Lesson 5: Transcription & Translation

• LT: Be able to explain the process of DNA transcription.

THE BIG PICTURE!!!

DNA RNA proteinTranscription Translation

Notes from reading pgs. 425-426

• RNA = ribonucleic acid– Made of nucleotides– Sugar in nucleotides is ribose

• RNA uses uracil instead of thymine• RNA is single-stranded and not double stranded• mRNA = messenger RNA

• Carries the message of DNA from the nucleus to the cytoplasm to be made into a protein

• Transcription: the process by which DNA is copied into a complementary RNA molecule

Process & Procedure: Modeling Transcription

• Create a double stranded DNA molecule that is 15 bases long

Our Code:RED = adenine (A)BLUE = thymine (T)

YELLOW = cytosine (C)GREEN = guanine (G)

BLACK = uracil (U)Work through step #3a-f

Stop & Think

1. How is DNA transcription like DNA replication? How are the 2 processes different?

In this activity, you transcribed 2 different DNA strands. Each one was only 15 nucleotides long. That seems pretty short.a. How many different arrangements of nucleotides are possible in a strand of DNA that is 15 nucleotides long?

Same: complementary bases, DNA acts as a templateDifferent: transcription uses uracil, replication uses thymine

4^15 = 1,073,741,824 possibilities

b. How would the number in 2a compare with the number of different arrangements of nucleotides possible in a real strand of DNA?

4^80,000,000 is a ridiculously HUGE number

Notes on DNA transcription

Do the cells in your eye and your tongue have the same functions?

Do the cells in your eye and your tongue have the same proteins?

Do the cells in your eye and your tongue have the same DNA?

What have we learned?

• Proteins determine most characteristics of a cell and organism

• Information stored in DNA determines which proteins can be made by a cell

• The environment influences which proteins are made by a cell

Where is protein made in a cell?

DNA does not leave the nucleus of eukaryotic cells... but proteins are made outside of the nucleus by ribosomes

human cheekcell mitochondria

chloroplasts

nucleus

vacuole

Elodea leaf cell

(DNA here)(DNA here)

DNA does not leave the nucleus of eukaryotic cells... but proteins are made outside of the nucleus by ribosomes

nucleus(DNA here)

(DNA here)

ribosomes

(proteins made here)

(proteins made here)

DNA and ribosomes are at different locations in a prokaryoic cell.

E. coli bacteria cell

DNA

(proteins made here)ribosomes

Information flow from DNA to trait

DNA protein Observed trait

Stored in nucleus

Made by ribosomes outside of nucleus

So how does DNA get turned into a protein if it can’t leave the nucleus???

messenger RNA

• mRNA transfers information from the DNA in the nucleus to the ribosomes.

• mRNA is made in the nucleus and then travels to the cytoplasm through nuclear pores

• Ribosomes build proteins according to the mRNA information received.

Information flow from DNA to trait

DNA messengerRNA protein Observed

traitStored in nucleus

Made by ribosomes outside of nucleus

DNA information mRNA information

Transcription is the process used to convert DNA information into mRNA information.

Note: DNA does not become RNA; the information in DNA is copied as RNA

DNA messengerRNA

RNA is different than DNA

• Single strand of nucleotides

• Contains uracil (U) instead of thymine (T)

• Made of the 5-Carbon sugar Ribose instead of deoxyribose (DNA)

http://www.makingthemodernworld.org.uk/learning_modules/biology/01.TU.03/illustrations/01.IL.09.gif

Difference between DNA and RNA

DNA RNA

5-Carbon Sugar: deoxyribose

5-Carbon sugar:Ribose

A,T,C,G A,U,C,G

Double stranded Single stranded

Different Sugars

DNA

RNA

Can you spot the difference?

Different Bases

Can you spot the difference?

DNA- double stranded

RNA- single stranded

RNA and DNA Nucleotides

DNA

RNA

RNA IS COPIED FROM DNA

COPIED

RNA(single strand -

mobile)

DNA(double stranded original, protected

in nucleus)

mRNA: the messengerRNA is how the body gets information from the nucleus (DNA) to the place where protein gets made (ribosomes)

3 Types of RNA

mRNA: messenger RNA

tRNA: transfer RNA

rRNA: ribosomal RNA

THE BIG PICTURE!!!

DNA RNA proteinTranscription Translation

http://fajerpc.magnet.fsu.edu/Education/2010/Lectures/26_DNA_Transcription_files/image006.jpg

Transcription• Molecule of DNA is copied into a

complimentary mRNA strand

http://fig.cox.miami.edu/~cmallery/150/gene/c7.17.7b.transcription.jpg

RNA Polymerase

• RNA polymerase is an enzyme• Attaches to promoters (special sequences

on the DNA)• Unzips the two strands of DNA• Synthesizes the mRNA strand

https://publicaffairs.llnl.gov/news/news_releases/2005/images/RNA_polymerase309x283.jpg

Steps of Transcription

Step 1: RNA polymerase attaches to DNAStep 2: RNA polymerase unzips DNAStep 3: RNA polymerase hooks together the

nucleotides as they base-pair along the DNA template

Step 4: Completed mRNA strand leaves the nucleus

Transcription

http://fig.cox.miami.edu/~cmallery/150/gene/c7.17.7b.transcription.jpg

If the DNA code is this:

UACGAGUUACAUAAA

TACGAGTTACATAAAATGCTCAATGTATTT

What is the mRNA code?Use the bottom strand as the template for mRNA

Which proteins are made in a cell?

• Controlled by activator molecules• Bind to enhancers (segments of DNA)• “Turns on” transcription of the geneExample: Arabinose and araC protein

Information flow from DNA to trait

DNA protein Observed trait

Stored in nucleus

Made by ribosomes outside of nucleus

Information flow from DNA to trait

DNA messengerRNA protein Observed

traitStored in nucleus

Made by ribosomes outside of nucleus

Transcription

Transcription Video

Part II: Translation

LT: Be able to explain the process of translation.

THE BIG PICTURE!!!

DNA RNA proteinTranscription Translation

Information flow from DNA to trait

DNA protein Observed trait

Stored in nucleus

Made by ribosomes outside of nucleus

Information flow from DNA to trait

DNA messengerRNA protein Observed

traitStored in nucleus

Made by ribosomes outside of nucleus

Transcription

Information flow from DNA to trait

DNA messengerRNA protein Observed

traitStored in nucleus

Made by ribosomes outside of nucleus

Translation

mRNA information protein

Translation is the process used to convert mRNA information into proteins.- also known as “protein synthesis”

Note: mRNA does not become a protein, the information on mRNA is “read” and ribosomes assemble proteins from this code

messengerRNA protein

Translation

• Ribosomes use mRNA as a guide to make proteins

http://fajerpc.magnet.fsu.edu/Education/2010/Lectures/26_DNA_Transcription_files/image006.jpg

4 Components used in Translation1. mRNA- the message to be translated into protein.

2. Amino acids- the building blocks that are linked together to form the protein.

3. Ribosomes- the “machines” that carry out translation.

4. tRNA (transfer RNA)- brings an amino acid to the mRNA and ribosome.

The message

• mRNA is a strand of nucleotides– Ex. AUGCCGUUGCCA…

• Each combination of three nucleotides on the mRNA is called a codon

tRNA• Transfer RNA• Single strand of RNA that loops back on itself• Has an Amino Acid attached at one end

– Amino Acids are the building blocks of proteins• Has an anticodon at the other end

http://www.wiley.com/legacy/college/boyer/0470003790/structure/tRNA/trna_diagram.gif

What is an anticodon?

• The anticodon is a set of three nucleotides on the tRNA that are complimentary to the codon on the mRNA

http://www.wiley.com/legacy/college/boyer/0470003790/structure/tRNA/trna_diagram.gif

The Ribosome

Steps of Translation

Step 1: mRNA binds to ribosomeStep 2: tRNA anticodon attaches to the first mRNA

codonStep 3: the anticodon of another tRNA binds to the next

mRNA codonStep 4: A peptide bond is formed between the amino

acids the tRNA molecules are carrying.

Translation

Steps of Translation cont.

Step 5: After the peptide bond is formed, the first tRNA leaves. The ribosome moves down to the next codon.

Step 6: This process continues until the ribosome reaches a stop codon.

Step 7: The chain of peptides (protein) is released and the mRNA and ribosome come apart.

Translation

http://www.medicine.uottawa.ca/Pathology/devel/images/text_figure8.gif

mRNA nucleotides are translated in groups of 3 called codons.

AUGCACUGCAGUCGAUGA

CODONS

Remember…

Decoding the message…Each codon codes for a specific amino acid. 20

different amino acids can be used in different combinations to form a protein.

For example:mRNA codon amino acid

AAU asparagineCGC arginineGGG glycine

The Genetic Code

http://www.cbs.dtu.dk/staff/dave/roanoke/fig13_18.jpg

Simulation!

• I need 6 volunteers who don’t mind holding hands.

• And then one more volunteer.

Translation Video

Amino Acid sequence determines the 3-D protein shape

• Interactions between amino acids cause folding and bending of the chain

Examples: – positive (+) and negative (-) parts of amino acids are

attracted to each other.– hydrophobic regions are attracted to each other

• Foldinghttp://www.stolaf.edu/people/giannini/flashanimat/proteins/hydrophobic%20force.swf• Structure levelshttp://www.stolaf.edu/people/giannini/flashanimat/proteins/protein structure.swf

How is the amino acid sequence determined?

• The mRNA• Each codon is a code for one amino acid

DNA sequence: T A C C G A G A T T C AmRNA sequence: A U G G C U C U A A G Uamino acid sequence: Met -- Ala -- Leu -- Ser

Whole Process Video

Special Codons

• Start codon: AUG• Stop codons: UAA, UGA, UAG

Your turn:

• For each of the codons below, determine the amino acid it corresponds with:– AUG: Methionine (Met)– CCA: Proline (Pro)– UUG: Leucine (Leu)– GCA: Alanine (Ala)– UAG: STOP!

The Activity

• My desk: NUCLEUS• Your desk space is the CYTOPLASM• In your group of 3, decide who will be:

– mRNA: transcribes the DNA template and delivers the message to the cytoplasm

– rRNA: makes up the ribosome and interprets the message in codons

– tRNA: brings correct amino acids to the ribosome using anticodons

Steps:1: mRNA comes to desk to transcribe the message (can’t just copy the DNA sequence)2: Take message back to cytoplasm & ribosome.3: rRNA: breaks message into codons4: tRNA: use the codons to find the amino acids – look for the ANTICODONS that are complementary to the codons.5: Bring back the card with the correct anticodon.6: Record the word that is on the back of the card in your notebook.7: Make sure to take the card back to where you got it so other teams can use it!8: Continue finding the correct anticodon cards and record the sequence of words in order. Check your end result with me.

Share sentences in order

Repeat steps, but change roles for round 2.

1: mRNA comes to desk to transcribe the message (can’t just copy the DNA sequence)2: Take message back to cytoplasm & ribosome.3: rRNA: breaks message into codons4: tRNA: use the codons to find the amino acids – look for the ANTICODONS that are complementary to the codons.5: Bring back the card with the correct anticodon.6: Record the word that is on the back of the card in your notebook.7: Make sure to take the card back to where you got it so other teams can use it!8: Continue finding the correct anticodon cards and record the sequence of words in order. Check your end result with me.

Share sentences in order

Repeat steps, but exchange roles for round 3.

1: mRNA comes to desk to transcribe the message (can’t just copy the DNA sequence)2: Take message back to cytoplasm & ribosome.3: rRNA: breaks message into codons4: tRNA: use the codons to find the amino acids – look for the ANTICODONS that are complementary to the codons.5: Bring back the card with the correct anticodon.6: Record the word that is on the back of the card in your notebook.7: Make sure to take the card back to where you got it so other teams can use it!8: Continue finding the correct anticodon cards and record the sequence of words in order. Check your end result with me.

Share sentences.

Follow-up Questions:

• What do the following analogies from the simulation represent in a real cell?– Words– Sentence

• What may have happened in round 3 of the simulation to give us the outcomes we got?

• Do you think this happens in nature?

Amino Acids

Proteins (polypeptides)