Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Materials and Methods
3. Materials and Methods
3.1. Population identification
Materials and Methods
Inclusion of sub populations in the present study was done following
consultations with anthropologists. Populations were identified with the attempt of
giving a fair representation of the extensive Indian population diversity.
Identification of populations in different parts of India for blood sample collection
was carried out with the help of trained social workers and community health
workers. Individuals fluent in the local language of the concerned populations were
consulted and involved actively in the study to get maximum authentic information
from the donors and help them to understand the purpose of the present
investigation.
Two panels namely discovery and validation were made keeping Indian
languages, morphological types, population size, religious fold and geography in
mind. Samples for discovery panel were collected on the basis of major linguistic
families/groups [Indo-European (IE), Tibeto-Burman (TB), Dravidian (DR) and
Austro-Asiatic (AA) populations], morphological types (Caucasoids, Mongoloids,
Australoids and Negritos), population size (large, small, isolated), geographical
distribution (east, west, north, north east, south, central), and Hindu religious fold
[four major caste classes viz. Brahmin (priestly class), Kshatriya (warrior class),
Vysya (business class), and Sudra (menial labour class)]. The populations for
validation panel were identified based on geographical zones, linguistic groups,
practice of endogamy, and presence of minority communities from different
religious groups and existence of populations of different sizes (large and small
populations). Populations were categorized as small if their size was <1 million
individuals and large if > 10 million. Major linguistic lineages and morphological
types were also considered as a criterion for sample collection. Blood samples were
drawn from unrelated distinct individuals of Indian sub populations so as to capture
the entire genetic diversity of the population. The term sub population was used for
the small part of or sub division of a population carrying a limited gene pool and
living in a changed environmental circumstances.
The questionnaire containing information regarding name, address, age, sex,
marital information, birth place, ear lobe, eye colour, height, weight, ethnicity, gotra,
marriage pattern, detail about the ancestral movement from one state to another,
parental and maternal family history related to different monogenetic and
27
Materials and Methods
polygenetic diseases, vaccination details, caste/tribe, tobacco chewing and smoking
habits, drinking habits, any medication, adverse reaction to any drug etc. were filled
at the time of blood sample collection.
Populations for discovery panel
A total of 40 samples were collected for composition of discovery panel and
SNP screening within genes C10orf2 and MPG. Forty discovery panel samples were
collected from six geographical zones of India namely east (8 populations), west (6),
north (14), north-east (2), south (7) and central India (3). All the collected samples
were named as discovery SNP panel or dSNP samples. These dSNP samples were
considered as representative samples oflndian population (Table I, Fig. 2).
Populations for validation panel
A total of fifty five (55) sub populations (approximately 2000 DNA samples)
were identified and collected for validation panel of C 1 Oorf2 gene. Validation panel
comprises 31 Indo-European (4 populations from east, 2 from north-east, 7 from
west, 17 from north and 1 from south); 4 Tibeto-Burman (all 4 populations from
north); 12 Dravidian (1 from east, 7 from central and 4 from south) and 8 Austro
Asiatic (3 from east, 1 from north-east, 3 from central and 1 from west) linguistic
sub populations of Indian origin (Table II). For each sub population of validation
panel maximum 46 and minimum 23 samples were collected.
In case ofMPG gene, a total of24 sub populations (approximately 550 DNA
samples) were identified and collected. Validation panel for MPG comprise 15 Indo
European (3 populations from east, 2 from north-east, 5 from west and 5 from
north); 3 Tibeto-Burman (2 from north and 1 from north-east); 4 Dravidian (3 from
south and 1 from central) and 2 Austro-Asiatic (1 from east and 1 from central) sub
populations (Table III). For each sub population of validation panel maximum 23
samples were collected in case ofMPG gene.
Samples for progressive external Ophthalmoplegia
For Association study of gene C10orf2 with Ophthalmoplegia patients were
identified from Sitapur eye hospital and Lucknow city, Lucknow, Uttar Pradesh
28
Materials and Methods
(UP). For PEO patients the questionnaire having general information's like name,
residential address, parents, sex, spouse, family history were recorded. The
symptoms of the disease like ptosis (single eye or both) at which age,
ophthalmoparesis, fundus examination, use of glasses with age of onset, specific
family history of eye disease, blurred vision, generalized fatigue, limitation of eye
movement, 3rd nerve palsy, cataract, age of onset of disease, histopathological
reportJCT/NMR scan etc. living setting and other symptoms (if any) were also
reordered along with few general body symptoms like external muscle pain/exercise
intolerance, palpitation, neurological disorder/sensory ataxic axonal neuropathy,
leodopa responsive parkinsonism, major depression, hypogonadism, progressive gait
disturbance/body balance, deafness etc (for patients details please see Table IV).
3.2. Blood sample collection from Indian sub populations
Prior to sample collection ethical clearance was obtained from the
Institutional Ethics Committee (IEC) following the guidelines of Indian Council of
Medical Research (ICMR) (http://icmr.nic.in). Several field trips were made to
collect samples. Participants were informed in the beginning about the purpose of
the study and data handling. It was also ensured that the participation is entirely
voluntary and no materialistic promises were made to the donors. An informed
written consent (Signed or thumb impressed) from the donors of the samples was
taken before collection of the blood. In case of child, parents consent was taken. A
uniform bar-coded detailed questionnaire was used containing information on
dietary habits, ethnicity, family history of disease and other phenotypic traits of the
donor.
Blood samples (8 ml) were collected by venipuncture and transferred to the
tube containing acid citrate dextrose (ACD) as anticoagulant agent (0.9 ml for each
5 ml of blood) and immediately mixed by inverting the tube (Vacutainers, Medigene
Co. Ltd) several times to prevent clotting. The vacutainers were kept on ice or at
4°C until processed for isolation of DNA. DNA isolation was done within a week of
the sample arrival in the laboratory.
The study protocol for association study was approved by Institutional Ethics
Committee of Central Drug Research Institute, Lucknow, UP. A total of 1 ml of
29
Table 1: Composition of discovery panel for genes C 1 Oorf2 and MPG of different Indian sub
populations with respective IDs.
Linguistics Caste ffribes Discovery ID Geographical location
West Bengal 11~-E-LP Rarhi Brahmin (c) dSNPI
Uttar Pradesh IE-N-LP Kanyakubj Brahmin (c) dSNP2
Himachal Pradesh IE-N-IP Kannet(T) dSNP3
West Bengal IE-E-LP Mahishya (c) dSNP4
Bihar IE-E-LP Bhumihar (c) dSNPS
Rajasthan IE-W-IP Bhil(n dSNP6
Rajasthan IE-W-LP Paliwal brahmin (c) dSNP7
Maharastra IE-W-LP Deshatha Brahmin (c) dSNP8
Rajasthan IE-W-SP Maheswaris (c) dSNP9
Maharastra IE-W-SP CKP(c) dSNPIO
Maharastra IE-W-SP Parsis (c) dSNPII
Maharastra IE-N-LP Koli (T) dSNPI2
Himachal Pradesh IE-N-LP Rajput(c) dSNPI3
Himachal Pradesh IE-N-LP Lohar (c) dSNPI4
West Bengal IE-N-LP Kayastha (c) dSNPIS
Uttar Pradesh IE-N-SP Shia(c) dSNP16
Haryana IE-N-SP Aggrawal (c) dSNP17
Punjab IE-N-SP Ramgaria sikh (c) dSNP18
Punjab IE-N-LP Khatri (c) dSNP19
Himachal Pradesh IE-N-LP Chamar(c) dSNP20
Karnataka IE-S-IP Hakki pikki (T) dSNP21
Maharastra IE-C-LP Chitpawan Brahmin (c) dSNP22
Meghalaya TB-NE-IP Khasi dSNP23
Andhra Pradesh DR-S-IP Kuruman<n dSNP24
Andhra Pradesh DR-S-LP Reddy (c) dSNP25
Karnataka DR-S-LP Gowda(c) dSNP26
Chattisgarh DR-C-LP Bison Hom Maria (c) dSNP27
West Bengal AA-E-IP Santhal (T) dSNP28
Jharkhand AA-E-IP Munda(T) dSNP29
Andaman &. Nicobar AA·S-IP Nicobaries (T) dSNP30
Andarnan &. Nicobar AA-S-IP Ongis(T) dSNP31
Maharastra AA-C-IP Kurku (T) dSNP32
Jharkhand IE-E-LP Chik Baraik (T) dSNP33
Uttar Pradesh IE-N-IP Tharu (T) dSNP34
Uttar Pradesh IE-N-SP Sunni (c) dSNP35
West Bengal IE-N-LP Bagdi (c) dSNP36
Meghalaya IE-NE-IP Hajong(T) dSNP37
West Bengal TB-E-IP Rabha(T) dSNP38
Bihar DR-E-IP Madia(T) dSNP39
Andhra Pradesh DR-S-IP Vaidiki Brahmin (c) dSNP40
Table II: Composition of validation panel for C1 Oorf2 gene of different Indian sub
populations with their respective IDs.
Serial No. Population name Population ID Three letter ID POP I ChikBaraik IE-E-LP CIB ern POP2 Kayastha (Wb) IE-E-LP KWB KWB POP3 Mahishya IE-E-LP MHA MHA POP4 Namsudra IE-NE-LP NSD NSD POPS Oriya Brahmin IE-E-LP ORB ORB POP6 Bhil IE-W-IP BHL BHL POP7 DongriBhil IE-W-IP DBH DBH POPS Deshastha Brahmins IE-W-LP DEB DEB POP9 Kokanastha Brahmins IE-W-LP KOB KOB POPIO Paliwal Brahmin IE-W-LP PAL PAL POPll Patidar IE-W-LP PTD PTD POP12 Siddi IE-W-LP SID SID POP13 Chamar(Hp) IE-N-LP CMR CMR POPI4 Jats IE-N-LP JAT JAT POPIS Kanyakubj Brahmin IE-N-LP KKB KKB POPI6 Kashmiri Pandit IE-N-LP KSP KSP POP17 Kayastha (Up) IE-N-LP KUP KUP POP18 Koli(Hp) IE-N-LP KOL KOL POP19 Rajput (Uttaranchal) IE-N-LP RJU RJU POP20 Rajput(Hp) IE-N-LP RJH RJH POP21 Saryuparin Brahmin IE-N-LP SPB SPB POP22 Khatri IE-N-LP KHT KHT POP23 Aggarwals IE-N-SP AGL AGL POP24 Rarngariah Sikh IE-N-SP RAM RAM POP25 Sunni IE-N-SP SUI SUI POP26 Shia IE-N-SP Sill sm POP27 Syed (Sunni) IE-N-SP_SYD SYD POP28 Hajong IE-NE-IP HJG HJG POP29 Kannet(Hp) IE-N-IP KNT KNT POP30 Tharu IE-N-IP THR THR POP31 Hakkipikki IE-S-IP HPK HPK POP32 Spiti (Hp) TB-N-IP SPT SPT POP33 Buddhists TB-N-SP BUD BUD POP34 Buddhist Heterogenous TB-N-SP BUH BUH POP35 Meitei TB-NE-LP MEl MEl POP36 Madia DR-E-IP MDA MDA POP37 Vaidiki Brahmin DR-S-LP VKB VKB POP38 Paniyan DR-S-IP PNY PNY POP39 Bison Hom Maria DR-C-LP BHM BHM POP40 Gond DR-C-IP GND GND POP41 Chenchu DR-S-IP CNC CNC POP42 Halakki DR-S-IP HLK HLK POP43 Kuruman DR-S-IP KRM KRM POP44 Naidu DR-S-LP NDU NDU POP45 Kallar DR-S-LP KLR KLR POP46 Karnataka Brahmin DR-S-LP KRB KRB POP47 Padaichi DR-S-LP PDC PDC POP48 Santhal AA-E-IP STL STL POP49 Munda AA-E-IP MUN MUN POP SO Juang AA-E-IP JNG JNG POPS I Kolis AA-W-IP KLS KLS POP 52 Khasi AA-NE-IP KHS KHS POP 53 Kurku AA-C-IP KKU KKU POP 54 Sahariya AA-C-IP SHY SHY POPSS Baiga AA-C-IP BAI BAI
Table Ill: Composition of validation panel for MPG gene of different Indian sub populations
with their respective IDs.
Serial No. Population name Population ID Three letter ID POP1 ChikBaraik IE-E-LP CIB CIB POP2 Kayastha (Wb) IE-E-LP KWB KWB POP3 Namsudra IE-NE-LP NSD NSD POP4 Oriya Brahmin IE-E-LP ORB ORB POPS Deshastha Brahmins IE-W-LP DEB DEB POP6 Kokanastha Brahmins IE-W-LP KOB KOB POP7 Paliwal Brahmin IE-W-LP PAL PAL POPS Patidar IE-W-LP PTD PTD POP9 Siddi IE-W-LP SID SID
POP10 Chamar(Hp) IE-N-LP CMR CMR POP 11 Kashmiri Pandit IE-N-LP KSP KSP POP12 Rajput(Hp) IE-N-LP RJH RJH POP13 Shia IE-N-SP SHI SHI POP14 Hajong IE-NE-IP HJG HJG POP15 Tharu IE-N-IP THR THR POP16 Spiti (Hp) TB-N-IP SPT SPT POP17 Buddhists TB-N-SP BUD BUD POP18 Meitei TB-NE-LP MEl MEl POP19 Gond DR-C-IP GND GND POP20 Kuruman DR-S-IP KRM KRM POP21 Naidu DR-S-LP NDU NDU POP22 Kallar DR-S-LP KLR KLR POP23 Juang AA-E-IP JNG JNG POP24 Baiga AA-C-IP BAI BAI
Table IV: Detailed Symptoms of Sporadic Ophthalmoplegia patients, with their symptoms,
age, sex,·marital status, onset of disease and living setting.
Patients Associated Age/sex/marital Onset of Living
of Ophthalmoplegia
symptoms status disease settings
Single eye ptosis, limited eye
16 year, female, At the age of First movement and Rural
symptoms of eye unmarried 6 month
ptosis Opthalmoparesis,
limited eye
Second movement in all 9 year, female, At the age of
Rural gazes except unmarried 2year
abduction, single eye ptosis
Single eye ptosis,
Third diplopia, limited eye 25 year, female, At the age of
Rural movement except married 25
down gaze
Fourth Single right eye 8 year, female,
Since birth Rural ptosis unmarried
Left eye ptosis since birth, eye muscle
Fifth pain, and limited 20 year, male,
Since birth Urban eye movement unmarried
except the down gaze
Materials and Methods
blood samples were collected from Ophthalmoplegia patients in 2 ml acid citrate
dextrose (ACD) buffer collection tubes and stored at 4°C till further use.
3.3. Isolation of DNA
High molecular genomic DNA isolation from blood using salting out procedure
8 ml of venous blood from each human subject was collected in a 10 ml
vacutainer followed by addition of 1.8 ml ACD buffer in order to prevent
coagulation and mixed well. To this 1 volume (10 ml) of ice cold cell lysis buffer or
C1 Buffer (4x) and 3 volumes (30 ml) of ice cold autoclaved distilled water was
added. Suspension was mixed by inverting the tubes several times until it became
translucent and incubated on ice for 10 min. Following incubation, the lysed blood
was centrifuged at 3200 rpm for 15 min at 4°C. The supernatant was discarded in
hypochlorite. 2 ml of ice cold C 1 buffer and 6 ml of ice cold distilled water was
added to the pellet. The pelleted nuclei were resuspended by vortexing and
centrifuged again at 3200 rpm for 15 min at 4°C. The supernatant was discarded in
hypochlorite. Finally 12 ml of nuclei lysis buffer was added to it and mixed well by
brief vortexing. To this 0.8 ml of 10% SDS and 50J.1l of Proteinase-K were added
and incubated at 65°C for 2-3 hours.
After 3 hours of incubation, 4 ml of saturated NaCl (6M) solution was added
and shaken vigorously for 15 sec. and immediately the tubes were spun at 2500 rpm
for 15 min at room temperature. The supernatant was taken and the DNA was
precipitated using two volumes of absolute ethanol kept at room temperature. The
DNA was precipitated by inverting the tubes 10 to 20 times. The precipitated DNA
was transferred to a micro centrifuge tube containing 1.0 ml of 70% ethanol at room
temperature. The tubes were vortexed briefly and centrifuged at 13,000 rpm for 10
min at 4°C. The supernatant was carefully removed without disturbing the pellet.
The pellet was air-dried and resuspended in 0.5 ml of Tris EDTA (TE) buffer (pH
8.0). Finally DNA was dissolved at 65°C for 2 hours and stored at -20°C (Miller et
al., 1988).
Reagents used in salting out procedure
Acid Citrate Dextrose (ACD) as an anti-coagulant
0.48g citric acid, 1.32g sodium acetate, 1.47g glucose, dissolved in water to a final
volume of 100 ml, autoclaved and stored at 4°C
30
Materials and Methods
4X Cell Lysis Buffer (Buffer Cl)
1.28 M Sucrose, 40 mM Tris-Cl, pH 7.5, 20mM MgCh, 4% Triton X- 100
(For 400 ml C1 buffer): Sucrose (M.W. 342.3) -175.25g, 1M Tris. HCl, pH 7.5- 16
ml, MgCh (M.W. 203.31)- 1.626g, Triton- 16 ml mixed and final volume made
upto 400 ml, autoclaved and stored at 4°C
Nuclei Lysis Buffer <NLB)
1 OmM Tris-HCl, 400mM NaCl, 2mM Na2EDTA (pH 8.0)
(For 400 ml NLB): 1M Tris-HCl (pH 8.0)- 4 ml, 5M NaCl- 32 ml, 0.5M EDTA
(pH 8.0) - 1.6 ml mixed and final volume was made upto 400 ml, autoclaved and
stored at room temperature.
Proteinase K solution (20mglml)
20mg of Proteinase K was dissolved in autoclaved distilled water. 200).11 was aliquoted
in eppendorfs and stored at -20°C for further use.
10%SDS
For 100 ml of SDS, 1 Og of SDS was dissolved in autoclaved distilled water and final
volume made upto 100 ml and stored at room temperature.
6M Saturated NaCl solution
For 100 ml of 6M NaCl, 35.064g NaCl was dissolved in distilled water and final
volume made upto 100 ml.
Alcohol for Precipitation
70% ethanol used for DNA precipitation at room temperature.
Tris EDTA (TE) Buffer
(For 200 ml): 10mM Tris (pH 8.0) and 1mM EDTA (pH 8.0) mixed, autoclaved and
stored at 4°C.
Mitochondrial DNA isolation
The blood (1 ml) was collected from patients diagnosed with
Ophthalmoplegia. It was centrifuged at 600 x g for 5 min at 4° C. Cells were washed 0
with 5-l 0 ml of ice-cold PBS buffer and centrifuged at 600 x g for 5 min at 4 C
following removal of supernatant. The cells were resuspended in 1.0 ml of 1X CEB
and incubated on ice for 10 min. Homogenate of cells were transferred to a 1.5 ml
tube, and centrifuged at 700 x g for 10 min at 4°C. This step was able to remove
nuclei and intact cells (in pellet). Supernatant was transferred to a fresh 1.5 ml tube,
31
Materials and Methods
and centrifuge at 10,000 x g for 30 min at 4°C. The supernatant was discarded and
the remaining pellet resuspended in 1 ml lX cytosol extraction buffer (CEB).
Following centrifugation at 10000 x g for 30 min at 4°C and isolated mitochondria
were recovered as the pellet. The isolated mitochondria were lysed in 40J.Ll of the
mitochondrial lysis buffer and kept on ice for 10 min. Subsequently the enzyme B
mix 5J.1.l was added to the sample tube and incubated at 50°C for 60 min, or until the
solution became clear. Following incubation the sample was precipitated with lOOJ!l
absolute ethanol at -20°C for 10 min. After precipitation the sample was centrifuged
in micro centrifuge at top speed for 5 min at RT and supernatant was removed. The
pellet was isolated mtDNA. The DNA pellet was washed twice with 1 ml of 70%
ethanol followed by removal of trace ethanol using pipette tip. The pellet was air
dried for 5 min and resuspended in 20J.1.l TE buffer and stored at -20°C till future
use.
Reagents used in mtDNA isolation
mtDNA isolation kit was procured from Bio Vision Research Product, CA, USA.
5X cytosol extraction buffer (CEB, 20 ml)
lX cytosolic extraction buffer was prepared by mixing 1 ml of the 5X buffer with 4
ml Milli Q H20.
Enzyme B mix (lyophilized 1 vial)
TE buffer 275J.Ll was added to enzyme B mix, aliquoted and refreezed immediately
at -70 ° C. All the buffers were kept on ice at all times during the experiment.
Concentrated wash solution (Isreal Kit Reagents for PCR product purification)
Before the first use, 22.5 ml of sterile Milli-Q water was added to 2.5 ml of
concentrate followed by 25 ml of absolute ethanol and was stored at -20°C.
PEG/Sodium acetate solution
After weighing 13.3g of PEGSOOO, it was dissolved in sterile water. Additional
333.0J.Ll of 1M MgCh and 10.0 ml of 3M Sodium acetate (pH 4.8) was added to the
PEG solution and final volume was made up to 50 ml with Milli-Q water.
Lambda DNA dilution
lOJ.lg/ml ofLambda DNA was diluted to a working concentration of lJ.Lg/ml.
32
Materials and Methods
Buffer PE (Concentrate)
PE buffer (wash buffer) 6 ml concentrates were diluted with 24 ml absolute alcohol to
make it as working stock.
Nuclease free water
Molecular grade water (nuclease free) was procured from Sigma and aliquots 0
prepared and stored at -20 C for further use during PCR set up or primer dilution.
3.4. Primer designing
Primers for C10orf2 and MPG genes
Primers for C 1 Oorf2 and MPG genes were designed using PrimerSelect
module of Lasergene v6.0 software (DNA STAR ™) and synthesized at The Centre
for Genomic Application {TCGA), Delhi and Sigma. Total 10 pair primers were
used for the amplification of C 1 Oorf2 and MPG genes (Table V). The nucleotide
sequences of the genes were downloaded from NCBI websites and these sequences
were used as templates sequence. Following primer characteristics as well as default
settings were used during primer design in PrimerSelect module of DNA STAR.
Primer lengths of minimum 17 and maximum 24 bp, Tm of the primers based on the
template(s) range (55-60°C) were used during primer design. Primer sequences were
checked for their self-complementary properties and avoided. Primers were also
checked for false priming, hairpins or dimers, self-dimer.
Primers for mtDNA
The primers for amplification of mitochondrial tRNA genes (tRNA-Leu,
tRNA-Asn and TRNL2) were used as described in Rieder et al., 1998. Three pair of
primers (tRNA-Leu, tRNA-Asn and tRNA-Leu TRNL2) were used for amplification
of mitochondrial tRNA genes (Rieder et al., 1998; Table VI). All the primer pairs
were procured from Sigma with PAGE purified specification.
The primers for mitochondrial tRNA genes were chosen in order to achieve
maximum coverage at both sides of the selected genes. Consequently, primers of
tRNA-Leu amplified RNR2 and ND1 genes. Similarly, primers for tRNA-Asn
amplified tRNA-Ala, tRNA-Trp, tRNA-Cys, tRNA-Try and ND4 gene; while
primers oftRNA-Leu TRNL2 amplified tRNA-His, tRNA-Ser and ND5 genes.
33
Table V: Primers for amplification of exonic regions of genes C10orf2 and MPG.
Primer sequence Ex on Amplicons Product length Gene Ex on Tm (bp) '
[S' .................................. 3') Start End Start End i
lA FP: 5'GGGGCCAGGGAGGGGTITCT3' 65.3 1181 1889 1049 RP: 5'GGCAGGGGGTAAGCAGGTCGTT3' 65.75
1525 477
ClOorfl lBb FP: 5'GGCTGCCTACCCTTACTCTACCC3' 65.64
1181 1889 1476 1957 RP: 5' AACCCACTTGCTTTTGTCACCTG3' 60.43
482
2 FP:5' AGATCAGGTGACAAAACAAGTGG3' 60.63
2080 2320 1931 RP:5'GGATATGTCTGGGAAAGCAAGGTG3' 62.3
2365 435
3 FP: 5'GAACTCCCCCATCTCCTTAG3' 49.3 RP: 5'TGTGGACAGCTGCTCGTGACC3' 58.4 2872 2979 2407 2974 568
4 FP:5'GGTTGTGGTAGTITGTGGGGAGAT3' 62.3
3305 3446 3204 3648 RP:5'CTGGGGGACAAGAACAGCAT AAGA3' 62.3
445
s FP:5' ACCCAGCCCCTCTCCCCATTCTTA3' 65.63 5626 5946 5514 5964
451 RP:5' ACCAGCTCTGCACGGCCTTCACTT3' 65.63
1 FP:5' AAAGGGCAGGGCTCCAGAAACCAG-3' 65.63
2280 2318 2006 RP:-5'CCCCATCCGTCGGCAAAACT-3' 2424 419
61.30 MPG
2 FP:5'CCGACGGATGGGGCAAAAg-3' 60.56 2412 2687 2412 2896 485 RP:-5'TGGGCAAGCAGCACTGACAATCT-3' 62.17 ...
3 FP: 5'CTGAGCTGGGGAGATGAGGT3' 61.30 5981 6185 5889 6489 RP: 5'CCGAAGTGCTGGGATGACA3' 58.45
541
4 FP:5'CAGGGGAAGCCAGGTGGAAAGGAACTGA-3' 69.16
8330 8706 8012 8609 598 RP:-5'CAGGGGACCACGCTCCAGCCATACAGC-3' 71.97
Table VI: Primers for mitochondrial gene amplification.
Amplicon Primer Product mtDNAgenes Primer sequence (5' •••• .3')
(Start-End) length length
FP:TACTTCACAAAGCGCCTTCC 20
tRNA-Leu 3230-3304 832
RP:ATGAAGAATAGGGCGAAGGG 20
FP:CTAACCGGCTTTTTGCCC 18 tRNA-Asn 5657-5729 814
RP:ACCTAGAAGGTTGCCTGGCT 20
FP:TATCACTCTCCTACTTACAG 20 tRNA-Leu
12266-12336 866 TRNL2 RP:AGAAGGTTATAATTCCTACG 20
Materials and Methods
3.5. PCR standardization and amplification
All the PCR reactions were performed in 0.2 ml transparent PCR tubes
(Axygen) using thermal cycler (MJ Research). The PCR reagents including PCR
buffer, nucleotide mix (dNTPs) and Taq DNA Polymerase were procured (Promega
and Sigma) and used for the standardization and amplification of the DNA samples.
Gradient PCR reactions were performed for each primer pairs and annealing
temperature was optimized. The annealing temperature for all the exons of the
C10orf2, MPG and mitochondrial tRNA genes (tRNA-Leu, tRNA-Asn and TRNL2)
was 58.3°C.
Reaction components Stock concentration Final concentration Volume
Taq Polymerase Buffer lOX IX 5.01-11
with MgCh (25mM)
Forward Primer (FP) lOOpmol/ 1-11 15pmolllll 3.01-11
Reverse Primer (RP) lOOpmol/ 1-11 15pmolllll 3.01-11
Genomic DNA lOOng/ Ill lng/1-11 1.01-11
dNTPsmix 2mM 2001-lM 1.01-11
Taq DNA Polymerase 3U/lll 0.03U/lll 0.251-11
Sterile water (MQ) - - Up to 501-11
Thermal cycling parameters consisted of 10 min initial denaturation at 95°C
followed by 30-35 cycles of 1min denaturation at 94°C, 1 min annealing at 58°C and
1 min extension at 72°C. Final extension at 72°C for 4 min was allowed before
holding the reaction at 4°C for 30 min. Similar PCR conditions were used for
mitochondrial DNA amplification in tRNA genes namely, tRNA-Leu, tRNA-Asn
and TRNL2. Reaction products were stored at 4°C prior to electrophoresis. TotalS~
of amplified product was mixed with l/5th volume of gel loading buffer (analytical
grade water containing 30% glycerol, 0.25% bromophenol blue, 0.25% xylene
cynole) and resolved on 1.2% agarose gel iii TAE buffer at 80 volts for 2 hour. DNA
markers (100bp, New England Biolabs) were run along with amplified product.
34
Materials and Methods
3.6. PCR product clean up for sequencing
The PCR products were purified using isolation kits and PEG protocol
(Biological Industries, Israel), polyethylene glycol methods or Qiagen MinElute gel
extraction kit.
Gel purification protocol using Israel kit
PCR product was electrophoresed on 2% agarose gel and the DNA band was
excised from ethidium bromide stained gel with a razor using 312nm UV light.
Three volumes of 6M Nai solution per gel slice volume were added to the excised
agarose piece and incubated at 55°C for 5-10 min with occasional mixing till the gel
piece dissolved completely. 6J.Ll of homogeneous glass powder suspension was
added to the agarose: DNA: Nai solution and mixed thoroughly and again incubated
at 55°C for 5-10 min with occasional mixing at interval of 1-2 min. DNA adsorbed
on glass powder suspension was pelleted at maximum speed for 10 sec and the pellet
was washed thrice with 300J.Ll (50 volumes of the glass powder) ofthe wash buffer.
The glass pellet was resuspended in 12-15J.Ll of autoclaved distilled water and
incubated for 10-15 min at 55°C. Following this, the glass powder was pelleted at
maximum speed for 30 sec and supernatant containing the eluted DNA was
transferred to a fresh collection tube.
Polyethylene glycol (PEG) purification protocol
Two volumes of PEG/sodium acetate solution was added to the PCR product
and mixed properly by vortexing and incubated for 10 min at room temperature. The
DNA was pelleted at 3,200 rpm for 30-60 min depending on the amplicon size. The
supernatant was removed by inverting the PCR reaction plate on tissue paper and
centrifuging up to 500 rpm. Pellet was washed twice with two volumes of 70%
ethanol by centrifuging at 3,200 rpm for 10 min. Ethanol was completely removed
and the pellet was air-dried and resuspended in 5-15J.Ll sterile Milli-Q H20.
Gel extraction kit protocol using a micro centrifuge
In case ofmtDNA sequencing, the PCR products oftRNA-Leu, tRNA-Asn and
TRNL2 were eluted from the agarose gel using Qiagen MinElute gel extraction
protocol. The PCR products (amplified DNA fragments) were excised from the
agarose gel with a clean, sharp scalpel and the size of gel slices were minimized by
35
Materials and Methods
removing extra agarose. The gel slices were weighed in a colorless tube and 3
volumes of buffer QG was added to 1 volume of gel (approximately 100 mg or
lOOJll). The gel slices were incubated at 50°C for 10 min to help dissolve the gel,
with intermittent mixing at every 2-3 min.
After complete dissolution of gel slice, the color of the mixture was checked
as yellow (similar to buffer QG without dissolved agarose), which was indicator of
pH 9.5 indicating efficient adsorption of DNA to the membrane. Additionally, 1
gel volume of isopropanol was added to the sample and mixed by inverting the tube
several times. Following isopropanol addition, MinElute columns were placed in a 2
ml collection tube and samples were loaded to facilitate DNA binding. The column
was centrifuged at 13000 rpm for 1min. All the centrifugation steps were done at
13000 rpm at room temperature. The flow through was discarded and 500Jll buffer
QG was dispensed in the MinElute column with the same collection tube. It was
centrifuged at 13000 rpm for 1 min. Flow through was discarded and washed with
750Jll of buffer PE. The flow through was discarded and MinElute column
centrifuged for an additional 1 min. After washing the MinElute columns were
placed into a clean 1.5 ml microcentrifuge tubes and centrifuged at 13000 rpm for 1
min after addition of 10Jll buffer EB (10 mM Tris-Cl, pH 8.5) or water to the center
of the column membrane. The average DNA eluted volume was 9Jll from 1 OJJ.l
elution buffer volume.
3.7. PCR for DNA sequencing
Sequencing was carried out using specific primers on an ABI 3100 capillary
sequencer (Applied Biosystems). Purified PCR product was gel quantitated prior to
sequencing. Briefly, sequencing primer (2pmoVJJ.l) and 50-150ng amplicons were
added to 4J,tl reaction mix, and volume made up to 10J,tl with autoclaved Milli-Q
water as per the Big Dye Terminator kit instructions (version 3.1, Applied
Biosystems). Dilution buffer was composed of 200mM Tris-HCl (pH 9) and 5mM
MgCh. The reaction was carried out for 30 cycles of denaturation at 96°C for 10 sec
followed by annealing for 5 sec and an extension at 60°C for 4 min. The annealing
temperatures were 50°C, 55°C or 60°C depending on the primer utilized for
sequencing.
36
Materials and Methods
Composition of the reaction mix (4JLI)
S. No. Big dye terminator reaction mix (2.5X) SX dilution buffer Milli-Q
I 2~1 ·~ ·~ II ·~I 1.5~1 1.5~1
III 0.5~1 1.75~1 1.75~1
Purification of sequencing products
After sequencing reaction, the products were precipitated using ethanol,
EDTA and sodium acetate to remove unincorporated primers and fluorescent
ddNTPs. Briefly, 2J.tl of 150mM EDTA and lOJ.tl of water were added to lOJ.tl of the
sequencing product and mixed well. To this mix, 2J.tl of 3M sodium acetate (pH 4.6)
and 50J.tl of absolute ethanol were added and incubated for 10 min at room
temperature. The pellets were washed twice with 1 OOJ!l of 70% ethanol by
centrifugation at 4,000 rpm for 5 min. The pellets were air-dried and resuspended in
IOJ.ll of 100% Hi-Di formamide (Applied Biosystems). The tubes were incubated at
94°C for 5 min and snap freezed on ice before loading onto the 3100 Automated
Sequencer (Applied Biosystem).
3.8. Procedure for picogreen estimation of DNA for validation panel
The genotype data used for validation was quantified with the help of
Picogreen estimation. Picogreen Dye is a fluorescent dye specific for dsDNA and
RNA and very sensitive at lower concentration (Singer et al., 1997). Picogreen bind
with dsDNA quantitatively i.e., as we increases the dilution the binding efficiency is
enhanced proportionately.
On the day of the experiment, an aqueous working solution of the Picogreen
reagent was prepared by making 1 :400 dilutions to the cone. solution in IX TE. The
solution was prepared in a plastic container as the reagent may stick to glass
surfaces. Working solutions was protected from light by covering it with foil, as the
Picogreen reagent is susceptible to photo degradation. To get the best result, the
solution was used within few hours of its preparation.
Briefly, a total of 25J.tl of diluted DNA was added into 384 well black plate
followed by addition of 25J!l of the aqueous working solution of Picogreen reagent
37
Materials and Methods
(diluted in 1: 400 ratio) to each well (standard + samples) as shown below. The
volume for diluted DNA and Pi co green dye was 25 J.Ll in each dilution. DNA and dye
were mixed well and incubated for 5 min at room temperature and covered with the
aluminum foil to protect from light. After incubation, samples fluorescence was
measured using a spectrofluoremeter microplate reader (BMG Labtech) at 260nm and
280nm. A standard curve of fluorescence Vs. DNA concentration was drawn for the
range (800pmoiiJ.Ll to 50pmoiiJ.Ll). Regression coefficient values were checked for
the standard, which was more than 0.98. The lambda DNA was used for preparation
of standard, as it was preferable to prepare the standard curve using the double
standard DNA. Essential dilution of the lJ.Lg/J.Ll of lambda DNA (standard DNA) was
done into a 384 well black plate as per the following:
Lambda DNA cone. Lambda DNA (in Jll) Picogreen (1:400)
(in pg/Jll) (in Jll)
800 25 25.0
600 25 25.0
400 25 25.0
200 25 25.0
100 25 25.0
50 25 25.0
00 25 25.0
During serial dilution of the dye, the initial lambda DNA concentration was
lOOOpg/J.Ll in 150J.Ll volume, it was diluted to 800pg/J1l after adding 120J.Ll of
1000pg/J1l DNA to next well and the volume was made upto 150J.Ll in each
successive dilution. Similarly, the 112.5J.Ll DNA sample was transferred to new well
from 800pg/J.Ll DNA well and concentration was made upto 600pg/J1l. Similar
process was continued for dilution upto the last dilution of 50pg/J1l.
38
Materials and Methods
Serial dilution of Picogreen Dye
3.9. SNP validation using Sequenom MassARRAY system
For the bulk of SNP validation, the Sequenom MassARRA Y system
(Applied Biosystem) was used as this system utilizes matrix assisted laser
desorption ionization (MALDI) time-of-flight (TOF) mass spectroscopy (MS)
technology and especially suited for high throughput genotyping (Jurinke et al.,
2002). The SNPs were selected for validation on the basis of their occurrence in
discovery panel, spacing between the markers, heterozygosity, frequency and their
validation status in different populations. The SNPs fulfilling a minimum of 3
criteria were chosen for validation.
The principle of hME assay is based upon the annealing of a MassEXTEND
primer adjacent to the polymorphic site of interest. The addition of a DNA
polymerase, plus a cocktail mixture of nucleotides (dNTPs) and terminators
(ddNTPs), allows extension of the primer through the polymorphic site. The
resultant mass of the primer extension product was then analyzed and used to
determine the sequence of the nucleotides at the polymorphic site. The accuracy of
the determined sequence was maintained through the application of four levels of
stringency i.e.,
(1). Proper hybridization of primers and amplification ofthe target region
(II). The specific hybridization of the MassEXTEND primer in the reaction mixture
39
Materials and Methods
(III). Extension through the polymorphic site and finally
(IV).Correlation between mass of measured primer extension product and calculated
values.
Briefly, primer (oligonucleotide) base extension was combined with MALDI
TOF mass spectrometry in the MassEXTEND assay. In assay a post-PCR primer
extension reaction was carried out in the presence of one or more di-deoxynucleotides
(ddNTPs) resulting in allele specific terminated extension products. Primers were
designed to anneal adjacent to the SNPs of interest. The addition of a DNA
polymerase, plus a cocktail of nucleotides and terminators, allows extension of the
primer through the polymorphic site. The resultant mass of the primer extension
products were then analyzed and used to determine the sequence of the nucleotides at
the polymorphic site. A homozygous genotype leads to one extension product of
defined mass. In heterozygous samples, two products of distinguishable masses were
generated. Process ofhME assay includes following steps:
Template amplification
2~1 of the DNA sample (2.5ng/~l) was added to the wells of a 384 well PCR
plate and then dried at 850C for 15 min in a PCR. A 50nM primer mix (of the forward
and reverse primers) was made from IOO~M stock. 2.5~1 of this primer mix was added
to the DNA containing wells (384 well plate). Again the plate was dried at 850C for 15
min in a thermal cycler. PCR mix was then made as follows:
Reagent Stock Working Volume (for 384 concentration concentration reactions)
HPLC grade water - - 955.9,.11
Red Dye - - 12.0J,11
HotStart Taq polymerase IOX,l5mM IX,l.5mM 120.0J.1l buffer with MgCI2
MgCh 25mM 2mM 96.0J,11
dNTPs 25mM 200J.1M 9.6J.1l
HotStart Taq Polymerase 5units/J.1l 0.07U/reaction 6.5J.1l
2.5 ~I of the PCR Mix was aliquoted to each of the wells of the PCR plate.
The sample plate was sealed with a plate sealing film. PCR reactions were carried
out in a two step reaction as follows:
40
94°C 15 min 94°C 20 sec} 56°C 1 min 10 cycles 72°C 1 min 94°C 20 sec} 56°C 30 sec 35 cycles 72°C 1 min
Materials and Methods
The PCR product was checked on 3% agarose gel and remaining amount of PCR
products was dried at 85°C for 15 min in a PCR machine.
Dephosphorylation of residual amplification nucleotides
Shrimp alkaline phosphatase (SAP) was added to the samples to
dephosphorylate/ neutralize the remaining, unincorporated dNTPs and to prevent
their further incorporation and interference with the primer extension assay. SAP
enzyme cleaves a phosphate from the unincorporated dNTPs, converting them to
ddNTPs and rendering them unavailable for future reaction.
The SAP enzyme solution was prepared as follows with the reagents added
in a serial order:
Reagent Stock concentration Working Volume (for 384 concentration reactions)
HPLC grade water - - . 779.5J1l
HotStart Taq buffer lOX o.sx 42.0J1l
SAP IU/Jtl 0.0440/reaction 18.5J1l
The solution was vortexed for 5sec to ensure proper mixing and then
centrifuged for 10 sec at 5000 rpm. 2JJ.l of SAP enzyme solution was added to the
dry PCR product using the Multimek liquid handler (Beckman). The sample plate
was sealed properly and kept in thermal cycler at the conditions with initial heating
at 3rC for 40 min followed by 85°C for 4 min before holding at 4°C.
37°C 40 min
85°C 4 min
4°C Hold
Homogeneous MassEXTEND (hME) reaction
This reaction generates allele-specific primer extension products that are
generally 1-4 bases longer than the original MassEXTEND primer. The hME primer
mix was prepared ( 400nM) and adjusted as per the multiplex reaction. 1 JJ.l of this
41
Materials and Methods
hME primer mix was added to the PCR product post SAP treatment. The hME mix
was then prepared as follows with the reagents added in a serial order:
Reagents Stock Working Volume (for concentration concentration 384 reactions)
HPLC grade water - - 880!-11
Red Dye - - 9.6!-11
TriMix 2.25mM 20!-'M 21.6!-11
MassEXTEND Enzyme 320/!-11 0.320/rxn 4.8!-11 (Thermo Sequenase)
The MassEXTEND enzyme was kept at -200C till the reaction cocktail was
prepared. 2J.ll of the hME mix was then added to the PCR plate. The plate was
properly sealed with a sealing film and kept in a thermal cycler with following
cycling conditions:
94°C 30 sec
94°C S sec } 20 cycles
S2°C Sse:} 80°C
S cycles Sse
72°C 3 min
4°C Hold
Sample conditioning and transfer
Following the extension reaction, MassEXTEND® clean resin was added to
the reaction to remove extraneous salts that interfere with MALDI-TOF analysis.
l6J.1.l of resin/water solution was added to each well of the sample plate. The
contents of the plate were mixed by repeated aspiration and dispensing (40 times).
The hME reaction product was centrifuged for 3 min at S13g. Furthermore, lSnl of
sample was transferred from the 384 well plate and spotted onto the pad of the 384-
SpectroCHIP bioarray.
Genotype calling and data analysis
The SpectroCHIP was placed into the Sequenom's platform and the mass
and correlating genotype were determined with MassARRA Y R'J"TM software.
42
Materials and Methods
3.10. Sequence alignment
DNA sequences were analyzed with the help of Lasergene v6.0 software
(DNA STAR) to fish out potential SNPs in discovery panel and mutations in case of
mtDNA. The homozygous and heterozygous calls were scored manually after alignment
of the sequences. SeqMan II module of Lasergene was used as an alignment tool,
which provides facilities to assemble two to tens ofthousands of reads into contigs.
Criteria for sequence inclusion into alignment programme
Prior to the assembly of sequences in SeqMan poor quality data vector
sequence and contaminating data from poor sequences were eliminated. Most
importantly, for our sequences we used the data from automated sequencers in the
form of chromatogram file, EditSeq DNA sequence file and .phd files. SeqMan
includes DNASTAR's unique Trace Quality Evaluation system, which evaluates the
quality of the underlying trace data, and then generates the most accurate consensus
sequence possible. Before assembling the sequences, SeqMan's preassembly option
was used in which poor sequencing data in beginning (30-50bp) and end of the
sequence (20-40bp) was trimmed depending on the sequencing quality/poor-quality
data. After assembly of the data, the tabular reports and graphic views were
reviewed to summarize results, which helped us to determine, whether additional
coverage may be needed or not. If coverage seems unsatisfactory, more sequences
were added and reassembled. The alignment view provided us more detailed picture
of the assembly, and allow editing and trimming constituent and consensus
sequences.
Entry order of sequence into the alignment programme
Sequences were assembled in SeqMan module of Lasergene v6.0, in a
sequential order to get the appropriate comparable alignment. Order of sequence
entry into the SeqMan was as follow: - First, entry of the total NCBI contig
sequence or freeze sequence followed by the sequence of the coding region/strand of
DNA on which both forward and reverse primer were designed and finally all the
forward and reverse sequences amplified within all the selected Indian populations
i.e. discovery panel. After alignment of the entire discovery panel sequences (i.e.
forward and reverse sequences) into the alignment project, the conflict base is
considered as potential SNP after its scoring in forward and reverse sequences.
43
Materials and Methods
3.11. Statistical analysis
For genotype data analysis, softwares like GENCOUNT, ALLHET (written
by Sujit Maiti, Center for Population Genetics, Indian Statistical Institute, Kolkata);
MAXLIKI (http://www-fp.mcs.anl.gov/otc/Guide/Blurbs/maxlik.html), DISPAN
(http://mep.bio.psu.edu/resdme.html/downloads/dispan.zip) and CONVERT
(http://www.agriculture.purdue.edu/fnrlhtml/faculty/Rhodes/Students%20and%20St
afflglaubitz/software.html) were used.
Preparation of standard genotype data set for SNPs of gene ClOortl
The genotypic data for four SNPs within the gene C 1 Oorf2 was tabulated in
excel sheet against 55 population and 1597 DNA samples excluding 60 positive
control samples and two negative control samples. The excel sheet was arranged
vertically having POP_ID (Population ID like PI, P2, P3 .... P55); IND_ID
(Individual ID like 1, 2, 3-upto 46) and SNPs reported in the gene C10orf2,
rs3740485 (SNPI), rs3740486 (SNP2), rs3740487 (SNP3) and rs3824783 (SNP4),
in separate column respectively. Each genotype for the particular SNP was filled
vertically and the missing genotype in the data was filled with a sign of interrogation
(?). This was a standard data set for the GENCOUNT, MAXLIKI, ALLHET,
CONVERT and DISPAN softwares used in the present study to analyze C10orf2 in
detail.
Gencount
Gencount calculates genotype frequencies for SNPs. To run the Gencount
programme the data set for C10orf2 was saved as fn.csv, where fn is file name and
csv is comma delimited file type. It gives descriptive frequency table and a file
named INFILE, which was used as input file for MAXLIKI.
Maxlikl
MAXLIKI a computer programme was used to calculate maximum
likelihood estimates of allele frequencies and their standard deviations for biallelic
and co-dominant loci. INFILE of the GENCOUNT was used as an input file for
MAXLIKI programme. MAXLIKl generates two output files called OUTFILE and
OUTFILEI. Both of these files are text files and can be opened under DOS-Edit or
using Notepad/Wordpad. The MAXLIKI output gives total number of
44
Materials and Methods
heterozygous, standard deviation and HW Chi-square. The OUTFILE 1 was used for
DISP AN input.
Allhet
ALLHET was used to test the null hypothesis that allele frequencies at 4-
SNP loci among 41-populations were equal. OUTFILE1 of the MAXLIK1 was used
as input file for ALLHET. To run the programme the input file name, number of
population and SNP loci were filled and resulting file was as ALLHET.txt. The
result was generated in the form of chi square and degree of freedom.
CONY _M_D (Convert_Maxlikl_Dispan)
CONVERT was used to convert the MAXLIK1 file for DISPAN use or to
prepare input file for DISPAN. OUTFILE1 ofMAXLIK1 was used as an input file
for the conversion of the MAXLIK1 to DISPAN. During run of the programme the
inputs information like number of loci, numbers of populations as well as name of
the populations were filled. Finally the output file was DISPAN.dat.
Dis pan
Dispan
downloadable
is a genetic distance and phylogenetic analysis programme,
from http://mep.bio.psu.edu/readme.htmVdownloadsldispan.zip.
DISPAN was used to calculate average heterozygosity and its standard error for
each population under study, genetic diversity (Ht) and its associated parameters Hs
and Gst. Output file of CONY _M_D was used as an input file for running the
DISPAN. The output file of CONV _M_D contains information regarding the
population name, n.o of monomorphic loci, and n.o of alleles in the locus, number of
chromosome sampled, locus name and allelic frequency. For running DISPAN
firstly the programme was started followed by filling the command as: (GNKDST
da-ds -fDISPAN.DAT-g r1000 -s516 -tn -tu) inside the programme. The cases
used in the commands were case sensitive and can be included and excluded
according the need. Here -da: DA distance, -ds: standard genetic distance, -
fDISPAN.DAT: input file -g: Hs, Ht and Gst for each locus, -r1000: Bootstrap tests
(The number after -r is the number of bootstrap replications), -s516: This is seed
number for random number generator which was randomly used (can not be zero). -
tn: NJ tree, -tu: UPGMA tree. After completion of the run the results were obtained
from GNKDST.DST file and interpreted.
45