Molecular Cell, Volume 45

Supplemental Information

Mechanistic Insight into the Microtubule and Actin Cytoskeleton Coupling through Dynein-Dependent RhoGEF Inhibition David Meiri, Christopher B. Marshall, Melissa A. Greeve, Bryan Kim, Marc Balan, Fernando Suarez, Chris Bakal, Chuanjin Wu, Jose LaRose, Noah Fine, Mitsuhiko Ikura, and Robert Rottapel

Figure S1. Lfc Is Required for LPA- and Thrombin-Induced Stress Fiber Formation (A) LPA signaling to the actin cytoskeleton requires Lfc expression. Rat2 cells were transfected with three different shRNA sequences targeting Lfc or scrambled control, starved for 72 h then treated with 1µM LPA for 30 min. Stress fibers were induced in cells transfected with scrambled but not Lfc shRNAs. GFP denote cells transfected with Lfc shRNA. (B) Lfc is required for induction of stress fiber assembly by Thrombin. Rat2 cells transfected with constructs encoding scrambled or Lfc targeting shRNA were starved for 72 h then treated with 3u Thrombin for 2 h. Cells were fixed and stained with phalloidin. All bars represent 10μm.

Figure S2. Identification of Tctex-1 as an Lfc-Binding Protein (A) Schematic diagram of the domain structure of wild type Lfc and Δ573Lfc used in yeast two-hybrid analyses. (B) Lfc and Tctex-1 interaction by yeast two-hybrid screening. The EML-C1 library was screened using full-length Lfc as bait. Colonies expressing Lfc and Tctex-1 were able to grow in the absence of histidine. Lamin and 3BP-2 were used a negative controls, while the interaction between SOCS-1 and the c-Kit receptor was used as a positive control. (C) Mapping the Tctex-1 binding site on Lfc. Domain structure of Lfc and deletion mutants used to determine the binding site of Tctex-1 are illustrated and binding of each construct to Tctex-1 is indicated, based on pulldown shown in Figure 2a. (D) In vitro-translated Tctex-1 interacts directly with Lfc and requires amino acids 87-151. 35S-Met His-Lfc, His-Δ87-151Lfc and unlabeled Flag-Tctex1 were synthesized separately by rabbit reticulocyte lysates (input, middle and right panels) and incubation mixtures were prepared as denoted. Flag-Tctex-1 immune complexes were separated by 5%-15% Bis-Tris PAGE and proteins detected by autoradiography (left). Input Flag-Tctex-1 and Flag immunoprecipitates were immunoblotted with anti-Flag antibody (right panel).

Figure S3. Role for Tctex-1 in Regulation of Stress Fiber and Focal Adhesions (A-C) Assembly of stress fibers and focal adhesions is suppressed by Tctex-1-overexpression. Rat2 cells stably expressing eGFP or eGFP-Tctex-1 were starved for 48 h then treated with or without 1 µM LPA for 30 min or 3 U/mL Thrombin for 2 h. Fixed cells were stained with phalloidin (A) and anti-vinculin (B). Bars represent 10 µm. (C). Quantification of vinculin-staining foci in cells expressing moderate levels of eGFP or eGFP-Tctex-1. Mean number of foci from 10-20 cells were counted for each construct. , n = 3, *p = 0.096, **p = 0.041, for total number of foci. (D) Tctex-1 expression is required for proper actin stress fiber organization. Rat2 cells growing in growth media were transfected with scrambled shRNA or Tctex-1 targeting shRNA constructs for 72 h, fixed and stained for F-actin (phalloidin). Bars represent 10 µm. Higher magnification views of the boxes depicted in the upper panels are illustrated in the lower panels. Bars represent 5 µm.

Figure S4. Overexpression of Bovine Tctex-1 Rescues the Effects of Tctex-1 shRNA on Stress Fiber Organization Rat2 cells were transfected with Tctex-1 shRNAs or scrambled control and either pCMV-Flag vector or Flag-tagged bovine Tctex-1. Cells were starved for 72h then treated with 3 U/mL Thrombin for 2 h prior to fixation. Cells were stained with phalloidin and eGFP was used as a marker for transfected cells. Chevrons indicate transfected cells.

Figure S5. Detection of GEF Activities in Cell Extracts by Real-Time NMR (A) Nucleotide exchange curves indicating the fraction of RhoA bound to GDP versus time, determined using the heights of nine pairs of peaks (black, intrinsic exchange; green, in the presence of lysate prepared from control HEK293 cells (21 μg of total protein); red, lysate from HEK293 overexpressing flag-Lfc (23 μg); blue, HEK293 lysate (22.5 μg) overexpresing a flag-Lfc mutant (T247F) predicted to impair exchange activity). (B) Nucleotide exchange rates derived by fitting curves in a to an exponential decay function. (C) The exchange activity of PDZRhoGEF is not inhibited by Tctex-1. Nucleotide exchange curves in the presence of lysates from HEK293 cells overexpressing PDZRhoGEF (black) or coexpressing PDZRhoGEF and Tctex-1 (blue). (D) Lfc does not increase Rac-1 nucleotide exchange rate. Nucleotide exchange curves indicating the fraction of Rac1 bound to GDP versus time, determined using the heights of nine pairs of peaks: black, intrinsic exchange; green, lysate from HEK293 overexpressing GFP; red, lysate from HEK293 overexpressing Lfc-eGFP(LfcGFP); yellow, HEK293 lysate coexpresing Lfc-eGFP(LfcGFP) and Tctex-1. (e-g) rTctex-1 does not inhibit rLfc in vitro. (E) Full-length Lfc was recombinantly expressed in Drosophila S2 cells while Tctex-1 was recombinantly expressed in E. coli cells. Co-immunoprecipitation was carried out in NMR buffer using anti-Lfc antibody and Western blotted with anti-Lfc and anti-Tctex-1 antibodies. The total protein levels of Tctex-1 in the whole sample (Input, lower panel) were also analyzed. (F) RhoA nucleotide exchange rates mediated by purified recombinant Lfc (rLfc) in the presence or absence of purified recombinant Tctex-1 (rTctex-1). Error bars represent standard deviation of the fraction GDP reported by ten residues. (G) Nucleotide exchange rates in the presence of lysates from HEK293 cells expressing Lfc-GFP in the absence (red) or presence (green) of purified recombinant Tctex-1 protein. Error bars represent standard deviation of the fraction GDP reported by ten residues.

Figure S6. Identification of the Tctex-1 Binding Site on Lfc (A) 1H-15N HSQC spectrum of 15N-Lfc(133-161) in NMR buffer (50mM Tris-HCl pH7.0, 100mM KCl, 2mM DTT, 10% D20, and 0.01% NaN3) at 220C, with assignments of each backbone amide resonance. GST indicates peaks from vector-derived residues remaining after thrombin cleavage. (B) Spectral perturbation of 15N-Lfc (133-161) by titration with unlabeled Tctex-1. 1H-15N HSQC spectra of Lfc(133-161) collected in the presence of [Tctex-1] at molar ratios of 0 (black), 0.05 (green), 0.1 (blue), and 0.5 (red). Strongly perturbed resonances are labeled with assignments, and arrows indicate resonances that exhibited modest chemical shift changes with increasing concentration of Tctex-1. (C) Change in Lfc(133-161) peak intensities upon titration with Tctex-1 (from the spectra in B). (D) 1H-15N HSQC spectra of Lfc(133-161) in the absence (black) and presence (red) of 2.5-molar excess Tctex-1. Arrows indicate Tctex-1-induced chemical shift changes. (E) Absolute value of chemical shift changes {(∆1H)2+(∆15N/6.5)2}1/2 plotted by Lfc residues 133-161. Yellow regions indicate residues whose resonances are extensively broadened by addition of Tctex-1. (F) Change in Lfc(133-161) peak intensities upon titration with Tctex-1. 1H-15N HSQC spectra of 15N-Lfc(133-161) were collected in the presence of Tctex-1 at molar ratios of 0.2 (blue), 0.4 (green), 0.8 (magenta), and peak heights were normalized to free Lfc(133-161).

Figure S7. Mapping the DIC and Lfc Binding Surfaces on Tctex-1 (A) 1H-15N HSQC spectra of 15N-labeled Tctex-1 in the absence (black) and presence of a 2-fold molar excess of unlabeled DIC(131-143) (red). (B) 1H-15N HSQC spectra of 15N-labeled Tctex-1 in the absence (black) and presence of a 2-fold molar excess of unlabeled Lfc(133-161) (green). For both (A) and (B), arrows indicate chemical shift changes of Tctex-1 resonances upon addition of peptides. (c-h) 1H-15N HSQC spectra showing select Tctex-1 resonances in the free (black), DIC-bound (red), and Lfc-bound (green) forms. (C-E) Resonances selectively perturbed by DIC (Q41, S81, and R96). (F-H) Resonances selectively perturbed by Lfc. (T10, G58, and I113). (I) Measured chemical shift changes (in ppm) plotted by Tctex-1 residue number induced by DIC (top) and Lfc (bottom), represented as {(∆1H)2+(∆15N/6.5)

2}1/2. Purple bars indicate resonances exhibiting extensive peak broadening due to chemical exchange and gray bars indicate that chemical shift changes could not be measured. Tctex-1 secondary structure is shown on top. Helix 1 is selectively perturbed by Lfc but not by DIC (red bar). (J and K) Determination of Kd for Lfc133-161 or DIC131-143 binding to Tctex-1. (J) Determination of Kd for Lfc133-161 binding to Tctex-1 1H-15N HSQC spectra were collected as 15N-Tctex-1 (200µM) was titrated with increasing amounts of Lfc133-161 peptide: black, 0µM; red, 100µM; magenta, 200µM; yellow, 300µM; green, 400µM; cyan, 500µM; blue, 600µM. Four well-resolved peaks are shown as examples. The normalized chemical shift changes ([Δ1H2 / (Δ15N/6.5)2]0.5) of twelve peaks were plotted against Lfc concentration (right panel). Error bars indicate standard deviation of the chemical shift change reported by the twelve peaks. The data was fit to the Hill equation, yielding a Kd value of 80 µM and a Hill coefficient of 2.3. (K) Determination of Kd for DIC131-143 binding to Tctex-1. 1H-15N HSQC spectra were collected as 15N-Tctex-1 (200µM) was titrated with increasing amounts of DIC131-143 peptide, as described for panel j. The data was fit to the Hill equation, yielding a Kd value of 70 µM and a Hill coefficient of 1.3.

Supplemental Experimental Procedures Derivation of Lfc knockout mice: A targeting construct was designed to insert a loxP

site upstream of exon2, and a loxP-flanked neomycin resistance cassette (in

reverse orientation) downstream of exon2 of the Lfc gene. The construct was

electroporated into the E14K embryonic stem cell (ES) cell line. Correctly targeted ES

cells were injected into recipient blastocysts and chimeric mice were bred to C57BL/6

females to establish the colony. The Lfc flox mice were then bred with CMV-Cre mice.

The resulting mice lacking both exon 2 and the floxed neo cassette were selectively bred

to remove the CMV-Cre transgene. Heterozygous mice were backcrossed for at least 4

generations and then bred together to generate homozygous mice.

Expression constructs. Full-length Lfc (accession no. AF177032) was cloned into the

pFlag-CMV2 vector (Sigma). cDNAs for all full-length and truncated versions of Lfc and

Δ87-151Lfc were cloned into pcDNA3.1(-)His/Myc vector (Invitrogen). eGFP-tagged

Lfc and Tctex-1 were constructed by cloning full-length Lfc or Tctex-1 (accession no.

NM_174620) into peGFP-C1 (Invitrogen). Lfc, Δ151Lfc and Tctex-1 were cloned into

the BglII/AgeI and BglII/EagI sites of pCMV-HA-VC155 and pCMV-HAVN173,

respectively. Lfc shRNA constructs were prepared by cloning the following hairpin

sequences into the BglII and HindIII restriction sites of pG-SHIN2; Lfc shRNA 1:

5’-

GATCCCCAACCTTCAATGGCTCCATTGAACTTCAAGAGAGTTCAATGGAGCC

ATTGAAGGTTTTTT-3’ and 5’-

AGCTAAAAAAACCTTCAATGGCTCCATTGAACTCTCTTGAAGTTCAATGGAG

CCATTGAAGGTGGG-3’, Lfc shRNA 2: 5’-

GATCCCCCTGTAGAGCAGACTCAGATTTCAAGAGAATCTGAGTCTGCTCTAC

AGTTTTT-3’ and 5’-

AGCTAAAAACTGTAGAGCAGACTCAGATTCTCTTGAAATCTGAGTCTGCTCTA

CAGGGG-3’, Lfc shRNA 3: 5’-

GATCCCCGGGCTAGTAAAGGAGTTGTTTCAAGAGAACAACTCCTTTACTAGC

CCTTTTT-3’ and 5’-

AGCTAAAAAGGGCTAGTAAAGGAGTTGTTCTCTTGAAACAACTCCTTTACTA

GCCCGGG-3’. Tctex-1 shRNA constructs were constructed using sequences published 2

previously [1] by cloning the following hairpins into pG-SHIN2 as described above;

Tctex-1 1: 5’-

GATCCCCGTCAACCAGTGGACCACTATTCAAGAGATAGTGGTCCACTGGTTG

ACTTTTT-3’ and 5’-

AGCTAAAAAGTCAACCAGTGGACCACTATCTCTTGAATAGTGGTCCACTGGT

TGACGGG-3’, Tctex-1 2: 5’-

GATCCCCGGTTACACACCGCAAGTTCTTCAAGAGAGAACTTGCGGTGTGTAA

CCTTTTT-3’ and 5’-

AGCTAAAAAGGTTACACACCGCAAGTTCTCTCTTGAAGAACTTGCGGTGTGT

AACCGGG-3’. A scrambled hairpin-expressing construct was created using the

following sequences: 5’-

GATCCCCGGTGAAGTACCGCTAAGGATTCAAGAGATCCTTAGCGGTACTTCA

CCTTTTT-3’ and 5’-

AGCTAAAAAGGTGAAGTACCGCTAAGGATCTCTTGAATCCTTAGCGGTACTT

CACCGGG-3’. pSHIRAZ constructs expressing shRNA sequences identical to those

described above were created by excising eGFP and cloning DsRed2 into the AgeI and

NotI sites of pG-SHIN2. Lfc and was cloned into the BglII and AgeI sites and Tctex-1

was cloned into the BglII and EcoRV sites of pCMV-HA-VN173/VC155-tubulin for

BiFC analysis. pCMV-Flag Tctex-1 and pG-SHIN2 were kind gifts from Drs C. H. Sung

(Cornell University) and A. Wilde (University of Toronto), respectively. pCMV-HA-

VN173-tubulin and pCMV-HA–VC155-tubulin constructs were obtained from Dr J.

DeLuca (Colorado State University).

Cell culture and transfection. Murine embryonic fibroblasts (MEFs) derived from Lfc-/-

embryos or wild type litter mates, HEK293T and Rat2 cells were cultured in Dulbecco's

modified Eagle's medium (DMEM, Life Technologies Inc.) supplemented with 10% FBS

(HyClone). MEFs and Rat2 cells were transfected using Effectene (QIAGEN), and

HEK293T using Polyfect, according to the manufacturer's instructions. Stable eGFP and

eGFP-Tctex-1 expressing Rat2 cells were established by culturing transfected cells in

selection media (500 g/mL G418) and isolating positive clones by fluorescence

activated cell sorting (FACS). All cultures were maintained in a 5% CO2 environment at

37C. For cell spreading and attachment analyses cells were propagated at low passage

number in the presence of DMEM with 10% FBS. For cell spreading analyses, cells were

re-plated at a density of 100,000 cells per 6-well dish and grown for another 48 hours.

For the attachment analyses, MEFs were re-plated at a density of 300,000 cells per 10cm

dish and cultured for 0.5, 2, 6 and 10 h. At each time point, attached cells were counted

following trypsinization and averaged over four independent experiments

Statistical analyses. Values are expressed as means SD. Paired Student’s t-tests

(Kirkman, 2006) were performed to determine statistical significance between samples.

Experiments were performed at least three times and means with p < 0.05 were

considered statistically significant.

Immunofluorescence imaging. Cells grown on glass coverslips were treated as indicated

in the corresponding figure legends and fixed with 4% paraformaldehyde for ten minutes,

washed three times with phosphate buffered solution (PBS) and permeabilized with 0.1%

Triton X-100 for 5 mins. The coverslips were blocked with 0.5% w/v bovine serum

albumin (BSA) in PBS for 1 hr at room temperature and incubated with primary antibody

(anti-DYNLT1 1:400, sheep anti-Lfc 1:150, α-tubulin 1:300, α-Vinculin 1:400) or Texas

Red phalloidin (1:400) in 0.5% BSA/PBS at 37C for 30 min or at 4C overnight.

Coverslips were washed three times with PBS and incubated with secondary antibody

(1:500) at 37C for 1 hr. For double labeling, slides were stained sequentially with

primary and secondary antibodies at 37C for 30 min, followed by DAPI (Molecular

Probes, Invitrogen) to stain nuclei. Slides were mounted using GelTol mounting medium

(Shandon Immunon, Thermo Electron Corporation).

Confocal imaging was performed with an Olympus IX81 inverted microscope using a

60x zoom x3(1.4 NA; PlanApo, Nikon) objective, and FluoView software (Olympus,

Tokyo, Japan). Resolution was 512x512 with 12 bits/pixel. The following excitation

wavelengths were used for GFP (473 nm), Texas Red (559 nm) and for DAPI or Pacific

Blue (405 nm), respectively. All images in each set of experiments were acquired with

the same microscope sensitivity settings. All images compared within each figure panel

were acquired on the same day, with identical staining conditions, gain and contrast

setting, and same magnification (except figures 2b,e). All statistical analyses were

derived from 60 or more images from three independent experiments for each treatment

condition.

NMR-based GEF assay. To measure GEF activity in lysates of mammalian cells we

adapted our recently developed real-time NMR-based assay (Gasmi-Seabrook et al.,

2010; Marshall et al., 2009). This assay monitors the heights of 15N -1H HSQC peaks of 15NRhoA protein that are specific to either the GDP-bound or GTP-bound form. The total

GEF activity in HEK293T cell lysates was measured as follows. HEK293T cells were

harvested from 6 cm plates in a minimal volume of lysis buffer (150 μl of 1% Triton-X,

10% glycerol, 50 mM HEPES pH 7.5, and Complete Protease Inhibitor cocktail (Roche)),

yielding total protein concentrations of 10 ± 4 μg/μl. Nucleotide exchange assays were

carried out using a Bruker 600 MHz NMR spectrometer equipped with a 1.7 mm

microcryoprobe, which requires a sample volume of only 35 µl. To measure nucleotide

exchange, 2 mM GTPγS and 3.5 µl cleared lysate were added to a 35 µl sample of 0.2

mM 15N RhoA-GDP (residues 1-181) in NMR buffer (20 mM HEPES, 100 mM NaCl, 5

mM MgCl2, 2 mM Tris (2-carboxyethyl) phosphine (TCEP), 10% D2O, pH7). To

compare endogenous GEF activity in HEK293 cells to cells overexpressing Lfc, the

amount of total cellular protein (20 µg) was standardized using the Bradford assay.

Intrinsic RhoA nucleotide exchange was measured with the addition of lysis buffer only.

Nucleotide exchange was monitored by collecting successive 1H-15N-HSQC spectra at

20oC using 4 or 8 scans (10 or 20 min / spectrum), depending on the reaction rate. Ten

pairs of GDP/GTPS-specific peaks (R5, V9, Q29, I46, A56, S73, Y74, D87, W158,

T163) were used to evaluate the fraction of GDP-bound RhoA present at each time point

and the data was fitted to a single-phase exponential decay function to obtain the

exchange rate as described previously (Gasmi-Seabrook et al., 2010). To investigate the

effect of Tctex-1 on Lfc GEF activity, wild type Lfc-eGFP, LfcΔ87-151-eGFP or eGFP

were expressed alone or with Flag-Tctex-1. The amount of Lfc added to each assay was

normalized according to the eGFP fluorescence of the lysate as measured by a Shimadzu

RF-5301PC spectrofluorophotometer using excitation and emission wavelengths of 488

nm and 509 nm, respectively. Protein expression was verified by Western blotting using

sheep α-Lfc and mouse α-Tctex-1 (Sigma) antibodies. Experiments with mutants of

Tctex-1 and Lfc were performed as described above. D-AKAP-1 RII-binding domain

peptide was co-expressed with Lfc and Tctex-1 to probe the role of PKA. Recombinant,

purified Tctex-1 was added to a concentration of 0.22 mM to a lysate from cells

overexpressing Lfc-GFP, and GEF activity was compared to that of the lysate alone. In

certain experiments, HEK293 cells overexpressing Lfc-eGFP or Lfc-eGFP/Tctex-1 were

treated with drugs before harvesting as follows: 20 μM nocodazole for 10 min, 30 μM

H89 for 30 min, 5 μM IPA3 for 30 min, or DMSO. As a control for specificity, Rac1

nucleotide exchange assays were performed with Rac1 (1-178, C178S) and data was

analyzed using eight pairs of previously assigned peaks (Bouguet-Bonnet and Buck,

2006; Thapar et al., 2003).

Yeast 2-hybrid assays. Assays were performed essentially as previously described (De

Sepulveda et al., 1999; Meiri et al., 2009). Constructs encoding full-length Lfc or the Lfc

C-terminus (aa 574-985) were cloned into the pBTM116 vector and used to screen an

EML-C1 cDNA library for Lfc-interacting proteins.

In vitro protein synthesis. His-Lfc, His-Δ87-151Lfc and Flag-Tctex-1 were synthesized

separately in vitro using the T7 Quick Coupled Transcription/Translation System

(Promega) according to the manufacturer's instructions. Synthesized proteins were

combined in lysis buffer and Flag-Tctex-1 was immunoprecipitated as described above.

Image analysis. Cells were incubated with CellTracker™ Red CMTPX for 30 minutes

and then incubated with fresh medium for an additional 30 minutes. Cells were fixed and

incubated with DAPI for imaging of nuclei. Image analysis for co-localization and cell

size was performed with the cell profiler v2.0 1 using “MeasureObjectSizeShape” for

size measurements and the “MeasureCorrelation” module for correlation. Focal adhesion

counts were performed using ImageJ v1.4q 2 (http://rsb.info.nih.gov/ij/index.html). Vinculin

stained cell images were transformed to 16 bits and the background was subtracted using

the “background subtractor” plugin 3. Then they were transformed into binary images

and focal adhesions were identified using the find maxima tool (Noise tolerance of 20).

Antibodies. Rabbit anti-DYNLT1 antibody (anti-Tctex-1) was purchased from Proteintec

(11954-1-ap). Polyclonal sheep anti-Lfc antibodies were raised as described previously

(Bakel et al., 2005). Mouse anti-Vinculin antibody (anti-Vinculin) was purchased from

Sigma (V9131). Mouse monoclonal antibody directed against bovine α-tubulin (236-

10501, A-11126), Pacific Blue anti-mouse IgG (P31582), Texas Red anti-rabbit IgG (T-

2767), Texas Red anti-mouse IgG (T-862), Texas Red phalloidin (T7471), Alexa Fluor

350 phalloidin (A22281) and Alexa Fluor 594 donkey anti-sheep IgG (A-11016) were

obtained from Invitrogen. Western blotting and immunofluorescence was performed

using the following primary antibodies; anti-Flag (M2, F3165, Sigma), anti-His (H15, sc-

803), anti-GST (B-14, sc-138), anti-phospho-MLC (3671), and anti-HA (H6908, Sigma).

HRP-conjugated anti-mouse or anti-rabbit secondary antibodies were from GE

Healthcare.

Full-length Lfc expression and purification protocol. Drosophila S2 cells were used to

express soluble recombinant full-length Lfc. Functional full-length Lfc was obtained by

extensive protein purification. The Lfc gene was cloned into a pMTTEVA vector with an

N-terminal Immunoglobulin-binding protein (BiP) signal sequence, which facilitates

secretion of the expressed protein into the medium. Drosophila S2 cells stably expressing

Lfc were established. The S2 cells were gradually scaled up to 500mL culture volume in

serum-free media and protein expression was induced by addition of 6 μM CdCl2 when

the cell density reached 5 x 106 cells/mL. Cells were removed from the medium by

centrifugation after 4 days of induction. After addition of protease inhibitors, the medium

was incubated with Ni2+-NTA resin to capture His6-tagged Lfc by immobilized metal

affinity chromatography (IMAC) beads (Profinity). His6-tagged Lfc was eluted from the

resin with imidazole and purified by anion-exchange chromatography. Recombinant Lfc

protein was exchanged into a low salt buffer solution at pH 8.0, bound to a HiTrap Q

column and eluted with a linear gradient of 0-0.8 M NaCl. Fractions containing

recombinant Lfc protein were concentrated and further purified by size-exclusion

chromatography (Superdex 200). Fractions containing recombinant Lfc protein were

concentrated and stored in 20mM HEPES pH 8.0, 100mM NaCl, 5mM MgCl2, and 2mM

tris(2-carboxyethyl)phosphine (TCEP).

Recombinant protein production and GST-pulldowns. pGEX-4T3 constructs were

transformed into the Escherichia coli strain BL21(DE3)pLYS-S (Novagen) and protein

synthesis induced by addition of isopropyl 1-thio β-D-galactopyranoside to a final

concentration of 0.1 mM and incubation for 4 h at 370C. Recombinant proteins were

dialyzed with PBS before use. Lysates from HEK293T cells or adult mouse brain were

incubated with 5 μg purified GST-tagged proteins for 1 h followed by glutathione

Sepharose beads for 1 h at 40C.

Cell treatments. Cells were starved for five days in the absence of serum and treated in

DMEM containing 20 mM HEPES and 0.5 mg/mL fatty acid-free BSA (A8806, Sigma).

Lysophosphatidic acid (LPA) obtained from Sigma (7260) was suspended in Hank’s

buffered saline solution containing 0.5 mg/mL fatty acid-free BSA and 20 mM HEPES to

a stock concentration of 1 mM. Bovine Thrombin (605157) and Y-27632 (688000) were

purchased from Calbiochem and reconstituted to a concentration of 1 U/μL and 10 mM,

respectively. Cell permeable C3 endotoxin was obtained from Cytoskeleton (CT04).

Immunoprecipitations and Western blotting. Cells were scraped into ice-cold lysis buffer

(30 mM Tris pH7.5, 150 mM NaCl, 1% Triton X-100, 0.2% sodium deoxycholate, 10

mM NaF, 1 mM Na3VO4 and 1 mM PMSF with Complete Protease Inhibitor cocktail

(Roche) and cleared extracts incubated with protein-G sepharose and appropriate

antibodies for 2 h at 40C. Immunoprecipitates were washed three times with wash buffer

(30 mM Tris pH7.5, 300 mM NaCl, 5 mM NaF and 0.1% Triton X-100), resuspended in

2X sample buffer, boiled and protein complexes resolved by SDS-PAGE before transfer

to PVDF (Imobilon) membranes and immunoblotting.

Supplemental References De Sepulveda, P., Okkenhaug, K., Rose, J.L., Hawley, R.G., Dubreuil, P., and Rottapel, R. (1999). Socs1 binds to multiple signalling proteins and suppresses steel factor-dependent proliferation. The EMBO journal 18, 904-915. Meiri, D., Greeve, M.A., Brunet, A., Finan, D., Wells, C.D., LaRose, J., and Rottapel, R. (2009). Modulation of Rho guanine exchange factor Lfc activity by protein kinase A-mediated phosphorylation. Molecular and cellular biology 29, 5963-5973. Bakal, C.J., Finan, D., LaRose, J., Wells, C.D., Gish, G., Kulkarni, S., DeSepulveda, P., Wilde, A., and Rottapel, R. (2005). The Rho GTP exchange factor Lfc promotes spindle assembly in early mitosis. Proceedings of the National Academy of Sciences of the United States of America 102, 9529-9534. Kirkman, T.W. Statistics to use. http://www.physics.csbsju.edu/stats/ (2006). Bouguet-Bonnet, S., and Buck, M. (2006). 1H, 15N, 13C assignments for the activated form of the small Rho-GTPase Rac1. J Biomol NMR 36 Suppl 1, 51. Thapar, R., Moore, C.D., and Campbell, S.L. (2003). Backbone 1H, 13C, and 15N resonance assignments for the 21 kDa GTPase Rac1 complexed to GDP and Mg2+. J Biomol NMR 27, 87-88.