate risk 101 7 93.1 103 15 85.4 91 9 9.9

Total 151 25 151 37 132 22

MRD response after induction

0.004 0.027 0.063MRD ≥0.01% 42 10 76.2 42 13 69.0 41 11 26.8

MRD <0.01% 117 10 91.5 116 19 83.6 113 16 14.2

Total 159 20 158 32 154 27

ECOG status

0.671 0.546 0.496ECOG score ≥2, (%) 5 1 80.0 5 1 80.0 5 1 20.0

ECOG score <2, (%) 15 5 66.7 15 5 66.7 12 5 41.7

Total 20 6 20 6 17 6

WBC count

0.042 0.117 0.668WBC <30 x 109/L 119 14 88.2 118 22 81.4 108 17 15.7

WBC ≥30 x 109/L 52 12 76.9 50 14 72.0 44 8 18.2

25

Total 171 26 168 36 152 25

LDH level

0.847 0.908 0.908Elevated LDH (U/L) level, (%) 114 15 86.8 114 23 79.8 106 17 16.0

Normal LDH (U/L) level, (%) 21 3 85.7 21 5 76.2 17 3 17.6

Total 135 18 135 28 123 20

Cytogenetics2

<0.0001 <0.0001 0.016Poor cytogenetic risk 14 7 50.0 14 7 50.0 13 4 30.8

Good cytogenetic risk 176 21 88.1 174 35 79.9 155 23 14.8

Total 190 28 188 42 168 27

Cytogenetic group

0.001 0.004 0.011ETV6-RUNX1 positive 41 0 100 42 2 95.2 38 1 2.6

ETV6-RUNX1 negative 149 28 81.2 146 40 72.6 130 26 20.0

Total 190 28 188 42 168 27

Age of children

<0.0001 <0.0001 <0.00011-10 years 143 11 92.3 140 20 85.7 129 14 10.9

> 10 years 38 13 65.8 39 18 53.8 31 11 35.5

Total 181 24 179 38 160 25

Phenotype

<0.0001 0.004 0.05Pro-B B-ALL 19 8 57.9 19 8 57.9 19 5 26.3

Common or Pre-B B-ALL 158 16 89.9 156 29 81.4 139 19 13.7

Total 177 24 175 37 158 24

1Risk group stratification was established mainly according to PETHEMA protocols, based on age, WBC and cytogenetic subgroup.2Includes t(9;22), t(v;11q23) and hypodiploidy.

Abbreviations: WBC, white blood cell; LDH, lactate dehydrogenase; ECOG, Eastern Cooperative Oncology Group; MRD, minimal residual disease; OS, overall survival; EFS, event-free survival; RR, relapse rate; NR, not reached; NC: not calculated. Statistically significant results (p<0.05) are indicated in bold.

Table S11. Univariate overall survival, event-free survival and relapse rates analysis of adult patients with B-ALL

26

Parameter and category

OS EFS RR

Patients Death5-year rate

p Patients Events5-year rate

p Patients Relapse5-year rate p

n n (Log-rank) n n (Log-rank) n n

CRLF2mut 7 4 42.9

0.641

7 6 14.3

0.642

6 4 66.7

0.412CRLF2wt 104 62 40.4 98 69 29.6 71 33 46.5

Total 111 66 105 75 77 37

PAX5 mut 5 3 40.0

0.433

5 3 40.0

0.194

2 1 50.0

0.693PAX5wt 106 63 40.6 100 72 28.0 75 36 48.0

Total 111 66 105 75 77 37

TP53mut 7 7 0.0

0.019

7 7 0.0

0.08

4 3 100

0.029TP53wt 104 59 43.3 98 68 30.6 73 34 61.4

Total 111 66 105 75 77 37

JAK2mut 7 4 42.9

0.972

7 7 0.0

0.035

5 5 100.0

0.002JAK2wt 104 62 40.4 98 68 30.6 72 32 60.4

Total 111 66 105 75 77 37

Risk group1

0.07 0.056 0.141High risk 96 60 37.5 90 67 25.6 66 33 50.0

Low risk/Intermediate risk 14 5 64.3 14 7 50.0 11 4 36.4

Total 110 65 104 74 77 37

MRD response after induction

0.314 0.023 0.003MRD ≥0.01% 28 14 50.0 24 18 25.0 24 15 62.5

MRD <0.01% 43 19 55.8 43 22 48.8 41 13 31.7

Total 71 33 67 40 65 28

ECOG status

0.231 0.43 0.659ECOG score ≥2, (%) 11 8 27.3 12 10 16.7 8 6 75.0

ECOG score <2, (%) 25 13 48.0 25 19 24.0 22 11 50.0

27

Total 36 21 37 29 30 17

WBC count

0.288 0.008 0.024WBC <30 x 109/L 48 26 45.8 47 29 38.3 37 15 40.5

WBC ≥30 x 109/L 47 29 38.3 44 35 20.5 32 19 59.4

Total 95 55 91 64 69 34

LDH level

0.36 0.611 0.777Elevated LDH (U/L) level, (%) 71 42 40.8 69 47 31.9 54 25 46.3

Normal LDH (U/L) level, (%) 10 5 50.0 9 7 22.2 7 5 71.4

Total 81 47 78 54 61 30

Cytogenetics2

0.013 0.025 0.988Poor cytogenetic risk 54 37 31.5 50 38 24.0 36 13 36.1

Good cytogenetic risk 57 29 49.1 55 37 32.7 41 24 58.5

Total 75 37

Cytogenetic group

0.106 0.083 0.234BCR-ABL1 positive 37 24 35.1 33 24 27.3 22 5 22.7

BCR-ABL1 negative 74 42 43.2 72 51 29.2 55 32 58.2

n Total 111 66 105 75 77 37

Age of adults

0.001 0.002 0.027<55 years 75 38 49.3 71 46 35.2 55 24 43.6

≥55 years 36 28 22.2 33 28 15.2 22 13 59.1

Total 111 66 104 74 77 37

Phenotype

0.923 0.516 0.599Pro-B B-ALL 23 14 39.1 23 16 30.4 16 7 43.8

Common or Pre-B B-ALL 73 46 37.0 72 54 25.0 52 27 51.9

Total 96 60 95 70 68 34

1Risk group stratification was established mainly according to PETHEMA protocols, based on age, WBC and cytogenetic subgroup.2Includes t(9;22), t(v;11q23) and hypodiploidy.

28

Abbreviations: mut, mutated; wt, wild type; WBC, white blood cell; LDH, lactate dehydrogenase; ECOG, Eastern Cooperative Oncology Group; MRD, minimal residual disease; OS, overall survival; EFS, event-free survival; RR, relapse rate; NR, not reached; NC: not calculated. Statistically significant results (p<0.05) are indicated in bold.

29

Supplemental figures

Figure S1. Somatic mutations observed in pediatric B-ALL patients.

In pediatric B-ALL patients, TP53 mutations were generally distributed across several exons. Three recurrent mutations were observed in JAK2 (p.R683G and p.R683S) and PAX5 (p.P80R). Gray boxes represent exons.

30

Figure S2. Somatic mutations observed in adult B-ALL patients.

In adult B-ALL patients, TP53 mutations were generally distributed across several exons. Four recurrent mutations were observed in CRLF2 (p.F232C), JAK2 (p.R683G and p.R683S) and PAX5 (p.P80R). Gray boxes represent exons.

31

Figure S3. Two patients with double mutation in the JAK2-E16 gene identified by amplicon-based NGS.

According to differential mutational loads between the two JAK2 mutations, the sequencing analysis demonstrated that the dominant clone harboring the c.2047A>G mutation was at the highest percentage compared with the minority clone harboring the c.2049A>T mutation. Patient ID31: JAK2-E16mut (R683G and R683S), and CRLF2-E06mut. Patient ID40: JAK2-E16mut (R683G and R683S).

32

Figure S4. Identification of clonal heterogeneity in the PAX5-E03 gene by amplicon-based NGS.

In one patient (ID27, see Table S2) who harbored two distinct mutations in the same amplicon (PAX5-E03, c.215A>G and c.239C>G), 454 deep-sequencing analysis enabled the presence of four lines to be identified; one minority and germline (PAX5wt: 8.8%), one dominant clone with c.215A>G mutation (51.4%), one subclone with c. 239C>G mutation (36.6%) and one minority subclone (3.2%) with both mutations (c.215A>G and c. 239C>G).

33

Figure S5. Identification of clonal heterogeneity in the JAK2 gene by amplicon-based NGS

In one patient (ID5) who carried two mutations in the same amplicon of the JAK2-E16 gene, 454 deep-sequencing analysis enabled three lines to be identified; one germline (JAK2wt: 84%) line, one subclone with c.2044_2045insGGACCTCCTCCCTCC mutation (12%) and one minority subclone with c.2049A>T mutation (4%).

34

Figure S6. Identification of clonal heterogeneity in the TP53 gene by amplicon-based NGS.

In one patient (ID26) who carried two mutations in the same amplicon of TP53-E08 gene, 454 deep-sequencing analysis enabled the presence of three lines to be identified; one germline (TP53wt:83.4%) line, and two minority lines, one subclone with c.841G>A mutation (10%) and one subclone with c.845G>C mutation (6.6%).

35

References

Forero-Castro M, Robledo C, Benito R, Abaigar M, Africa Martin A, Arefi M, Fuster JL, de Las Heras N, Rodriguez JN, Quintero J, Riesco S, Hermosin L, de la Fuente I, Recio I, Ribera J, Labrador J, Alonso JM, Olivier C, Sierra M, Megido M, Corchete-Sanchez LA, Ciudad Pizarro J, Garcia JL, Ribera JM, Hernandez-Rivas JM (2016) Genome-Wide DNA Copy Number Analysis of Acute Lymphoblastic Leukemia Identifies New Genetic Markers Associated with Clinical Outcome. PLoS One 11(2): e0148972

Grossmann V, Roller A, Klein HU, Weissmann S, Kern W, Haferlach C, Dugas M, Haferlach T, Schnittger S, Kohlmann A (2013) Robustness of amplicon deep sequencing underlines its utility in clinical applications. The Journal of molecular diagnostics : JMD 15(4): 473-84

Harrison C (2011) New genetics and diagnosis of childhood B-cell precursor acute lymphoblastic leukemia. Pediatr Rep 3 Suppl 2: e4

Harrison CJ, Moorman AV, Broadfield ZJ, Cheung KL, Harris RL, Reza Jalali G, Robinson HM, Barber KE, Richards SM, Mitchell CD, Eden TO, Hann IM, Hill FG, Kinsey SE, Gibson BE, Lilleyman J, Vora A, Goldstone AH, Franklin IM, Durrant J, Martineau M (2004) Three distinct subgroups of hypodiploidy in acute lymphoblastic leukaemia. Br J Haematol 125(5): 552-9

Holmfeldt L, Wei L, Diaz-Flores E, Walsh M, Zhang J, Ding L, Payne-Turner D, Churchman M, Andersson A, Chen SC, McCastlain K, Becksfort J, Ma J, Wu G, Patel SN, Heatley SL, Phillips LA, Song G, Easton J, Parker M, Chen X, Rusch M, Boggs K, Vadodaria B, Hedlund E, Drenberg C, Baker S, Pei D, Cheng C, Huether R, Lu C, Fulton RS, Fulton LL, Tabib Y, Dooling DJ, Ochoa K, Minden M, Lewis ID, To LB, Marlton P, Roberts AW, Raca G, Stock W, Neale G, Drexler HG, Dickins RA, Ellison DW, Shurtleff SA, Pui CH, Ribeiro RC, Devidas M, Carroll AJ, Heerema NA, Wood B, Borowitz MJ, Gastier-Foster JM, Raimondi SC, Mardis ER, Wilson RK, Downing JR, Hunger SP, Loh ML, Mullighan CG (2013) The genomic landscape of hypodiploid acute lymphoblastic leukemia. Nat Genet 45(3): 242-52

Kohlmann A, Klein HU, Weissmann S, Bresolin S, Chaplin T, Cuppens H, Haschke-Becher E, Garicochea B, Grossmann V, Hanczaruk B, Hebestreit K, Gabriel C, Iacobucci I, Jansen JH, te Kronnie G, van de Locht L, Martinelli G, McGowan K, Schweiger MR, Timmermann B, Vandenberghe P, Young BD, Dugas M, Haferlach T (2011) The Interlaboratory RObustness of Next-generation sequencing (IRON) study: a deep sequencing investigation of TET2, CBL and KRAS mutations by an international consortium involving 10 laboratories. Leukemia 25(12): 1840-8

Leroy B, Anderson M, Soussi T (2014) TP53 mutations in human cancer: database reassessment and prospects for the next decade. Human mutation 35(6): 672-88

Neale GA, Coustan-Smith E, Stow P, Pan Q, Chen X, Pui CH, Campana D (2004) Comparative analysis of flow cytometry and polymerase chain reaction for the detection of minimal residual disease in childhood acute lymphoblastic leukemia. Leukemia 18(5): 934-8

Ribera JM, Garcia O, Grande C, Esteve J, Oriol A, Bergua J, Gonzalez-Campos J, Vall-Llovera F, Tormo M, Hernandez-Rivas JM, Garcia D, Brunet S, Alonso N, Barba P, Miralles P, Llorente A, Montesinos P, Moreno MJ, Hernandez-Rivas JA, Bernal T (2013) Dose-intensive chemotherapy including rituximab in Burkitt's leukemia or lymphoma regardless of human immunodeficiency virus infection status: final results of a phase 2 study (Burkimab). Cancer 119(9): 1660-8

Weissmann S, Roller A, Jeromin S, Hernandez M, Abaigar M, Hernandez-Rivas JM, Grossmann V, Haferlach C, Kern W, Haferlach T, Schnittger S, Kohlmann A (2013) Prognostic impact and landscape of NOTCH1 mutations in chronic lymphocytic leukemia (CLL): a study on 852 patients. Leukemia 27(12): 2393-6

Xicoy B, Ribera JM, Muller M, Garcia O, Hoffmann C, Oriol A, Hentrich M, Grande C, Wasmuth JC, Esteve J, van Lunzen J, Del Potro E, Knechten H, Brunet S, Mayr C, Escoda L, Schommers P, Alonso N,

36

Vall-Llovera F, Perez M, Morgades M, Gonzalez J, Fernandez A, Thoden J, Gokbuget N, Hoelzer D, Fatkenheuer G, Wyen C, for the PG, German HIVLC (2014) Dose-intensive chemotherapy including rituximab is highly effective but toxic in human immunodeficiency virus-infected patients with Burkitt lymphoma/leukemia: parallel study of 81 patients. Leuk Lymphoma 55(10): 2341-2348

Yoda A, Yoda Y, Chiaretti S, Bar-Natan M, Mani K, Rodig SJ, West N, Xiao Y, Brown JR, Mitsiades C, Sattler M, Kutok JL, DeAngelo DJ, Wadleigh M, Piciocchi A, Dal Cin P, Bradner JE, Griffin JD, Anderson KC, Stone RM, Ritz J, Foa R, Aster JC, Frank DA, Weinstock DM (2010) Functional screening identifies CRLF2 in precursor B-cell acute lymphoblastic leukemia. Proc Natl Acad Sci U S A 107(1): 252-7

37

Documents

media.nature.com€¦ · Web viewFor quantitative RT-PCR assays, complementary DNA (cDNA) was retro-transcribed with High Capacity cDNA Reverse Transcription Kit (Life Technologies)