Local Tensile Stress in the Development of Posttraumatic

Research ArticleLocal Tensile Stress in the Development ofPosttraumatic Osteoarthritis

Dongyan Zhong123 Meng Zhang4 Jia Yu 12 and Zong-Ping Luo 12

1Orthopedic Institute Medical College Soochow University Suzhou Jiangsu 215006 China2Department of Orthopedics The First Affiliated Hospital of Soochow University Suzhou Jiangsu 215006 China3Suzhou Gusu District Women amp Children Health Care Institution Suzhou Jiangsu 215007 China4Huairsquoan First Peoplersquos Hospital The Affiliated Huairsquoan No 1 Peoplersquos Hospital of Nanjing Medical University HuairsquoanJiangsu 223300 China

Correspondence should be addressed to Zong-Ping Luo zongping luoyahoocom

Received 27 August 2018 Revised 7 October 2018 Accepted 25 October 2018 Published 4 November 2018

Academic Editor Magali Cucchiarini

Copyright copy 2018 DongyanZhong et alThis is an open access article distributed under theCreative CommonsAttribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

The pathogenesis of posttraumatic osteoarthritis (PTOA) remains unrevealed We speculate that cartilage crack caused by jointtrauma will induce local abnormal tensile stress leading to change in extracellular matrix (ECM) expression of chondrocytescartilage degeneration and initiation of osteoarthritis Finite element model was used to examine whether the local tensilestress could be produced around the crack Cell experiments were conducted to test the effect of tensile strain on chondrocyteECM expression Animal tests in rabbits were carried out to examine the change around the cartilage crack The resultsindicated that the local tensile stress was generated around the crack and varied with the crack angles The maximum principaltensile stress was 059 MPa around the 45∘ crack and no tensile stress was found at 90∘ 10 tensile strain could significantlypromote type I collagen mRNA expression and inhibit type II collagen and aggrecan (the proteoglycan core protein) mRNAexpression Type I collagen was detected around the 45∘ crack region in the cartilage with no change in type II collagenand proteoglycan We conclude that the local tensile stress produced around the cartilage crack can cause the change incartilage matrix expression which might lead to cartilage degeneration and initiation of osteoarthritis This study providesbiomechanical-based insight into the pathogenesis of PTOA and potentially new intervention in prevention and treatment ofPTOA

1 Introduction

Posttraumatic osteoarthritis (PTOA) is a common orthope-dic disease that may occur after joint trauma PTOA accountsfor sim12 of all cases of osteoarthritis which causes financialburden on the health care system [1 2] Until now thepathogenesis of PTOA remains unrevealed [3]

Osteoarthritis is a chronic degeneration process involvingthe entire joint including the articular cartilage subchondralbone ligaments capsule and synovial membrane [4 5] Thedegeneration of cartilage and subchondral bone sclerosis isthe main characteristic [6]The main component of cartilagematrix is gradually changed from type II collagen andproteoglycan to type I collagen [7 8] Type II collagen fibersare arranged crosswise to form a network structure in which

proteoglycans and other molecules are firmly bound together[9] This sponge-like structure provides cartilage with themost important properties of withstanding the compressionapplied to joints during daily activities [10] Type I collagenis the main component in bone ligament and tendon whichhas enormous tensile strength needed in these structures [11]This implies that a tensile stress environment may exist whenosteoarthritis occurs causing the alteration of chondrocytephenotype

Based on these changes in cartilage structure andmechanical environment during cartilage degeneration ofosteoarthritis we propose an assumption of the pathogenesisof PTOA Localized cartilage cracks may be produced afterjoint trauma inducing abnormal tensile stress around thecrack region the alteration of local mechanical environment

HindawiBioMed Research InternationalVolume 2018 Article ID 4210353 8 pageshttpsdoiorg10115520184210353

2 BioMed Research International

Figure 1 Flow diagram of the study design

further causes changes in chondrocyte phenotype down-regulation of type II collagen and proteoglycan expressionand upregulation of type I collagen expression leading tocartilage degeneration and initiation of osteoarthritis Thepresent study will verify this hypothesis both theoreticallyand experimentally The results will provide a basic biome-chanical support for future studies on the pathogenesis ofposttraumatic osteoarthritis

2 Materials and Methods

The study included three parts finite element model (FEM)cell experiments and animal tests FEMwas used to examinewhether the local tensile stress could be produced around thecrack Cell experiments were conducted to test the effect oftensile stress on chondrocyte ECM expression Animal testswere carried out to examine the cartilage change around thecrack (Figure 1)

21 Finite Element Model FEM simulated a two-dimensionalcartilage layer The cartilage thickness of 05 mm was froma typical New Zealand white rabbit sample used in theexperiment and the length of the simulated crack was 03mmThe elastic modulus and Poissonrsquos ratio were 8 MPa and042 respectively [12]The intact cartilage was first simulatedThe cracks were then analyzed at different angles from 15∘to 90∘ The surface loading was a uniform pressure of 015MPa simulating a normal loading to knee joint during dailywalking [13]

22 Cell Experiments

221 Isolation and Culture of Chondrocytes Articular car-tilage was isolated from knee joints of 4-month-old NewZealand white rabbits Briefly cartilage was asepticallyremoved chipped and then minced Diced tissue wasdigested in 02 type II collagenase (Sigma-Aldrich) for 3hours at 37∘C The suspension was filtered through a 70120583m nylon mesh Chondrocytes were centrifuged and platedin culture medium [Dulbeccorsquos modified Eagle medium(DMEM Gibco) containing 10 fetal bovine serum (FBSGibco) 100 UmL penicillin and 100 120583gmL streptomycin]Passage 2 chondrocytes were used in subsequent experiments[14]

I IIIII

Figure 2 Custom-designedmechanical loading systemThe systemcontains three parts control unit (I) silicone chambers (II) anddrive unit (III) The drive apparatus has one fixed end opposite anend which is driven by the control unit

222 Biomechanical Tests of Chondrocytes A custom-designed mechanical loading system was used to offer tensilestrain (Figure 2) The system included three parts a controlunit silicone chambers and a drive unit The chambers weremade of silicone elastomer Sylgard 184 (Dow CorningGmbH Wiesbaden Germany) with a surface measuring3 times 6 cm The chambers were sterilized and coated withfibronectin on the bottom surface before chondrocyteculture One end of the chamber was attached to the drivedevice and driven by the control unit and the other end wasfixed The arrangement enabled the entire silicon membranearea containing the cultured chondrocytes to be stretcheduniformly Chondrocytes at approximately 60 confluencewere exposed to mild (5) or excessive (10) tensile strainat 05 Hz and 3 hd for 3 days Chondrocytes withoutmechanical loading were seeded onto the same dishes for useas a control

223 Total RNA Extraction and RT-qPCR Total RNA wasextracted from chondrocytes by using TRIzol reagent (Invit-rogen USA) 1120583g of total RNA was reverse-transcribedusing a RevertAid First Strand cDNA Synthesis Kit (ThermoFisher Scientific) To quantify mRNA expression RT-qPCRwas performed using the iTaq Universal SYBR GreenSupermix kit (Bio-Rad Hercules CA USA) on a CFX96Real-Time PCR System (Bio-Rad) Relative mRNA expres-sion levels of COL1A1 (type I collagen) COL2A1 (type IIcollagen) Acan (aggrecan) and SOX9were evaluated againstGAPDH (glyceraldehyde-3-phosphate dehydrogenase) using

BioMed Research International 3

Table 1 Primer sequences of genes used for real-time PCR analysis

Gene name Primer sequence (51015840-31015840) Primer sequence (31015840-51015840)COL1A1 GGCAGATGACGCCAACG CCAGTGTCCATGTCGCAGACOL2A1 AAGCTGGTGAGAAGGGACTG GGAAACCTCGTTCACCCCTGAcan CTACACGCTACACCCTCGAC ACGTCCTCACACCAGGAAACSOX9 AAGCTCTGGAGACTTCTGAACG CGTTCTTCACCGACTTCCTCCGAPDH CTATAAATTGAGCCCGCAGC ACCAAATCCGTTGACTCCG

the formula 2-ΔΔCT The CT is determined from a log-linear plot of the PCR signal versus the cycle number andis an exponential term Using the 2-ΔΔCT method the geneexpression levels are presented as the fold change normalizedto an endogenous reference gene GAPDH and relative to theuntreated control [15] The primer sequences were listed inTable 1

23 Animal Tests

231 Animal Model The cartilage crack model was createdusing 15 four-month old New Zealand white rabbits weighed25-30 kg The study was approved by the InstitutionalAnimal Care and Use Committee The animals housed in theanimal care facility with free access to water and foods weredivided into 3 groups randomly Anesthesia was achievedthrough injecting chloral hydrate (01 gml) The skin oftheir hind legs was shaved and disinfected with entoiodinefor 3 minutes The patella was then dislocated laterally toexpose the fossa intercondyloidea of the femurThe crack wascarefully made in the middle of the femoral trochlear grooveusing a scalpel and the crack was angled in two directionsone perpendicular to the articular surface (90∘) and the otheroblique (45∘) Each animal only received one crack angleThejoint was irrigated with 09 sodium solution after operationThe patella was repositioned and the capsule and skin weresutured After operation all the animals received antibiotics(penicillin) to prevent infection [16]

232 Histology The articular cartilage was evaluated at 2 6and 20 weeks At each time point the animals (n=5) weresacrificed via overdose of chloral hydrate The knee jointswere removed and fixed in 10 neutral buffered formalin for2 days The samples were then dehydrated and embeddedin paraffin after decalcification in buffered 10 EDTA ofpH74 for 4 weeks Afterwards horizontal plane sectionsof femoral trochlear groove (5 120583m) were cut into slidesusing a microtome (RM2165 Leica Nussloch Germany)For the evaluation of proteoglycans slides were stained withsafranin-O (Sigma-Aldrich Co St Louis USA)

233 Immunohistochemistry Types I and II collagen incartilage were evaluated immunohistochemically Slides weredeparaffinized in xylene and incubated with testicularhyaluronidase (2 mgml) (Sigma-Aldrich Co St Louis USA)for 60 minutes at 37∘CThe slides were treated with 1 H

2O2

to inactivate endogenous peroxidase and 15 horse serumto eliminate nonspecific protein absorption The sectionswere incubated with antibodies of type I and II collagenrespectively (Abcam San Francisco USA) The samples werethen exposed to the secondary antibodies (PK6200 Vec-tor Laboratories Burlingame USA) and avidin Color wasdeveloped with 03 diaminobenzidine tetrahydrochloride(Sk4100 Vector Laboratories Burlingame USA)

24 Statistical Analysis All data were expressed as the meanplusmn standard deviation (SD) The differences between groupswere analyzed by one-way analysis of variance (ANOVA) andStudentrsquos unpaired t-test using SPSS 160 software (SPSS IncChicago IL USA) Significance was indicated by a P-value oflt 005

3 Results

The finite element calculation indicated that cartilage crackcould induce local tensile stress and the stress distributionaround the crack changed significantly along with crackangles (Figure 3) In the intact cartilage the maximal princi-pal stress was uniformly compressive at 015 MPa When thecrack occurred the tensile stress formed around the crackA 45∘ crack induced the maximum tensile stress (059 MPaor 39 times of the principal compressive pressure) while notensile stress was found with a 90∘ cracking

Chondrocyte test in vitro showed that 10 tensile strainincreased the expression of COL1A1 by 419 and 412respectively comparedwith the control group (P =0009) and5 tensile strain (P = 0006) Meanwhile 10 tensile straindownregulated the expression ofCOL2A1 by 117 and 120separately in contrast with the static group (P = 0008) and 5tensile strain group (P = 0001) inhibiting the mRNA level ofAcan by 203 (P = 0009) relative to the untreated cells Incontrast to the control group 10 tensile strain reduced SOX9mRNA expression by 228 (P = 0007) The mild tensilestrain (5) had little influence on the expression of thesegenes (Figure 4)

Immunohistochemical results from the animal tests illus-trated a 45∘ crack induced obvious type I collagen expressionwith the mean optical density increasing from 013 plusmn 007 at2 weeks to 019 plusmn 009 at 20 weeks However there was notype I collagen around the 90∘ crack (Figure 5) Both of typeII collagen and proteoglycan expression did not change in 45∘or 90∘ group (Figures 6 and 7)


05854

012000105000900007500060000450003000015000000-01492

0135001500

(a)

(b)

0

2648

4348

5854

4558

1962

00100200300400500600700

0 15 30 45 60 75 90

Tens

ile st

ress

(KPa

)

Crack angle (∘)

(c)

Figure 3 Finite element analysis (a) The distribution of tensile stress around the 45∘ crack and the peak was 059 MPa (b) The distributionof tensile stress around the 90∘ crack and no tensile stress existed (c) The maximal tensile stress variation with the crack angle

Rela

tive m

RNA

expr

essio

n

control

5 tensile strain

10 tensile strain

lowast

lowastlowastlowastlowastlowastlowast

lowastlowast

COLIA1 COL2A1 Acan SOX9

20

15

10

05

00

Figure 4 The mRNA expression levels of COL1A1 COL2A1 Acanand SOX9 (119899 = 3) lowastP lt 005 lowastlowastP lt 001 and lowast lowast lowastP lt 0001compared with the control group P lt 005 P lt 001 and P lt0001 in the indicated groups

4 Discussion

In the present study we identified the local tensile stressformation after the cartilage crack through finite elementanalysis discovered that the excessive tensile strain couldinduce change in chondrocyte phenotype and confirmedthe abnormal presence of type I collagen around the crackin vivo

When the joint is damaged the injury to articularcartilage appears most significant compared with other jointtissues The damage of cartilage is irreversible and may bethe mainly determinant for the development of PTOA [1718] Articular cartilage is continually subjected to repetitivecompressive loading during physical activity Chondrocytethe only cell type in cartilage is mechanically sensitiveAppropriate joint loading ensures chondrocytes maintenanceof cartilage ECM homeostasis essential for the healthyfunctioning of cartilage [19] We found that the oblique crackwith 45∘ angle could induce the maximum local tensile stresswhile the vertical crack induces no tensile stressThis suggeststhat crack angle could be an important factor for development


(a) (b) (c)

(d) (e) (f)

Figure 5 Immunohistochemical staining of type I collagen showed increase from 2 weeks to 20 weeks around the 45∘ crack but nopresentation around the 90∘ crack (a) 45∘ crack at 2 weeks (b) 45∘ crack at 6 weeks (c) 45∘ crack at 20 weeks (d) 90∘ crack at 2 weeks(e) 90∘ crack at 6 weeks (f) 90∘ crack at 20 weeks Scale bar 200 120583m

of PTOA which could also explain the fact that not all traumato cartilage resulting in OA [20]

Our study showed that 10 tensile strain significantlydecreased the expression level of COL2A1 Acan and SOX9while induced COL1A1 expression Aggrecan is the predom-inant proteoglycan in cartilage [21] Some authors foundan upregulation of collagen II mRNA in early degenerativestages corresponding with slightly increased color intensitiesin immunohistochemical studies for collagen II in deeperlayers which was a symptom of a persisting but initiallystill intact repair process Thus this symptom was followedby a decrease leading to lower type II collagen expression[22] The downregulation of COL2A1 and Acan may lead to

cartilage degeneration and initiation of OA [22] As the firstchondrogenic transcription factor SOX9 plays crucial rolesin chondrocyte differentiation and cartilage formation [23]Therefore the downregulation of SOX9 could also influencethe development of OA Type I collagen which mainly existsin tendon and fibrocartilage is also amarker of osteoarthriticchondrocytes [24] 10 tensile strain promoted the mRNAexpression of COL1A1 which was consistent with animalmodel analysis

As tensile stress is one of the causes of cartilage degen-eration it is of value to consider how to minimize thepresence of tensile stress in cartilage repair During thestudy and application of cartilage tissue engineering tensile


(a) (b) (c)

(d) (e) (f)

Figure 6 Immunohistochemical staining of type II collagen showed no significant changes from 2weeks to 20 weeks (a) 45∘ crack at 2 weeks(b) 45∘ crack at 6 weeks (c) 45∘ crack at 20 weeks (d) 90∘ crack at 2 weeks (e) 90∘ crack at 6 weeks (f) 90∘ crack at 20 weeks

stress should also be paid attention in the design of scaf-folds and cartilage materials Patients receiving rehabilitationshould be advised to stay away from any postures or move-ments that favor local tensile stress formation at the injurysites

Limitations of this study should also be addressed Wefailed to detect the suppression of type II collagen andproteoglycans around cartilage crack in vivo This might bedue to the limitation of our animalmodel In the animal studya single scratch was created on the cartilage and the inducedtensile stress was limited around the crack without significantchanges of stress formation in the remaining cartilage andsubchondral bone This might lead to a slow pace of cartilagedegeneration without obvious change in expression of type II

collagen and proteoglycans at early stage Further studies areneeded to verify the findings

5 Conclusions

This study demonstrated occurrence of local tensile stressafter cartilage injury chondrocyte phenotype changes andformation of type I collagen around the cartilage crack Thefindings suggested that the local tensile stress caused by thecrack could play important role in cartilage degeneration andinitiation of osteoarthritis after joint trauma This might pro-vide a biomechanical based insight into PTOA pathogenesisand potentially new intervention in prevention and treatmentof PTOA


(a) (b) (c)

(d) (e) (f)

Figure 7 Safranin O staining showed no significant changes from 2 weeks to 20 weeks (a) 45∘ crack at 2 weeks (b) 45∘ crack at 6 weeks (c)45∘ crack at 20 weeks (d) 90∘ crack at 2 weeks (e) 90∘ crack at 6 weeks (f) 90∘ crack at 20 weeks

Data Availability

The data used to support the findings of this study areincluded within the article

Conflicts of Interest

The authors declare no conflicts of interest

Authorsrsquo Contributions

Dongyan Zhong and Meng Zhang contributed equally to thework

Acknowledgments

This project is funded by the National Natural ScienceFoundation of China (81320108018 31570943 and 31270995)Innovation and Entrepreneurship Program of JiangsuProvince and the Priority Academic Program Developmentof Jiangsu Higher Education Institutions

References

[1] A C Thomas T Hubbard-Turner E A Wikstrom and R MPalmieri-Smith ldquoEpidemiology of posttraumatic osteoarthri-tisrdquo Journal of Athletic Training vol 52 no 6 pp 491ndash496 2017


[2] T D Brown R C Johnston C L Saltzman J L Marsh andJ A Buckwalter ldquoPosttraumatic osteoarthritis a first estimateof incidence prevalence and burden of diseaserdquo Journal ofOrthopaedic Trauma vol 20 no 10 pp 739ndash748 2006

[3] A Carbone and S Rodeo ldquoReview of current understandingof post-traumatic osteoarthritis resulting from sports injuriesrdquoJournal of Orthopaedic Research vol 35 no 3 pp 397ndash405 2017

[4] D Pereira E Ramos and J Branco ldquoOsteoarthritisrdquo ActaMedica Portuguesa vol 28 no 1 pp 99ndash106 2015

[5] M Embree M Ono T Kilts et al ldquoRole of subchondral boneduring early-stage experimental TMJ osteoarthritisrdquo Journal ofDental Research vol 90 no 11 pp 1331ndash1338 2011

[6] P M van der Kraan ldquoOsteoarthritis year 2012 in reviewBiologyrdquo Osteoarthritis and Cartilage vol 20 no 12 pp 1447ndash1450 2012

[7] M Pei C Yu and M Qu ldquoExpression of collagen type I IIand III in loose body of osteoarthritisrdquo Journal of OrthopaedicScience vol 5 no 3 pp 288ndash293 2000

[8] F Guilak R J Nims A Dicks C Wu and I MeulenbeltldquoOsteoarthritis as a disease of the cartilage pericellular matrixrdquoMatrix Biology vol 71-72 pp 40ndash50 2018

[9] J Bella and D J S Hulmes ldquoFibrillar collagensrdquo SubcellularBiochemistry vol 82 pp 457ndash490 2017

[10] A J Sophia Fox A Bedi and S A Rodeo ldquoThe basic science ofarticular cartilage structure composition and functionrdquo SportsHealth vol 1 no 6 pp 461ndash468 2009

[11] E G Canty and K Kadler ldquoCollagen fibril biosynthesis in ten-don A review and recent insightsrdquo Comparative Biochemistryand Physiology - AMolecularand Integrative Physiology vol 133no 4 pp 979ndash985 2002

[12] P Julkunen T Harjula J Iivarinen et al ldquoBiomechanical bio-chemical and structural correlations in immature and maturerabbit articular cartilagerdquo Osteoarthritis and Cartilage vol 17no 12 pp 1628ndash1638 2009

[13] K M Coughlin G D Peura B C Fleming S Hallock and BD Beynnon ldquoIn vivo loads in the medial compartment of therabbit kneerdquoClinical Biomechanics vol 20 no 9 pp 1007ndash10092005

[14] D Y Zhong X Chen W Zhang and Z P Luo ldquoExcessivetensile strain induced the change in chondrocyte phenotyperdquoActa of Bioengineering and Biomechanics vol 20 pp 3ndash10 2018

[15] A Al-Sabah P Stadnik S J Gilbert V C Duance and EJ Blain ldquoImportance of reference gene selection for articularcartilage mechanobiology studiesrdquoOsteoarthritis and Cartilagevol 24 no 4 pp 719ndash730 2016

[16] J Yu M Zhang W Zhang and Z P Luo ldquoBiomechanicalprediction of crack angle effect on local tensile stress of articularcartilagerdquo Journal of bone reports Recommendations vol 2 p 162016

[17] M K Lotz and V B Kraus ldquoNew developments in osteoarthri-tis Posttraumatic osteoarthritis pathogenesis and pharmaco-logical treatment optionsrdquo Arthritis Research ampTherapy vol 12no 3 article 211 2010

[18] M L Schenker R L Mauck and S Mehta ldquoPathogenesis andprevention of posttraumatic osteoarthritis after intra-articularfracturerdquo Journal of the American Academy of OrthopaedicSur-geons vol 22 no 1 pp 20ndash28 2014

[19] A J Grodzinsky M E Levenston M Jin and E H FrankldquoCartilage tissue remodeling in response to mechanical forcesrdquoAnnual Review of Biomedical Engineering vol 2 no 2000 pp691ndash713 2000

[20] D D Anderson S Chubinskaya F Guilak et al ldquoPost-traumatic osteoarthritis Improved understanding and oppor-tunities for early interventionrdquo Journal of Orthopaedic Researchvol 29 no 6 pp 802ndash809 2011

[21] S Kuroda K Tanimoto T Izawa S Fujihara J H Koolstra andE Tanaka ldquoBiomechanical and biochemical characteristics ofthemandibular condylar cartilagerdquoOsteoarthritis andCartilagevol 17 no 11 pp 1408ndash1415 2009

[22] A Lahm D Dabravolski H Spank H Merk J Esser and RKasch ldquoRegional differences of tibial and femoral cartilage inthe chondrocyte gene expression immunhistochemistry andcomposite in different stages of osteoarthritisrdquo Tissue amp Cellvol 49 no 2 pp 249ndash256 2017

[23] V Lefebvre R R Behringer and B de Crombrugghe ldquoL-Sox5 Sox6 and SOx9 control essential steps of the chondrocytedifferentiation pathwayrdquoOsteoarthritis and Cartilage vol 9 ppS69ndashS75 2001

[24] NMiosge MHartmann CMaelicke and R Herken ldquoExpres-sion of collagen type I and type II in consecutive stages ofhuman osteoarthritisrdquoHistochemistry and Cell Biology vol 122no 3 pp 229ndash236 2004

Stem Cells International

Hindawiwwwhindawicom Volume 2018


MEDIATORSINFLAMMATION

of

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom

The Scientific World Journal

Volume 2018

Immunology ResearchHindawiwwwhindawicom Volume 2018

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine


Behavioural Neurology

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary andAlternative Medicine

Volume 2018Hindawiwwwhindawicom

Submit your manuscripts atwwwhindawicom


Figure 1 Flow diagram of the study design

further causes changes in chondrocyte phenotype down-regulation of type II collagen and proteoglycan expressionand upregulation of type I collagen expression leading tocartilage degeneration and initiation of osteoarthritis Thepresent study will verify this hypothesis both theoreticallyand experimentally The results will provide a basic biome-chanical support for future studies on the pathogenesis ofposttraumatic osteoarthritis

2 Materials and Methods

The study included three parts finite element model (FEM)cell experiments and animal tests FEMwas used to examinewhether the local tensile stress could be produced around thecrack Cell experiments were conducted to test the effect oftensile stress on chondrocyte ECM expression Animal testswere carried out to examine the cartilage change around thecrack (Figure 1)

21 Finite Element Model FEM simulated a two-dimensionalcartilage layer The cartilage thickness of 05 mm was froma typical New Zealand white rabbit sample used in theexperiment and the length of the simulated crack was 03mmThe elastic modulus and Poissonrsquos ratio were 8 MPa and042 respectively [12]The intact cartilage was first simulatedThe cracks were then analyzed at different angles from 15∘to 90∘ The surface loading was a uniform pressure of 015MPa simulating a normal loading to knee joint during dailywalking [13]

22 Cell Experiments

221 Isolation and Culture of Chondrocytes Articular car-tilage was isolated from knee joints of 4-month-old NewZealand white rabbits Briefly cartilage was asepticallyremoved chipped and then minced Diced tissue wasdigested in 02 type II collagenase (Sigma-Aldrich) for 3hours at 37∘C The suspension was filtered through a 70120583m nylon mesh Chondrocytes were centrifuged and platedin culture medium [Dulbeccorsquos modified Eagle medium(DMEM Gibco) containing 10 fetal bovine serum (FBSGibco) 100 UmL penicillin and 100 120583gmL streptomycin]Passage 2 chondrocytes were used in subsequent experiments[14]

I IIIII

Figure 2 Custom-designedmechanical loading systemThe systemcontains three parts control unit (I) silicone chambers (II) anddrive unit (III) The drive apparatus has one fixed end opposite anend which is driven by the control unit

222 Biomechanical Tests of Chondrocytes A custom-designed mechanical loading system was used to offer tensilestrain (Figure 2) The system included three parts a controlunit silicone chambers and a drive unit The chambers weremade of silicone elastomer Sylgard 184 (Dow CorningGmbH Wiesbaden Germany) with a surface measuring3 times 6 cm The chambers were sterilized and coated withfibronectin on the bottom surface before chondrocyteculture One end of the chamber was attached to the drivedevice and driven by the control unit and the other end wasfixed The arrangement enabled the entire silicon membranearea containing the cultured chondrocytes to be stretcheduniformly Chondrocytes at approximately 60 confluencewere exposed to mild (5) or excessive (10) tensile strainat 05 Hz and 3 hd for 3 days Chondrocytes withoutmechanical loading were seeded onto the same dishes for useas a control

223 Total RNA Extraction and RT-qPCR Total RNA wasextracted from chondrocytes by using TRIzol reagent (Invit-rogen USA) 1120583g of total RNA was reverse-transcribedusing a RevertAid First Strand cDNA Synthesis Kit (ThermoFisher Scientific) To quantify mRNA expression RT-qPCRwas performed using the iTaq Universal SYBR GreenSupermix kit (Bio-Rad Hercules CA USA) on a CFX96Real-Time PCR System (Bio-Rad) Relative mRNA expres-sion levels of COL1A1 (type I collagen) COL2A1 (type IIcollagen) Acan (aggrecan) and SOX9were evaluated againstGAPDH (glyceraldehyde-3-phosphate dehydrogenase) using





23 Animal Tests




2O2



3 Results





05854

012000105000900007500060000450003000015000000-01492

0135001500

(a)

(b)

0

2648

4348

5854

4558

1962

00100200300400500600700

0 15 30 45 60 75 90

Tens

ile st

ress

(KPa

)

Crack angle (∘)

(c)


Rela

tive m

RNA

expr

essio

n

control

5 tensile strain

10 tensile strain

lowast


lowastlowast


20

15

10

05

00


4 Discussion




(a) (b) (c)

(d) (e) (f)







(a) (b) (c)

(d) (e) (f)





5 Conclusions



(a) (b) (c)

(d) (e) (f)


Data Availability






Acknowledgments


References






























of




Disease Markers



OncologyJournal of





PPAR Research



Volume 2018


Journal of

ObesityJournal of























23 Animal Tests




2O2



3 Results





05854

012000105000900007500060000450003000015000000-01492

0135001500

(a)

(b)

0

2648

4348

5854

4558

1962

00100200300400500600700

0 15 30 45 60 75 90

Tens

ile st

ress

(KPa

)

Crack angle (∘)

(c)


Rela

tive m

RNA

expr

essio

n

control

5 tensile strain

10 tensile strain

lowast


lowastlowast


20

15

10

05

00


4 Discussion




(a) (b) (c)

(d) (e) (f)







(a) (b) (c)

(d) (e) (f)





5 Conclusions



(a) (b) (c)

(d) (e) (f)


Data Availability






Acknowledgments


References






























of




Disease Markers



OncologyJournal of





PPAR Research



Volume 2018


Journal of

ObesityJournal of




















05854

012000105000900007500060000450003000015000000-01492

0135001500

(a)

(b)

0

2648

4348

5854

4558

1962

00100200300400500600700

0 15 30 45 60 75 90

Tens

ile st

ress

(KPa

)

Crack angle (∘)

(c)


Rela

tive m

RNA

expr

essio

n

control

5 tensile strain

10 tensile strain

lowast


lowastlowast


20

15

10

05

00


4 Discussion




(a) (b) (c)

(d) (e) (f)







(a) (b) (c)

(d) (e) (f)





5 Conclusions



(a) (b) (c)

(d) (e) (f)


Data Availability






Acknowledgments


References






























of




Disease Markers



OncologyJournal of





PPAR Research



Volume 2018


Journal of

ObesityJournal of




















(a) (b) (c)

(d) (e) (f)







(a) (b) (c)

(d) (e) (f)





5 Conclusions



(a) (b) (c)

(d) (e) (f)


Data Availability






Acknowledgments


References






























of




Disease Markers



OncologyJournal of





PPAR Research



Volume 2018


Journal of

ObesityJournal of




















(a) (b) (c)

(d) (e) (f)





5 Conclusions



(a) (b) (c)

(d) (e) (f)


Data Availability






Acknowledgments


References






























of




Disease Markers



OncologyJournal of





PPAR Research



Volume 2018


Journal of

ObesityJournal of




















(a) (b) (c)

(d) (e) (f)


Data Availability






Acknowledgments


References






























of




Disease Markers



OncologyJournal of





PPAR Research



Volume 2018


Journal of

ObesityJournal of















































of




Disease Markers



OncologyJournal of





PPAR Research



Volume 2018


Journal of

ObesityJournal of























of




Disease Markers



OncologyJournal of





PPAR Research



Volume 2018


Journal of

ObesityJournal of



















Documents

Local Tensile Stress in the Development of Posttraumatic