Upload
others
View
6
Download
0
Embed Size (px)
Citation preview
Loss of BRCA1 in Normal Human Mammary Epithelial
Cells Induces a Novel Mechanism of Senescence
by
Noor Herah Salman
A thesis submitted in conformity with the requirements for the degree of Masters of Science
Department of Medical Biophysics University of Toronto
© Copyright by Noor H. Salman, 2011
II
Loss of BRCA1 in Normal Human Mammary Epithelial Cells Induces a
Novel Mechanism of Senescence
Noor H. Salman
Masters of Science
Department of Medical Biophysics
University of Toronto
2011
Abstract
Early events in BRCA1-associated tumorigenesis remain poorly understood. To understand the
immediate consequences of BRCA1 loss of function, we modeled BRCA1 loss of function in
vitro using normal primary human mammary epithelial cells (HMEC). We have found that in
HMEC, loss of BRCA1 results in a novel type of senescence. Loss of BRCA1-induced
senescence is not associated with DNA damage or p53 upregulation. We find that p53 protein
levels are down regulated due to proteasome-mediated degradation. Although p53 levels are
down regulated, we find that BRCA1 loss induced expression of a number of p53-dependent
anti-oxidant genes. In particular we uncovered that SESN2, a p53 downstream target gene,
inhibits loss of BRCA1 induced ROS and activates autophagy. In contrast to human fibroblasts,
we found that loss of BRCA1 induced senescence is p53 independent, and can occur in the
absence of ROS upregulation and autophagy induction.
III
Acknowledgments
As of today, September 30th
2011, my research graduate training has taken full 3 years
and 1 month to complete. The phase of compilation and writing of this thesis was unexpectedly
difficult. The hardship was because not the concepts that I had studied were hard to describe,
instead it was due to looking back and analyzing all the mistakes that I had made during my
research training. The only reason I was able to pull through mistake after mistake was the
support of the people around me. Amidst my mistakes studded data were a few successes
detailed in this thesis, which would have never been possible without the guidance and support
of my colleagues.
First and foremost, I must thank my supervisor, Dr. Mona Gauthier for providing
unconditional support throughout my graduate term. If I were to list all the things for which I am
to acknowledge Mona, there would be no room left for this thesis to be written. Mona not only
gave me the opportunity to work in her lab but also to work on, what I think to be, the best
project in the lab. As a mentor in life science, her efforts have been exemplary. From her I
received supervision, guidance, and on one too many occasions rigorous bashings in matters of
both life and science. What Mona has done is carved my mind in a manner no one else could
have and shaped the person that I now am. For this I can never be grateful enough.
I am very fortunate to have more than one mentor during my training. This thesis has
been in large part with Jennifer Cruickshank, a collaborator/mentor. In many ways, I have come
to see Jen as a role model. I have benefitted from Jen’s experience and knowledge in many ways.
Throughout the past three years, whenever I had any questions during bench work, in preparation
of presentations, and even in the writing of this thesis, I could always interrupt Jen. To help me,
she has always put her work on hold and given all attention to me. This thesis tells an interesting
story because I got a lot of help from Jen. I have become a big fan of Jen forever.
My fellow graduate student, Rania Chehade, has also contributed important pieces of data
that in this thesis. Rania and I have worked together, literally side by side for almost years. I
have thoroughly enjoyed her company. I have savored her excitement about science and also the
food she would so frequently shared. Rania’s presence made my doing science lively. Bernie
Martin, our lab manager, has also assisted me from the first day that I joined. From Bernie I
IV
learned the fundamentals of tissue culture and many other things in the lab. Members of our
collaborating lab, Sophia George, Sanjeev Shaw, and graduate student Anca Milea, have helped
with trouble shooting and scientific discussions on numerous occasions. Their presence in our
lab meetings and in our lab has flavored and enriched my experience. I have benefitted from
them in many ways. Brenda Cohen, in our neighboring lab, helped pretty much ‘stand on my
feet’ when I first started. I would frequently go to her with questions, reagents, and help with
trouble shooting. Both of her students and my class mates, Julia Izrailit and Pavel Goldvasser,
have provided good advice whenever needed and great company throughout. I have loved
working with our present undergrad student Nymisha Chilukuri and our past summer students,
Dan Myran and Lesley Leung. I got the privilege to spend the most time with Nymisha, and it
has been a great pleasure. To all of these people I owe special thanks for sharing my joys and
making my gloomy days bright.
My committee members, Dr. Senthil Muthuswamy, Dr. Linda Penn, and Dr. Nadeem
Mughol, have always constructively critiqued during my committee meeting, which has been
helpful. Dr. Hal Berman, our collaborator, has been my unofficial mentor. He has always had an
open door policy about going to him for help on matters ranging from PCR problems, life related
resolutions and most importantly career counseling. Help in these areas is not always available to
all graduate students. I have been very fortunate to have Hal help during my training.
These past three years have been unpredictable ride. As I leave graduate school and go on
to a still unknown next step in life, more than anything else, I will always remember the people
who stood by me during my hard and happy days in the lab. Of course, my family has taken the
lead in allowing me the time to do this thesis. In particular, my parents supported me during the
first half of school and my husband, Muhammad, during the second half of it. I am blessed to
have family and friends like mine.
V
Statement of Contribution
Figure 2. Isolation of all HMECs from mammary tissue was done by Jennifer Cruickshank and
Bernard Martin.
Figure 3A. Propagation and infection of cells and rtPCR of BRCA1 was done by Jennifer
Cruickshank.
Figure 4 A, B, D. Propagation and infection of cells with control and shBRCA1 was done with
Dr. Gauthier. The growth curve, cell cycle and cell death analysis was also done with Dr.
Gauthier.
Figure 5 B, C. -galactosidase staining and quantification was done with Dr. Gauthier.
Figure 6. Propagation, infection of cells with control and shBRCA1, and -galactosidase was
done with Dr. Gauthier.
Figure 7B. Cell cycle blots were done with Dr. Gauthier.
Figure 8 B, C, D, E. rtPCR of p53 was done by Jennifer Cruickshank. Cell culture, infection, and
-galactosidase and IF were done with Dr. Gauthier.
Figure 9B. Cell culture and Western blot were done with Dr. Gauthier.
Figure 12 A, B. Cell culture and Western blots were done with Dr. Gauthier. Comet assay was
done by Jennifer Cruickshank.
Figure 13. ROS analysis was done Jennifer Cruickshank.
Figure 14 B, C. ROS analysis was done by Jennifer Cruickshank and trypan blue analysis was
done with Dr. Gauthier.
Figure 16C. ROS analysis was done by Rania Chehade.
VI
Figure 17 C, D. Beclin1 rtPCR was done by Rania Chehade and microarray analysis was done by
Nymisha Chilukuri.
Figure 20 A, C. Beclin1 rtPCR and ROS analysis was done by Rania Chehade.
Figure 21. Cell culture, Western blots, growth curves and -galactosidase assays were done with
Dr. Gauthier.
Figure 22. Cell culture, Western blots, and growth curves were done with Dr. Gauthier.
Figure 23 B, C, D. Cell culture, infection, -galactosidase staining, and ROS analysis was done
by Jennifer Cruickshank.
Figure 24. Cell culture, infection, and -galactosidase assays were done by Rania Chehade.
Table 8. Microarray analysis was done by Dr. Gauthier.
VII
Table of Contents
Acknowledgments……………………………………………………………………………… iii
Statement of Contribution……………………………………………………………………… vi
Table of Contents………………………………………………………………………………..viii
List of Tables……………………………………………………………………………………xiv
List of Figures………………………………………………………………………………....…xv
Abbreviations……………………………………………………………………………………xvi
Chapter 1: Introduction…………………………………………………………………….……...1
Breast Cancer…………………………………………………………………………………..1
Sporadic breast cancer……………………………………………………………......……..1
Molecular Sub-types of Invasive Ductal Carcinoma………………………………………..2
ER positive sub-types: Luminal A and Luminal B tumors………………..……….....2
ER negative sub-types: HER2 positive and basal-like tumors……..………………...2
Familial breast cancer…………………………………………………………………….....5
Li Fraumeni syndrome………………………………………………………………..5
Cowden’s syndrome…………………………………………………………………..5
Peutz-Jeghers syndrome………………………………………………………………6
ATM heterozygous mutations………………………………………………………...6
Hereditary Breast Ovarian Cancer……………………………………………………6
Early events in malignant transformation……………………………………………………...7
Bypass of barriers required for transformation……………………………………………..8
Barriers: Apoptosis and Senescence………………………….……………………………..8
Apoptosis……………………………………………………………………………..9
VIII
Senescence……………………………………………………………………………9
Inducers of Senescence……………………………………………………………...11
Senescence-associated phenotypes: similarities and differences……………………12
Consequences of senescence: anti-tumorigenic versus pro-tumorigenic……...….…13
BRCA1 tumorigenesis…………………………………………………………………..……14
BRCA1 function……………………………………………………………….……14
Mouse models of BRCA1 tumorigenesis………………………………………..….14
Human studies of BRCA1 tumorigenesis………………………………………..….15
Rational……………………………………………………………………………………15
Hypotheses…………………………………………………………………………….......16
Chapter 2: Materials and Methods………………………………………………………………17
Cell Culture………………………………………………………………………………..17
Isolation and propagation of HMECs in culture…………………………………….17
Additional cell lines…………………………………………………………………17
Proliferation analysis………………………………………………………………………18
Analysis of apoptosis………………………………………………………………………18
Engineering of stable cell lines…………………………………………………………….19
Retroviral and lentiviral vectors……………………………………………………..19
Retroviral vectors………………………………………………………...19
Lentiviral vectors………………………………………………………...19
Transfection of cells for lentivirus and retrovirus production………………………19
Generation of stable HMEC cell lines………………………………………………19
Pharmacological treatment of HMECs…………………………………………………….19
IX
MG132………………………………………………………………………………19
Leptomycin B………………………………………………………………………..19
Doxorubicin…………………………………………………………………………19
Senescence associated β-galactosidase activity…………………………………………...19
Western blot analysis………………………………………………………………………20
Total Protein isolation……………………………………………………………….20
Protein quantification ……………………………………………………………….20
SDS-PAGE………………………………………………………………………….20
Western blot protocol……………………………………….……………………….22
Reverse transcription PCR……………………………………………………………...…25
Total RNA isolation and quantification……………………………………………..25
Polymerase Chain Reaction (PCR)………………………………………………….25
Agarose gel electrophoresis…………………………………………………………25
rtPCR primers……………………………………………………………………….25
Comet assay……………………………………………………………………………….28
Slide preparation…………………………………………………………………….28
Electrophoresis………………………………………………………………………27
Flow cytometry…………………………………………………………………………….27
Immunofluorescence (IF)……………………………………………..…………………...27
Sample preparation………………………………………………………………….27
Antibodies…………………………………………………………………………..29
Immunocytochemistry (ICC)……………………………………………………….29
Microarray analysis……………………………………………………….……………….29
X
Sample preparation……………………………………………….…………………29
RNA isolation………………………………………………….……..……………..29
Bioanalyzer……………………………………………………….…..……………..29
Microarray center…………………………………………….….…….…………….29
Electron microscopy…………………………………………….………………..…………...30
Sample preparation……………………………………………………..…………...30
Mt. Sinai lab center…………………………….………………………..………......30
Chapter 3: Results...…………………………………………………………………..….………31
Loss of BRCA1 in normal mammary epithelial cells induces cellular senescence...………...31
Modeling BRCA1 loss of function………………………………………..………...31
Loss of BRCA1 results in growth arrest……………………………………..……...33
Loss of BRCA1 results in senescence……………………………………….……...36
Loss of BRCA1 induced senescence is unique to normal epithelial cells….……….38
HMECs display unique senescence-associated phenotypes……………………………….…38
Senescence is associated with p53 down regulation……………………………..….38
Loss of BRCA1 induces p53 down regulation……………………….....38
p53 down regulation correlates with cytoplasmic shuttling…………....41
p53 down regulation occurs through a proteasome mediated
degradation……………………………………………………….……..43
p53 down regulation in response to loss of BRCA1 induced senescence is
unique to mammary epithelial cells………………………...…………..45
p53 down regulation in response to loss of BRCA1 in epithelial cells is
not unique to loss of BRCA1…………………………………………...46
XI
Senescence occurs in the absence of DNA damage…………………………………46
Senescence is associated with ROS deregulation…………………………………...52
ROS deregulation is senescence inducer specific………………………52
p53 regulates ROS in response to loss of BRCA1……………………...52
p53 responsive antioxidant genes are up regulated in response to BRCA1
loss……………………………………………………………….……..54
SESN2 regulates ROS in response to BRCA1 loss…………………….58
Loss of BRCA1 results in autophagy….……………………………………………60
Loss of BRCA1 induced autophagy is p53 and SESN2 dependent…..…63
Autophagy does not inhibit ROS in response to loss of BRCA1……..…65
Bypass of loss of BRCA1 induced senescence does not occur through the known regulators of
senescence induction…………………………………………………………….……………67
Loss of BRCA1 results in p53 and RB1 independent senescence………..…………67
Loss of BRCA1 results in senescence independent of ROS up regulation..………...71
Loss of BRCA1 results in senescence independent of autophagy…………..………71
Chapter 4: Discussion………………………………………………..…………………………..74
The role of DNA damage and p53 in BRCA1 loss induced senescence….….……………75
DNA damage response………………………………………………..……………..75
p53 regulation………………………………………………………….……………76
The role of ROS and autophagy in response to loss of BRCA1…………….…………….77
ROS regulation……………………………………………………….……….……..77
Autophagy induction………………………………………………….……….…….77
Significant findings………………………………………………………………….…….79
XII
Conclusion……………………………………………………………………….………………80
References………………………………………………………………………………………..81
XIII
List of Tables
Table 1. Breast cancer sub-types in as they occur in breast cancer syndrome
Table 2. Mouse models of BRCA1 tumorigenesis
Table 3. Short hairpin sequences
Table 4. β-galactosidase staining solution
Table 5. Antibodies
Table 6. PCR conditions
Table 7. Sequences of primers
Table 8. p53 target genes are up regulated in response to loss of BRCA1
XIV
List of Figures
Figure 1. Sub-types of invasive breast cancer
Figure 2. Isolation and propagation of human mammary epithelial cells (HMEC)
Figure 3. Lentiviral mediated down regulation of BRCA1.
Figure 4. Loss of BRCA1 results in growth arrest in the absence of cell death.
Figure 5. Loss of BRCA1 results in senescence.
Figure 6. Loss of BRCA1 induced senescence is unique to normal primary cells.
Figure 7. Loss of BRCA1 results in the down regulation of p53 protein levels.
Figure 8. p53 down regulation is concurrent with the induction of senescence phenotype and
correlates with cytoplasmic shuttling.
Figure 9. Loss of BRCA1 results in post-transcriptional downregulation of p53
Figure 10. p53 down regulation in response to BRCA1 is unique to epithelial cells
Figure 11. Replicative and premature senescence in HMEC results in p53 down regulation.
Figure 12. Loss of BRCA1 induced senescence is independent of DNA damage.
Figure 13. ROS up-regulation is unique to loss of BRCA1 induced senescence.
Figure 14. p53 quenches ROS levels in response to BRCA1 loss.
Figure 15. p53 dependent genes are up regulated in response to loss of BRCA1.
Figure 16. Sestrin 2 regulates ROS in response to BRCA1 loss.
Figure 17. Loss of BRCA1 results in the induction of autophagy.
Figure 18. Loss of BRCA1results in p53 dependent autophagy induction.
Figure 19. Loss of SESN2 results in the down regulation of autophagy proteins.
Figure 20. Loss of autophagy does not result in up-regulation of ROS.
XV
Figure 21. Loss of BRCA1-induced senescence in HMEC is independent of p53 and RB.
Figure 22. Loss of BRCA1-induced senescence in NMF and IMR90 is p53 dependent.
Figure 23. Loss of BRCA1-induced senescence is independent of ROS.
Figure 24. Loss if BRCA1-induced senescence is not dependent on autophagy.
Figure 25. Summary of the consequences of BRCA1 loss in normal mammary epithelial cells.
XVI
Abbreviations Abbreviation Full Form
AMPK protein kinase, AMP-activated, beta 1 non-catalytic subunit
ARHGAP5 Rho GTPase activating protein 5
ATG13 ATG autophagy related 13 homolog
ATM Ataxia Telangiectasia Mutated
ATR Ataxia Telangiectasia and Rad3 related
BECN1 Beclin 1, autophagy related
BRAF v-raf murine sarcoma viral oncogene homolog B1
BRCA1 Breast Cancer 1, early onset
BRCA2 Breast Cancer 2, early onset
BrdU Bromodeoxyuridine
BSA Bovine Serum Albumin
CALD1 Caldesmon 1
CDK Cyclin Dependent Kinase
CHK1 CHK1 Checkpoint homolog
CHK2 CHK2 Checkpoint homolog
CK17 Keratin 17
CK18 Keratin 18
CK5/6 Keratin 5/6
cKIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
COL4A1 Collagen, type IV, alpha 1
CRM1 Exportin 1 (CRM1 homolog, yeast)
CXCR2 Chemokine (C-X-C motif) receptor 2
DCF Dichlorofluorescein
DCFDA Dichlorodihydrofluorescein Diacetate
DCIS Ductal Carcinoma In Situ
DDR DNA Damage Response
DI Deionized
DMEM Dulbecco's Modified Eagle Medium
DMSO Dimethyl sulfoxide
DRAM DNA-damage Regulated Autophagy Modulator 1
E2F E2F transcription factor
EGFR Epidermal Growth Factor Receptor
EM Electron Microscopy
ENC1 Ectodermal-Neural Cortex 1
ER Estrogen Receptor
XVII
Abbreviation Full Form
FACS Fluorescence-Activated Cell Sorting
FBS Fetal Bovine Serum
FITC Fluorescein Isothiocyanate
GPX3 Glutathione Peroxidase 3
GSE22 Genetic Suppressor Element 22
HBOC Hereditary Breast and Ovarian Cancer
HER2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2
HMEC Human Mammary Epithelial Cells
HMOX1 Heme Oxygenase (decycling) 1
hRASV12
v-Ha-ras Harvey rat sarcoma viral oncogene homolog
hTERT human Telomerase Reverse Transcriptase
IDC Invasive Ductal Carcinoma
IF Immuno Florescence
IGFB1 Insulin-like Growth Factor Binding protein 1
IL8 Interleukin 8
INF γ Interferon Gamma
iPSC induced Pluripotent Stem Cells
KD Knock Down
LC3 microtubule-associated protein 1 Light Chain 3
LFS Li-Fraumeni Syndrome
LOH Loss Of Heterozygosity
MEF Mouse Embryonic Fibroblasts
MEGM Mammary Epithelial Cell Medium
MKI67 antigen identified by monoclonal antibody Ki-67
MRN Mre11, Rad50 and Nbs1
mTOR mammalian Target Of Rapamycin
MYC v-myc myelocytomatosis viral oncogene homolog (avian)
NMF Normal Mammary Fibroblasts
NQO1 NAD(P)H dehydrogenase, Quinone 1
NRF2 Nuclear Factor (erythroid-derived 2)-like 2
OCT4 POU class 5 homeobox 1
OIS Oncogene Induced Senescence
p16 cyclin-dependent kinase inhibitor 2A
p21 cyclin-dependent kinase inhibitor 1A
p53 Tumor Protein p53
PBS Phosphate Buffered Saline
XVIII
Abbreviation Full Form
PCDH7 Protocadherin 7
PCR Polymerase Chain Reaction
p-H2AX Phospho H2A histone family, member X
PI Propidium Iodide
PJS Peutz-Jeghers Syndrome
PR Progesterone Receptor
PrEC Prostate Epithelial Cells
PTEN Phosphatase and Tensin homolog
PUMA BCL2 binding component 3
RB Retinoblastoma
RM Reduction Mammaplasty
ROS Reactive Oxygen Species
RS Replicative Senescence
rtPCR reverse transcriptase Polymerase Chain Reaction
SAHF Senescence Associated Heterochromatic Foci
SASP Senescence Associated Secretory Phenotype
SDS Sodium Dodecyl Suphate
SESN2 Sestrin 2
sh short hairpin
shLuc short hairpin Luciferase
SOD2 Superoxide Dismutase 2
Sox2 SRY (sex determining region Y)-box 2
SQSTM1 Sequestosome 1
STK11 Serine/Threonine Kinase 11
TBS Tris Buffered Saline
TP53I3 Tumor Protein p53 Inducible protein 3
TP53INP1 Tumor Protein p53 Inducible Nuclear Protein 1
TSG Tumor Suppressor Gene
TXNRD1 Thioredoxin Reductase 1
ULK1 Unc-51 like kinase 1
ULK2 Unc-51 like kinase 2
1
Chapter 1: Introduction
Breast cancer
With 1 in 9 women expected to develop breast cancer and 1 in 29 to die of it, breast
cancer is the most common cancer occurrence in Canadian women (after non-melanoma skin
cancer) and the second most common cause of cancer death. This year alone (2011) in Canada,
an estimated 23,400 women will be diagnosed with breast cancer and 5,100 women will not
survive it [1]. Although the mortality rate of breast cancer has gone down over the past 40 years,
a large number of women, when diagnosed at late stage, are still detrimentally affected by the
disease [2].
The most unique aspect of breast cancer biology is that both molecular and
morphological tumor heterogeneity is appreciated. Within the disease, there are many types that
are morphologically distinct, of which ductal carcinoma is the most prevalent; [3]. Within this
particular type, there are many distinctly classified molecular sub-types [4]. Upon a breakdown
of the mortality rates stratified by each sub-type of breast cancer, it was found that the rates are
skewed towards a few sub-types [5]. This feature not only provides the sub-type classification
prognostic power, but also raises the question of how this disease arises in its multiple forms.
Despite great advances in understanding breast cancer and its management, the series of early
events that occur in a cell to give rise to any specific type of breast cancer remains unknown.
Sporadic breast cancer
Breast cancer predominantly occurs sporadically, i.e. randomly in a population.
Although there are a few risk factors associated with the disease, the causal mechanistic
relationship of these risk factors with the disease is actively being studied. Like most other
cancers, breast cancer development is a complex, multi-step process. Over the past several
years, a number of studies have focussed on understanding and characterizing invasive breast
cancer.
2
Molecular Sub-types of Invasive Ductal Carcinoma:
The use of whole genome expression array experiments and hierarchical clustering of
breast tumor samples has revealed that invasive ductal carcinoma (IDC) can be subdivided into
at least 4 distinct molecular sub-types. Tumors of each sub-type cluster together and have a gene
expression signature (of several thousand genes), which distinguishes them from tumors of other
sub-types [4, 6-9]. The distinguishing features of IDC sub-types are the expression of
differentiation genes, oncogenes, and proliferation genes. An important benefit of this
classification is that it has prognostic significance [5, 9, 10], making it clinically applicable
(Fig.1).
ER positive sub-types: Luminal A and Luminal B tumors
The sub-type of IDC with the longest disease free survival and best prognosis is Luminal
A and second to it is Luminal B. They are called luminal because the tumor cells from these
sub-types show markers of differentiated luminal cells of the normal breast. For example, both
sub-types express the estrogen receptor (ER) and are said to be ER positive. However, they are
distinguished by expression of the progesterone receptor (PR) and by expression of a number of
cell cycle regulatory proteins [11, 12]. Luminal A (but not Luminal B) shows expression of
progesterone receptor, while the majority of Luminal B tumors are devoid of PR expression [13,
14]. Luminal B tumors are highly proliferative and show over expression of proliferation-
associated genes such as MKI67 (Ki67) [12].
ER negative sub-types: HER2 positive and basal-like tumors
The two sub-types associated with poor prognosis are Her2 expressing tumors and
tumors that show expression of basal epithelial makers and are hence, referred to as basal-like
tumors. Neither of these sub-types expresses ER and are said to be ER negative. The Her2 sub-
type is named as such because these tumors have amplification of the HER2 gene [15]. In the
past decade, the use of Herceptin, a monoclonal antibody developed to inhibit HER2 function,
has significantly increased the disease free survival of these patients [16, 17].
Basal-like tumors have unique characteristics. About 86% of ‘basal’ tumors present with
a histological grade of 3, meaning that the tumor tissue has very little similarity with the normal
3
tissue from which it originates and hence, displays a lack of differentiation [18]. They also
show evidence of necrosis and lymphocytic infiltrate [18]. Immunohistochemical, these tumors
stain negative for ER, PR, and HER2, and express normal basal cell cytokeratins such as CK 5/6
and 17 [19]. Roughly, half of basal tumors stain positive for EGFR and a third for c-KIT
expression [19].
A key feature of basal-like tumors is the high frequency of point mutations in p53. About
30% of breast cancers have p53 mutations and the majority of these are found in basal-like
tumors. Over 90% of basal-like tumors acquire p53 mutations compared to 13% of Luminal A
[5, 20]. Sequencing of the p53 gene has revealed that most basal-like tumors carry missense p53
mutations, which when detected by IHC show an absence of p53 protein accumulation [20, 21].
The explanation for the high rate of these mutations in basal-like tumors is so far unresolved
[20]. It is speculated that loss of p53 function might be an early event in breast cancer. One
reason supporting this evidence is that people who inherit germ line mutations in p53,
predominantly develop breast cancer [22]. Since p53 mutations occur so frequently in basal-like
tumors, it is thought that p53 loss may be necessary for these tumors to develop. The loss of p53
function correlates with highly proliferative tumors which are initially chemosensitive; [23-25]
however, patients commonly develop disease recurrence [24]. Several long term studies have
shown that women with basal-like breast cancer have a higher recurrence rate and lower overall
survival than women with other sub-types of breast cancer [23, 26].
Studies have been done to investigate if there is a precursor state of invasive basal-like
tumors. One such report demonstrated that a large percentage of patients with basal-like breast
cancer also show the presence of Ductal Carcinoma In Situ (DCIS) [27]. DCIS is a non-invasive
lesion, in which pre-malignant cells remain contained within the basement membrane. When
immunostaining was done on regions of DCIS in samples that had invasive basal cancer, it
revealed the same immunophenotype of basal-like tumors. The DCIS regions were negative for
ER, PR, and HER2 expression, and positive for expression of CK5/6, 17, and EGFR [27].
Another study found that 6% of DCIS cases show features of basal-like IDC, including triple
4
Figure 1: Sub-types of invasive breast cancer. Kaplan-Meier analysis of time to development
of distant metastasis stratified according breast cancer sub-type [9]. Data and patient cohort
from van’t Veer et. al. [10]
5
negativity and positive staining for basal cytokeratins [28]. In an elaborate study, Gauthier et. al.
demonstrated that women with DCIS lesions expressing hallmarks of basal-like tumors and
high levels of p16 and Ki67, were at increased risk of developing subsequent invasive tumors of
the basal-like sub-type [29, 30].
How basal-like tumors originate remains debatable. There is data showing a molecular
resemblance between basal-like tumors and normal embryonic stem cells. Genes that are up-
regulated in stem cells and those that drive induced pluripotency, such as Oct4 and Sox2, show
an increased expression by microarray analysis in basal-like tumors [31]. Whether basal-like
tumors arise from de-differentiation of fully differentiated cells (by a mechanism similar to
induced pluripotent stem cells (iPSC)) or from mammary progenitor stem cells remain unclear.
Familial breast cancer
Although the majority of breast cancer is sporadic, a small percentage of breast cancer
(about 15%) occurs due to cancer syndromes caused by inherited gene mutations (see Table 1).
The cancer syndromes described below predispose women to cancers of several different
organs, including breast.
Li Fraumeni syndrome:
Hereditary mutations in p53 are highly penetrant and show an autosomal dominant
pattern. People who inherit germ line mutations in p53 develop Li Fraumeni syndrome (LFS)
[32]. Although LFS patients develop multiple cancers, the most frequent occurrence is that of
early onset breast cancer. More than 30% of all LFS tumors develop in the breast [33, 34].
Cowden’s syndrome:
Similar to p53, hereditary mutations in the tumor suppressor gene PTEN also show an
autosomal dominant pattern and cause Cowden’s syndrome [35, 36]. Patients with Cowden’s
syndrome develop multiple hamartomas, which are benign lesions. As with LFS patients,
Cowden’s syndrome patients also develop early onset breast lesions more frequently than
6
lesions in any other organ [37]. About 75% of Cowden’s patients develop benign breast disease,
which increases their risk of developing malignant disease by 25-50% [37].
Peutz-Jeghers syndrome:
Like p53 and PTEN, hereditary mutations in the tumor suppressor gene STK11 also
result in an autosomal dominant cancer syndrome called Peutz-Jeghers syndrome (PJS) [38].
This syndrome is characterized by multiple gastrointestinal polyps. However, the most
commonly developed malignancy in patients with PJS is breast cancer [39], accounting for more
than 30% of all cancers that occur in PJS patients. As with LFS and Cowden’s disease, breast
cancer in PJS patients occurs as an early onset disease.
ATM heterozygous Mutations:
All of the known mutations that increase the risk of breast cancer occur in autosomal
dominant genes except for mutations in ATM, which are autosomal recessive. Homozygous
deletion of ATM predisposes to malignancy, particularly lymphoma or leukemia. Heterozygote
carriers of ATM also have an increased risk of developing breast cancer [40].
Hereditary Breast Ovarian Cancer:
More than 80% of all hereditary breast cancer is caused by Hereditary Breast Ovarian
Cancer (HBOC) syndrome [41]. HBOC occurs due to highly penetrant, autosomal dominant
genetic mutations in BRCA1 [42] or BRCA2 [43]. Among the women who inherit BRCA1
mutations, approximately 50 - 80% will develop breast cancer and 40% will develop ovarian
cancer [41]. Among the women who inherit BRCA2 mutations, approximately 40% will
develop breast cancer and 20% will develop ovarian cancer [41]. Although mutations in both
BRCA1 and BRCA2 increase the risk for breast cancer, the tumors that develop are distinct for
each gene. The breast tumors that occur in BRCA1 mutation carriers are predominantly of the
basal-like sub-type [9, 44] while tumors arising from BRCA2 mutations are predominantly of
the Luminal B molecular sub-type [45]. Like basal-like breast cancer, BRCA1-associated
tumors are ER, PR, and HER2 negative and harbor frequent p53 mutations. In contrast to basal-
like tumors, the spectrum of p53 mutations in BRCA1-related tumors is different from those in
non-BRCA1 mutated basal-like tumors [21]. BRCA1 related tumors have non-sense p53
7
mutations that results in a truncated protein and accumulation of p53 protein. Despite the
different spectrum of p53 mutations, in murine models, p53 loss of function appears necessary
for tumor development in cells that have lost BRCA1 function [46-48].
Table 1. Breast cancer sub-types in as they occur in breast cancer syndrome.
Gene Penetrance Tumor Sub-
type Reference
BRCA 1 high Basal Sorlie et al. PNAS 2003
BRCA 2 high Luminal B Melchor et al. Ontogeny 2008
p53 high Basal? Gonzales et al. JCO 2009
PTEN high ? Liaw et al. Nature 1997
STK11 high Basal? Hartmann et al. Ann Int Med 1998
ATM moderate ? Renwick et al. Nat Gen 2006
Not only is breast cancer the most common sporadically occurring disease, it is apparent
that the mammary gland is more vulnerable to tumorigenesis than any other gland in the body in
cancer syndrome patients. We think that this may be due, in part, to different or more lenient
early barriers to tumorigenesis in mammary cells as compared to those from those of other cell
types.
Early events in malignant transformation
The events that increase the risk of malignant transformation may occur through a
combination of cell type and mutation of origin. Given that there are many cell types in the
normal breast, and that there are also multiple molecular sub-types of breast cancer, the question
arises whether a particular cell type gives rise to a specific tumor sub-type. The early events that
occur and the susceptibility for malignant transformation may be different for the distinct
molecular sub-types of breast cancer. The cell of origin hypothesis predicts that distinct cell
types give rise to distinct tumor molecular sub-types, while the mutation of origin hypothesis
states that mutations in key pathways dictate molecular sub-type. It is likely that the
combination of the cell type and the mutation increases the risk for malignant transformation.
8
Bypass of barriers required for transformation:
Regardless of whether the cause of a particular molecular sub-type is due to cell type or
mutation of origin, tumor cells of all sub-types must bypass a number of intrinsic barriers. The
bypass of some but not all barriers does not necessarily lead to transformation. For example, it
has been shown that human pre-malignant lesions bypass growth barriers as they commonly
show increased mitotic indices. However, unlike malignant disease, pre-malignant lesions
commonly show intact apoptotic barriers [49].
Normal cells must acquire several biological alterations to become transformed cells. A
cell’s transition from normal to malignant is a multistep process in tumorigenesis. It has been
established by in vitro experiments that loss of tumor suppressor function combined with
oncogenic activation and immortalization will transform normal cells into tumor cells [50].
When these cells are implanted into a mouse recipient, they commonly give rise to a tumors
[51]. It is important to recognize that human cells are more resistant to transformation compared
to mouse cells [52]. When experiments were done in vitro, normal human cells were found to
require multiple events for successful transformation compared with murine cells. Several
groups have shown that immortalized mouse fibroblasts can be transformed by oncogenic RAS
alone [53, 54], while immortalized human fibroblasts require both RAS and MYC [51] or RAS
and p53 deregulation for transformation [50].
Normal human mammary epithelial cells (HMEC) have also been immortalized. Unlike
fibroblasts, the activation of hTERT alone does not immortalize epithelial cells. Combined
expression of hTERT and loss of p16 are required for HMEC immortalization [55]. In the
setting of hTERT activation and deregulation of RB/p16, HMEC can be transformed by
expression of oncogenic RAS [56, 57]. This data implies that epithelial cells may be more
resistant to immortalization as compared to fibroblasts.
Barriers: Apoptosis and Senescence
Both tumor suppressor dysfunction and oncogene activation are required for
transformation. Independently, tumor suppressor inactivation or oncogene activation results in
9
either apoptosis or cellular senescence. Both are mechanisms to limit the propagation of
potentially damaged cells.
Apoptosis: Apoptosis is a definitive barrier in tumorigenesis and is therefore disabled in tumor
cells. It has been argued that since apoptosis kills damaged cells, it should be the mechanism of
choice, instead of growth arrest. To address this question, it has been demonstrated that the
threshold of DNA damage is the most probable deciding factor. If the threshold of damage is
greater than some cell intrinsic level, cells will initiate an apoptotic program. Likewise, if the
damage is relatively low, then the cells initiate a senescence program [58].
Senescence: Although senescence limits the propagation of damaged cells, it also promotes cell
survival, which may allow for the selection of clones that have bypassed senescence and
therefore, increases the risk of transformation. Senescent cells display distinct hallmarks which
are discussed below [59].
Morphology: The morphology of cells is distinguishably altered as they undergo
senescence. Senescent cells increase in size and become 5-10 times larger than their original
size. Their shape also changes and they become flattened. These changes do not occur
immediately; rather, the cells alter gradually over the course of a few days and then, maintain
this enlarged phenotype [59]. It can be speculated that even though the cells do not divide and
increase in number, protein synthesis continues, resulting in the increased size [60]. Increased
metabolic activity results in the formation of vacuoles and the nucleus of senescent cells
becomes enlarged. Reports have documented chromatin remodeling in senescent cells. Narita,
et. al. showed that senescence associated heterochromatic foci (SAHF) are a hallmark of
senescence [61]. These heterochromatic regions are compact with hypermethylated regions of
silenced DNA. [62]. As cells senesce, proliferation genes are silenced and DNA
hypermethylation results in an irreversible growth arrest [62].
Cell cycle arrest: Cell cycle arrest is the most distinguishing feature of senescence. The
mechanism of senescence has been well studied at the molecular level. Nearly all cells become
senescent either through the p53 or p16/RB pathway or through both pathways. p53 activation
plays a central role in senescence induction. The immediate downstream effecter of p53
senescence induction is transcription of p21 [63], a CDK inhibitor that prevents the CDKs from
10
binding with cyclins, thus preventing cell division [64]. p16 maintains RB in its active form,
bound to E2F, preventing E2F from transcribing proliferation genes [65]. Activated RB also
mediates the formation of senescence-associated heterochromatin foci [61]. Upregulation of p16
can occur through multiple mechanisms including inhibition of upstream regulators like BMI1
[59]. When BMI is down-regulated, p16 levels are increased and as a consequence, senescence
is induced [66].
DNA damage response activation: p53 stabilization and activation occurs in response to
upregulation of DNA damage response proteins. DNA breaks are sensed by the MRN complex,
which activates ATM [67] (when double stand breaks occur) and ATR [68] (when single strand
breaks occur) by phosphorylation. Phosphorylated ATM then activates CHK1 [69], CHK2 [70]
and p53 [67], while phosphorylated ATR activates CHK1 [71] and p53 [68], also by
phosphorylation. ATM also inhibits Mdm2, thereby inhibiting p53 degradation and favouring
p53 stabilization [72].
Reactive Oxygen: Reactive oxygen species (ROS) has been shown to be a key factor that
contributes to senescence induction. When oxidative stress was measured in replicative
senescent human fibroblasts, a several fold increase in oxidative stress was found in senescent
cells as compared to young cells [73]. Culturing cells at reduced oxygen levels such as 3% O2
results in prolonged lifespan [73]. Recent data has shown that p53 is required to mediate
mitochondrial changes and ROS production is required for the induction of RAS induced
senescence [74]. The current understanding of the role of ROS in senescence induction is that
increased mitochondrial activity results in increased ROS, leading to increased DNA damage
which then results in the activation of p53 and the induction of senescence.
Autophagy: Autophagy has been shown to play a role in senescence [75]. Autophagy is a
process by which damaged cellular components and organelles are sequestered in double
membrane structures called autophagosomes and are transported to lysosomes for degradation
[76]. Autophagy not only removes waste from cells, but also allows cells to recycle
macromolecules and generate energy during times of stress and starvation. However,
unregulated autophagy results in excessive digestion of cellular components and can lead to cell
death. This feature of autophagy gives it a tumor suppressive property.
11
During senescence, autophagy provides amino acids and simple forms of lipids to be re-
used to maintain cell viability. Due to this role of autophagy in cell survival, it has also been
shown to have oncogenic properties. Rapidly proliferating tumor cells use autophagy to derive
nutrients and energy through catabolism [77].
The main regulators of autophagy are mTOR and p53. Classically, mTOR inhibits
autophagy by inhibiting ULK1 [78, 79]. mTOR phosphorylates ULK1, preventing it from
forming a complex with ATG13, which is necessary for autophagy initiation. AMPK, a well
studied inhibitor of mTOR [80] also triggers autophagy directly activating ULK1 [81, 82]. The
regulation of autophagy by p53 is unique. p53 nuclear and cytoplasmic localization within the
cell differentially regulates autophagy. Nuclear p53 induces autophagy while cytoplasmic p53
inhibits it. Nuclear p53 transcribes autophagy regulatory genes such as DRAM [83] and mTOR
inhibitory genes such as SESN2 [84]. Since autophagy is upregulated in senescent cells, it can
be hypothesized that these genes should also be upregulated in senescent cells. In contrast,
cytoplasmic levels of p53 inhibit autophagy. Cytoplasmic p53 inhibits AMPK, a positive
regulator of autophagy, which in turn activates mTOR, a negative regulator of autophagy [85].
Secretory phenotype: Recent data has shown that once cells become senescent, they
secrete a variety of biologically active molecules. This has been termed the Senescence
Associated Secretory Phenotype (SASP) [86]. Expression array studies [87] and antibody arrays
[88] have revealed numerous secreted factors released by senescent cells. These include diverse
interleukins, chemokines, and growth factors that have been shown to modulate the micro-
environment. For example, the SASP due to oncogenic BRAF induced senescence was capable
of altering the behavior of neighboring cells. In particular, IGFBP7, IL8 and CXCR2 secreted
by oncogene induced senescent cells induced senescence and apoptosis in neighboring cells [89-
91].
Inducers of Senescence:
There are several stressors that are capable of inducing senescence. These include
mitochondrial dysfunction, oxidative stress, DNA damaging agents that cause irreparable DNA
damage, aberrant microenvironment, and chromatin disruption among others. The most studied
12
types of senescence are those induced by Replicative Senescence (RS) and pre-mature
Oncogene Induced Senescence (OIS).
Primary cells have a finite life span or a set number of replicative cycles in cell culture
before they senesce [92]. This is called replicative senescence. It was shown that telomere
length shortens with each replicative cycle [93] and telomere erosion beyond a critical threshold
results in DNA damage [94]. In response to telomere erosion, DNA Damage Response proteins
(DDR) activate p53, which induces senescence. p53 appears to play a causal role in senescence
[95] as mutant p53 results in extended lifespan and allows for bypass of senescence [96].
Activation of oncogenes or loss of tumor suppressor genes results in pre-mature
senescence. Induction of pre-mature senescence due to over-expression of oncogenic RAS in
normal cells results in cellular hyper-proliferation and the collapsing of replication forks. This is
detected as DNA damage by the cell resulting in DDR up regulation, activation of p53, and
senescence induction [97]. Similarly, loss of tumor suppressor genes, such as NF1, also results
in senescence as a consequence of DNA damage [98]. This work led to the establishment of the
paradigm that senescence induction is mediated through DDR and activation of p53. To date,
over-expression of a number of oncogenes and loss of tumor suppressor genes have been shown
to induce senescence [99, 100].
Senescence-associated phenotypes: Similarities and differences
Although oncogene activation or loss of tumor suppressor function in normal cells
results in shared senescence associated phenotypes, the mechanism of senescence induction is
different. The shared senescence phenotypes include irreversible growth arrest and senescence-
associated morphological changes (large, flat, and vacuolated cells). All senescent cells thus far
analyzed also produce a secretory phenotype [86]. Increased oxidative stress is another shared
feature among all senescent cells studied to date [101]. Autophagy has only been described in
oncogenic RAS-induced senescence [75].
The mechanism of senescence onset can be specific to different inducers of senescence.
One very well studied example is the regulation of p53 protein levels. The role of p53 in
senescent cells has been shown to be both context dependent and cell type dependent. The levels
13
of p53 protein are differentially expressed in human fibroblasts, in response to different inducers
of senescence. Activation of oncogenes and silencing of certain tumor suppressors results in
senescence correlated with an increased expression of p53 [98, 102, 103]. However, in human
fibroblasts, when senescence is induced by telomere shortening, p53 protein levels are not
increased [95, 104-106]. Furthermore, DDR proteins are not universally up regulated in
senescent cells. For example, loss of PTEN-induced senescence does not result in DNA damage
or activation of a DNA damage response [107]. Another inducer-specific difference is the
secreted factors released by senescent cells. All senescent cells have a secretory phenotype;
however, the molecules that are secreted are not necessarily the same. One example is that of
interferon gamma (INF γ) which is only secreted by fibroblasts undergoing oncogenic RAS-
induced senescence and not by cells undergoing RS or irradiated senescent cells [88, 108].
These findings suggest that although senescent cells share several features, there are inducer
and/or cell type specific differences that may influence the mechanisms by which cells bypass
this barrier to tumorigenesis.
Consequences of senescence: anti-tumorigenic versus pro-tumorigenic:
Senescence is an anti-tumorigenic mechanism that inhibits the growth of damaged cells.
Although senescence has been well described in cultured cells, the in vivo relevance of
senescence has been questioned. Recent seminal reports have established that senescence does
occur in vivo and limits the propagation of damaged cells as previously shown in experimentally
cultured cells [98, 102, 109-115]. In both mouse and human models of tumorigenesis, genotoxic
stress (oncogene activation or loss of TSGs) results in pre-malignant disease that correlates with
the induction of senescence. Lesions that have progressed to malignancy show an absence of
senescence markers, suggesting that bypass of senescence is required for cellular transformation
[98, 102, 109-115].
Senescent cells can also play pro-tumorigenic role. This pro-tumorigenic role is largely
mediated by senescence-associated secreted factors that promote cell survival and the growth of
neighbouring cells. In vitro, senescent cells were first shown to increase the invasiveness of
pancreatic cancer cell lines [116]. In another study, immortalized, but non-tumorigenic
MCF10A cells, co-cultured with senescent fibroblasts were more proliferative and underwent
14
malignant transformation in a mouse model [117, 118]. There have now been several reports of
senescent cells altering the micro-environment in a pro-tumorigenic manner [88-90].
BRCA1 Tumorigenesis
BRCA1 function:
BRCA1 is identified as a breast cancer susceptibility gene mapped by genetic linkage
analysis to chromosome 17q12-21 [119]. Initially, several studies demonstrated that BRCA1
was involved in DNA repair and interacts with and acts upstream of RAD51 [120-122]. This
lead to the understanding that BRCA1 is a DNA damage repair protein. Later reports
demonstrated that BRCA1 can also sense DNA damage and plays a role in DNA damage
response signaling [123]. BRCA1 has been shown to have a cell cycle regulation role as well.
Loss of BRCA1 has shown to result in defective G2-M checkpoint [124] and functional BRCA1
has been demonstrated to be a co-activator of p53 [125, 126]. Recently, BRCA1 has also been
shown to serve an antioxidant function as well [127, 128]. As research has advanced in studying
BRCA1, accumulating evidence suggests that BRCA1 is an important multifunctional protein.
Mouse Models of BRCA1 tumorigenesis:
BRCA1 tumorigenesis has been studied extensively using several mouse models.
Complete knock out of BRCA1 results in embryonic lethality in the mouse [47]. This parallels
the fact that there are no human reports of BRCA1 homozygous deletion cases. Conditional
knock down of BRCA1 targeted to the mammary gland does not result in breast tumor
development, suggesting that additional events are required for transformation [129].
Inactivation of p53 in combination with conditional inactivation of BRCA1 in the mammary
gland does allow for mammary tumor formation [129]. However, these tumors appeared after a
long latency period, suggesting that p53 inactivation alone does not recapitulate early disease
onset in women with BRCA1 mutations [48]. Studies have shown that combined knock down of
BRCA1 with other tumor suppressor genes such as CHK2 also results in the formation of breast
tumors [130]. The efficiency of tumor formation in these mice is reduced, such that 50% of mice
develop mammary tumors and only after a long latency. Similarly, combined knock down of
BRCA1 and ATM results in mammary tumors after long latency in a small percentage (10%) of
15
mice [131]. Knock down of BRCA1 has also been combined with 53BP1 inactivation.
Interestingly, 53BP1 inactivation rescues embryonic lethality due to BRCA1 loss, but these
mice do not develop mammary tumors [132]. (See Table 2 for a summary of known mediators
of BRCA1-associated murine mammary tumorigenesis.)
Table 2. Mouse models of BRCA1 tumorigenesis
Driver Co-driver Latency/frequency Reference
BRCA1 -/+ - no tumor YM Jing et al. Ontogeny 2007
BRCA1 -/- - no tumor X Liu et al PNAS 2007
BRCA1 -/- p53-/- long/80% X Liu et al PNAS 2007
BRCA1 -/- CHK2-/- long/50% McPherson et al. Gen & Dev 2004
BRCA1 -/- ATM-/- long/10% Liu Cao et al. EMBO 2006
BRCA1 -/- 53BP1-/- no tumor Liu Cao et al. Cell 2009
Human studies of BRCA1 tumorigenesis:
Although loss of BRCA1 function has a very high correlation with breast cancer
incidence, there is relatively little known about the early events in BRCA1-associated
tumorigenesis. Tumors that develop in mammary tissue from BRCA1 mutation carriers all show
LOH at the BRCA1 locus, strongly suggesting that LOH is a causal event for tumor
development [133-135]. Evidence suggests that loss of heterozygosity (LOH) in BRCA1
heterozygous mammary epithelial cells may be an early initiating event. Tissue samples from
histologically normal mammary tissue from disease-free BRCA1 mutation carrier women and
from normal regions of mammary tissue adjacent to carcinoma in BRCA1 carriers show an
increased frequency of LOH compared with samples from non-BRCA1 mutation carriers.
However, the consequences of loss of BRCA1 in normal mammary cells remains
underexplored.
Rationale:
In this study, we proposed to advance our understanding of the consequences of loss of
BRCA1 in normal mammary epithelial cells. We think it is necessary to unveil the early events
that occur following loss of BRCA1. If we have the knowledge of how BRCA1 related breast
16
cancer develops in the early stages, then this may provide that can be used for early diagnostics,
targeted therapeutics, and possibly even prevention. The central aim of starting this project was
to investigate the consequences of loss of BRCA1 for the purpose of understanding breast
cancer etiology.
Hypotheses:
1. Loss of BRCA1 results in the induction of senescence.
2. BRCA1 loss induced senescence involves DNA damage, p53 activation, ROS up-
regulation and autophagy induction.
3. BRCA1 loss induced senescence is maintained by p53, ROS and autophagy.
17
Chapter 2: Materials and Methods
Cell Culture
Isolation and propagation of HMECs in Culture
The HMEC system is a well established model for studying early events in breast
carcinogenesis, first described in 1980 [136, 137]. We obtain fresh reduction mammoplasty
(RM) tissue from consenting patients undergoing breast reduction or reconstruction. Briefly
described, we process the tissue first by mechanical disruption, followed by overnight enzymatic
digestion at 37C using 50-100mL digestion media, which contains RPMI + 10% Fetal Bovine
Serum (FBS) (Hyclone, Fisher Scientific) + 1% Penicillin/Streptomycin/Fungizone (pen/strep;
Invitrogen) + 0.8mg/ml collagenase type I (Sigma) + 0.36mg/ml hyaluronidase (Sigma). The
following day, the digested mix is spun down and washed 3 times with RPMI + 10% FBS
(Hyclone) + 1% pen/strep (Invitrogen). After the final wash, the digested tissue pellet is
resuspended in 15mL RPMI and filtered through a pre-wetted 150 um filter first, then through a
50µm filter. The final filtrate contains single cell fibroblasts and the residue on both the filters
contains cell clusters called organoids. These organoid structures are enriched in terminal ductal
lobules. The organoids are collected and cryofrozen in freezing media. The freezing media is
RPMI + 20% FBS + 10% DMSO (Sigma). When thawed and plated in culture, primary
epithelial cells are encouraged to proliferate in a serum-free defined media. HMECs were
cultured in serum-free media MEGM (Mammary Epithelial Cell Basal Medium) from Clonetics
(Catalog # CC-3150). Growth supplements were also obtained from Clonetics and were added
separately; these include BPE, hEGF, Hydrocortisone, Insulin, and Gentamicin sulphate
amphotericin. All cell culture experiments were conducted in 21% O2 with 5% CO2 at 37C. In
experiments where indicated, HMECs were grown in 3% O2 with 5% CO2 at 37C.
Additional Cell Lines: MCF10A cells were obtained from American Type Culture Collection
(ATCC) and grown in Dulbecco's Modified Eagle Medium (DMEM), supplemented with 5%
horse serum (Invitrogen), 20 ng/ml epidermal growth factor (Sigma), 0.5 μg/ml hydrocortisone
(Sigma), 100 mg/ml cholera toxin (Sigma), 10 μg/ml insulin (Sigma) and 1%
antibiotic/antimycotic (Invitrogen) [138]. IMR90 cells were obtained ATCC and grown in
18
DMEM F12 supplemented with 10% FBS (Hyclone). NMF were isolated from the filtrate of
processed RM specimens and were also grown in DMEM F12 with 10% FBS. 184A1 were
obtained from ATCC and cultured in MEGM.
Proliferation analysis
Growth kinetics was determined as follows. HMECs were typically trypsinized into 6-well
tissue culture plates one day post-infection. Control HMECs were seeded at a density of 1 X 104
cells/well while experimental HMECs were seeded at 5 X 104 cells/well. Media was changed
every day and cells were counted every 2-3 days using a hemocytometer. To count, cells were
first washed with 1 X PBS, trypsinized using 1 mL 0.05% trypsin (Invitrogen) for
approximately 5 min and collected following trypsin neutralization using PBS containing 2%
FBS. Approximately 15µL of cell suspension was used to determine the number of cells per ml.
All samples were counted in triplicates. Cells counts were used to calculate population
doublings as follows:
LOG (# of cells counted/# of cells seeded)
LOG (2)
Analysis of apoptosis
Apoptosis was determined by flow cytometry. Annexin V, a marker of early apoptotic cell,
conjugated with Fluorescence Isothiocyanate (FITC) was used in combination with Propidium
Iodide (PI), a marker of late apoptotic and necrotic cells. 5 X 105 cells were trypsinized from
each plate and suspended in cold binding buffer to a volume of 500µL in a microfuge tube, as
per manufacturer instructions (Calbiochem). 1.25µL of annexin was added 5 X 105 cells in each
microfuge tube and incubated for 15 min at room temperature in dark. This was followed by
centrifugation and re-suspension in binding buffer. 10µL PI was added and samples were stored
on ice in the dark until analyzed. Flow cytometry was performed on a FACS Calibur machine at
the Princess Margaret Hospital. FITC is detected at 518nm and PI fluoresces at 620nm. FITC
was plotted on the x-axis and PI on the y-axis. Data was analyzed using Flowjo analysis
software.
19
Engineering of stable cell lines
Retroviral and lentiviral vectors
Retroviral vectors: pBabe control vector and pBabe-H-RASV12
containing a puromycin
resistance cassette was obtained from Dr. Weinberg through Addgene distribution
(http://www.addgene.org/1768/).
Lentiviral vectors: We designed and generated short hairpin RNA expressing vectors against
BRCA1 #1, BRCA2, and SESN2 #2 using pLKO construct and following Addgene instructions.
Short hairpins against BRCA1 #2, #3, #4, #5, p53, and BECN1 were provided by Dr. Jason
Moffat. Control vectors, scrambled short hairpin (shScr), shLuciferase (shLuc), and an empty
vector (LKO), were also provided by Dr. Moffat.
Transfection of cells for lentivirus and retrovirus production: Lentiviral transfections were
carried out in 293T cells (ATCC). Fugene 6 (Roche) was used as the transfection reagent for
DNA delivery into the cells. For transfection of a 10cm plate, 5µg lentiviral plasmid DNA, 4µg
packaging vector (pCMV), and 2µg envelope vector (pMD) was used in the transfection
reaction in 4mL DMEM H21 (high glucose) 10% FBS media. Cells were incubated for 4-6
hours at 37C with 5% CO2 and then, 6mL of additional media was added. Media was replaced
with 10mL fresh DMEM H21 5% FBS media after 24 hours and virus was collected at 48 hours
and 72 hours and filtered through a 0.45µm filter. Retrovirus was generated using Phoenix A
cells. For a 10cm plate, Fugene 6 and 10µg retroviral vector DNA were used in the transfection
reaction; retroviral collection was performed as described for lentivirus collection above.
Generation of stable HMEC cell lines: For knockdown (KD) experiments, cells were incubated
with lentivirus for 4-6 hours in a total volume of 4 mL (1mL virus + 3mL media + 4µL of
4µg/µL polybrene (Sigma)) in a 10cm plate, after which this infection media was replaced with
fresh MEGM media. For retroviral infection, cells were incubated in a total volume of 4mL
(10cm plate) for 4-6 hours (2mL virus + 2mL media + 4µL of 4µg/µL polybrene) after which
6mL media was added to the plate and cells were incubated overnight. On day 1 post infection,
selection media containing 2µg/mL puromycin or 3µg/mL blasticidin was applied and was used
to select for stable lines expressing the construct of interest.
20
Table 3. Short hairpin sequences
Gene Target Sequence Provider/Reference
LKO
shLUC
shScr
shBRCA1 #1
shBRCA1 #2
shBRCA1 #3
shBRCA1 #4
shBRCA1 #5
BRCA2 #1
Empty vector
ACGCTGAGTACTTCGAAATGT
AGGTTAAGTCGCCCTCG
GCTCCTCTCACTCTTCAGTTT
TCACAGTGTCCTTTATGTA
GCCTACAAGAAAGTACGAGAT
GAGAATCCTAGAGATACTGAA
GCCCACCTAATTGTACTGAAT
AAGCTCCACCCTATAATTCTG
Moffat Lab
Moffat Lab
Addgene Plasmid 1864
Designed in lab
Moffat Lab
Moffat Lab
Moffat Lab
Moffat Lab
Schoenfeld et al. MCB 2004
BRCA2 #2
shBECN1 #1
shp53
shSESN2 #1
shSESN2 #2
AATCAGCTGGCTTCAACTCCA
CCCGTGGAATGGAATGAGATT
GTCCAGATGAAGCTCCCAGAA
AAGACCATGGCTACTCGCTGA
AACTCAGCGAGATCAACAAGT
Li et al. Oncogene 2006
Moffat Lab
Moffat Lab
Budanov et. al. Science 2004
Designed in lab
Pharmacological treatment of HMECs
MG132: Stable cell lines of HMEC-LKO and HMEC-shBRCA1 were treated with 10µM
MG132 in culture media for 4 hours on day 2 post infection. After the treatment, cells were
washed with PBS and media was replaced. Control lines were treated with equal volume of
DMSO.
21
Leptomycin B: HMEC-LKO and HMEC-shBRCA1 were incubated with 25nM leptomycin B in
culture media from day one of infection until collection on day 5 post-infection.
Doxorubicin: Where indicated, HMEC-LKO and HMEC-shBRCA1 were incubated with
0.5µM doxorubicin or DMSO solubilized in culture media for 6 hours. Cells were collected
after 6 hours of doxorubicin exposure or allowed to recover in regular media for an additional
24 h prior to collection.
Senescence Associated β-galactosidase activity
Cells were seeded in triplicate in a 24 well plate one day after infection with the gene of interest
and cultured until ready for β-galactosidase staining as indicated. Culture media was aspirated
from each well and cells were washed with 1mL 1X PBS 3 times for 2 minutes each time with
gentle shaking. After the final wash, PBS was aspirated and replaced with 500µL fix solution.
Cells were incubated with the fix solution (2% Formaldehyde, 0.2% Glutaraldehyde, in 1X
PBS) for 5 minutes at room temperature with gentle shaking. Fix solution was aspirated and
cells were washed once with 1mL 1X PBS. 500µL of β-galactosidase staining solution (Table 4)
was added to each well and the cells were incubated at 37C in the absence of CO2 for 5-7
hours. After the incubation, cells were washed with 1X PBS and analyzed in PBS. For analysis,
3 pictures of different fields of view were taken from each well and a minimum of 100 cells
were counted from each picture. The total number of cells and the number of cells that stained
positive with β-galactosidase were counted and the percentage of positive cells was calculated
and plotted in a histogram.
Table 4. β-galactosidase staining solution
Reagent Concentration Volume per rxn
X-gal 1mg/mL 25µL
Citric Acid/Na2HPO4 40mM 100µL
Potassium ferrocyanide 5mM 25µL
Potassium ferricyanide 5mM 25µL
NaCl 150mM 15µL
MgCl2 2mM 1µL
Total 500µL
22
Western blot analysis
Total protein isolation: NP40 cell lysis buffer (20mM Tris, 150mM NaCl, 0.1mM EDTA,
20mM NaF, 1% NP40) was used for protein isolation. 10µL of NP40 lysis buffer was added per
1 X 104 cells to re-suspend the frozen cell pellet. Resuspended cells were incubated on ice for 10
min and then pipetted gently to mix. The samples were pelleted by centrifugation at 14,000
RPM for 30 min at 4C and the supernatant (protein lysate) was frozen at -80C until further
use.
Protein quantification: Protein concentration was determined using the Bradford assay [139].
Bradford reagent was diluted 1:5 with Deionized (DI) water. 200µL of diluted Bradford reagent
was aliquoted into each well of a 96 well plate. Protein samples were assessed in triplicate.
Colormetric analysis was determined using Coomassie Brilliant Blue dye (Bradford reagent
Bio-Rad) in which, 1µL of protein sample was added and the absorbance was measured at A595.
Bovine Serum Albumin (BSA) was used as a protein standard. Once protein concentrations
were determined, 6X sample buffer (0.5M Tris, 30% glycerol, 10% SDS, 5% β-mercaptoethal,
0.04% Bromophenol blue) was used to dilute the protein lysates down to a final concentration of
3µg/µL.
SDS-PAGE: BioRad gel casting apparatus was used to cast all polyacrylamide minigels. The
resolving solution (1.5M Tris pH 8.8 (stock), 12% Acrylamide, 0.1% SDS, 0.1% APS, and 0.4%
TEMED) was prepared, poured and left to polymerize for 20-30 min. The stacking gel (1M Tris
pH 6.8 (stock), 4% Acrylamide, 0.1% SDS, 0.1% APS, and 0.4% TEMED) was prepared, poured, a
10 well comb was inserted and the gel was allowed to polymerize for at least 1 hour. Protein
lysates were boiled for 5-6 min, allowed to cool for about 3-4 min and then loaded in each well.
After loading all the samples, the wells were topped up with running buffer (10X = 0.25M Tris,
2.5M glycine, 1% SDS). The plates were then taken out of the casting stand and assembled in
the gel running apparatus and the gels were run at 110V for roughly 1 hour 30 min in running
buffer. Once gel electrophoresis was completed, the gels plates were disassembled very
carefully, the stacking gel was removed, and the gels were equilibrated in transfer buffer with
gentle shaking for 10 min at room temperature.
23
Western blot protocol: The separated proteins were transferred to PVDF membrane (BioRad).
First, the PVDF membrane was submerged in methanol for 30sec and then transferred to
transfer buffer (25mM Tris, 192mM glycine, and 10% methanol) for 10 min. An immunoblot
sandwich was made in a tray filled with transfer buffer. The transfer cassette was place in the
tray, followed by a pad, a filter paper, the gel, the membrane, a second filter paper and then a
pad. The transfer cassette was latched properly and then placed in the tank with an ice pack in it
and filled with transfer buffer. The proteins were transferred at 100V for 1 hour. After the
transfer, the membrane was blocked in blocking buffer (5% milk in 0.1% TTBS (1X TBS+
0.1%Tween)) for 1 hour and probed with primary antibody as indicated. The membrane was
then washed 3 times with 0.1% TTBS (10X = 0.25M Tris, 80g NaCl, 2g KCl, pH 7.4 in 1L, and
0.1% Tween) and then incubated with the secondary antibody, after which it was washed again
3 times with 0.1% TTBS. ECL+ (GE) solution was applied to the membrane as per
manufacturer instructions. The chemiluminescent signal was visualized using scientific imaging
film (Kodak).
24
Table 5. Antibodies
Antibody (provider) Dilution factor Incubation time 2nd
ary antibody
β-actin (Santa Cruz)
AMPK (Cell Signaling)
53BP1 (Cell Signaling)
BRCA1 (Santa Cruz)
1:10,000
1:1000
1:1000
1:100
3 hr minimum
Overnight
Overnight
48 hours
Mouse
Rabbit
Rabbit
Mouse
LC3 (MBL)
RB (BD Pharmagen)
1:750
1: 200
Overnight
Overnight
Rabbit
Mouse
p15 (Neomarkers) 1: 200 Overnight Mouse
p16 (BD Bioscience) 1:200 Overnight Mouse
p21 (Cell Signaling)
p53 (Santa Cruz)
pAMPK (Cell Signaling)
pATM (Cell Signaling)
pCHK2 (Cell Signaling)
pH2AX (Upstate)
RASV12 (Santa Cruz)
1:300
1:1000
1:750
1:100
1:200
1:100
1:1000
Overnight
Overnight
Overnight
Overnight
Overnight
Overnight
Overnight
Mouse
Mouse
Rabbit
Rabbit
Rabbit
Rabbit
Rabbit
25
Reverse Transcription PCR
Total RNA isolation and quantification: Total RNA was isolated using Trizol (Invitrogen)
following manufacturer’s instructions. 1µL of isolated RNA was run on 2% agarose gel
determine RNA integrity. RNA concentration was measured using NanoDrop (Thermo
Scientific).
Polymerase Chain Reaction: 1µg RNA was used in a total reaction of 20 µL for rtPCR.
Manufacturer instructions were followed for the synthesis of cDNA using iScript kit (Bio-Rad).
The concentration of cDNA was measured using NanoDrop and all samples were diluted in
DEPC water to a final concentration of 500ng/µL. 1µg of cDNA was used for semi-quantitative
PCR. The PCR conditions are listed in Table 6.
Agarose gel electrophoresis: PCR amplified products were separated through a 2.5% agarose
gel (ONBIO) in 1X TAE buffer (50X = 1M Tris, 28.6mL Acetic acid + 0.5M EDTA). DNA
ladder (Invitrogen) was always loaded in the first lane and the PCR product in the following
lanes. Electrophoresis was done at 90V for 35-40 minutes and the gel was analyzed in the Gel
Doc imaging system (Bio-Rad).
rtPCR primers: Where indicated, primer sequences were determined by previously published
reports; otherwise they were designed using Primer 3, as indicated in table 7. Primers were
synthesized by Eurofins MWG Operon (EMO). Lyophilized primers that were received from
EMO were dissolved with DI water to generate a 100µM stock. For PCR, 10µM concentration
of all primers was used.
26
Table 6. PCR conditions
Gene Annealing temp C # of cycles
β-actin
BECN1
BRCA1
BRCA2
GPX3
HMOX1
NQO1
NRF2
SESN2
SOD2
TP53I3
TP53INP1
TXNRD1
p53
57
61
57.3
55
60
60
60
60
60
57
56
56
60
50
25
29
28
30
32
30
30
30
28
32
30
30
32
30
27
Table 7. Sequences of primers
Gene Forward Primer Reverse Primer Reference
β-actin
BECL1
BRCA1
BRCA2
GPX3
HMOX1
NQO1
NRF2
SESN2
SOD2
TP53I3
TP53INP1
TXNRD1
p53
TCCTTCCTGGGCATGGAG
TCCAGGAACTCACAGCTCCA
TATTTTGAGAGGTTGCTGTTTAG
CAAGCAGATGATGTTTCCTGTCC
ATGACTGACGTCCCCAGAAG
TCTCTTGGCTGGCTTCCTTA
AAAACACTGCCCTCTTGTGG
CCCTGCAGCAAACAAGAGAT
TGCCTCCTCTCTGACCAGTT
TTCAATAAGGAACGGGGACA
TAGCCGTGCACTTTGACAAG
CTTCCTCCAACCAAGAACCA
GCAGCACTGAGTGGTCAAAA
CCATGGCCATCTACAAGCAG
AGGAGGAGCAATGATCTTGATCTT
GCTGTTGGCACTTTCTGTGG
CTAAAAAACCCCACAACCTATCCC
AGAACTAAGGGTGGGTGGTGTAGC
GTCACATCTGCCTTGGTTGA
ACTCAGGGCTTTTGGAGGTT
GTGCCAGTCAGCATCTGGTA
CCCTGCAGCAAACAAGAGAT
CCTCTTCTCTCCTGCACACC
ACACATCAATCCCCAGCAGT
ATGCCTCAAGTCCCAAAATG
TCAGCCAAGCACTCAAGAGA
TGCCTCAATTGCTCTCTCCT
AGGGTGAAATATTCTCC
[140]
Designed
[141]
Wu et. al. 2003
Designed
Designed
Designed
Designed
Designed
Designed
Designed
Designed
Designed
Designed
28
Comet assay
Slide preparation: The comet assay was performed as previously described [142]. Briefly,
microscope slides were coated with 1% Normal Melting Agarose (NMA) (ONBIO) in DI. 1 X
104
cells in 10µL mixed with 75µL of 0.5% Low Melting Point Agarose (Sigma) solubilized in
PBS was added to the NMA coated slide and protected by a coverslip. The slides were placed on
a tray resting on ice until the agarose layer hardened. Cells were lysed by incubating the slides
in lysing solution (2.5mM NaCl + 100mM EDTA + 1mM Tris) at 4C for 2 hours.
Electrophoresis: Slides were placed in gel box filled with 1X TAE buffer for 20 minutes before
electrophoresis. Electrophoresis was performed at 24 volts for 30 minutes in cold room. The
slides were then stained with SYBR Green I (Invitrogen) for about 30 minutes with gentle
agitation at room temperature. The slides were visualized with a fluorescent microscope (Zeiss).
Flow cytometry
ROS was measured by probing for Di-Chloro-Fluorescein (DCF) levels using flow
cytometry. A 250 µM solution of CM-H2DCFDA (Invitrogen) was prepared by resuspending
the CM-H2DCFDA powder in DMSO prior to each experiment. Media was aspirated from the
plate and adherent cells were washed twice with 1X PBS. Adherent cells were incubated with
250 nM of CM-H2DCFDA at 37C for 30 minutes. After the incubation with CM-H2DCFDA,
the cells were washed with 1X PBS, trypsinized and resuspended in cold 1X PBS and kept in
dark until ready for flow cytometry analysis. A FACS Calibur flow cytometer was used for
measuring DCF levels and FlowJo software was used for data analysis.
Immunofluorescence (IF)
Sample preparation: HMECs were seeded on coverslips in a 24 well plate and were infected
with LKO and shBRCA1. IF was done on control cells on the day of infection and on HMEC-
shBRCA1 every post-infection until day 6. The samples were prepared by washing the cells
with 1X PBS and then fixing with 3% paraformaldehyde (PFA) for 10 minutes at 4C. The cells
were then washed twice with 10mM glycine in PBS. To permeabilize, the cells were incubated
with 1mL 0.2% Triton X-100 for 5 minutes at room temperature (RT), after which they were
washed twice with glycine/PBS.
29
Antibodies: p53 primary antibody was used from Santa Cruz. The secondary antibody was
Alexa Fluor 488 Goat anti-Mouse IgG1 from Invitrogen.
Immunocytochemistry (ICC): To block, cells were incubated with 2% BSA (in PBS) for 30
minutes at RT. The primary antibody, 1:200 of p53, was then applied to the cells for 1 hour at
RT. The cells were then washed twice with glycine/PBS, for 10 minutes each wash. The cells
were incubated with 1:200 secondary antibody for 1 hour at RT and then washed with
glycine/PBS twice for 10 minutes. After incubation with antibodies, the cells were stained with
1:1000 Hoechst 33342 for 10 -15 minutes at RT and then washed with PBS containing 0.05%
tween for 10 minutes at RT. Coverslips were mounted on slides with 2 µL mounting
media/coverslip (Vector Laboratories) and nail polish was used to seal the edges of the
coverslips. Cells were visualized with a fluorescent microscope (Zeiss). Nuclei were visualized
using DAPI (Invitrogen) at 1:1000 dilution.
Microarray analysis
Sample preparation: HMECs were infected with LKO and shBRCA1 and cultured in media
containing 2µg/µL puromycin. The cells were harvested on day 6 post infection and cell pellets
were snap frozen.
RNA isolation: RNA was isolated using the column extraction methods. Columns were
obtained from the RNeasy Qiagen kit. Manufacturer’s instructions were followed for RNA
isolation.
Bioanalyzer: Agilent 2100 Bioanalyzer was used to determine RNA integrity of the samples.
Agilent RNA 600 Nano kit containing microfluidic chips were used and manufacturer’s
instructions were followed.
Microarray center: Affymetrix whole genome U1332A arrays were used. Samples were sent
for array profiling at the UHN Microarray Facility.
30
Electron microscopy (EM)
Sample preparation: HMEC-LKO and HMEC-shBRCA1 were seeded on Thermonox plastic
cover slips in a 24 well plate and on day 1 post-infection. Cells were cultured for 6 days post -
infection.
Mt Sinai lab center: Sample preparation and analysis for EM was done at the Advanced
Bioimaging Centre.
31
Chapter 3: Results
Loss of BRCA1 in normal mammary epithelial cells induces cellular
senescence
Modeling BRCA1 loss of function
To study consequences of loss of BRCA1, we chose to perform our experiments using
normal Human Mammary Epithelial Cells (HMEC) from disease free-reduction mammoplasty
tissue (RM). In vitro propagation of primary HMECs is an established model for studying early
events in breast carcinogenesis, first described in 1980 [136, 137]. As previously described,
reduction mammoplasty tissue is obtained from consenting patients undergoing breast reduction
or reconstruction (Fig. 2A). Live tissue is first mechanically disrupted followed by overnight
enzymatic digestion with hyaluronidase and collagenase. Digested tissue is filtered through a
series of 2 meshes. The filtrate is enriched for mesenchymal cells including immune cells,
fibroblasts and endothelial cells. Tissue clusters of organoids larger than the meshes (50µm) are
enriched for mammary epithelial cells. When these organoids are plated, primary mammary
epithelial cells are encouraged to proliferate in a serum-free defined media. Proliferating early
passage epithelial populations represent both luminal and basal cells, as indicated by expression
of luminal markers such as CK18 and basal markers such as CK17 (Fig. 2B). As the cells are
passaged in culture they are pre-dominantly CK17 positive and show markers of basal
progenitor cells such as CD49+ and EpCam- (data not shown).
In culture, HMECs grow for approximately 10 population doublings before reaching a
p16-dependent growth arrest [143]. This growth plateau has been termed stasis. After 30 to 45
days, approximately 1 in 106 cells escape stasis via p16 promoter hypermethylation [144]. These
cells proliferate for an additional 30-60 population doublings until reaching a second senescence
growth plateau due to telomere erosion [145]. The second growth plateau has been called
agonescence [146] and can be bypassed by reactivation of human telomerase [147]. The natural
lifespan of HMECs in culture is unique in that senescence induction occurs twice through two
mechanistically different pathways.
To mimic BRCA1 loss of function in normal mammary epithelium, we genetically
targeted down regulation of BRCA1. A lentiviral construct, pLKO, harboring a short hairpin
32
Figure 2. Isolation and propagation of human mammary epithelial cells (HMEC).
A. Schematic representation of how breast tissue is processed in the laboratory to generate primary non-
immortalized, non-tumorigenic cell lines.
B. Immunofluorescence staining with cytokeratin 17 (red), cytokeratin 18 (green) and DAPI (blue) in pre-senescent
primary mammary epithelial cells generated from normal breast tissue.
33
targeting BRCA1 mRNA was designed in the lab (shBRCA1 #1). Four additional lentiviral
short hairpins against BRCA1 were also used to validate results where indicated and were
generously provided by Dr. Moffat (TRC). HMECs stably expressing each short hairpin were
selected by propagation in culture media containing 4µg/ml puromycin. RNA and protein was
isolated 5 days post-infection. BRCA1 mRNA expression was determined by rtPCR and protein
levels were determined by Western blot analysis (Fig. 3A). All five short hairpins showed
successful down regulation of BRCA1 mRNA. BRCA1 protein levels were also down regulated
in cells prepared from HMEC-shBRCA1 #1 (Fig. 3B).
Chappuis et. al. [148] first reported that tumors that occur in BRCA1 mutation carriers
are hypersensitive to platinum therapy. There is increasing evidence from both in vitro and in
vivo studies that loss of BRCA1 renders increased sensitivity to carboplatin [122, 149]. To
determine if using lentiviral knock down of BRCA1 can recapitulate the functional effect of loss
of BRCA1, we treated MDA-MB-231 cells stably expressing shBRCA1 with carboplatin.
Lentiviral down regulation of BRCA1 in MDA-MB-231 resulted in increased sensitivity to
carboplatin treatment compared to treated LKO control cells (Nagao and Gauthier, unpublished
data). This result confirmed that down regulation of BRCA1 functionally recapitulates BRCA1
loss of function.
Loss of BRCA1 results in growth arrest
We determined the consequences of loss of BRCA1 in HMECs by first assessing
growth kinetics following BRCA1 down regulation. To do this, we analyzed population growth
by calculating population doublings over time. Cells were seeded in 6 well plates and then
infected after 3 days with control HMEC-LKO and with a short hairpin to BRCA1. The cells
were then counted every 3 days. Three separate growth curves with LKO controls were
performed and all 5 previously tested short hairpins to BRCA1 were used to generate 8 lines in
total. Cells were manually counted and population doublings were calculated.
We found that loss of BRCA1 resulted in an immediate population growth arrest as
compared with control cells (Fig. 4A). We assessed the population growth of two different
controls, empty vector LKO and shLuciferase (shLuc). Cells were infected with each control
34
Figure 3. Lentiviral mediated down regulation of BRCA1.
A. rtPCR of BRCA1 and B-actin following stable lentiviral integration of shBRCA1 #1
B. Western blot of BRCA1 and B-actin following stable lentiviral integration of shBRCA1 #2 through #5
35
Figure 4. Loss of BRCA1 results in growth arrest in the absence of cell death.
A. Population doublings were calculated for vector control (LKO) cells and cells expressing 5 different short
hairpins against BRCA1.
B. Population doublings for HMEC stably expressing LKO or shLuciferase
C. Cell cycle analysis of HMEC-LKO (black) and HMEC-shBRCA1#1 (grey) following BrdU labeling, PI staining
and flow cytometry analysis. The percent cells in G1, S and G2 phases of the cell cycle are shown.
D. Analysis of cell death of HMEC-LKO (black) and HMEC-shBRCA1 #1 (grey) following Annexin V staining
and flow cytometry. The percent cells staining positive for Annexin V staining is shown.
36
and then allowed to undergo selection. On day 5 post-infection, cells were seeded in 6 well
plates and counted. We found that both HMEC-LKO and HMEC-shLuc have similar growth
kinetics (Fig. 4B). We next determined if the observed population growth arrest in the HMEC-
shBRCA1 was due to cell cycle arrest or apoptosis. To determine the cell cycle profile following
loss of BRCA1, HMEC-shBRCA1 and HMEC-LKO, on day 5 post-infection were pulsed with
10uM BrdU for 4 hours, and stained with PI. BrdU and PI content were analyzed by flow
cytometry. We found that only 1% of cells with loss of BRCA1 showed DNA in the S-phase
compared to 16% of LKO control cells (Fig. 4C). The remaining DNA was distributed between
G1 and G2 phases of the cell cycle. The growth kinetics and BrdU/PI analysis demonstrated an
absence of proliferation in HMEC-shBRCA1 cells. We next determined if BRCA1 loss affected
cell death by Annexin V and Propidium Iodide (PI) staining. Quantification of Annexin V
fluorescence by flow cytometry demonstrated insignificant death in response to loss of BRCA1
(Fig. 4D). All this data supports that BRCA1 loss induces arrest.
Loss of BRCA1 results in senescence
A hallmark of senescence is irreversible growth arrest in the absence of cell death. In
vitro, senescent cells adopt characteristic morphological features which include becoming large,
flat, and vacuolated. Upon a close examination of the morphological appearance of HMEC
following BRCA1 down regulation, we observed the cells were large, flat and vacuolated (Fig.
5A). To determine if loss of BRCA1 in HMEC induces senescence, we performed β-
galactosidase staining, a standard assay for senescence. β-galactosidase is a lysosomal enzyme
whose enzymatic activity can be detected by monitoring the cleavage of X-gal substrate, in a
colorimetric assay, with cells of interest [150]. In proliferating cells, β-galactosidase activity can
be visualized at pH 4. In senescent cells, β-galactosidase significantly increases and can also be
visualized at pH 6, a level at which β-galactosidase activity is undetected in proliferating and
quiescent cells [151]. This allows for selective positive staining of senescent cells.
On day 5 post-infection, we found that cells with loss of BRCA1 stained strongly
positive for β-galactosidase activity (Fig. 5B). Quantification of the positive staining was done
by counting 3 fields of a minimum of 100 cells per field that were positive (blue) or negative (no
37
Figure 5. Loss of BRCA1 results in senescence.
A. Phase contrast images of control cells (HMEC-LKO) and HMEC-shBRCA1. The scale bar is 100µm.
B. β-galactosidase staining (blue) on HMEC-LKO and HMEC-shBRCA1 5 days post- infection.
C. Quantification of β-galactosidase positive stained cells in HMEC-LKO and HMEC-shBRCA1 5 days post-
infection.
38
stain) and then calculating % positive cells (Fig. 5C). 80% of HMEC-shBRCA1 cells stained
positive for β-galactosidase compared to 8% of control HMEC-LKO cells. Taken together, our
data has demonstrated that loss of BRCA1 in primary human mammary epithelial cells induces
senescence.
Loss of BRCA1 induced senescence is unique to normal epithelial cells
We established that loss of BRCA1 induces senescence in primary mammary epithelial
cells. To determine if loss of BRCA1-induced senescence is unique to HMEC, we down
regulated BRCA1 in 3 primary cell lines and in 2 immortalized, non-tumorigenic cell lines.
HMECs and NMFs (Normal Mammary Fibroblasts) were isolated and propagated in the lab
from RM specimens. PrECs (Prostate Epithelial Cells) were obtained from Clonetics. IMR90
(lung embryonic cells), 184A1 (immortalized mammary cells), and MCF10A (immortalized
mammary cells) cell lines were obtained from ATCC. All cell types were infected with control
LKO and shBRCA1 and allowed to pass through puromycin selection. β-galactosidase staining
was performed on day 5 post-infection. Cell morphology of all cell lines was analyzed and
images were captured 5 days post-infection. In response to loss of BRCA1, all the primary cell
lines (HMEC, PrEC, NMF, and IMR90) displayed morphological features of senescence: cells
were large, flat, vacuolated, non-refractive and displayed increased β-galactosidase activity (Fig.
6). Immortalized cell lines, 184A1and MCF10A, did not acquire senescence morphology, nor
did they show increased β-galactosidase activity. To determine if these cell lines were sensitive
to senesce induction, 184A1 and MCF10A were treated with 1µM doxorubicin for 2 hours and
allowed to recover for 72 hrs. β-galactosidase staining was performed and both cell lines
showed increased staining (Fig. 6B). These findings strongly suggest that primary cells senesce
in response to loss of BRCA1 while immortalized cells, even though have maintained the
senescence barrier, are refractive to BRCA1 loss senescence induction.
HMEC display unique senescence-associated phenotypes
1) Senescence is associated with p53 down regulation
Loss of BRCA1 induces p53 down regulation
39
Figure 6. Loss of BRCA1 induced senescence is unique to normal primary cells.
A. Phase contract images of control LKO and shBRCA1- expressing HMEC (Human Mammary Epithelial Cells),
PREC (primary human prostatic epithelial cells), NMF (normal human mammary fibroblasts), IMR90 (normal
human lung embryonic fibroblasts), 184A1 (immortalized non-tumorigenic human mammary epithelial cells), and
MCF10A (immortalized non-tumorigenic human mammary epithelial cells) with corresponding quantification of β-
galactosidase staining. The scale bar equals 100µm. The micrographs and β-galactosidase staining were performed
5 days post-infection.
B. β-galactosidase quantification 184A1 and MCF10A control (Ctrl) and 1µM doxorubicin (Dox) treated cells.
Cells were treated for 2 hr and then cultured for 3 days before β-galactosidase staining was performed.
40
Figure 7. Loss of BRCA1 results in the down regulation of p53 protein levels.
A. rtPCR of BRCA1 and B-actin in HMEC-LKO (control) and HMEC-shBRCA1.
B. Western blot analysis of p16, p15, p53, p21 and B-actin.
C. Western blot analysis of p53 and B-actin in HMEC-LKO and HMEC stably expressing 4 different BRCA1 short
hairpins (shBRCA #2 through #5).
41
p53 and RB are the two dominant pathways known to regulate senescence induction [63,
66]. It has been shown that p53 stabilization precedes RB hypo-phosphorylation during
senescence induction and is sufficient for senescence to occur [152]. p53 protein upregulation is
considered a central event in senescence induction. Stabilization of p53 results in transcriptional
upregulation of a number of downstream targets including, p21 [125], also known to be essential
for senescence induction [153]. RB hypo-phosphorylation is maintained through increased p16
levels [154]. We sought to determine the expression levels of cell cycle inhibitors in HMEC in
response to loss of BRCA1.
Control HMEC-LKO and HMEC-shBRCA1 were harvested 5 days post-infection. RNA
from these samples was isolated and rtPCR for BRCA1 and B-actin was done to confirm KD of
BRCA1 (Fig. 7A). Protein was isolated from these samples and western blots were done to
probe for major cell cycle proteins (Fig. 7B). We found that in HMEC, loss of BRCA1 resulted
in increased p15. p16 protein levels are absent because we have used variant HMECs that have
escaped senescence by p16 hypermethylation. These observations are consistent with previous
findings [103, 155]. In contrast, we found that p53 and p21 levels were surprisingly down
regulated. Previous studies using MEF show that loss of BRCA1 induced senescence is
associated with p53 and p21 upregulation [156]. To ensure that down regulation of p53 in
response to loss of BRCA1 was not due to an off target effect, we down regulated BRCA1 using
4 additional short hairpins (shBRCA1 #2 through #5) and harvested cells 5 days post infection.
Protein lysates were probed for p53 and B-actin by western blot (Fig. 7C). We were able to
reproduce the results that were generated using the first short hairpin, further validating that p53
protein levels are down regulated in response to loss of BRCA1. Down regulation of p53 in a
senescent cell, particularly in response to loss of BRCA1, is a novel observation. To further
understand our finding, we sought to elucidate how p53 was being down regulated in loss of
BRCA1 senescent cells.
p53 down regulation correlates with cytoplasmic shuttling
Our analysis of p53 protein levels was performed 5 days following lentiviral expression
of shBRCA1, when senescence is maximally achieved. To determine the kinetics of p53 down
regulation during senescence, we measured p53 protein levels every 24 hours for 5 days
42
Figure 8. p53 down regulation is concurrent with the induction of senescence phenotype and correlates with
cytoplasmic shuttling.
A. HMEC-LKO collected at day 5, HMEC-shBRCA collected every 24 hrs for 5 days (D1,D2,D3,D4,D5) were
probed for BRCA1 and B-actin by rtPCR and for p53 and B-actin by western blot.
B. Quantification of β-galactosidase staining of HMEC-LKO cells and successive HMEC-shBRCA1 cells from D1
of shBRCA1 expression through D5.
C. rtPCR for p53 and B-actin in HMEC-LKO and HMEC-shBRCA1 cells collected at day 5.
D. Phase contrast (with scale bar equals 50µm) and p53 immunofluorescence images of HMEC-shBRCA1 captured
on Day 0 of shBRCA1 expression through Day 5.
E. Quantification of nuclear (N) and nuclear/cytoplasmic (N/C) localization of p53 immunofluorescence from D0
through D5 following shBRCA1 infection.
43
following lentiviral infection of cells with shBRCA1. rtPCR of BRCA1 and B-actin was done to
confirm KD in HMEC-shBRCA1. We observed a gradual decrease in BRCA1 levels that was
maximally achieved by day 3 (Fig. 8A). Similarly, we observed that p53 protein levels
consistently decreased over time and corresponded with increasing levels of β-galactosidase
activity and the appearance of senescence morphology (Fig. 8B, D). It is intriguing that in cells
with loss of BRCA1, p53 levels are consistently down regulated prior to the onset of
senescence. Down regulation of p53 could occur either at the transcriptional level with reduced
p53 mRNA or it could occur at the post-translational level through p53 protein degradation
[157, 158]. To determine if the down regulation of p53 is due to transcriptional regulation, we
measured p53 mRNA levels. We did rtPCR for p53 and B-actin on HMEC-shBRCA1 and
HMEC-LKO at D5 post-infection. We found no difference in p53 mRNA levels (Fig 8C),
indicating that p53 down regulation following BRCA1 loss occurs in a transcriptionally
independent manner.
Nuclear localization is essential for p53 transcriptional activity of cell cycle regulatory
proteins [159, 160]. When p53 is sequestered into the cytoplasm and is in its un-phophorylated
form [161], it gets ubiqutinated by MDM2 and degraded [162]. As such, we determined if
down regulation of p53 occurs at the post-translational level. We hypothesized that p53 would
have to be mislocalized into the cytoplasm for post-translational modification to occur. To
determine the p53 sub-cellular localization during senescence induction, we performed p53
immunofluorescence (IF) from Day 0 through Day 5 of BRCA1 KD (Fig. 8D). IF images along
with IF quantification (Fig. 8E) shows that as the cells senesce, p53 is shuttled to the cytoplasm.
p53 mislocalization in response to senescence induction or loss of BRCA1 has not been
previously demonstrated. We concluded from these results that p53 down regulation occurs
concurrently with cytoplasmic shuttling and senescence induction.
p53 down regulation occurs through a proteosome mediated degradation
We have so far uncovered that p53 levels are down regulated in response to loss of
BRCA1 and that this down regulation occurs in parallel with cytoplasmic shuttling of p53 (Fig.
7, 8). Ubiquitination of p53 has been shown to trigger p53 nuclear export and protein
44
Figure 9. Loss of BRCA1 results in post-translational down regulation of p53
A. HMEC-LKO and HMEC-shBRCA1 cells treated with 25nM of leptomycin B and collected on D1, D3, and D5
were probed for p53 and B-actin by Western blot.
B. HMEC-LKO and HMEC-shBRCA1 cells treated with 10uM MG132 for 4 hrs were probed for p53, p21, and B-
actin by Western blot.
45
degradation [163]. To determine if cytoplasmic shuttling is required for p53 degradation, we
inhibited nuclear export in our cells by treating them with Leptomycin B. Leptomycin B inhibits
the nuclear export of proteins by inhibiting CRM1 (re-named Exportin 1), which is an essential
nuclear export protein [164]. CRM1 (Chromosome Region Maintenance 1) was first identified
in yeast [165] and later its human homolog was found to bind to a protein and move between the
nuclear pores and nucleoplasm suggesting that the human homolog might be a nuclear transport
factor [166]. Leptomycin B works by inhibiting the binding of CRM1 with the nuclear export
signal (NES) of proteins [164, 167].
HMEC-LKO and HMEC-shBRCA1 cells were incubated with 25nM Leptomycin B one
day post-infection and collected on D1, D3, and D5. Protein lysates were prepared from all 6
samples. Western blots probing for p53 and B-actin showed that in untreated HMEC-shBRCA1
cells, p53 levels were down regulated, while leptomycin B treatment abrogated p53 protein
down regulation (Fig. 9A). This supports our hypothesis that in response to loss of BRCA1, p53
is shuttled to the cytoplasm for degradation.
To determine if down regulation of p53 is mediated through proteasome degradation, we
measured p53 levels following exposure to the proteasome inhibitor, MG132. MG132 is a
potent, cell permeable inhibitor that blocks the proteolytic activity of 26S proteasome [168].
Protein lysates were prepared from cells incubated with 10µM of MG132 for 4 hours and
probed for p53, p21, and B-actin by western blot (Fig. 9B). p53 and p21 levels in untreated
HMEC-shBRCA1 cells were down regulated as seen previously. However, in MG132 treated
HMEC-shBRCA1 cells, p53 and p21 levels were significantly elevated. Thus, proteasome
inhibition by MG132 treatment abrogates p53 down regulation, suggesting that p53 down
regulation in response to BRCA1 loss is mediated post-translationally through a proteasome
mediated mechanism.
p53 down regulation in response to loss of BRCA1 induced senescence is unique to
epithelial cells
Our observations that loss of BRCA1 in human epithelial cells induces p53 protein down
regulation is in contrast to previous reported studies using MEFs [156]. To elucidate the
discrepency between these results, we sought to determine if p53 regulation in response to
46
BRCA1 loss is cell type dependent. We induced down regulation of BRCA1 in 2 different
primary fibroblast cell lines, IMR90 and NMFs. BRCA1 was down regulated in these cells
using our lentiviral short hairpin against BRCA1. Cells were cultured in DMEM with 10%
serum and harvested on Day 5 post-infection. Protein was isolated to determine the expression
level of BRCA1 and cell cycle proteins. Similar to our observations in HMEC, we found that in
response to BRCA p16 and p15 protein levels were upregulated (Fig. 10). In contrast, the
expression of p53 and p21 were increased in response to loss of BRCA1 (Fig.10). By comparing
the responses to loss of BRCA1 in fibroblasts and epithelial cells, we have uncovered that the
down regulation of p53 is unique to epithelial cells.
p53 down regulation in response to loss of BRCA1 in epithelial cells is not unique to loss of
BRCA1
To determine if p53 protein down regulation in response to loss of BRCA1 in epithelial
cells is unique to loss of BRCA1 induced senescence, we measured p53 protein levels in HMEC
undergoing replicative senescence and premature senescence. HMECs were allowed to reach
replicative senescence by serial passaging. Premature senescence was induced in two ways. The
first, by overexpression of oncogenic hRASV12
through stable retroviral integration. Second, by
down regulation of BRCA2 by stable integration of a lentiviral short hairpin against BRCA2.
Stable HMEC lines over expressing hRASV12
and HMECs with stable KD of BRCA2 were
generated and analyzed. Replicative senescent HMEC (HMEC-RS), HMEC-hRASV12
, and
HMEC-shBRCA2 all acquired a senescent cell morphology by day 5 post-infection (Fig. 11A)
and showed significant upregualtion of β-galactosidase staining (Fig. 11B). Western blot
analysis demonstrated that p53 protein levels were down regulated in all senescent HMECs:
replicative senescent HMEC (Fig. 11C), hRASV12
overexpressing HMEC (Fig. 11D), and
BRCA2 KD HMEC (Fig. 11E). We found that p21 levels remained unchanged in these
senescent cells. We concluded that the down regulation of p53 occured in response to
senescence in epithelial cells and was independent of the inducer of senescence.
2) Senescence occurs in the absence of DNA damage
DNA damage has been previously demonstrated to be important for senescence
induction and has been shown to occur either through telomere shortening (RS) or over
47
Figure 10. p53 down regulation in response to BRCA1 is unique to epithelial cells
NMF and IMR90 cells were infected with stable lentiviral constructs of control LKO and shBRCA1 and harvested
5 days post-infection. NMF-LKO and NMF-shBRCA1, and IMR90-LKO and IMR90-shBRCA1 were probed for
BRCA1, p16, p15, p53, p21, and B-actin by Western blot.
48
Figure 11. Replicative and premature senescence in HMEC results in p53 down regulation.
A. Micrograph images with scale bar of 100µm of HMEC-control cells, replicative senececent HMEC, HMEC-
hRASV12, and HMEC-shBRCA2.
B. Quantification of β-galactosidase staining of HMEC-control cells, replicative senescent HMEC, HMEC-
hRASV12, and HMEC- shBRCA2 on Day 5 post-infection .
C. Western blots of HMEC-proliferating cells (control) and HMEC-replicative senescent probing for p53, p21, B-
actin.
D. Western blots of HMEC-pBabe(control) and HMEC-hRASV12 probing for RAS, p53, p21, and B-actin.
E. rtPCR of HMEC-LKO and HMEC-shBRCA2 probing for BRCA2. Western blots of p53 and B-actin.
49
Figure 12. Loss of BRCA1 induced senescence is independent of DNA damage.
A. Western blot analysis of p53, pATM, pCHK2, pH2AX, 53BP1, and B-actin in HMEC-LKO and HMEC-
shBRCA1.
B. Comet assay to probe for damaged DNA in HMEC-LKO, HMEC-shBRCA1 cells, and of control and etoposide
treated HeLa cells.
C. HMEC-LKO and HMEC-shBRCA1 cells were treated with 0.5uM of doxorubicin for 6 hours with or without
recovery for 24 hours and were probed for pCHK2, p53, p21, and B-actin by Western blot.
50
expression of oncogenes.When telomere errosion reaches a critical length, a DNA damage
response is induced to trigger terminal replication or replicative senescence [94]. Expression of
oncogenes such as RAS cause hyper-proliferation of cells, resulting in DNA adducts that also
trigger a DNA damage response to limit the propagation of damaged cells [97]. DNA Damage
Response (DDR) proteins such as CHK2 [69, 70] and ATM [169] phosporylate p53 to inhibit
proliferation and induce senescence. p53, CHK2 and ATM have all been demonstrated to be
necessary for senescence as loss of any of these proteins render cells refractive to senescence in
response to oncogenic RAS [97, 170]. Fig. 7 demonstrates that loss of BRCA1-induced
senescence is associated with down regulation of p53, thus raising the possbility that DDR may
not play a central role in premature senescence in HMEC.
To determine if DNA damage is activated in response to loss of BRCA1, we performed
Western blot analysis of DNA damage response proteins. Protein lysates from HMECs with loss
of BRCA1 and vector control were probed for p53, DDR proteins, and B-actin (Fig. 12A). p53
protein levels were down regulated in response to loss of BRCA1. DDR proteins, pATM,
pCHK2, p-H2AX, and 53BP1, were all surprisingly down regulated in response to loss of
BRCA1 (Fig. 12A). To determine if the down regulation of DDR proteins was due the absence
of DNA damage, we examined the extent of DNA damage using the comet assay. In this assay,
cells with damaged DNA form a smear on the gel referred to as comet tail. HeLa cells treated
with etoposide did form comet tails. HMEC-shBRCA1 did not show comet tails, suggesting the
absence of DNA damage in response to loss of BRCA1 (Fig. 12B).
The down regulation of DDR proteins promoted us to determine if cells with BRCA1
loss of function remain responsive to DNA damage. HMEC-LKO and HMEC-shBRCA1 were
exposed to the double-strand break inducing agent, doxorubicin, and were either harvested 6 hr
after treatment or were allowed to recover from doxorubicin exposure for an additional 24 hr in
regular media. Protein lysates were prepared and Western blots were done probing for pCHK2,
p53, and B-actin. In HMEC-LKO, we observed a robust upregulation of pCHK2, p53, and p21
(Fig. 12C) in response to doxorubicin exposure. HMEC-LKO treated with doxorubicin and
allowed to recover for 24 hours showed levels of pCHK2 and p53 similar to those in untreated
cells, suggesting that DNA repair had taken place. Doxorubicin treatment of HMEC-shBRCA1
cells showed a similar pattern of upregulation of pCHK2 and p53. pCHK2 and p53 levels also
51
Figure 13. ROS upregulation is unique to loss of BRCA1 induced senescence.
A. ROS levels were determined by DCF fluorescence in HMEC-LKO and HMEC-shBRCA1. Corresponding
quantification is expressed as fold increase over control. Significance was calculated using paired Student t-test.
B. ROS levels were determined by DCF fluorescence in HMEC-pBabe and HMEC-HRASV12. Corresponding
quantification is expressed as fold increase over control.
C. ROS levels were determined by DCF fluorescence in proliferating HMEC (prolif.) and replicative senescent
HMEC (RS). Corresponding quantification is expressed as fold increase over control.
52
returned to baseline after 24 hr recovery. Interestingly, p21 protein levels were not up-regulated
in loss of BRCA1 treated cells suggesting BRCA1 may coordinately regulate p53 downstream
genes. These findings support the work of others that demonstrate BRCA1 physically interacts
with p53 and acts as a transcriptional co-regulator [126, 171]. Upregulation of p53 in response
to doxorubicin treatment indicates that despite down regulation of pCHK2 and p53 in response
to loss of BRCA1, cells remain responsive to exogenous damage.
3) Senescence is associated with ROS deregulation
ROS deregulation is senescence inducer specific
It has been previously demonstrated that ROS upregulation plays a causal role in both
hRASV12
induced senescence [172] and replicative senescence [73]. When cells were cultured in
1% O2 or treated with scavengers of hydrogen peroxide, expression of oncogenic hRASV12
was
unable to trigger senescence [172]. Similarly, cells grown in 3% O2 achieved 50% more
population doublings than those grown in 20% O2 [73]. Cells cultured at lower O2 levels show
diminished ROS, reduced DNA damage and show a prolonged life span compared to control
cells [73].
We sought to determine if cellular senescence alters re-dox regulation in HMEC.
Senescence was induced in HMECs by serial passaging cells in culture, by down regulation of
BRCA1 and by over expression of oncogenic hRASV12
. ROS levels were detected by DCF
(dichlorofluorescein) fluorescence and were measured using flow cytometry. DCF is permeable
to cell membranes and non-fluorescent in its reduced form (DCFDA). DCFDA oxidization to
DCF results in fluorescence that can be quantified by flow cytometry analysis. We found that
inducers of senescence differentially modulated ROS levels. Loss of BRCA1 resulted in
upregulation of ROS (Fig. 13A). In contrast, replicative senescence and senescence induced by
over expression of hRASV12
, resulted in down regulation of ROS levels (Fig. 13B, C). Previous
reports have consistently demonstrated that replicative and premature senescence is associated
with an increase in ROS levels [73]. These conclusions were generated from studies using
primary murine or human fibroblasts. Our data suggests that ROS regulation may be cell type
dependent, in addition to senescence inducer specific.
53
Figure 14. p53 quenches ROS levels in response to BRCA1 loss.
A. Western blots probing for p53, p21 and B-actin in HMEC and HMEC-GSE22 treated with 0.5µM Doxorubicin
(Dox) for 6 hours.
B. Western blots probing for p53, p21, and B-actin in HMEC-GSE-LKO and HMEC-GSE-shBRCA1.
C. ROS levels measured by DCF florescence in HMEC-LKO, HMEC-shBRCA1, HMEC-GSE-LKO and HMEC-
GSE-shBRCA1. DCF fluorescent levels are expressed as fold change compared to control cells. Significance was
calculated using paired Student t-test.
D. Trypan blue analysis of HMEC-LKO, HMEC-shBRCA1, HMEC-GSE22, and HMEC-shBRCA1-GSE22.
54
p53 regulates ROS in response to loss of BRCA1
Recent studies have described p53 as having both a pro-oxidant and an anti-oxidant role.
The pro-oxidant role of p53 can be observed in response to exogenous damage. For example,
under severe stress p53 stabilization leads to transcription of pro-oxidant genes such as Bax and
PUMA resulting in ROS accumulation and induction of senescence or apoptosis [173-175]. The
antioxidant function of p53 has been primarily described in unstressed cells under basal
conditions where p53 transcribes antioxidant genes to reduce ROS [176]. In other words, when
p53 protein levels are reduced or at basal levels, it serves an antioxidant function.
Given that BRCA1 can co-regulate p53 target genes, we determined if p53 is involved in
ROS regulation in response to BRCA1 loss [126]. p53 was inactivated by GSE22. GSE22
(Genetic Suppressor Element #22) is a cDNA fragment encoding a dominant negative peptide
that corresponds to the C-terminal portion of the p53 protein, which regulates sequence specific
DNA binding [177]. Thus, expression of GSE22 results in a stable, but functionally inactive
form of p53. We show increased p53 levels and lower levels of p21 in HMEC-GSE22 compared
to control cells (Fig. 14A). HMEC-GSE22 treated with 5µM Doxorubicin for 6 hours also fails
to transcriptionally upregulate the p53 downstream target gene p21 compared with control
HMEC (Fig. 14B). To determine the role of p53 in the regulation of ROS following BRCa1
loss, HMECs expressing stable integration of GSE22 were infected with LKO and shBRCA1.
Protein lysates were prepared from HMEC-GSE22-LKO and HMEC-GSE22-shBRCA1.
Western blots were done probing for p53, p21, and B-actin to confirm inactivation of p53 by
GSE22. DCF levels were measured to determine the role of p53 in the regulation of ROS in the
context of loss of BRCA1. We found that BRCA1 loss in HMEC-GSE22 led to a 3-fold increase
in ROS levels compared to control GSE-LKO cells (Fig 14B). This increase was significantly
higher than that observed in the presence of wild-type p53 (1.7 fold increase in ROS levels).
These data demonstrate that in the absence of p53, ROS is significantly up-regulated and
suggests that p53 acts to reduce ROS accumulation in response to loss of BRCA1. To determine
the consequences of elevated ROS in the absence of p53 and BRCA1, we measured cell
viability by trypan blue exclusion. We found that HMEC-GSE22-shBRCA1 show a significant
increase in trypan blue staining compared with HMEC-shBRCA1 (Fig. 14C). These
observations suggest that p53 plays a role in cell survival following BRCA1 loss by maintaining
ROS levels below a threshold that induces cells death.
55
NAME ----- FOLDinsulin-like growth factor binding protein 3 IGFBP3 69.40
protocadherin 7 PCDH7 16.33
fibroblast growth factor 2 (basic) FGF2 8.62
heme oxygenase (decycling) 1 HMOX1 8.29
activating transcription factor 3 ATF3 7.81
growth differentiation factor 15 GDF15 6.69
ectodermal-neural cortex ENC1 6.40
serpin peptidase inhibitor, clade E SERPINE1 5.74
breast carcinoma amplified sequence 3 BCAS3 5.65
sestrin 2 SESN2 5.31
caldesmon 1 CALD1 5.15
tumor protein p53 inducible protein 3 TP53I3 4.47
collagen, type IV, alpha 1 COL4A1 4.08
neogenin homolog 1 NEO1 3.49
CDC42 effector protein 3 CDC42EP3 3.26
phorbol-12-myristate-13-acetate-induced protein 1 PMAIP1 3.24
protein tyrosine phosphatase, receptor type, M PTPRM 3.09
polo-like kinase 3 PLK3 2.87
carbohydrate sulfotransferase 12 CHST12 2.76
shroom family member 3 SHROOM3 2.74
polo-like kinase 2 PLK2 2.67
dickkopf homolog 3 DKK3 2.59
Rho GTPase activating protein 5 ARHGAP5 2.55
tumor protein p53 inducible nuclear protein 1 TP53INP1 2.49
growth arrest and DNA-damage-inducible, alpha GADD45a 2.45
cyclin-dependent kinase inhibitor 1A CDKN1A 2.28
chromodomain helicase DNA binding protein 2 CHD2 2.26
guanine nucleotide binding protein (G protein), q polypeptideGNAQ 2.25
tumor protein p53 inducible protein 11 TP53I11 2.16
seven in absentia homolog 1 (Drosophila) SIAH1 2.13
ankyrin repeat domain 10 ANKRD10 2.09
ubiquitin specific peptidase 9, X-linked USP9X 2.08
neural precursor cell expressed, developmentally down-regulated 4-likeNEDD4L 2.05
ribonucleotide reductase M2 B (TP53 inducible) RRM2B 2.05
LATS, large tumor suppressor, homolog 2 (Drosophila) LATS2 2.01
protein tyrosine phosphatase, receptor type, E PTPRE 2.00
Table 8. p53 target genes are up regulated in response to loss of BRCA1
56
p53 responsive antioxidant genes are up regulated in response to BRCA1 loss
Our findings that p53 regulates ROS in response to BRCA1 suggests loss of BRCA may
induce a p53-dependent anti-oxidant program. We have found that p53 remains responsive to
exogenous damage in the absence of BRCA1 (Fig. 12C). This indicates that even though p53
protein levels are down regulated in cells with loss of BRCA1, p53 may maintain transactivation
capacity. To determine if loss of BRCA1 induces a unique p53-dependent transcriptional
program, we analyzed p53-dependent genes in presence and absence of BRCA1. Whole genome
Affymetrix expression array was done on HMEC-LKO and HMEC-shBRCA1 cells at the UHN
Microarray facility. We identified p53 target genes previously published [178] and cross-
referenced them to our microarray data. Among the 122 published p53 target genes, 32 genes
were up-regulated more than 2 fold in HMEC lacking expression of BRCA1 (Table 8). The list
of p53 target genes that are up regulated in loss of BRCA1 cells have a variety of known
functions. These include: upregulation genes such as PCDH7 [179], which functions in cell
adhesion and genes responsible for cytoskeleton regulation, such as ARHGAP5 [180] and
CALD1. We also observed increased levels of genes involved in differentiation, namely, ENC1
and COL4A1. Of interest, we found several antioxidant genes among the genes that were
significantly up-regulated, including SESN2, TP53I3, TP53INP1, HMOX1, and SOD2. SESN2
(Sestrin 2) was up regulated in response to loss of BRCA1 by 5.3 fold. SESN2 has also been
shown to be a p53 target, [176] antioxidant gene [181]. TP53I3 (Tumor Protein 53 Inducible
Protein 3) and TP53INP1 (Tumor Protein p53 Inducible Nuclear Protein 1) are also a known
p53 target antioxidant genes known to be involved in apoptosis [182, 183]. In response to loss of
BRCA1, TP5313 is up-regulated 4.5 fold and TP53INP1 2.49 fold. HMOX1 (Heme Oxygenase
(decycling) 1) expression was stimulated by a factor of 8.3 in cells with loss of BRCA1
compared to control cells. HMOX1 is a heme catabolizing enzyme that has previously shown to
be p53-dependant [184] and has an antioxidant function [185]. SOD2 (Superoxide Dismutase
2), a well studied mitochondrial antioxidant gene, is also p53 dependent [186] and was up
regulated in response to loss of BRCA1. These data suggest that BRCA1 loss results in
transcriptional upregulation of several p53-dependent antioxidant genes.
We validated our microarray data by rtPCR and found increased mRNA expression of
SESN2, TP53I3, TP53INP1, HMOX1, and SOD2 in response to BRCA1 loss (Fig 15). In order
to validate that the increased expression of the antioxidant genes was dependent on p53, we
57
Figure 15. p53 dependent genes are up regulated in response to loss of BRCA1.
Western blots probing for p53 and actin in HMEC-LKO, HMEC-shBRCA1, and HMEC-shBRCA1-shp53 followed
by rtPCR of antioxidant genes and B-actin in HMEC-LKO, HMEC-shBRCA1, and HMEC-shBRCA1-shp53.
58
measured mRNA expression of several genes in the absence of p53 and BRCA1. Three lines
were generated: HMEC-LKO, HMEC-shBRCA1, and HMEC-shp53-shBRCA1. Cells were
harvested 5 days post-infection, protein was isolated and Western blots were performed to
confirm KD of p53 (Fig. 15). p53 was down-regulated in loss of BRCA1 cells and further down
regulated in HMEC-shp53-shBRCA1 cells, indicating effective KD of p53. We found that
HMOX1, SESN2, SOD2, TP53I3, and TP53INP1 mRNA expression levels were down
regulated in the absence of p53, thereby confirming the role of p53 in transcriptional
upregulation of these genes in response to BRCA1 loss. We also analyzed the expression of a
number of other antioxidant genes shown to be up-regulated in response to BRCA1 loss in our
microarray analysis, but not dependent on p53. These include GPX3, NQO1, TXNRD1 and
NRF2. We find only GPX3 and NQO1 were transcriptionally up-regulated. We concluded that
BRCA loss induces upregulation of several p53 dependent antioxidant genes that function to
maintain ROS levels below an intrinsically defined threshold that induces apoptosis.
SESN2 regulates ROS in response to BRCA1 loss
To determine if SESN2, one of the most highly upregulated antioxidant genes in HMEC-
shBRCA1, regulates stress induced ROS, we measured ROS levels in HMEC in response to
BRCA1 loss in the absence of SESN2. Lentiviral short hairpins to BRCA1 and control LKO
with blasticidin resistance were generated in the (designated shBRCA1(b) and LKO(b)). In this
manner we were able to select for shBRCA1 and LKO with blasticidin and for shSESN2 and
LKO with puromycin (designated shSESN2(p) and LKO(p)). Cells were double infected with
all combinations of control LKO, shBRCA1, and shSESN2. One day after infection, cells were
cultured in media containing 2µg/mL puromycin + 3µg/mL blasticidin. Four lines were
generated: HMEC-LKO(b)-LKO(p), HMEC-LKO(p)-shBRCA1(b), HMEC-LKO(b)-
shSESN2(p), and HMEC-shBRCA1(b)-shSESN2(p). On day 5 post-infection, cells were
harvested and RNA was isolated to test KD. rtPCR was done for BRCA1, SESN2, and B-actin
and confirmed KD (Fig. 16A). The morphology of cells with combined loss of BRCA1 and
SESN2 showed evidence of senescence (Fig. 16B) and stained positive of β-galactosidase (data
not shown). We measured DCF levels in all four lines and found that ROS levels were increased
in response to loss of BRCA1 alone and SESN2 alone (Fig. 16C). Combined down regulation of
59
Figure 16. Sestrin 2 regulates ROS in response to BRCA1 loss.
A. rtPCR of BRCA1 and SESN2 in HMEC-LKO-LKO, HMEC-LKO-shBRCA1, HMEC-LKO-shSENS2, and
HMEC-shBRCA1-shSESN2.
B. Phase contrast images with scale bar of 100µm of HMEC-LKO-LKO, HMEC-LKO-shBRCA1, HMEC-LKO-
shSENS2, and HMEC-shBRCA1-shSESN2 on day 5 post-infection.
C. Quantification of DCF fluorescence measured by flow cytometry in HMEC-LKO-LKO, HMEC-LKO-
shBRCA1, HMEC-LKO-shSENS2, and HMEC-shBRCA1-shSESN2.
60
BRCA1 and SESN2 showed a 4.5 fold increase in ROS levels. These data suggest SESN2 plays
an important role in regulating ROS in cells following loss of BRCA1.
4) Loss of BRCA1 results in autophagy
Autophagy is a process involving the degradation of cellular components into
macromolecules which can be recycled to allow for cell survival under conditions of stress.
Autophagy was recently shown to play an important role in senescence induction and
maintenance as the absence of an essential autophagy gene, ATG5, resulted in the delay of
hRASV12
induced senescence [187]. Microscopic analysis of HMEC-shBRCA1 cells shows an
increase in the number of peri-nuclear vacuoles, a characteristic feature of cells undergoing
autophagy. This observation led us to examine if autophagy was induced in loss of BRCA1
senescent cells. Electron microscopy (EM) allows for ultra structural imaging and is an accurate
method for detecting autophagosomes [188]. Cells infected with shBRCA1 or LKO, were
allowed to pass through puromycin selection and on Day 6 post-infection the cover slips on
which the cells were grown were sent to Mount Sinai Laboratory Medicine for sample
preparation and EM analysis. We detected abundant autophagosomes in HMEC-shBRCA1
compared to HMEC-LKO (Fig. 17A). The HMEC-shBRCA1 cells showed a striking phenotype;
there were densely embedded with vacuoles, whereas the control cells had very few of these
vacuoles. The different stages of the autophagosomes could not be distinguished; however,
several autophagic vacuoles contained partially degraded cytoplasmic material, indicative of
active autophagy. The EM photographs identified autophagy induction in response to loss of
BRCA1. To further confirm autophagy induction, we measured other autophagy hallmarks such
as LC3 lipidation and mRNA expression of autophagy regulatory genes. HMECs were infected
with LKO and shBRCA1 and cells were harvested every 24 hours for 5 days following down
regulation of BRCA1. RNA was isolated to confirm BRCA1 KD by rtPCR for BRCA1 and B-
actin (Fig. 17B). Protein was isolated and probed for the autophagy marker, LC3 (microtubule-
associated protein 1 Light Chain 3). LC3 plays an essential role in autophagosome formation
[189] and has two forms, LC3-I and LC3-II [190]. The LC3 precursor gets cleaved forming
LC3-I, which is a soluble form that localizes to the cytosol [190]. During autophagy initiation,
LC3-I gets lipid conjugated to form LC3-II [191], which is very stable and is localized to the
autophagosome membrane and is, hence used as a marker of autophagy [190, 192]. We
61
Figure 17. Loss of BRCA1 results in the induction of autophagy.
A. EM micrographs of HMEC-LKO and HMEC-shBRCA1 on day 6 post- infection.
B. rtPCR of BRCA1 and B-actin in HMEC-LKO and HMEC-shBRCA1 cells collected every 24 hours for 5 days
post-infection. Western blots for LC3 in HMEC-LKO and HMEC-shBRCA1 cells collected every 24 hours for 5
days post-infection.
C. rtPCR of BRCA1, BECL1, and B-actin in HMEC-LKO and HMEC-shBRCA1 collected on day 5 of infection.
D. Data from expression array showing fold increase in expression of autophagy regulatory genes in cells with loss
of BRCA1
62
Figure 18. Loss of BRCA1results in p53 dependent autophagy induction.
A. Schematic diagram showing p53 induction of autophagy by suppression of mTOR.
B. HMEC cells expressing stable integration of GSE22 were infected with LKO (or shLuc) and shBRCA1 and then
harvested after day 5 of infection. Western blots probing for p53, p21, AMPK, pAMPK, B-actin and LC3 and its
corresponding B-actin in HMEC-LKO, HMEC-shBRCA1, HMEC-GSE22-LKO, HMEC-GSE22-shBRCA1.
63
observed a consistent increase in LC3-II levels following down regulation of BRCA1 (Fig.
17B). To further validate that autophagy is induced, we determined the expression levels of
other autophagy regulatory genes. We found that BECN1 expression was increased in loss of
BRCA1 cells (Fig. 17C). We also found 8 other autophagy regulatory genes that showed
increased expression in cells with loss of BRCA1 (Fig. 17D). These genes include the
autophagy initiating gene, ULK1 [193], which showed a 7 fold increase in expression and
ULK2, the ortholog of ULK1, which showed a 2 fold increase in expression [194].
SQSTM1(p62) is required for the degradation of proteins by autophagy [195], and was
increased by 4.5 fold in cells with loss of BRCA1. DRAM encodes a lysosomal membrane
protein that is essential in p53 modulated autophagy [83]. DRAM expression was also increased
2 fold in cells with loss of BRCA1. ULK1, SQSTM1, and DRAM are all major regulators of
autophagy that have increased expression in cells with loss of BRCA1.
Loss of BRCA1 induced autophagy is p53 and SESN2 dependent
The role of p53 in autophagy is unique as it is known to be capable of both inducing [83,
196] and inhibiting autophagy, depending on the context [85]. A schematic of how p53 is
known up regulate autophagy is depicted in Fig.18A. To determine if the induction of autophagy
that we have observed in loss of BRCA1 cells is p53 dependent, we inactivated p53 using
GSE22. Already established HMEC-GSE and HMECs were infected with control LKO and
shBRCA1 to generate the following cell lines: HMEC-LKO, HMEC-shBRCA1, HMEC-
GSE22-LKO, and HMEC-GSE22-shBRCA1. Western blot analysis confirmed p53 inactivation
by stable integration of GSE22 (Fig. 18B). LC3 levels were increased in response to loss of
BRCA1 as observed in figure 16B. However in the absence of p53, LC3 protein levels were
decreased and were not upregulated in response to BRCA1 loss (Fig. 18B). These data suggest
loss of BRCA1-induced autophagy is mediated at least in part through p53. Previous studies
have shown p53 regulates autophagy through AMPK/mTOR signaling [196, 197]. We sought to
determine if p53 regulation of autophagy is mediated through AMPK/mTOR signaling
following BRCA1 loss. We probed for total AMPK protein and phospho-AMPK and found that
loss of BRCA1 resulted in a significant increase in phospho-AMPK levels; this increase was
64
Figure 19. Loss of SESN2 results in the down regulation of autophagy proteins.
A. rtPCR of SESN2 and B-actin in HMEC-LKO and HMEC-shSESN2.
B. Western blots probing for AMPK, pAMPK, LC3, and B-actin in HMEC-LKO and HMEC-shSESN2.
65
found to be p53 dependent (Fig. 18B). Recent studies have shown the p53 target, SESN2,
regulates AMPK through phosphorylation and promotes AMPK/TSC1/2 complex formation,
thus inhibiting mTOR [198]. To determine if p53 induced autophagy is SESN2 dependent we
determined phospho-activation of AMPK and LC3 accumulation in the absence of SESN2. We
found that both total AMPK protein levels and phospho-AMPK levels were down regulated in
response to loss of SESN2 (Fig. 19). We probed for LC3 and found that it was also down
regulated in response to loss of SESN2 (Fig. 19). The down regulation of both pAMPK and LC3
demonstrate that in the absence of SESN2 autophagy is not induced and supports a model by
which loss of BRCA1 induced autophagy is mediated through SESN2.
Autophagy does not inhibit ROS in response to loss of BRCA1
Our previous findings show elevated ROS levels in response to BRCA1 loss are
maintained within a physiological range that allows for cell survival through a p53-SESN2
dependent process (Fig. 14B, 16C). Since SESN2 also regulates autophagy, (Fig. 19) we sought
to determine if autophagy induction also regulates ROS following BRCA1 loss of function. We
hypothesized that if autophagy inhibits ROS in cells with loss of BRCA1, down regulation of
the essential autophagy regulatory gene, BECN1, would result in increased ROS levels. We
performed double infections with short hairpins targeting BRCA1 and BECN1 in HMECs. We
used shBRCA1 with blasticidin (b) resistance and shBECN1 with puromycin (p) resistance to
allow us to select for cells harboring both constructs. Cells were cultured in media containing
2µg/mL puromycin and 3µg/mL blasticidin. Four stable cell lines were generated: HMEC-
LKO(b)-LKO(p), HMEC-LKO(p)-shBRCA1(b), HMEC-LKO(b)-shBECN1(p), and HMEC-
shBRCA1(b)-shBECN1(p). We confirmed KD of BRCA1 and BECN1 by rtPCR (Fig. 20A).
Combined loss of BRCA1 and BECN1 resulted in a morphology consistent with cellular
senescence, while the cellular phenotype of HMEC with only BECN1 down regulation was
small and round (Fig. 20B). DCF fluorescence showed ROS levels were increased in HMEC-
LKO(p)-shBRCA1(b) compared to control cells (Fig. 20C). We also found ROS levels were
increased in cells with loss of BECN1. In cells in which both BRCA1 and BECN1 were down
regulated, we did not observe a further increase in ROS compared to cells with loss of BRCA1
or BECN1 alone; ROS levels were decreased by about 30% in HMEC-shBRCA1(b)-
66
Figure 20. Loss of autophagy does not result in upregulation of ROS.
A. HMEC were double infected with shBRCA1 together with shBECN1 and harvested on day 5 of infection. rtPCR
of BECN1, BRCA1, and B-actin in cells expressing two short hairpins.
B. Phase contrast images with scale bar of 500µm taken of day 5 of infection of HMEC-LKO-LKO, HMEC-LKO-
shBRCA1, HMEC-LKO-shBECN1, and HMEC-shBRCA1-shBECN1.
C. Quantification of DCF fluorescence measured by flow cytometry in of HMEC-LKO-LKO, HMEC-LKO-
shBRCA1, HMEC-LKO-shBECN1, and HMEC-shBRCA1-shBECN1. Significance was calculated using paired
Student t-test.
67
shBECN1(p). We had expected that inhibiting autophagy would result in increased ROS and so
this was a surprise. This data suggests that in response to loss of BRCA1, autophagy does not
inhibit ROS.
Bypass of loss of BRCA1-induced senescence does not occur through the
known regulators of senescence induction
Loss of BRCA1 results in p53 and RB1 independent senescence
Previous studies have established that senescence induction is p53 and/or RB dependent,
regardless of the inducer of senescence. In MEFs, loss of BRCA1 induced senescence is
bypassed in the absence of p53 [156]. In mice with conditional KD of BRCA1, KD of p53 is
required for bypass of senescence and tumor formation [129]. In both mouse and human
fibroblasts, oncogene-induced senescence is also bypassed by the inactivation of p53 [103]. The
role of RB inactivation in the bypass of OIS is restricted to MEFs as OIS is not rescued by RB
inactivation in human fibroblast cell lines. We have found that senescence induction in response
to loss of BRCA1 is different in epithelial cells as compared to fibroblasts when it comes to p53
expression (Fig. 10). We have also found that p53, even though down-regulated, is functional in
loss of BRCA1 senescent cells (Fig. 1, 8). We sought to determine the role of RB and p53 in
senescence induction by BRCA1 loss. HPV16-E7 gene of the human papilloma virus binds to
RB allowing the release of E2F transcription factors, thereby inhibiting RB function [199].
Stable lines were generated expressing HMEC-E7 and HMEC-E7-shp53. Both these lines were
then infected with shBRCA1 and LKO. As a control HMEC-LKO and HMEC-shBRCA1 lines
were also generated. This gave us 6 lines: HMEC-LKO, HMEC-shBRCA1, HMEC-E7-LKO,
HMEC-E7-shBRCA1, HMEC-E7-shp53, and HMEC-E7-shp53-shBRCA1. Protein was isolated
from all of these lines and Western blots were done to confirm down regulation of BRCA1, RB,
and p53 (Fig. 21A). Western blots for the control lines, HMEC-LKO and HMEC-shBRCA1, are
presented separate from the Western blots of experimental lines. BRCA1 protein expression was
absent in cells expressing shBRCA1. Similarly, RB expression was also absent in all lines
expressing E7. Since we used pre-senescent cells in this experiment, all cells expressed p16
levels. Cells expressing shp53 showed reduced expression of p53. All cells with loss of BRCA1
(HMEC-shBRCA1, HMEC-E7-shBRCA1, and HMEC-E7-shp53-shBRCA1) displayed
68
Figure 21. Loss of BRCA1-induced senescence in HMEC is independent of p53 and RB.
A. Western blots of BRCA1, Rb, p16, p53, p21, and B-actin in (starting from left) HMEC-LKO and HMEC-
shBRCA1. (Continued in the next column) HMEC-pBABE, HMEC-E7, HMEC-LKO-E7, HMEC-E7-shBRCA1,
HMEC-E7-shp53, and HMEC-E7-shp53-shBRCA1.
B. Phase contrast images of HMEC-LKO, HMEC-LKO-E7, HMEC-E7-shp53, HMEC-shBRCA1, HMEC-
shBRCA1-E7, HMEC-shBRCA1-E7-shp53 cells on day 5 post infection.
C. Growth kinetics of all the cell lines calculated by population doublings over time.
D. Quantification of β-galactosidase positive stained cells in all of the cell lines on day 5 post- infection.
69
senescent cell morphology compared to their respective controls (HMEC-LKO, HMEC-E7-
LKO, and HMEC-E7-shp53) (Fig. 21B). We then determined population doublings of all cell
lines by counting cell number every 3 days. We found that BRCA1 down regulation in presence
or absence of RB and/or p53 resulted in an immediate population growth arrest (Fig.21C). This
demonstrates that loss of BRCA1 induced growth arrest is both p53 and RB independent. To
determine if the growth arrest in these lines was due to senescence, we performed β-
galactosidase staining. We found increased β-galactosidase staining in all cells with loss of
BRCA1, including cells with prior RB inactivation and p53 down regulation (Fig. 20D).
However, we also observed increased cell death and relatively reduced β-galactosidase activity
in response to combined loss of p53, RB, and BRCA1. Contrary to the paradigm that senescence
cannot be induced in the absence of p53, we found that loss of BRCA1 induced senescence in
HMECs is both p53 and RB independent.
The data demonstrating that even with combined loss of RB and p53, loss of BRCA1
induced senescence is not bypassed was very astonishing. We sought to evaluate if p53 is
required for loss of BRCA1 induced senescence or if p53 is cell type specific and required only
for senescence induction in fibroblasts. To do so, we down regulated BRCA1 along with p53 in
two different fibroblast lines: NMF and IMR90. The cell lines that were generated were LKO,
shBRCA1, LKO-shp53, and shBRCA1-shp53 for both NMF and IMR90. Cells from all of these
lines were collected and protein lysates were made. Western blots probing for p53, p21, and B-
actin confirmed effective down regulation of p53 in response to the short hairpins (Fig.22A). To
determine if these cells senesced in the absence of p53 and BRCA1, we first assessed
proliferation rates. Both NMF-shBRCA1 and IMR90-shBRCA1 showed an immediate growth
arrest, indicative of senescence (Fig. 21B). Control LKO and shp53 cell lines continued to
proliferate. Cells with combined loss of BRCA1 and p53 also continued to proliferate, clearly
indicating that senescence was not induced in the absence of p53. This is in agreement with
previously published data showing that loss of BRCA1 induced senescence is p53 dependent
[156].
70
Figure 22. Loss of BRCA1-induced senescence in NMF and IMR90 is p53 dependent.
A. Western blots probing for p53, p21, and B-actin of IMR90-LKO, IMR90-shp53, IMR90-shp53-shBRCA1,
NMF-LKO, NMF-shp53, and NMF-shp53-shBRCA1.
B. Growth kinetics of all IMR90 and NMF in the presence or absence of BRCA1were determined by calculating
population doublings over time.
71
Loss of BRCA1 results in senescence independent of ROS upregulation
To determine if reduced ROS has an effect on senescence induction, we down regulated
BRCA1 in HMECs while culturing cells in reduced oxygen conditions. HMEC-LKO and
HMEC-shBRCA1 cells were cultured in 3% O2 or 21% O2 for the course of the experiment.
rtPCR confirmed BRCA1 down regulation under both conditions (Fig. 23A). ROS levels were
determined by DCF fluorescence. As previously demonstrated, when cultured in 21% O2,
HMEC- shBRCA1 showed increased ROS compared to HMEC-LKO, and showed a large, flat
cell morphology with increased β-galactosidase expression (Fig. 23B, C, D). In contrast, when
cells were cultured in reduced O2 conditions, ROS levels were significantly reduced and were
not increased in response to BRCA1 loss (Fig. 23B). Despite reduced ROS levels, the cells with
loss of BRCA1 cultured in 3% O2 also exhibited the large, flat, senescent cell morphology and
stained positive for β-galactosidase expression (Fig. 23C, D). These data demonstrate that
oxidative stress is not necessary for senescence induction in response to loss of BRCA1.
Loss of BRCA1 results in senescence independent of autophagy
To determine if loss of BRCA1 induced senescence is dependent on autophagy, we
down regulated BRCA1 in the absence of autophagy and then performed β-galactosidase
staining. We down regulated BRCA1 together with BECN1 by performing double infections
with a short hairpin targeting each gene. As previously described, we used shBRCA1 with
blasticidin resistance and shBECN1 with puromycin resistance to allow for selection of cells
harboring both constructs. rtPCR confirmed KD of BRCA1 and BECN1 in these lines (Fig.
24A). Cell morphology and β-galactosidase expression showed that BRCA1 loss in presence or
absence of BECN1 resulted in cellular senescence (Fig. 24B, C). As previously shown, cells
with loss of BRCA1 showed more that 75% positivity in β-galactosidase assays. Cells with
combined loss of BECN1 and BRCA1 demonstrated more that 50% positivity in B-
galactosidase, suggesting that BECN1 loss does not inhibit senescence, but may delay
senescence onset.
72
Figure 23. Loss of BRCA1-induced senescence is independent of ROS.
A. rtPCR of BRCA1 and B-actin in HMEC-shLuc and HMEC-shBRCA1 cultured in 21% O2 or 3% O2.
B. ROS levels measured by DCF fluorescence and analyzed by flow cytometry in HMEC-shLuc and HMEC-
shBRCA1 in 21% O2 and 3% O2.
C. Phase contrast images with scale bar of 100µm of HMEC-shLuc and HMEC-shBRCA1 in 21% O2 and HMEC-
shLuc and HMEC-shBRCA1 in 3% O2 captured on day 6 after infection.
D. Images of β-galactosidase staining of HMEC-shLuc and HMEC-shBRCA1 in 21% O2 and 3% O2 captured on
day 6 after infection.
73
Figure 24. Loss if BRCA1-induced senescence is not dependent on autophagy.
A. rtPCR of BECN1, BRCA1, and B-actin in cells expressing HMEC-LKO-LKO, HMEC-LKO-shBRCA1,
HMEC-LKO-shBECN1, and HMEC-shBRCA1-shBECN1. Cells were double infected with shBRCA1 together
with shBECN1 and harvested on day 5 of infection
B. Phase contrast images with scale bar of 100µm were taken on day 5 on infection of HMEC-LKO-LKO, HMEC-
LKO-shBRCA1, HMEC-LKO-shBECN1, and HMEC-shBRCA1-shBECN1.
C. Quantification of β-galactosidase staining in HMEC-LKO-LKO, HMEC-LKO-shBRCA1, HMEC-LKO-
shBECN1, and HMEC-shBRCA1-shBECN1.
74
Chapter 4: Discussion
Senescence has been demonstrated to be a tumor suppressive mechanism in transgenic
mouse models of carcinogenesis and mouse xenograft models using human cell lines. Activation
of oncogenes or loss of TSGs in primary cells launches fail-safe mechanisms to limit the
propagation of damaged cells. The role of senescence in human carcinogenesis is best described
in studies that have examined the distribution of senescence markers in normal, pre-malignant
and malignant lesions. Studies of prostate, lung, skin, and breast [29, 109, 111, 113] have all
found that markers of senescence are commonly found in pre-malignant lesions compared with
normal and malignant tissues. These studies have reinforced that mechanisms that allow cells to
bypass senescence are necessary for malignant transformation. Since the physiological inducers
of senescence are unique to each cell type, the mechanism of senescence bypass may be equally
unique.
In this study we used an in vitro model to study the consequences of BRCA1 loss of
function in human mammary epithelial cells. We find that loss of BRCA1 induces cellular
senescence that is restricted to normal cells. Premalignant and malignant mammary epithelial
cells are refractive to senescence induction by loss of BRCA1. This is not because these cells
are not capable of senescence induction as doxorubicin treatment of breast cancer cell lines
induces senescence (data not shown). We have hypothesized that this data could signify two
different scenarios in terms of BRCA1-associated tumorigenesis. In the first scenario, BRCA1
loss of function is not the first event in carcinogenesis and does not occur in cells that have
acquired events that render them refractive to senescence induction by BRCA1 loss. The second
possibility is that BRCA1 loss of function is the first event, leading to cellular senescence, and
these senescent cells must acquire additional event(s) that promote escape of senescence. In
either scenario, the need to understand the immediate consequences of BRCA1 loss in normal
cells is essential. In the process of uncovering these immediate consequences, we find that loss
of BRCA1 induces a novel mechanism of cellular senescence.
75
The role of DNA damage and p53 in BRCA1-loss induced senescence
Classic studies have established that DNA damage induction and consequent p53
upregulation are essential for senescence induction. It was for this reason that we examined
these factors in our model.
DNA damage response
Typically, the DNA damage response (DDR) is the major mechanism of senescence
induction. Both RS and oncogene induced senescence (OIS) occur in response to DDR
activation upregulation [94, 97]. In RS, when telomeres become critically short due to DNA
replication, the DDR is initiated, resulting in p53 stabilization and transcriptional upregulation
of p53 target genes [94]. In OIS, hyper-proliferation results in stalled replication forks, which
results in replication induced DDR upregulation, again leading to p53 stabilization and
transactivation [97]. We have found that loss of BRCA1 uncouples DNA damage from
senescence induction. We observed that BRCA1 loss does not cause cell hyper-proliferation and
DNA damage. This suggests that BRCA1 loss induced senescence does not rely on DNA
replication, but instead, results in an immediate cell cycle arrest and progressive accumulation
of β-galactosidase activity that is maximally achieved in 5 days. Although the DDR is not
engaged in response to loss of BRCA1, we find these cells are equally responsive to exogenous
stress as compared to control cells.
Although the majority of oncogenes studied so far induce senescence due to DNA
damage, senescence induction by tumor suppressors may occur in the absence of DNA damage.
In addition to our findings, senescence induced by loss of VHL or PTEN do not require DNA
damage [107, 200]. Senescence in response to loss of VHL occurs through RB activation and is
DNA damage independent [200]. Loss of PTEN also results in DNA damage independent
senescence but is accompanied with p53 upregulation [107]. Senescence in the absence of DNA
damage may also be cell type dependent. A recent publication demonstrated that HMEC OIS
(hRASV12) could also occur in the absence of DNA damage [201]. Since RAS-induced
senescence in mesenchymal cells is classically associated with DNA damage, these data
question the role of DNA damage during senescence in epithelial cells.
76
p53 regulation
p53 is a well known tumor suppressor that is exquisitely sensitive to cellular stress. It
acts as a barometer for the type and intensity of stress. For example, in response to oncogene
activation (e.g. RAS) and moderate DNA damage, p53 induces senescence [58, 103]. while in
response to intense damage, p53 transcribes pro-apoptotic genes to induce apoptosis [58].
Senescence typically results in p53 upregulation due to DNA damage, which activates the DDR.
CHK2, when activated by phosphorylation [69], stabilizes p53 leading to increased p53 protein
levels which leads to senescence induction.
We find that in loss of BRCA1 induced senescence in HMECs, p53 levels are down-
regulated and p53 is not required for loss of BRCA1 induced senescence. This was in stark
contrast to previously published reports whereby loss of BRCA1 in MEFs results in p53-
dependent senescence [156] and the combined inactivation of BRCA1 and p53 gives rise to
tumors in the mouse mammary gland [48]. We also observed that down regulation of p53 was
not unique to BRCA1 loss. OIS (via over expression of hRASV12
), loss of BRCA2, and even RS
was accompanied with the down regulation of p53 protein levels in HMECs. Since these data
were in opposition to that previously published using mesenchymal cells, we compared
senescence induction in fibroblasts to that in epithelial cells. We demonstrated that in response
to BRCA1 loss, upregulation of p53 does occur in fibroblasts, both in IMR90 and normal
mammary fibroblasts, whereas in epithelial cells p53 is downregulated. We conclude that the
role of p53 in response to cellular stress may be cell type dependent. During the writing of this
thesis, the novel observation that p53 protein levels are down regulated in senescent HMEC was
reported by another group. Similar to our findings, Cipriano et. al. have also found reduced p53
protein levels in response to hRASV12
induced senescence. These results further highlight
important differences between epithelial and mesenchymal cells in response to cellular stress.
In response to BRCA1 loss, we found that p53 is shuttled to the cytoplasm and targeted
for proteasome mediated degradation. We demonstrated by immunocytochemistry that as the
senescence phenotype is induced, p53 is gradually shuttled to the cytoplasm. The levels of p53
protein also gradually decrease over 5 days and this decrease occurs simultaneously with p53
mislocalization. Despite the reduced levels of p53 in response to BRCA1 loss, p53 is still
77
transcriptionally active. Several p53 target antioxidant genes, including SESN2, HMOX1,
TP53INP1, and TP53I3 are upregulated in response to loss of BRCA1. Forced inactivation of
p53 inhibited loss of BRCA1 induced upregulation of these antioxidant genes, suggesting that
p53 plays a central role in BRCA1 loss-induced antioxidant upregulation.
Our finding that antioxidant genes are upregulated in response to BRCA1 loss in HMEC
is in opposition to previous studies. BRCA1, when upregulated, has been shown to induce the
transcription of antioxidant genes and to protect against oxidative stress [127]. In the absence of
BRCA1, antioxidant genes were found to be downregulated [127] and ROS levels were
increased [128]. Authors of both of these studies used MEF isolated from BRCA1 knock-out
mice in addition to the breast cancer cell line, MCF7, to conduct their experiments. We think
that a possible reason why our results are in opposition to those previously published by others
is due to differences in cell type specificity. Our study utilized normal epithelial cells and we
and others have already shown key differences between senescence mechanisms in epithelial
versus fibroblast cells. This may account for the differences between MEF and HMEC, in
addition to species differences.
Although loss of BRCA1 results in senescence in the absence of p53, it appears that p53
plays a role in maintaining senescence. We have found that in the absence of p53, cells with loss
of BRCA1 acquire increased levels of ROS and show increased cell death. We hypothesize that
p53 at lower levels upregulates antioxidant genes to quench ROS levels. This results in
maintaining ROS levels below a threshold that would otherwise induce cell death in response to
loss of BRCA1.
The role ROS and autophagy in response to loss of BRCA1
Autophagy induction and ROS regulation are both not only associated with senescence
but are also important processes in tumor formation. In this study we have been able to explore
the role of both these processes as they relate to senescence.
ROS regulation
The upregulation of ROS plays an integral role in senescence induction. The role of ROS
in senescence was first appreciated when cells cultured at lower O2 showed increased lifespan
78
[73]. Since then, a number of reports have documented increased ROS levels in response to
oncogene activation [74, 172] and have shown that senescence can be averted if ROS levels are
inhibited [73, 202]. We have found that ROS is differentially regulated in HMECs in an inducer
specific manner. In HMECs undergoing replicative senescence or RAS-induced senescence,
ROS levels were surprisingly downregulated as compared to control cells, while ROS levels
were increased in response to loss of BRCA1 induced senescence. Others have also reported
that BRCA1 loss in MEFs is associated with increased levels of ROS [127, 128]. These findings
were attributed to down regulation of antioxidant gene expression in response to BRCA1 loss.
In HMECs, we find that loss of BRCA1 induces upregulation of p53 dependent antioxidant
genes that appear to play an important role in quenching ROS levels to maintain cell viability.
The loss of p53 or SESN2 in combination with loss of BRCA1 resulted in increased cell death,
presumably due to deleterious ROS levels. Upregulation of an antioxidant program is likely
initiated in response to increased ROS levels. The mechanism that results in ROS upregulation
following BRCA1 loss remains unknown. Increased ROS may be due to increased
mitochondrial metabolism. Recent studies using cancer cell lines and MEFs have demonstrated
that RAS-induced tumorigenesis increases mitochondria metabolism and as a consequence,
leads to increased oxidative stress that is required for anchorage independent growth [74, 203].
Although we have observed an increase in mitochondria numbers by EM, we have not
quantified our findings or probed with mitochondria specific markers. Understanding the
consequences of BRCA1 on mitochondria metabolism requires further study.
Persistent ROS accumulation may increase the susceptibility of cells to genomic
instability, leading to increased predisposition to tumorigenesis. This could be one explanation
for the increased risk of tumor development due to BRCA1 loss of function. Human mammary
epithelial cells that acquire other forms of aberrations (such as oncogenic RAS), maintain
reduced levels of ROS, thereby decreasing the chances of genomic instability. Perhaps, it is the
unique consequence of ROS upregulation in response to loss of BRCA1 that drives BRCA1
related tumor formation.
Autophagy induction
Autophagy has been shown to play a role in senescence [75]. Autophagy not only
removes wastes from cells and recycles cellular components, but is also an adaptation
79
mechanism during times of stress and starvation as it generates energy. We have found that loss
of BRCA1 results in the induction of autophagy. We were also able to uncover the mechanism
by which autophagy is induced. As described above, p53 levels are down regulated in response
to loss of BRCA1, resulting in the upregulation of the antioxidant gene, SESN2. It has recently
been found that SESN2 serves an antioxidant independent function as well. SESN2
phosphorylates AMPK and forms a complex with AMPK, TSC1, and TSC2 to indirectly inhibit
mTOR [198], thus activating autophagy [84]. We have found that in HMECs, autophagy is
induced in a p53 dependent manner through SESN2. In cells with loss of BRCA1, reduced
levels of p53 upregulate SESN2, resulting in the phosphorylation of AMPK and the induction of
autophagy. In the absence of SESN2, the induction of autophagy in these cells is abrogated.
Autophagy is known to play both a tumor suppressive and an oncogenic role. On the one
hand, it has been demonstrated that autophagy is an important mechanism in senescence and can
act as a tumor suppressor [204, 205]. On the other hand, autophagy induction has been shown to
promote cancer cell survival in several studies [206]. We have found that in the absence of
autophagy, loss of BRCA1 induced senescence is delayed, but not bypassed, indicating that
autophagy is not absolutely required for senescence. Since autophagy has a tumor promoting
function, we think that perhaps combining autophagy activation with additional mutation events
that result in bypass of loss of BRCA1 induced senescence may lead to tumorigenesis.
Significant findings
Our most striking finding was that loss of BRCA1 induced senescence is not dependent
on p53, RB, ROS upregulation, or autophagy induction. This demonstrates that BRCA1 loss
results in a novel type of senescence that is mechanistically different from that which has been
previously described. We think that although p53 is not required for the induction of loss of
BRCA1 senescence, it might be required for bypass along with additional events. A recently
published report demonstrated that in HMECs, RAS induced senescence was p53 independent,
but could be bypassed with the down regulation of p53 together with TGFβ inhibition [201].
We think that our results regarding SESN2 provide important links between p53, ROS,
and autophagy. Since SESN2 plays a dual role of inhibiting ROS and inducing autophagy in
response to loss of BRCA1, we think that we have uncovered an important element in
80
senescence induction. Inhibition of SESN family members has been shown to be associated with
mutagenesis in response to expression of oncogenic RAS [207]. The expression of SESN genes
was able to reduce ROS levels in response to oncogenic RAS and decrease the rate of
tumorigenesis. We hypothesize that loss of SESN2 function might be an additional event that
drives BRCA1 tumorigenesis.
Conclusion
In summary, we find that loss of BRCA1 results in a down regulation of p53 and an
upregulation of ROS and autophagy (Fig. 25). We have mechanistically linked the p53-
downstream gene, SESN2, to the regulation of ROS and autophagy in response to BRCA1 loss.
Although ROS levels appear to be quenched by SESN2, more work needs to be done to identify
how ROS gets upregulated in response to loss of BRCA1. Although p53 is seemingly central in
our model, it is not required for the induction of senescence since senescence can be induced in
its absence. It does, however, function in maintaining the senescence phenotype since β-
galactosidase expression is diminished in its absence. It remains to be explored if coupling loss
of p53 and autophagy would be sufficient for bypass of BRCA1 loss-induced senescence. In
summary, we conclude that loss of BRCA1 induced senescence in HMECs is unique from
previously described phenotypes of senescence. It is, therefore essential to further explore the
underlying causes of senescence induction and the events that result in its bypass.
Figure 25. Summary of the consequences of BRCA1 loss in normal mammary epithelial cells.
81
References
1. http://www.cancer.ca/. Breast cancer statistics. In Canadian Cancer Society, Edition 2010. 2. http://seer.cancer.gov/statfacts/html/breast.html. SEER Stat Fact Sheets: Breast. In National Cancer Institute, Edition 2009. 3. http://www.cancer.gov/cancertopics/pdq/treatment/breast/HealthProfessional/page2. Cellular Classification of Breast Cancer. In National Cancer Institute, Edition 2010. 4. Perou CM, Sorlie T, Eisen MB et al. Molecular portraits of human breast tumors. Nature 2000; 406: 747-752. 5. Sorlie T, Perou CM, Tibshirani R et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U S A 2001; 98: 10869-10874. 6. Ross DT, Scherf U, Eisen MB et al. Systematic variation in gene expression patterns in human cancer cell lines. Nat Genet 2000; 24: 227-235. 7. Perou CM, Jeffrey SS, van de Rijn M et al. Distinctive gene expression patterns in human mammary epithelial cells and breast cancers. Proc Natl Acad Sci U S A 1999; 96: 9212-9217. 8. Hu Z, Fan C, Oh DS et al. The molecular portraits of breast tumors are conserved across microarray platforms. BMC Genomics 2006; 7: 96. 9. Sorlie T, Tibshirani R, Parker J et al. Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc Natl Acad Sci U S A 2003; 100: 8418-8423. 10. van 't Veer LJ, Dai H, van de Vijver MJ et al. Gene expression profiling predicts clinical outcome of breast cancer. Nature 2002; 415: 530-536. 11. Liu S, Chia SK, Mehl E et al. Progesterone receptor is a significant factor associated with clinical outcomes and effect of adjuvant tamoxifen therapy in breast cancer patients. Breast Cancer Res Treat 2010; 119: 53-61. 12. Paik S, Shak S, Tang G et al. A multigene assay to predict recurrence of tamoxifen-treated, node-negative breast cancer. N Engl J Med 2004; 351: 2817-2826. 13. Cheang MC, Chia SK, Voduc D et al. Ki67 index, HER2 status, and prognosis of patients with luminal B breast cancer. J Natl Cancer Inst 2009; 101: 736-750. 14. Nielsen TO, Parker JS, Leung S et al. A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor-positive breast cancer. Clin Cancer Res 2010; 16: 5222-5232. 15. Slamon DJ, Clark GM, Wong SG et al. Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 1987; 235: 177-182. 16. Carter P, Presta L, Gorman CM et al. Humanization of an anti-p185HER2 antibody for human cancer therapy. Proc Natl Acad Sci U S A 1992; 89: 4285-4289. 17. Baselga J, Tripathy D, Mendelsohn J et al. Phase II study of weekly intravenous recombinant humanized anti-p185HER2 monoclonal antibody in patients with HER2/neu-overexpressing metastatic breast cancer. J Clin Oncol 1996; 14: 737-744. 18. Kreike B, van Kouwenhove M, Horlings H et al. Gene expression profiling and histopathological characterization of triple-negative/basal-like breast carcinomas. Breast Cancer Res 2007; 9: R65. 19. Nielsen TO, Hsu FD, Jensen K et al. Immunohistochemical and clinical characterization of the basal-like subtype of invasive breast carcinoma. Clin Cancer Res 2004; 10: 5367-5374. 20. Langerod A, Zhao H, Borgan O et al. TP53 mutation status and gene expression profiles are powerful prognostic markers of breast cancer. Breast Cancer Res 2007; 9: R30. 21. Manie E, Vincent-Salomon A, Lehmann-Che J et al. High frequency of TP53 mutation in BRCA1 and sporadic basal-like carcinomas but not in BRCA1 luminal breast tumors. Cancer Res 2009; 69: 663-671.
82
22. Petitjean A, Achatz MI, Borresen-Dale AL et al. TP53 mutations in human cancers: functional selection and impact on cancer prognosis and outcomes. Oncogene 2007; 26: 2157-2165. 23. Liedtke C, Mazouni C, Hess KR et al. Response to neoadjuvant therapy and long-term survival in patients with triple-negative breast cancer. J Clin Oncol 2008; 26: 1275-1281. 24. Rouzier R, Perou CM, Symmans WF et al. Breast cancer molecular subtypes respond differently to preoperative chemotherapy. Clin Cancer Res 2005; 11: 5678-5685. 25. Livasy CA, Karaca G, Nanda R et al. Phenotypic evaluation of the basal-like subtype of invasive breast carcinoma. Mod Pathol 2006; 19: 264-271. 26. Dent R, Trudeau M, Pritchard KI et al. Triple-negative breast cancer: clinical features and patterns of recurrence. Clin Cancer Res 2007; 13: 4429-4434. 27. Dabbs DJ, Chivukula M, Carter G, Bhargava R. Basal phenotype of ductal carcinoma in situ: recognition and immunohistologic profile. Mod Pathol 2006; 19: 1506-1511. 28. Bryan BB, Schnitt SJ, Collins LC. Ductal carcinoma in situ with basal-like phenotype: a possible precursor to invasive basal-like breast cancer. Mod Pathol 2006; 19: 617-621. 29. Gauthier ML, Berman HK, Miller C et al. Abrogated response to cellular stress identifies DCIS associated with subsequent tumor events and defines basal-like breast tumors. Cancer Cell 2007; 12: 479-491. 30. Kerlikowske K, Molinaro AM, Gauthier ML et al. Biomarker expression and risk of subsequent tumors after initial ductal carcinoma in situ diagnosis. J Natl Cancer Inst 2010; 102: 627-637. 31. Ben-Porath I, Thomson MW, Carey VJ et al. An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat Genet 2008; 40: 499-507. 32. Malkin D, Li FP, Strong LC et al. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 1990; 250: 1233-1238. 33. Birch JM, Blair V, Kelsey AM et al. Cancer phenotype correlates with constitutional TP53 genotype in families with the Li-Fraumeni syndrome. Oncogene 1998; 17: 1061-1068. 34. Birch JM, Alston RD, McNally RJ et al. Relative frequency and morphology of cancers in carriers of germline TP53 mutations. Oncogene 2001; 20: 4621-4628. 35. Nelen MR, Padberg GW, Peeters EA et al. Localization of the gene for Cowden disease to chromosome 10q22-23. Nat Genet 1996; 13: 114-116. 36. Liaw D, Marsh DJ, Li J et al. Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet 1997; 16: 64-67. 37. Starink TM. Cowden's disease: analysis of fourteen new cases. J Am Acad Dermatol 1984; 11: 1127-1141. 38. Jenne DE, Reimann H, Nezu J et al. Peutz-Jeghers syndrome is caused by mutations in a novel serine threonine kinase. Nat Genet 1998; 18: 38-43. 39. Boardman LA, Thibodeau SN, Schaid DJ et al. Increased risk for cancer in patients with the Peutz-Jeghers syndrome. Ann Intern Med 1998; 128: 896-899. 40. Izatt L, Greenman J, Hodgson S et al. Identification of germline missense mutations and rare allelic variants in the ATM gene in early-onset breast cancer. Genes Chromosomes Cancer 1999; 26: 286-294. 41. Ford D, Easton DF, Stratton M et al. Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. The Breast Cancer Linkage Consortium. Am J Hum Genet 1998; 62: 676-689. 42. Newman B, Austin MA, Lee M, King MC. Inheritance of human breast cancer: evidence for autosomal dominant transmission in high-risk families. Proc Natl Acad Sci U S A 1988; 85: 3044-3048. 43. Wooster R, Neuhausen SL, Mangion J et al. Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science 1994; 265: 2088-2090.
83
44. Foulkes WD, Stefansson IM, Chappuis PO et al. Germline BRCA1 mutations and a basal epithelial phenotype in breast cancer. J Natl Cancer Inst 2003; 95: 1482-1485. 45. Melchor L, Honrado E, Garcia MJ et al. Distinct genomic aberration patterns are found in familial breast cancer associated with different immunohistochemical subtypes. Oncogene 2008; 27: 3165-3175. 46. Hakem R, de la Pompa JL, Sirard C et al. The tumor suppressor gene Brca1 is required for embryonic cellular proliferation in the mouse. Cell 1996; 85: 1009-1023. 47. Gowen LC, Johnson BL, Latour AM et al. Brca1 deficiency results in early embryonic lethality characterized by neuroepithelial abnormalities. Nat Genet 1996; 12: 191-194. 48. Xu X, Qiao W, Linke SP et al. Genetic interactions between tumor suppressors Brca1 and p53 in apoptosis, cell cycle and tumorigenesis. Nat Genet 2001; 28: 266-271. 49. Mommers EC, van Diest PJ, Leonhart AM et al. Balance of cell proliferation and apoptosis in breast carcinogenesis. Breast Cancer Res Treat 1999; 58: 163-169. 50. Hahn WC, Counter CM, Lundberg AS et al. Creation of human tumor cells with defined genetic elements. Nature 1999; 400: 464-468. 51. Hurlin PJ, Maher VM, McCormick JJ. Malignant transformation of human fibroblasts caused by expression of a transfected T24 HRAS oncogene. Proc Natl Acad Sci U S A 1989; 86: 187-191. 52. Sager R, Tanaka K, Lau CC et al. Resistance of human cells to tumorigenesis induced by cloned transforming genes. Proc Natl Acad Sci U S A 1983; 80: 7601-7605. 53. Newbold RF, Overell RW. Fibroblast immortality is a prerequisite for transformation by EJ c-Ha-ras oncogene. Nature 1983; 304: 648-651. 54. Land H, Parada LF, Weinberg RA. Tumorigenic conversion of primary embryo fibroblasts requires at least two cooperating oncogenes. Nature 1983; 304: 596-602. 55. Kiyono T, Foster SA, Koop JI et al. Both Rb/p16INK4a inactivation and telomerase activity are required to immortalize human epithelial cells. Nature 1998; 396: 84-88. 56. Elenbaas B, Spirio L, Koerner F et al. Human breast cancer cells generated by oncogenic transformation of primary mammary epithelial cells. Genes Dev 2001; 15: 50-65. 57. Zhao JJ, Gjoerup OV, Subramanian RR et al. Human mammary epithelial cell transformation through the activation of phosphatidylinositol 3-kinase. Cancer Cell 2003; 3: 483-495. 58. Rebbaa A, Zheng X, Chou PM, Mirkin BL. Caspase inhibition switches doxorubicin-induced apoptosis to senescence. Oncogene 2003; 22: 2805-2811. 59. Campisi J, d'Adda di Fagagna F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol 2007; 8: 729-740. 60. Demidenko ZN, Zubova SG, Bukreeva EI et al. Rapamycin decelerates cellular senescence. Cell Cycle 2009; 8: 1888-1895. 61. Narita M, Nunez S, Heard E et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell 2003; 113: 703-716. 62. Zhang R, Chen W, Adams PD. Molecular dissection of formation of senescence-associated heterochromatin foci. Mol Cell Biol 2007; 27: 2343-2358. 63. Di Leonardo A, Linke SP, Clarkin K, Wahl GM. DNA damage triggers a prolonged p53-dependent G1 arrest and long-term induction of Cip1 in normal human fibroblasts. Genes Dev 1994; 8: 2540-2551. 64. Xiong Y, Hannon GJ, Zhang H et al. p21 is a universal inhibitor of cyclin kinases. Nature 1993; 366: 701-704. 65. Bringold F, Serrano M. Tumor suppressors and oncogenes in cellular senescence. Exp Gerontol 2000; 35: 317-329. 66. Jacobs JJ, Kieboom K, Marino S et al. The oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a locus. Nature 1999; 397: 164-168.
84
67. Khanna KK, Keating KE, Kozlov S et al. ATM associates with and phosphorylates p53: mapping the region of interaction. Nat Genet 1998; 20: 398-400. 68. Tibbetts RS, Brumbaugh KM, Williams JM et al. A role for ATR in the DNA damage-induced phosphorylation of p53. Genes Dev 1999; 13: 152-157. 69. Shieh SY, Ahn J, Tamai K et al. The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites. Genes Dev 2000; 14: 289-300. 70. Chehab NH, Malikzay A, Appel M, Halazonetis TD. Chk2/hCds1 functions as a DNA damage checkpoint in G(1) by stabilizing p53. Genes Dev 2000; 14: 278-288. 71. Liu Q, Guntuku S, Cui XS et al. Chk1 is an essential kinase that is regulated by Atr and required for the G(2)/M DNA damage checkpoint. Genes Dev 2000; 14: 1448-1459. 72. Meulmeester E, Pereg Y, Shiloh Y, Jochemsen AG. ATM-mediated phosphorylations inhibit Mdmx/Mdm2 stabilization by HAUSP in favor of p53 activation. Cell Cycle 2005; 4: 1166-1170. 73. Chen Q, Fischer A, Reagan JD et al. Oxidative DNA damage and senescence of human diploid fibroblast cells. Proc Natl Acad Sci U S A 1995; 92: 4337-4341. 74. Moiseeva O, Bourdeau V, Roux A et al. Mitochondrial dysfunction contributes to oncogene-induced senescence. Mol Cell Biol 2009; 29: 4495-4507. 75. Narita M, Young AR. Autophagy facilitates oncogene-induced senescence. Autophagy 2009; 5: 1046-1047. 76. Levine B, Klionsky DJ. Development by self-digestion: molecular mechanisms and biological functions of autophagy. Dev Cell 2004; 6: 463-477. 77. Morselli E, Galluzzi L, Kepp O et al. Anti- and pro-tumor functions of autophagy. Biochim Biophys Acta 2009; 1793: 1524-1532. 78. Hosokawa N, Hara T, Kaizuka T et al. Nutrient-dependent mTORC1 association with the ULK1-Atg13-FIP200 complex required for autophagy. Mol Biol Cell 2009; 20: 1981-1991. 79. Jung CH, Jun CB, Ro SH et al. ULK-Atg13-FIP200 complexes mediate mTOR signaling to the autophagy machinery. Mol Biol Cell 2009; 20: 1992-2003. 80. Meley D, Bauvy C, Houben-Weerts JH et al. AMP-activated protein kinase and the regulation of autophagic proteolysis. J Biol Chem 2006; 281: 34870-34879. 81. Kim J, Kundu M, Viollet B, Guan KL. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol 2011; 13: 132-141. 82. Egan DF, Shackelford DB, Mihaylova MM et al. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science 2011; 331: 456-461. 83. Crighton D, Wilkinson S, O'Prey J et al. DRAM, a p53-induced modulator of autophagy, is critical for apoptosis. Cell 2006; 126: 121-134. 84. Maiuri MC, Malik SA, Morselli E et al. Stimulation of autophagy by the p53 target gene Sestrin2. Cell Cycle 2009; 8: 1571-1576. 85. Tasdemir E, Maiuri MC, Galluzzi L et al. Regulation of autophagy by cytoplasmic p53. Nat Cell Biol 2008; 10: 676-687. 86. Coppe JP, Desprez PY, Krtolica A, Campisi J. The senescence-associated secretory phenotype: the dark side of tumor suppression. Annu Rev Pathol 2010; 5: 99-118. 87. Bavik C, Coleman I, Dean JP et al. The gene expression program of prostate fibroblast senescence modulates neoplastic epithelial cell proliferation through paracrine mechanisms. Cancer Res 2006; 66: 794-802. 88. Coppe JP, Patil CK, Rodier F et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol 2008; 6: 2853-2868. 89. Wajapeyee N, Serra RW, Zhu X et al. Oncogenic BRAF induces senescence and apoptosis through pathways mediated by the secreted protein IGFBP7. Cell 2008; 132: 363-374.
85
90. Acosta JC, O'Loghlen A, Banito A et al. Chemokine signaling via the CXCR2 receptor reinforces senescence. Cell 2008; 133: 1006-1018. 91. Kuilman T, Michaloglou C, Vredeveld LC et al. Oncogene-induced senescence relayed by an interleukin-dependent inflammatory network. Cell 2008; 133: 1019-1031. 92. Hayflick L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res 1965; 37: 614-636. 93. Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human fibroblasts. Nature 1990; 345: 458-460. 94. d'Adda di Fagagna F, Reaper PM, Clay-Farrace L et al. A DNA damage checkpoint response in telomere-initiated senescence. Nature 2003; 426: 194-198. 95. Atadja P, Wong H, Garkavtsev I et al. Increased activity of p53 in senescing fibroblasts. Proc Natl Acad Sci U S A 1995; 92: 8348-8352. 96. Bond JA, Wyllie FS, Wynford-Thomas D. Escape from senescence in human diploid fibroblasts induced directly by mutant p53. Oncogene 1994; 9: 1885-1889. 97. Di Micco R, Fumagalli M, Cicalese A et al. Oncogene-induced senescence is a DNA damage response triggered by DNA hyper-replication. Nature 2006; 444: 638-642. 98. Courtois-Cox S, Genther Williams SM, Reczek EE et al. A negative feedback signaling network underlies oncogene-induced senescence. Cancer Cell 2006; 10: 459-472. 99. Collado M, Serrano M. Senescence in tumors: evidence from mice and humans. Nat Rev Cancer 2010; 10: 51-57. 100. Gorgoulis VG, Halazonetis TD. Oncogene-induced senescence: the bright and dark side of the response. Curr Opin Cell Biol 2010; 22: 816-827. 101. Reddy JP, Li Y. Oncogene-induced senescence and its role in tumor suppression. J Mammary Gland Biol Neoplasia 2011; 16: 247-256. 102. Bartkova J, Rezaei N, Liontos M et al. Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints. Nature 2006; 444: 633-637. 103. Serrano M, Lin AW, McCurrach ME et al. Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 1997; 88: 593-602. 104. Jackson JG, Pereira-Smith OM. p53 is preferentially recruited to the promoters of growth arrest genes p21 and GADD45 during replicative senescence of normal human fibroblasts. Cancer Res 2006; 66: 8356-8360. 105. Vaziri H, West MD, Allsopp RC et al. ATM-dependent telomere loss in aging human diploid fibroblasts and DNA damage lead to the post-translational activation of p53 protein involving poly(ADP-ribose) polymerase. EMBO J 1997; 16: 6018-6033. 106. Afshari CA, Vojta PJ, Annab LA et al. Investigation of the role of G1/S cell cycle mediators in cellular senescence. Exp Cell Res 1993; 209: 231-237. 107. Alimonti A, Nardella C, Chen Z et al. A novel type of cellular senescence that can be enhanced in mouse models and human tumor xenografts to suppress prostate tumorigenesis. J Clin Invest 2010; 120: 681-693. 108. Rodier F, Coppe JP, Patil CK et al. Persistent DNA damage signalling triggers senescence-associated inflammatory cytokine secretion. Nat Cell Biol 2009; 11: 973-979. 109. Michaloglou C, Vredeveld LC, Soengas MS et al. BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 2005; 436: 720-724. 110. Chen Z, Trotman LC, Shaffer D et al. Crucial role of p53-dependent cellular senescence in suppression of Pten-deficient tumorigenesis. Nature 2005; 436: 725-730. 111. Collado M, Gil J, Efeyan A et al. Tumor biology: senescence in premalignant tumors. Nature 2005; 436: 642.
86
112. Dankort D, Filenova E, Collado M et al. A new mouse model to explore the initiation, progression, and therapy of BRAFV600E-induced lung tumors. Genes Dev 2007; 21: 379-384. 113. Majumder PK, Grisanzio C, O'Connell F et al. A prostatic intraepithelial neoplasia-dependent p27 Kip1 checkpoint induces senescence and inhibits cell proliferation and cancer progression. Cancer Cell 2008; 14: 146-155. 114. Choi J, Shendrik I, Peacocke M et al. Expression of senescence-associated beta-galactosidase in enlarged prostates from men with benign prostatic hyperplasia. Urology 2000; 56: 160-166. 115. Jacob K, Quang-Khuong DA, Jones DT et al. Genetic Aberrations Leading to MAPK Pathway Activation Mediate Oncogene-Induced Senescence in Sporadic Pilocytic Astrocytomas. Clin Cancer Res 2011. 116. Ohuchida K, Mizumoto K, Murakami M et al. Radiation to stromal fibroblasts increases invasiveness of pancreatic cancer cells through tumor-stromal interactions. Cancer Res 2004; 64: 3215-3222. 117. Parrinello S, Coppe JP, Krtolica A, Campisi J. Stromal-epithelial interactions in aging and cancer: senescent fibroblasts alter epithelial cell differentiation. J Cell Sci 2005; 118: 485-496. 118. Krtolica A, Parrinello S, Lockett S et al. Senescent fibroblasts promote epithelial cell growth and tumorigenesis: a link between cancer and aging. Proc Natl Acad Sci U S A 2001; 98: 12072-12077. 119. Hall JM, Lee MK, Newman B et al. Linkage of early-onset familial breast cancer to chromosome 17q21. Science 1990; 250: 1684-1689. 120. Scully R, Chen J, Plug A et al. Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell 1997; 88: 265-275. 121. Chen J, Silver DP, Walpita D et al. Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells. Mol Cell 1998; 2: 317-328. 122. Bhattacharyya A, Ear US, Koller BH et al. The breast cancer susceptibility gene BRCA1 is required for subnuclear assembly of Rad51 and survival following treatment with the DNA cross-linking agent cisplatin. J Biol Chem 2000; 275: 23899-23903. 123. Cortez D, Wang Y, Qin J, Elledge SJ. Requirement of ATM-dependent phosphorylation of brca1 in the DNA damage response to double-strand breaks. Science 1999; 286: 1162-1166. 124. Xu X, Weaver Z, Linke SP et al. Centrosome amplification and a defective G2-M cell cycle checkpoint induce genetic instability in BRCA1 exon 11 isoform-deficient cells. Mol Cell 1999; 3: 389-395. 125. el-Deiry WS, Tokino T, Velculescu VE et al. WAF1, a potential mediator of p53 tumor suppression. Cell 1993; 75: 817-825. 126. Zhang H, Somasundaram K, Peng Y et al. BRCA1 physically associates with p53 and stimulates its transcriptional activity. Oncogene 1998; 16: 1713-1721. 127. Bae I, Fan S, Meng Q et al. BRCA1 induces antioxidant gene expression and resistance to oxidative stress. Cancer Res 2004; 64: 7893-7909. 128. Saha T, Rih JK, Rosen EM. BRCA1 down-regulates cellular levels of reactive oxygen species. FEBS Lett 2009; 583: 1535-1543. 129. Liu X, Holstege H, van der Gulden H et al. Somatic loss of BRCA1 and p53 in mice induces mammary tumors with features of human BRCA1-mutated basal-like breast cancer. Proc Natl Acad Sci U S A 2007; 104: 12111-12116. 130. McPherson JP, Lemmers B, Hirao A et al. Collaboration of Brca1 and Chk2 in tumorigenesis. Genes Dev 2004; 18: 1144-1153. 131. Cao L, Kim S, Xiao C et al. ATM-Chk2-p53 activation prevents tumorigenesis at an expense of organ homeostasis upon Brca1 deficiency. EMBO J 2006; 25: 2167-2177. 132. Cao L, Xu X, Bunting SF et al. A selective requirement for 53BP1 in the biological response to genomic instability induced by Brca1 deficiency. Mol Cell 2009; 35: 534-541.
87
133. Lakhani SR, Chaggar R, Davies S et al. Genetic alterations in 'normal' luminal and myoepithelial cells of the breast. J Pathol 1999; 189: 496-503. 134. Larson PS, Schlechter BL, de las Morenas A et al. Allele imbalance, or loss of heterozygosity, in normal breast epithelium of sporadic breast cancer cases and BRCA1 gene mutation carriers is increased compared with reduction mammoplasty tissues. J Clin Oncol 2005; 23: 8613-8619. 135. King TA, Li W, Brogi E et al. Heterogenic loss of the wild-type BRCA allele in human breast tumorigenesis. Ann Surg Oncol 2007; 14: 2510-2518. 136. Stampfer M, Hallowes RC, Hackett AJ. Growth of normal human mammary cells in culture. In Vitro 1980; 16: 415-425. 137. Janss DH, Hillman EA, Malan-Shibley LB, Ben TL. Methods for the isolation and culture of normal human breast epithelial cells. Methods Cell Biol 1980; 21B: 107-135. 138. Debnath J, Muthuswamy SK, Brugge JS. Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in three-dimensional basement membrane cultures. Methods 2003; 30: 256-268. 139. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976; 72: 248-254. 140. Marchetti A, Pellegrini C, Buttitta F et al. Prediction of survival in stage I lung carcinoma patients by telomerase function evaluation. Lab Invest 2002; 82: 729-736. 141. Favy DA, Lafarge S, Rio P et al. Real-time PCR quantification of full-length and exon 11 spliced BRCA1 transcripts in human breast cancer cell lines. Biochem Biophys Res Commun 2000; 274: 73-78. 142. Alok Dhawan MB, Alok Pandey, Devendra Parmar. Protocol for the single cell gel electrophoresis/comet assay for rapid genotoxicity assessment. In Edition Lucknow. 143. Brenner AJ, Stampfer MR, Aldaz CM. Increased p16 expression with first senescence arrest in human mammary epithelial cells and extended growth capacity with p16 inactivation. Oncogene 1998; 17: 199-205. 144. Huschtscha LI, Noble JR, Neumann AA et al. Loss of p16INK4 expression by methylation is associated with lifespan extension of human mammary epithelial cells. Cancer Res 1998; 58: 3508-3512. 145. Romanov SR, Kozakiewicz BK, Holst CR et al. Normal human mammary epithelial cells spontaneously escape senescence and acquire genomic changes. Nature 2001; 409: 633-637. 146. Tlsty TD, Romanov SR, Kozakiewicz BK et al. Loss of chromosomal integrity in human mammary epithelial cells subsequent to escape from senescence. J Mammary Gland Biol Neoplasia 2001; 6: 235-243. 147. Stampfer MR, Garbe J, Levine G et al. Expression of the telomerase catalytic subunit, hTERT, induces resistance to transforming growth factor beta growth inhibition in p16INK4A(-) human mammary epithelial cells. Proc Natl Acad Sci U S A 2001; 98: 4498-4503. 148. Chappuis PO, Goffin J, Wong N et al. A significant response to neoadjuvant chemotherapy in BRCA1/2 related breast cancer. J Med Genet 2002; 39: 608-610. 149. Tutt AN, Lord CJ, McCabe N et al. Exploiting the DNA repair defect in BRCA mutant cells in the design of new therapeutic strategies for cancer. Cold Spring Harb Symp Quant Biol 2005; 70: 139-148. 150. Miller JH. Experiments in Molecular Genetics. Cold Spring Harbor: Cold Spring Harbor Laboratory Press 1972. 151. Dimri GP, Lee X, Basile G et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A 1995; 92: 9363-9367. 152. Stein GH, Drullinger LF, Soulard A, Dulic V. Differential roles for cyclin-dependent kinase inhibitors p21 and p16 in the mechanisms of senescence and differentiation in human fibroblasts. Mol Cell Biol 1999; 19: 2109-2117. 153. Brugarolas J, Chandrasekaran C, Gordon JI et al. Radiation-induced cell cycle arrest compromised by p21 deficiency. Nature 1995; 377: 552-557.
88
154. Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature 1993; 366: 704-707. 155. Tremain R, Marko M, Kinnimulki V et al. Defects in TGF-beta signaling overcome senescence of mouse keratinocytes expressing v-Ha-ras. Oncogene 2000; 19: 1698-1709. 156. Cao L, Li W, Kim S et al. Senescence, aging, and malignant transformation mediated by p53 in mice lacking the Brca1 full-length isoform. Genes Dev 2003; 17: 201-213. 157. Dai C, Gu W. p53 post-translational modification: deregulated in tumorigenesis. Trends Mol Med 2010; 16: 528-536. 158. Moll UM, Riou G, Levine AJ. Two distinct mechanisms alter p53 in breast cancer: mutation and nuclear exclusion. Proc Natl Acad Sci U S A 1992; 89: 7262-7266. 159. Shaulsky G, Goldfinger N, Peled A, Rotter V. Involvement of wild-type p53 protein in the cell cycle requires nuclear localization. Cell Growth Differ 1991; 2: 661-667. 160. Shaulsky G, Goldfinger N, Tosky MS et al. Nuclear localization is essential for the activity of p53 protein. Oncogene 1991; 6: 2055-2065. 161. Shieh SY, Ikeda M, Taya Y, Prives C. DNA damage-induced phosphorylation of p53 alleviates inhibition by MDM2. Cell 1997; 91: 325-334. 162. Honda R, Yasuda H. Association of p19(ARF) with Mdm2 inhibits ubiquitin ligase activity of Mdm2 for tumor suppressor p53. EMBO J 1999; 18: 22-27. 163. Lohrum MA, Woods DB, Ludwig RL et al. C-terminal ubiquitination of p53 contributes to nuclear export. Mol Cell Biol 2001; 21: 8521-8532. 164. Fukuda M, Asano S, Nakamura T et al. CRM1 is responsible for intracellular transport mediated by the nuclear export signal. Nature 1997; 390: 308-311. 165. Adachi Y, Yanagida M. Higher order chromosome structure is affected by cold-sensitive mutations in a Schizosaccharomyces pombe gene crm1+ which encodes a 115-kD protein preferentially localized in the nucleus and its periphery. J Cell Biol 1989; 108: 1195-1207. 166. Fornerod M, van Deursen J, van Baal S et al. The human homologue of yeast CRM1 is in a dynamic subcomplex with CAN/Nup214 and a novel nuclear pore component Nup88. EMBO J 1997; 16: 807-816. 167. Stade K, Ford CS, Guthrie C, Weis K. Exportin 1 (Crm1p) is an essential nuclear export factor. Cell 1997; 90: 1041-1050. 168. Lee DH, Goldberg AL. Proteasome inhibitors: valuable new tools for cell biologists. Trends Cell Biol 1998; 8: 397-403. 169. Siliciano JD, Canman CE, Taya Y et al. DNA damage induces phosphorylation of the amino terminus of p53. Genes Dev 1997; 11: 3471-3481. 170. Mallette FA, Gaumont-Leclerc MF, Ferbeyre G. The DNA damage signaling pathway is a critical mediator of oncogene-induced senescence. Genes Dev 2007; 21: 43-48. 171. Chai YL, Cui J, Shao N et al. The second BRCT domain of BRCA1 proteins interacts with p53 and stimulates transcription from the p21WAF1/CIP1 promoter. Oncogene 1999; 18: 263-268. 172. Lee AC, Fenster BE, Ito H et al. Ras proteins induce senescence by altering the intracellular levels of reactive oxygen species. J Biol Chem 1999; 274: 7936-7940. 173. Johnson TM, Yu ZX, Ferrans VJ et al. Reactive oxygen species are downstream mediators of p53-dependent apoptosis. Proc Natl Acad Sci U S A 1996; 93: 11848-11852. 174. Polyak K, Xia Y, Zweier JL et al. A model for p53-induced apoptosis. Nature 1997; 389: 300-305. 175. Macip S, Igarashi M, Berggren P et al. Influence of induced reactive oxygen species in p53-mediated cell fate decisions. Mol Cell Biol 2003; 23: 8576-8585. 176. Sablina AA, Budanov AV, Ilyinskaya GV et al. The antioxidant function of the p53 tumor suppressor. Nat Med 2005; 11: 1306-1313.
89
177. Ossovskaya VS, Mazo IA, Chernov MV et al. Use of genetic suppressor elements to dissect distinct biological effects of separate p53 domains. Proc Natl Acad Sci U S A 1996; 93: 10309-10314. 178. Wei CL, Wu Q, Vega VB et al. A global map of p53 transcription-factor binding sites in the human genome. Cell 2006; 124: 207-219. 179. Yoshida K, Yoshitomo-Nakagawa K, Seki N et al. Cloning, expression analysis, and chromosomal localization of BH-protocadherin (PCDH7), a novel member of the cadherin superfamily. Genomics 1998; 49: 458-461. 180. Fincham VJ, Chudleigh A, Frame MC. Regulation of p190 Rho-GAP by v-Src is linked to cytoskeletal disruption during transformation. J Cell Sci 1999; 112 ( Pt 6): 947-956. 181. Budanov AV, Sablina AA, Feinstein E et al. Regeneration of peroxiredoxins by p53-regulated sestrins, homologs of bacterial AhpD. Science 2004; 304: 596-600. 182. Flatt PM, Polyak K, Tang LJ et al. p53-dependent expression of PIG3 during proliferation, genotoxic stress, and reversible growth arrest. Cancer Lett 2000; 156: 63-72. 183. Okamura S, Arakawa H, Tanaka T et al. p53DINP1, a p53-inducible gene, regulates p53-dependent apoptosis. Mol Cell 2001; 8: 85-94. 184. Meiller A, Alvarez S, Drane P et al. p53-dependent stimulation of redox-related genes in the lymphoid organs of gamma-irradiated--mice identification of Haeme-oxygenase 1 as a direct p53 target gene. Nucleic Acids Res 2007; 35: 6924-6934. 185. Vile GF, Basu-Modak S, Waltner C, Tyrrell RM. Heme oxygenase 1 mediates an adaptive response to oxidative stress in human skin fibroblasts. Proc Natl Acad Sci U S A 1994; 91: 2607-2610. 186. Li Y, Huang TT, Carlson EJ et al. Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nat Genet 1995; 11: 376-381. 187. Young AR, Narita M, Ferreira M et al. Autophagy mediates the mitotic senescence transition. Genes Dev 2009; 23: 798-803. 188. Yla-Anttila P, Vihinen H, Jokitalo E, Eskelinen EL. Monitoring autophagy by electron microscopy in Mammalian cells. Methods Enzymol 2009; 452: 143-164. 189. Kirisako T, Baba M, Ishihara N et al. Formation process of autophagosome is traced with Apg8/Aut7p in yeast. J Cell Biol 1999; 147: 435-446. 190. Kabeya Y, Mizushima N, Ueno T et al. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 2000; 19: 5720-5728. 191. Kabeya Y, Mizushima N, Yamamoto A et al. LC3, GABARAP and GATE16 localize to autophagosomal membrane depending on form-II formation. J Cell Sci 2004; 117: 2805-2812. 192. Mizushima N, Yamamoto A, Hatano M et al. Dissection of autophagosome formation using Apg5-deficient mouse embryonic stem cells. J Cell Biol 2001; 152: 657-668. 193. Matsuura A, Tsukada M, Wada Y, Ohsumi Y. Apg1p, a novel protein kinase required for the autophagic process in Saccharomyces cerevisiae. Gene 1997; 192: 245-250. 194. Yan J, Kuroyanagi H, Tomemori T et al. Mouse ULK2, a novel member of the UNC-51-like protein kinases: unique features of functional domains. Oncogene 1999; 18: 5850-5859. 195. Pankiv S, Clausen TH, Lamark T et al. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J Biol Chem 2007; 282: 24131-24145. 196. Feng Z, Zhang H, Levine AJ, Jin S. The coordinate regulation of the p53 and mTOR pathways in cells. Proc Natl Acad Sci U S A 2005; 102: 8204-8209. 197. Blommaart EF, Luiken JJ, Blommaart PJ et al. Phosphorylation of ribosomal protein S6 is inhibitory for autophagy in isolated rat hepatocytes. J Biol Chem 1995; 270: 2320-2326. 198. Budanov AV, Karin M. p53 target genes sestrin1 and sestrin2 connect genotoxic stress and mTOR signaling. Cell 2008; 134: 451-460. 199. Ikeda MA, Nevins JR. Identification of distinct roles for separate E1A domains in disruption of E2F complexes. Mol Cell Biol 1993; 13: 7029-7035.
90
200. Young AP, Schlisio S, Minamishima YA et al. VHL loss actuates a HIF-independent senescence programme mediated by Rb and p400. Nat Cell Biol 2008; 10: 361-369. 201. Cipriano R, Kan CE, Graham J et al. TGF-beta signaling engages an ATM-CHK2-p53-independent RAS-induced senescence and prevents malignant transformation in human mammary epithelial cells. Proc Natl Acad Sci U S A 2011; 108: 8668-8673. 202. Parrinello S, Samper E, Krtolica A et al. Oxygen sensitivity severely limits the replicative lifespan of murine fibroblasts. Nat Cell Biol 2003; 5: 741-747. 203. Weinberg F, Hamanaka R, Wheaton WW et al. Mitochondrial metabolism and ROS generation are essential for Kras-mediated tumorigenicity. Proc Natl Acad Sci U S A 2010; 107: 8788-8793. 204. Mathew R, Kongara S, Beaudoin B et al. Autophagy suppresses tumor progression by limiting chromosomal instability. Genes Dev 2007; 21: 1367-1381. 205. Mathew R, Karp CM, Beaudoin B et al. Autophagy Suppresses Tumorigenesis through Elimination of p62. Cell 2009; 137: 1062-1075. 206. Guo JY, Chen HY, Mathew R et al. Activated Ras requires autophagy to maintain oxidative metabolism and tumorigenesis. Genes Dev 2011; 25: 460-470. 207. Kopnin PB, Agapova LS, Kopnin BP, Chumakov PM. Repression of sestrin family genes contributes to oncogenic Ras-induced reactive oxygen species up-regulation and genetic instability. Cancer Res 2007; 67: 4671-4678.