19
Managing Resistance to Anthelmintics Dr Nick Sangster [email protected]

Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

  • Upload
    buinhan

  • View
    219

  • Download
    1

Embed Size (px)

Citation preview

Page 1: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Managing Resistance to Anthelmintics

Dr Nick [email protected]

Page 2: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

What are the anthelmintics? CLASSESBenzimidazolesLevamisoleMacrocyclic lactones

• Avermectins• Milbemycins

Amino acetonitrile derivativeSpiroindoles(Ops, piperazine, closantel)What is

resistance? Greater frequency of individuals in a population able to

tolerate doses of a compound than in a normal population of the same species.

Efficacy is less that 90% (or 95% in sheep).

Kill or control:Nemathelminthes (roundworms)

Platyhelminthes (flatworms)

Page 3: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Anthelmintic Resistance

R Mechanisms specific to drug class

Appear to be target site related

Mendelian inheritance - chromosomal genes (sexual reproduction)

Parasite species specific

Can infect other hosts within host range eg.

donkeys pasture horses,

goats pasture sheep

Range of resistance mechanisms

Genetic transfer of R factors between bacterial species occurs

Transfer of organisms between host species eg.:

pigs humans

humans dogs

Antimicrobial Resistance

Ivermectin -resistant Trichostrongylus: sheep faeces humans

Tricladendazole-resistant Fasciola: cattle faeces snails water plants humans

Page 4: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Hosts Resistant parasites

SheepGoatsCattle

HaemonchusTeladorsagiaTrichostrongylusOstertagiaCooperiaFasciola

Dogs DirofilariaAncylostoma

HorsesDonkeys

CyathosominaeParascaris

Pigs Oesophagostomum

Camel ?

Page 5: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Resistance in scour worms

% of farms with <95% FECR

Drug BZ LEV ML (IVM) ALL 3 None

NZ(Waghorn et al 2006)

41 24 36 8 36

Spain(Alvarez-Sanchez)

13 35 16 0 -AustraliaPlayfordet al 2013

88 84 25-76 23 rare

Note: in some regions resistance is CRITICAL

Page 6: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Measuring resistance• In vivo

• FECR

• Problems with interpretation

• In vitro• Development of freeliving stages

• But: Time delay, validation

• Molecular• PCR

• Lack of knowledge of mechanisms

CAGACGAAACTTTCTGTATTCAGACGAAACTT*CTGTATTCAGACGAAACTTACTGTATTCAGACGAAACTTTCTGTATTCAGACGAAACTTACTGTATT

Page 7: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

A case study –ivermectin resistance

1980 New drug class with outstanding in potency and spectrum

1990 Outcomes:• Some parasite species are virtually eradicate• In others, eg.Trichostongylus, resistance is rare.• Ostertagia (Teladorsagia) and Haemonchus develop

resistance in 2 to 5 years, IVM-R appears to be a dominant phenomenon.

1995 More potent and persistent chemicals of the same class (eg. moxidectin) followed IVM on to the market - resistance quickly developed to those compounds too.

Page 8: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

To manage resistance we need to understand the risk factors

Factor ExampleWorm biology Presence of R gene at some levelSurvive treatment Underdosing allows marginally R individuals

to surviveLow level daily dosing in horses

High treatmentfrequency

More opportunities for selection

Few organisms in the environment (low refugia)

Most worms in the metapopulation are selected

Activities that allow resistance genes: to be selected and reach the next worm generation

Page 9: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Guide to managing resistanceFactor PrinciplesWorm biology inherent property of the parasite species

Do not import resistance- quarantine treatNot surviving treatment

Give full doses of effective* compoundsOral or injection preferredUse short acting drugs not long acting preps

Reduce treatmentfrequency

Use non chemical control such as:Pasture rotation to prevent reinfectionSelect animals for immunityImprove immunity with nutrition

Organisms in the environment (high refugia)

Use targeted treatment – monitor for infection and treat at thresholdLeave some animals untreatedDo not ‘treat and move’

Intermediate hosts Control other hosts to break life cycle

* Quality, storage, rotation between classes. Prescription

Page 10: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Some approaches• Using mathematical models to understand

• Better diagnosis

• Targeted treatment

• Combination therapy

• Rotational systems, especially for the tropics

• Advice and decision support

Page 11: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Mathematical models

05

1015202530

0 2 4 6 8 10Years

R fr

eque

ncy

(%)

drought

nodrought

• Need information on parasite pop. Dynamics

• Outputs are burdens, resistance frequency etc.

• Can ask ‘What if?’

Sangster and Dobson 2002

Page 12: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Better diagnosis of resistance

0

0.2

0.4

0.6

0.8

1

1.2

-0.5 0.5 1.5 2.5 3.5

susceptible

resistant

log drug concentration

proportion responding

susceptible

resistant

Page 13: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Targeted treatment

Treat when pathology appears

Treat when burden reaches threshold

Page 14: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Combination therapy

-10

0

10

20

30

40

50

60

70

80

0 5 10 15 20

Years

R fr

eque

ncy

(%)

rotation(1,2,1…)

combination

Components: • High efficacy (no resistance)• Independent action • Similar half life• Coadministration

Sangster and Dobson (2002)

Page 15: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Rotational grazing management• In warm and moist environments larvae become infective in 5 days

• In these conditions larvae die in 60 days on pasture

• 15 cells grazed for 4 days - achieves zero transmission

Zero grazing forage systems (Chandrawathani et al 2004)

Page 16: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Advice and decision support

Page 17: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug
Page 18: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

Plenty to chew on:- Better measurement of resistance- Understand the risk factors and minimise them- Lower chemical use (use combinations)- Break the life cycle

Page 19: Managing Resistance to Anthelmintics - OIE: Homerr-asia.oie.int/.../3-03_Sangster_Managing_resistance_to_anthelmintics.pdf · Anthelmintic Resistance R Mechanisms specific to drug

About MLA

Meat and Livestock Australia Ltd (MLA) strives to be the recognised leader in delivering world class research, development and marketing outcomes that benefit Australian cattle, sheep and goat producers.

Working in collaboration with the Australian Government and wider red meat industry, MLA's mission is to deliver value to levy payers by investing in initiatives that contribute to producer profitability, sustainability and global competitiveness.

MLA is a producer owned, not-for-profit organisation and not an industry representative body.