1

M1:02082 — REVISED

Design and Production of Active Cellulosome Chimeras:

SELECTIVE INCORPORATION OF DOCKERIN-CONTAINING ENZYMES INTO

DEFINED FUNCTIONAL COMPLEXES*

Henri-Pierre Fierobe‡, Adva Mechaly§, Chantal Tardif‡¶, Anne Belaich‡,

Raphael Lamed||, Yuval Shoham**, Jean-Pierre Belaich‡¶ and Edward A. Bayer§‡‡

From the ‡Bioénergétique et Ingéniérie des Protéines, Centre National de la Recherche

Scientifique, IBSM-IFR1, 13402 Marseille, France; the §Department of Biological Chemistry,

The Weizmann Institute of Science, Rehovot 76100 Israel; the ¶Université de Provence, 13331

Marseille, France; the ||Department of Molecular Microbiology and Biotechnology, Tel Aviv

University, Ramat Aviv 69978 Israel; and the **Department of Food Engineering and

Biotechnology, and Institute of Catalysis Science and Technology, Technion — Israel Institute of

Technology, Haifa 32000 Israel

‡‡Correspondence to: Edward A. BayerDepartment of Biological ChemistryThe Weizmann Institute of ScienceRehovot 76100 Israel

Tel: (+972) 8-934-2373Fax: (+972) 8-946-8256E-mail: bfbayer@wicc.weizmann.ac.il

Running title: Chimeric cellulosomes

Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on April 4, 2001 as Manuscript M102082200 by guest on A

ugust 21, 2020http://w

ww

.jbc.org/D

ownloaded from

2

Acknowledgments

*The authors are grateful to S. Champ and O. Valette for expert technical assistance. This

work was supported by a contract from the European Commission (Fourth Framework,

Biotechnology Programme, BIO4-97-2303). Grants from the Israel Science Foundation

(administered by the Israel Academy of Sciences and Humanities, Jerusalem) are gratefully

acknowledged. Additional support was provided by the Otto Meyerhof Center for

Biotechnology, established by the Minerva Foundation, (Munich, Germany), and funds from the

Technion-Niedersachsen Cooperation (Hannover, Germany).

1 The abbreviations used are: CBD, cellulose-binding domain; CBM, carbohydrate-binding

module; HPLC, high-performance liquid chromatography; nondenaturing PAGE, polyacrylamide

gel electrophoresis (in the absence of detergent); Rmax, maximum binding capacity of analyte in

RU; RU, resonance units; SPR, surface plasmon resonance

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

3

SUMMARY

Defined chimeric cellulosomes were produced, in which selected enzymes were incorporated in

specific locations within a multi-component complex. The molecular building blocks of this

approach are based on complementary protein modules from the cellulosomes of two clostridia

— Clostridium thermocellum and Clostridium cellulolyticum — wherein cellulolytic enzymes are

incorporated into the complexes by means of high-affinity species-specific cohesin-dockerin

interactions. To construct the desired complexes, a series of chimeric scaffoldins was prepared by

recombinant means. The scaffoldin chimeras were designed to include two cohesin modules from

the different species, optionally connected to a cellulose-binding domain. The two divergent

cohesins exhibited distinct specificities, such that each recognized selectively and bound strongly

to its dockerin counterpart. Using this strategy, appropriate dockerin-containing enzymes could

be assembled, precisely and by design, into a desired complex. Compared to the mixture of free

cellulases, the resultant cellulosome chimeras exhibited enhanced synergistic action on crystalline

cellulose.

Key words: Cellulosome; cellulases; multi-enzyme complex; cohesin domain, scaffoldin

subunit; protein-protein interaction; Clostridium thermocellum; Clostridium cellulolyticum

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

4

INTRODUCTION

Cellulosomes are macromolecular complexes, produced in cellulolytic microorganisms,

designed for efficient degradation of cellulose and associated plant cell wall polysaccharides (1-5).

Cellulosomes are composed of a collection of subunits, each of which comprises a set of

interacting functional modules or domains. A typical cellulosome contains a cellulose-binding

scaffoldin subunit that organizes the other enzymatic components into the complex by virtue of a

high-affinity interaction among complementary domains. Thus, scaffoldin contains a cellulose-

binding domain (CBD) and multiple copies of cohesin domains. Each cohesin interacts

tenaciously with a dockerin domain on an enzyme subunit, thereby incorporating the enzymes

into the complex.

Various reports have indicated that the cohesins of a given cellulosome appear to recognize

all of the dockerin-containing enzymes within the same species (6,7), suggesting that the intra-

species cohesin-dockerin interaction is relatively non-specific. On the other hand, at least for two

clostridial species, C. thermocellum and C. cellulolyticum, the recognition between their cohesins

and dockerins was shown to be species specific (8).

In an earlier review (9), we suggested the use of hybrid forms of cellulosomal components

for improved hydrolysis of cellulosic substrates. We now provide experimental evidence

demonstrating that increased synergistic action among cellulolytic enzymes can be achieved by

selective incorporation into cellulosome-like complexes. To this end, several chimeric scaffoldins

and hybrid enzymes were designed. The chimeric scaffoldins comprised an optional CBD and

two cohesin domains of unlike specificity, one from each clostridial species. Recombinant

enzyme constructs contained a catalytic module together in the same polypeptide chain with a

dockerin domain from either species. The cellulosome chimeras were assembled in vitro, simply

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

5

by combining, in equimolar amounts, three desired components, i.e., the chimeric scaffoldin and

two enzymes. The resultant cellulosome chimeras exhibited enhanced synergy on a

microcrystalline cellulose substrate. This approach is appropriate for incorporating other types

of enzyme and non-enzyme components into complexes for biotechnological application.

EXPERIMENTAL PROCEDURES

Plasmids—Plasmids and encoded proteins are summarized in Figure 1. Positive clones were

verified by DNA sequencing. BL21(DE3) (Novagen, Madison, WI) was used as production host

for pET derivatives.

pJFAc, encoding for a His-tag-containing construct of the native, dockerin-bearing CelA of

C. cellulolyticum, was obtained by inserting the primer 5’-

AGCTAGAACACCACCACCACCACCACTAATA-3’ into a HindIII site (His-tag underlined

in all sequences), located at the 3’ extremity of the coding region of pA2 (10).

To exchange the native C. cellulolyticum CelA dockerin, the dockerin-encoding region of C.

thermocellum CelS was amplified from pQE30-docS (11), using the primers 5’-

GCCGCCTTAGAAGCCAAGACAAGCCCTAGCCCATCTACTAAATTATAC-3’ (AsuII

site in bold) and 5’-

CCCCCCAAGCTTTTAGTGGTGGTGGTGGTGGTGGTTCTTGTACGCCAATGT-3’

(HindIII site, bold). The amplified fragment was ligated into AsuII-HindIII linearized pJFAc

resulting in pJFAt.

pETFt was obtained using the overlap-extension PCR method (12,13). The DNA

encoding the catalytic domain of celF was amplified from pETFc (14,15), using the forward 5'-

GACCTAGGTTGTGCTTCTTCACT-3' (unique AvrII site in bold) and reverse 5'-

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

6

TACTTTATATGTCATGCTCGGGAAGAGTATTGCATAAACTC-3' primers. The DNA

encoding a C. thermocellum dockerin-domain was amplified from pQE30-docS, using the forward

5'-

TTCCCGAGCATGACATATAAAGTACCTGGTACTCCTTCTACTAAATTATACGGCGACG

TC-3' and reverse 5'-GTGCTCGAGGTTCTTGTACGGCAATGTATCTAT-3' primers,

introducing a XhoI site (bold) at the 3’-extremity. The two resultant overlapping fragments

(overlapping regions in italics) were mixed, and a combined fragment was synthesised using the

external primers. The fragment was cloned into AvrII-XhoI-linearized pETFc, thereby generating

pETFt.

pETscaf1 was constructed by PCR amplification of two fragments: the Ct-CBDt-

encoding DNA was amplified from p2CBD3(6) using 5’-

GGAATACCATGGTTCCGTCAGACGGTGTG-3’ (NcoI, bold) and 5‘-

GATCCTTAAGAGAATCTGACGGCGGTA-3’ (AflIII, bold). The Cc-encoding region was

amplified from pETCipC1 (16) using primers 5’-GATTCTCTTAAGGTTACAGTAGG-3’

(AflIII, bold) and 5’-CGGGATCCTTATTGAGTACCAGG-3’ (BamHI, bold). The fragments

were ligated into NcoI-BamHI-linearized pET9d.

pETscaf2 was similarly constructed: The DNA coding for Cc was amplified from

pETCipC1 using primers 5‘-CATGCCATGGGCGATTCTCTTAAAG-3’ (NcoI, bold) and 5’-

CCAGGATCGATCGTTACACTACC-3’ (PvuI, bold), and the CBDt-Ct region from p2CBD3

using primers 5‘-TGGCACGATCGATCCGACCAAGGGAGC-3’ (PvuI, bold) and 5‘-

CGCGGATCCTAATCTCCAACATTTAC-3’ (BamHI, bold).

pETscaf3 was constructed from pETCipC1 and pCBD3. The stop codon in the former

plasmid was eliminated using primers 5’-TGCAGGAAGTCTTCCAGCTGGAGG-3’ (located

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

7

upstream of a unique BamHI site) and 5’-

CCGCCCCTCGAGTTCCTTTGTAGGTTGAGTACC-3’ (XhoI site in bold, located

immediately downstream of the gene). The amplified fragment was ligated into the original

plasmid using the BamHI-XhoI sites, resulting in pETCip1X. Ct-encoding DNA was amplified

from pCBD3 using primers 5’-GGGCGGCTCGAGCCATCAACACAGCTTGTAACA-3’ and

5’-GGGCGGCTCGAGGA TCCTATCTCCAACATTTAC-3’, thus introducing a XhoI site

(bold) at both extremities. The resulting fragment was then ligated into the XhoI site of

pETCip1X.

pETscaf4 was constructed by amplifying the Ct-encoding region from p2CBD (6), using

NdeI-containing primers 5’-GGGCGGCATATGGTTCCGTCAGACGGT-3’ and 5’-

GGGCGGCATATGCGGTGTGTTTGTCGGTGT-3’, and ligating the PCR product into NdeI-

linearized pETcoh1B (17).

Production and purification of recombinant proteins—E. coli was grown at 37°C to OD600

= 1.5 in Luria-Bertani medium, supplemented with 1.2% glycerol (w/v) and the appropriate

antibiotic. The culture was then cooled to 25°C (Ac, At, all chimeric scaffoldins) or 18°C (Fc and

Ft), and isopropyl thio-β-D-galactoside was added to a final concentration of 400 µM (Ac, At, all

chimeric scaffoldins) or 40 µM (Fc and Ft). After 16 h, the cells were centrifuged (10 min, 3000

g), resuspended in 30 mM Tris-HCl, pH 8, and broken in a French press. The purification of His-

tagged proteins (see Fig. 1) was performed on Ni-NTA resin (18). Scaf1 and Scaf2 were purified

on Avicel as previously described (6). The concentration of purified proteins was estimated by

absorbance (280 nm) in 6 M guanidine hydrochloride, based on the known amino acid

composition of the desired protein (http://expasy.hcuge.ch/sprot/protparam.html).

Nondenaturing PAGE—Samples (7.5 µM final concentration) were mixed at room

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

8

temperature in 10 mM Tris-HCl, pH 8, 250 mM NaCl, 10 mM CaCl2, and 4 µl were subjected to

PAGE (gradient 4-15%) using a PhastSystem apparatus (Pharmacia, Uppsala, Sweden).

Gel filtration—Gel filtration was performed by HPLC using a calibrated Zorbax G-250

(Interchim, Montlucon, France) column, equilibrated with 50 mM Tris-HCl pH 8, 0.4 M KCl, 10

mM CaCl2, 0.01% surfactant P20 (Biacore AB, Uppsala, Sweden) at a flow rate of 1 ml min-1.

Samples were diluted in the same buffer (14 µM final concentration), and 10 µL were loaded onto

the column. Chromatographic data were recorded at 280 nm.

Surface plasmon resonance (SPR)—Experiments were performed using a Biacore system

as described earlier (17), using 10 mM Tris-maleate pH 6.5, 2.5 mM CaCl2, 0.005% P20 as

running buffer (flow rate 25µl min-1). Biotinylated chimeric scaffoldins (19), 95-100 RU of Scaf1

and Scaf2, 110-120 RU of Scaf3, and 65-70 RU of Scaf4, were coupled to streptavidin–bearing

sensor chips. The cellulases were diluted to 5 nM in the same buffer and allowed to interact with

the immobilized chimeric scaffoldin by injections of 600 s.

Enzyme activity—Samples (8 µM in 20 mM Tris-maleate pH 6.0, 0.1 M NaCl, 10 mM

CaCl2, 50 µl) were incubated at 37°C with 4 ml of Avicel (8 g liter-1, Fluka, Buchs, Switzerland).

At predetermined time intervals, 1-ml aliquots were centrifuged and examined for reducing sugars

(20). The final protein concentration during the assay was 0.1 µM, and glucose was used as the

standard for reducing sugar analysis.

RESULTS

Design and preparation of recombinant components—Four different chimeric scaffoldins

were engineered (Fig. 1), each containing two different cohesin species that exhibit divergent

specificities (8). Scaf1 and Scaf2 are based on the cellulosomal scaffoldin from C. thermocellum, in

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

9

which the two cohesins are separated by an internal CBD (21). Scaf3 is based on the C.

cellulolyticum cellulosome and contains an N-terminal CBD (22). Scaf4, which lacks a CBD, was

designed to determine whether simple complexation of enzymes would also promote synergistic

activity.

The enzyme components were all based on two established cellulosomal enzymes: the

family-5 CelA (10) and the family-48 CelF (15), herein referred to as Ac and Fc, respectively. To

complement the native enzymes, two hybrid constructs (termed At and Ft) were designed, in

which the intrinsic dockerin domain (designated “c”) of the respective C. cellulolyticum enzyme

was replaced by a dockerin domain (designated “t”) of differing specificity from the

corresponding family-48 enzyme, CelS (23), from C. thermocellum (Fig. 1). Thus, four different

enzyme pairs can be incorporated onto each chimeric scaffoldin: Ac + At, Ac + Ft, Fc + At, and

Fc + Ft.

The engineered proteins were produced in E. coli and affinity-purified in one step on either

cellulose or Ni-NTA, according to the presence of a CBD or His-tag, respectively. The chimeric

scaffoldins were found to be very stable upon storage for several days at 4°C, whereas low levels

of spontaneous cleavage between the catalytic and the dockerin modules were detectable for both

wild-type and hybrid enzymes.

Analysis of chimeric cellulosome complexes—Complex formation in the presence of calcium

was verified using three different techniques: nondenaturing PAGE, gel-filtration HPLC and SPR.

Nondenaturing PAGE clearly demonstrated that near-complete complex formation could be

achieved by simply mixing the desired components in vitro (Fig. 2). Binary or ternary mixtures of

the free proteins resulted in a single major band of altered electrophoretic mobility. These results

were confirmed by gel filtration HPLC of stoichiometric mixtures of the same components (Fig.

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

10

3). The peaks corresponding to the free components disappeared and were replaced by a major

peak of higher molecular mass. Apparent masses of 150 kDa and 200 kDa were found for binary

and ternary complexes, respectively. The results are in good agreement with the expected sizes of

the desired cellulosome chimeras. A minor peak (~400 kDa) was also observed, which may

suggest that low levels of oligomerization may also occur.

SPR-based estimates of affinity parameters for the interaction of Ac and Fc with the

various chimeric scaffoldins revealed similar Kd values (1-2.5 10-10 M). These results were in

accord with previously determined values for the cohesin-dockerin interaction in C. cellulolyticum

(17). The affinity of At and Ft, however, was too high (>1011 M-1) to be determined using the

Biacore system, suggesting a much stronger interaction in the C. thermocellum cellulosome.

The interaction between the chimeric scaffoldins and different combinations of the enzyme

components is presented in Fig. 4A. In this set of experiments, enzymes bearing C. cellulolyticum

dockerins were introduced prior to those from C. thermocellum. Under saturating or near-

saturating conditions, the amounts of enzyme, Ac or At (85-95 RU) and Fc or Ft (130-140 RU),

that were bound to the immobilized chimeric scaffoldin, were in close agreement with the

calculated Rmax, thus confirming a stoichiometry of 1 :1 :1 for the ternary complexes. The results

indicate that complexation between the enzymes and the C. cellulolyticum cohesin does not

disturb subsequent binding of the second enzyme to the C. thermocellum cohesin.

In another set of experiments, Scaf4 was employed to examine whether assembly of the

chimeric cellulosomes is affected by the mode of interaction among the different components. For

this purpose, the desired enzymes were either introduced simultaneously or in reversed order

(Fig. 4B). The resultant sensograms clearly demonstrated that each type of cohesin binds in an

independent manner to the appropriate dockerin-containing enzyme, irrespective of the order of

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

11

incorporation.

Enhanced synergy of cellulosome chimeras—Cellulosome chimeras were generally found to

be more active than simple mixtures of the free enzyme pairs (Fig. 5). Bringing two cellulolytic

modules into close proximity clearly enhances the catalytic efficiency on crystalline cellulose. The

observed enhancement of activity increased with incubation time (data not shown) and reached a

maximum after 24 h. The cellulolytic activity of the enzyme complexes was further improved

when the scaffoldin contained a CBD. When attached to the CBD-containing scaffoldins (Scaf1,

Scaf2 and Scaf3), the heterogeneous enzyme mixtures (Ac + Ft or Fc + At) exhibited an enhanced

synergy of about 2 to 3 fold. In the absence of a CBD (Scaf4), enhanced levels of synergy (~1.5

fold) were also observed. The most effective combinations of components were Scaf1 and Scaf2

together with enzymes Fc and At. Interestingly, the homogeneous mixture of family-5 enzymes

(Ac and At) also displayed levels of enhanced synergy, roughly equivalent to those of the

heterogeneous mixture of Ac and Ft. In contrast, chimeric complexes containing only the family-

48 enzymes (Fc and Ft) showed little if any synergistic action.

DISCUSSION

The results of the present work provide experimental verification of earlier proposals

whereby cellulosome chimeras can be constructed by combining appropriate dockerin-containing

enzymes and recombinant cohesin-containing scaffoldins (9). The concept is shown

schematically in Figure 6. The construction of the desired cellulosome chimeras is generated by

the tenacious binding interaction between complementary modules each located on

complementary interacting components, i.e., cohesins on chimeric scaffoldins and dockerins on

enzyme subunits. The resultant multi-component protein complexes assume some or all of the

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

12

functional characteristics of the parent components, such that their proximity within the same

complex leads to enhanced synergistic activity.

In previous works, single enzyme components of the C. thermocellum cellulosome have

been shown individually to exhibit enhanced activity on insoluble cellulose substrates upon

incorporation via a suitable scaffoldin into a cellulosome-like complex. In an early study, Wu et

al. (24) reported that a purified cellulosomal cellulase (CelS) can be combined with the native

scaffoldin, leading to an increase in hydrolytic activity of the complex on crystalline cellulose.

More recently, Kataeva et al. (25) showed that a different cellulosomal enzyme (endoglucanase

CelD) interacts stoichiometrically with scaffoldin constructs, and the resultant complexes were

found to degrade cellulose in a synergistic manner. Yet another cellulosomal enzyme

(endoglucanase CelE) was shown by Ciruela et al. (26) to exhibit enhanced crystalline cellulase

activity upon prior interaction with the full-length recombinant scaffoldin. In each of these latter

studies, only one enzyme type was incorporated into the given complexes, and the observed

enhancement of activity was mainly attributed to targeting of the enzyme to the solid substrate

by the scaffoldin-borne CBD. Finally, Bhat and colleagues (27,28), reconstituted a simplified

cellulosome by combining purified preparations of native cellulosomal components, including the

full-size scaffoldin with selected enzymatic subunits. The resultant reconstituted complex

exhibited enhanced synergy on cellulose compared to the activity of the mixture of free enzymes.

In this communication, we investigated the synergistic interaction of a heterogeneous

system, wherein two different recombinant cellulosomal enzymes were incorporated selectively

into discrete artificial cellulosome complexes by virtue of their vectorial interaction with defined

chimeric scaffoldins. Each of the chimeric scaffoldins contained two cohesins of divergent

specificities. The scaffoldins were designed to examine the contribution of location of the

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

13

designated modules therein. Thus, Scaf1 and Scaf2 both contain cohesins from the two species,

but their position vis-à-vis the internal CBD is reversed. The content of Scaf3 is very similar to

that of Scaf2, except its CBD is at an N-terminal rather than internal position. Finally, the

cohesins of Scaf4 are identical to Scaf1, except Scaf4 lacks a CBD. The data indicate that the

activity levels of the chimeric cellulosomes were significantly higher than those of the combined

free enzyme systems, thereby demonstrating that proximity of the different enzymes within the

complex indeed appears critical to the observed enhancement of synergistic action. The presence

of a targeting CBD in the chimeric scaffoldin conferred an additional contribution towards the

final level of enzyme activity displayed by a given complex.

Since the enzymes from C. thermocellum are thermophilic whereas those from C.

cellulolyticum are mesophilic, enzymes from the two bacteria would be incompatible in the same

complex. Thus, the mesophilic C. cellulolyticum cellulases (family-5 CelA and family-48 CelF)

were selected for this work, because their recombinant forms have already been shown to act

synergistically in the free state on crystalline cellulose (Corinne Reverbel-Leroy, Thesis of

Université de Provence, Aix-Marseille France, September 1996). The incorporation of the

enzymes into defined chimeric cellulosomes provided further enhancement of 2- to 3-fold.

It is interesting to note that some enzyme combinations proved better than others. It is

currently unknown why complexes composed of the homogeneous mixture of Ac and At resulted

in enhanced synergy while those of Fc and Ft displayed no synergy. It is also unclear why those

containing the combination of Fc and At consistently showed heightened levels of synergy over

those containing Ac and Ft. A possible stabilizing effect of the cohesin-dockerin interaction on

the Fc and/or At constructs could account for the observed differences. In any case, improved

levels of synergy may eventually be expected by using higher-degree systems that contain

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

14

additional or other combinations of enzymes.

Analysis of complex formation by three complementary methods revealed that selectivity

and stoichiometry of the cohesin-dockerin interaction are strictly maintained. In this context, the

individual dockerin-containing enzymes were incorporated into the desired chimeric scaffoldins

via binding to the matching cohesins, in an independent manner, irrespective of the order of

application. The enzymes could be added sequentially or mixed together and applied concurrently

with the same effect: complete and selective incorporation of the desired components.

This work represents an initial demonstration of the approach, and the use of the cohesin-

dockerin interaction as a selective type of molecular adapter for incorporating desired proteins

into multi-component complexes. In doing so, we have used the components of two well-

characterized cellulosome systems, which exhibit divergent cohesin-dockerin specificities. The

present system can be refined and elaborated in several ways. In order to extend the system,

cohesin and dockerin pairs can be used from other cellulosome species (3) to selectively

incorporate additional enzyme components into higher order complexes. Alternatively,

mutagenesis experiments may provide tailor-made specificities for this purpose (8,11,29).

Moreover, the genetic approach can be applied to increase the tenacity of the cohesin-dockerin

interaction thereby reinforcing the stability of the resultant chimeric cellulsomes. In any event,

the capacity to control the specific incorporation of enzymatic and non-enzymatic components

into defined chimeric cellulosome complexes should have considerable biotechnological value for a

broad variety of applications (9).

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

15

REFERENCES

1. Felix, C. R., and Ljungdahl, L. G. (1993) Annu. Rev. Microbiol. 47, 791-819

2. Béguin, P., and Lemaire, M. (1996) Crit. Rev. Biochem. Molec. Biol. 31, 201-236

3. Bayer, E. A., Chanzy, H., Lamed, R., and Shoham, Y. (1998) Curr. Opin. Struct. Biol. 8,

548-557

4. Bayer, E. A., Shimon, L. J. W., Lamed, R., and Shoham, Y. (1998) J. Struct. Biol. 124,

221-234

5. Shoham, Y., Lamed, R., and Bayer, E. A. (1999) Trends Microbiol. 7, 275-281

6. Yaron, S., Morag, E., Bayer, E. A., Lamed, R., and Shoham, Y. (1995) FEBS Lett. 360,

121-124

7. Lytle, B., Myers, C., Kruus, K., and Wu, J. H. D. (1996) J. Bacteriol. 178, 1200-1203

8. Pagès, S., Belaich, A., Belaich, J.-P., Morag, E., Lamed, R., Shoham, Y., and Bayer, E. A.

(1997) Proteins 29, 517-527

9. Bayer, E. A., Morag, E., and Lamed, R. (1994) Trends Biotechnol. 12, 378-386

10. Fierobe, H.-P., Gaudin, C., Belaich, A., Loutfi, M., Faure, F., Bagnara, C., Baty, D., and

Belaich, J.-P. (1991) J. Bacteriol. 173, 7956-7962

11. Mechaly, A., Yaron, S., Lamed, R., Fierobe, H.-P., Belaich, A., Belaich, J.-P., Shoham, Y.,

and Bayer, E. A. (2000) Proteins 39, 170-177

12. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene 77, 51-

56

13. Meza, R., Nufiez-Valdez, M.-E., Sanchez, J., and Bravo, A. (1996) FEMS Microbiol. Lett.

145, 333-339

14. Reverbel-Leroy, C., Belaich, A., Bernadac, A., Gaudin, C., Belaich, J.-P., and Tardif, C.

(1996) Microbiology 142, 1013-1023

15. Reverbel-Leroy, C., Pagés, S., Belaich, A., Belaich, J.-P., and Tardif, C. (1997) J.

Bacteriol. 179, 46-52

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

16

16. Pagès, S., Belaich, A., Tardif, C., Reverbel-Leroy, C., Gaudin, C., and Belaich, J.-P. (1996)

J. Bacteriol. 178, 2279-2286

17. Fierobe, H.-P., Pagès, S., Belaich, A., Champ, S., Lexa, D., and Belaich, J.-P. (1999)

Biochemistry 38(2), 12822-12832

18. Porath, J., Carlsson, J., Olsson, I., and Belfrage, G. (1975) Nature 258, 598-599

19. Bayer, E. A., and Wilchek, M. (1990) Methods Enzymol. 184, 138-160

20. Park, J. T., and Johnson, M. S. A. (1949) J. Biol. Chem. 181, 149-151

21. Gerngross, U. T., Romaniec, M. P. M., Kobayashi, T., Huskisson, N. S., and Demain, A.

L. (1993) Mol. Microbiol. 8, 325-334

22. Pagès, S., Belaich, A., Fierobe, H.-P., Tardif, C., Gaudin, C., and Belaich, J.-P. (1999) J.

Bacteriol. 181, 1801-1810

23. Wang, W. K., Kruus, K., and Wu, J. H. D. (1993) J. Bacteriol. 175, 1293-1302

24. Wu, J. H. D., Orme-Johnson, W. H., and Demain, A. L. (1988) Biochemistry 27, 1703-

1709

25. Kataeva, I., Guglielmi, G., and Béguin, P. (1997) Biochem. J. 326, 617-624

26. Ciruela, A., Gilbert, H. J., Ali, B. R. S., and Hazlewood, G. P. (1998) FEBS Lett. 422,

221-224

27. Bhat, M. K. (1998) Recent Res. Devel. Biotech. Bioeng. 1, 59-84

28. Bhat, S., Goodenough, P. W., Bhat, M. K., and Owen, E. (1994) Int. J. Biol. Macromol.

16(6), 335-342

29. Mechaly, A., Fierobe, H.-P., Belaich, A., Belaich, J.-P., Lamed, R., Shoham, Y., and

Bayer, E. A. (2001) J. Biol. Chem. 276, 9883-9888

30. Spinelli, S., Fierobe, H. P., Belaich, A., Belaich, J. P., Henrissat, B., and Cambillau, C.

(2000) J Mol Biol 304(2), 189-200

31. Tavares, G. A., Béguin, P., and Alzari, P. M. (1997) J. Mol. Biol. 273, 701-713

32. Shimon, L. J. W., Bayer, E. A., Morag, E., Lamed, R., Yaron, S., Shoham, Y., and Frolow,

F. (1997) Structure 5, 381-390

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

17

Figure Legends

FIG. 1. Schematic representation of the recombinant proteins used in this study.

White (C. thermocellum) and gray (C. cellulolyticum) symbols denote the source of the respective

domain (see Key to Symbols). The cohesin domains are numbered according to their original

position in the respective native cellulosomal scaffoldin. A hydrophilic domain (x) of unknown

function is part of the C. cellulolyticum scaffoldin. In the shorthand notation for the enzymes, A

and F represent the catalytic domains from C. cellulolyticum cellulosomal family-5 CelA and

family-48 CelF, respectively; c and t refer to the dockerin domains, derived from C. cellulolyticum

or C. thermocellum, respectively.

FIG. 2. Electrophoretic mobility of components and assembled complexes on

nondenaturing gels. (A) Scaf1-based cellulosome chimeras with Fc and At: lane1, Scaf1 alone;

lane 2, Fc alone; lane 3, At alone; lane 4, binary mixture of Scaf1 and Fc ; lane 5, binary mixture of

Scaf1and At ; lane 6, ternary mixture of Scaf1, Fc and At. (B) Scaf3-based chimeras with the same

enzyme components: Lanes same as (A) with substitution of the designated chimeric scaffoldin.

In each lane, equimolar concentrations (7.5 µM), of the indicated proteins were used, except the

control in lanes 3, where 30 µM of At were applied, due to the characteristic diffuse banding

pattern of the free protein. Similar quality gels were obtained for Scaf2- and Scaf4-based systems.

Note: the minor bands observed in several of the lanes do not reflect significant proteolytic

cleavage of the dockerin domain, as indicated in separate SDS-PAGE experiments (data not

shown).

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

18

FIG. 3. Gel filtration HPLC analysis of Scaf3-based components and assembled

chimeric cellulosome complexes. Injected proteins are indicated on each chromatogram.

Vertical lines indicate the positions of molecular mass markers : blue dextran (V0 > 2 MDa), β-

amylase (200 kDa), alcohol dehydrogenase (150 kDa), bovine serum albumin (66 kDa), ovalbumin

(44 kDa) and carbonic anhydrase (29 kDa). Data of similar quality were also obtained for chimeric

cellulosomes based on Scaf1, Scaf2 and Scaf4. Note that the chimeric scaffoldin elutes at a

significantly higher position than its expected molecular mass, an effect possibly related to an

extended arrangement of its modules or the known tendency of uncomplexed cohesins to dimerize

(30-32). On the other hand, the elution of both dockerin-containing enzymes At and Fc is

retarded. This effect appears to reflect the presence of the dockerin domain, since the recombinant

forms of the dockerin-free (truncated) enzymes elute more rapidly, in agreement with the

expected molecular mass (data not shown).

FIG. 4. SPR sensograms showing sequential binding of cellulases onto

immobilized chimeric scaffoldins. (A) Scaf1-, Scaf2- and Scaf3-based systems, in which the

order of injection is the same where the designated C. cellulolyticum enzymes are followed by

those of C. thermocellum, and (B) Scaf4-based systems, in which the order of injection is altered

where c,t = C. cellulolyticum enzymes followed by C. thermocellum, t,c = C. thermocellum

followed by C. cellulolyticum and (c+t) = simultaneous injection of the designated enzymes. In all

graphs, curves 1 = injection of Ac and At (solid lines); 2 = injection of Ac and Ft (dotted lines), 3

= injection of Fc and At (dashed lines) and 4 = injection of Fc and Ft (dot-dashed lines). Black

bars above the figure indicate the duration of the injection of the desired cellulase (5 nM each).

Note the characteristic broad curve of enzymes containing the C. cellulolyticum-derived dockerins

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

19

(first injection) compared to the sharp curves of those from C. thermocellum (second injection),

reflecting the remarkably high affinity of the latter cohesin-dockerin interaction.

FIG. 5. Activity of chimeric cellulosomes on microcrystalline cellulose. The

designated pairs of enzymes were mixed in stoichiometric amounts with the indicated chimeric

scaffoldin. The activity on Avicel of the resultant chimeric cellulosome complexes was compared

with that of equimolar concentrations of the free enzymes alone or in the presence of free CBD

from CipC. Microcrystalline cellulase activity represents the amount of soluble sugars released

(µM), measured after 24 h of incubation at 37°C, to a total level of solubilization estimated at

about 2% of the original amount of substrate. Glucose was used as a standard. The data show

the mean and standard deviation of three independent experiments.

FIG. 6. Schematic representation of the approach. A chimeric scaffoldin is produced,

containing an optional carbohydrate-binding module (CBM) and multiple (n) cohesin modules of

different dockerin specificities. The dockerin counterparts comprise distinct modules as part of

the polypeptide chains of the desired protein component (e.g., enzymes A, B, C, and N). The

chimeric cellulosome complex is constructed by simply mixing in solution the chimeric scaffoldin

and dockerin-containing components. The resultant complex exhibits enhanced synergistic

functions, due to the close proximity of the interacting components. (See Figure 1 for key to

symbols).

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Yuval Shoham, Jean-Pierre Belaich and Edward A. BayerHenri-Pierre Fierobe, Adva Mechaly, Chantal Tardif, Anne Belaich, Raphael Lamed,

dockerin-containing enzymes into defined functional complexesDesign and production of active cellulosome chimeras: Selective incorporation of

published online April 4, 2001J. Biol. Chem. 

  10.1074/jbc.M102082200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from