1Proprietary & ConfidentialThe world leader in serving scienceProprietary & Confidential

Pooling of cultured samples and comparison of multistate laboratory workflows with the MagMAX sample preparation system and VetMAX quantitative polymerase chain reaction reagents for detection of Tritrichomonas foetus–colonized bullsLee EffingerLalitha PeddireddiMarilyn SimunichRichard OberstCatherine O’ConnellIvan Leyva-Baca

Oregon Department of Agriculture, Animal Health and Identification Division, Animal Health Laboratory, Salem, OR (Effinger) Department of Diagnostic Medicine/Pathobiology (Peddireddi), Kansas State University, Manhattan, KS Kansas State Veterinary Diagnostic Laboratory (Oberst), Kansas State University, Manhattan, KS Animal Health Laboratory, Idaho State Department of Agriculture, Boise, ID (Simunich) Animal Health and Food Safety Group at Life Technologies, Austin, TX (Leyva-Baca, O’Connell)

JVDI, 2014, Vol. 26(1) 72-87

2Proprietary & Confidential

Background

• 2010 AAVLD parasitology committee

• Proposed a study to determine whether T. foetus samples can be pooled in order to reduce the costs for testing

• Lee Effinger from Oregon State Department of Agriculture led Experimental Design for the project

• Marilyn Simunich Idaho State Department of Agriculture served as Study Coordinator & Data Keeper

• The Life Technologies Animal Health & Food Safety Group agreed to support the study

3Proprietary & Confidential

Objectives

1. Determine the effect of pooling a single positive sample having various CT ranges with four negative samples (1:5). If a negative effect was seen, a 1:3 pooling study would then be conducted

2. Compare different sample preparation systems and various real-time PCR (feeder lab workflows) with the 5X MagMAXTM-pathogen RNA/DNA purification kit and amplification with VetMAXTM T. foetus reagents (Life Technologies workflow)

3. Assess the specificity of the VetMAXTM T. foetus reagents by sequencing all positive samples with CT values less than 38 and suspect sample CT values between 38 and less than 40 cycles

4Proprietary & Confidential

Materials and Methods

• Sample collection (Cultured Smegma Samples)• 5 Feeder labs provided 803 samples

• 1 on the West Coast• 1 in the Southwest• 1 in the Central States • 2 in the South

• Each feeder lab ran their own protocol including sample preparation system and real-time PCR

1 Central Study lab (KSVDL) Sample preparation with MagMAXTM Real-time PCR with VetMAXTM T. foetus reagents

5Proprietary & Confidential

Cultured smegma samples provided by feeder labs

Sample Matrix

Source

# of positive

samples *

# of negative samples*

# of inconclusive samples *

Total samples

submitted

Cultured smegma samples

(A) 73 301 0 374

(B) 28 72 0 100

(C) 9 52 2 63

(D) 17 33 0 50

(F) 34 182 0 216

Total 161 640 2 803

* As reported by the feeder labs

6Proprietary & Confidential

Real Time PCR Parameters for Feeder LaboratoriesLab A Lab B Lab C Herds

1-2Lab C Herds

3-6 Lab D Lab F Study LabFinal reaction volume(µL) 20 20 25 25 25 25 25Vol. of T. foetus primer/probe per reaction (µL) 1 1 1 1 1 0.88/1.13-

F&R 1

Volume of extract per reaction(µL) 4 4 8 8 5 5 8Volume Master Mix (µL) 15 15 12.5 12.5 19 18.75 12.5Primer/probe design McMillen McMillen Vet-Max Vet-Max Vet-Max Modified

McMillen Vet-Max

Taq used Universal qPCR

Universal qPCR qPCR MM qPCR MM TaqMan

Univ.MMAbsolute

qPCR low rox mix

qPCR MM

Thermocycler AB 7500 AB 7500 Cepheid SC AB7500 AB7500 AB7500 AB7500Thermocycler mode Standard Standard Fast Standard StandardStage 1 temperature(°C) 95 95 95 95 50/95 95 95Stage 1 time (sec) 10 10 600 10 120/120 15 600Stage2 denaturation (°C) 95 95 95 97 95 95 95Stage 2 denaturation time (sec) 15 15 15 2 20 15 15Stage 2 annealing temp (°C) 55 55 55 55 60 60 55Stage 2 annealing time (sec) 45 45 45 40 45 60 45# cycles 40 40 40 40 40 45 40

Analysis threshold Fixed 2.0 Fixed 2.0Control based threshold-10%

max TF/5% max Xeno

Control based threshold-10%

max TF/5% max Xeno

Fixed 0.2 Control based threshold- 10% max TF/Xeno

Analysis baseline setting 3-15 3-15 autoPositive (Ct) <35 <35 <36 <36 <38 <37 <38

Suspect/Inconclusive(CT) 35-40 35-40 36-40 36-40 38-39 >37 38-40/Xeno 28.5-31.5

Negative(CT) >40 >40 >40 >40 >40 undetected Undetected/Xeno 28.5-31.5

Internal extraction control No No Yes <36 CT Yes <36 CT No Yes Yes CT = 28.5-31.5

7Proprietary & Confidential

Results: Individual Sample Testing

      Study Lab Result / Feeder Lab Result    

Sample Matrix

Lab Sourc

e

Sample preparati

on system

Pos/Pos

Pos/Neg

Pos/Inc

PresPos/Neg

Neg/Pos

Neg/Inc Neg/Neg Total

Percent agreemen

t

Cultured smegma samples

A Boiling 71 5 0 1 2 0 295 374 97.9B Boiling 21 10 0 0 7 0 62 100 83.0C MagMax 9 2 2 0 0 0 50 63 96.7D Boiling 17 4 0 1 0 0 28 50 90.0F Qiagen 34 0 0 1 0 0 181 21 6 99.5

Results All labs Multiple 152 21 2 3 9 0 616 803 95.6

Order of the call = KSVDL Study Lab / Feeder LaboratoryPos = positive, Neg = negative, Inc = inconclusive, PresPos= presumptive positive

Study Lab Results vs. Feeder Lab Results

8Proprietary & Confidential

Conclusions Individual Testing

• 803 smegma samples were provided by feeder labs (FL)

• All the samples were tested by study laboratory with Life Technologies workflow systems:• MagMAXTM

• VetMAXTM T. foetus reagents

• Agreement of 95.6% was reached with 768/803 samples between feeder labs and study lab

• Interestingly, Lab F reached almost 100% agreement using a different sample prep system and a modified McMillen’s assay

• Study laboratory (KSVDL) with LT protocol identified 24 more positives than the feeder laboratories. On retesting, one of the feeder labs missed 9 samples reported as positives.

9Proprietary & Confidential

Pooling Study

Laboratory ID

Positive Samples Available

Negative Samples Available

Negatives Needed

Deficit /Surplus of Negative Samples

A 77 297 308 -11 B 31 69 124 -55 C 13 50 52 -2D 21 28 84 -56F 34 181 136 +45Total 176 625 704   

Positives, presumptive positive and negative samples used from each lab for pooling

10Proprietary & Confidential

Pooling results

Sample ID*

Individual test CT

Pooled1:5 Test CT

Pooled1:3 Test CT

Study lab final call

Pooled 1:5 call

Pooled 1:3 call

1 C-6-11 35.05 Undetected Undetected Positive Negative Negative2 A-40-5 35.20 37.83 37.86 Positive Positive Positive3 A-39-2 35.41 35.93 34.82 Positive Positive Positive4 F-1-7 35.43 35.43 35.53 Positive Positive Positive5 F-18-1 35.52 36.16 34.75 Positive Positive Positive6 C-1-23 35.93 35.75 35.82 Positive Positive Positive7 B-8-4 36.02 34.91 35.59 Positive Positive Positive8 F-19-10 36.30 33.48 32.82 Positive Positive Positive

10 A-27-9 36.36 Undetected Undetected Positive Negative Negative9 B-4-1 36.45 Undetected Undetected Positive Negative Negative

11 C-6-10 37.20 Undetected 37.69 Positive Negative Positive12 A-41-2 37.89 36.92 Not tested Positive Positive Not tested13 C-4-5** 38.77 (ave of 4) Undetected Undetected Positive WFA* Negative Negative14 C-6-15** 39.09 (ave of 3) Undetected Undetected Positive WFA Negative Negative

15 A-24-10** 39.12 (ave of 2) Undetected Undetected Suspect Positive WFA Negative Negative

Effect of pooling for T. foetus samples with CT>35 after individual testing

*WFA: Suspect workflow A; ** samples confirmed T. foetus by sequencing

11Proprietary & Confidential

Pooling results

1:5 Pools• 1:5 pooling of positive samples with a CT of 35 and below were all

detected• Only 3 of 9 positive samples with CTs between 36-39.9 were detected

in 1:5 pools• Pooling at 1:5 missed 4% (7/176) of T. foetus positive samples

1:3 Pools• Only 8 of 15 positive samples with CTs between 36-39.9 were

detected in the 1:3 pools• 1:3 pooling missed 3.5% (6/176) of T. foetus positive samples

12Proprietary & Confidential

Sequencing primer design for nested PCR

(R-TFSM-primer)

(O-F-TFSM-Primer) (M13-I-F-TFSM-Primer)

(M-13-R-TFSM-primer)

TTAGCTTTCTTT GCGA T. foetus

TTAGCTAACAAT GCGA S. moskowitzi

Primers for Nested PCR Abbreviation Primer SequenceForward outer forward primer (O-F-TFSM-Primer) CCTTAGGCAATGGATGTCTTGGC

Reverse primer (R-TFSM-primer) GCGCAATGTGCATTCAAAG

M13 Forward Inner primer (M13-I-F-TFSM-Primer)

TGTAAAACGACGGCCAGTCTTACACGATGAAGAACGTTGC

M13 Reverse primer (M-13-R-TFSM-primer)

CAGGAAACAGCTATGACCGCGCAATGTGCATTCAAAG

GenBank: GQ254636.1 Simplicimonas moskowitziGenBank: AY349189.1 Tritrichomonas foetus

13Proprietary & Confidential

Sequencing results for 175 T. foetus positives

175/176 T. foetus positive samples, including three late risers, were confirmed T. foetus by DNA sequencing

14Proprietary & Confidential

Sensitivity, specificity, & predictive values of positive & negative results for all cultured smegma samples

Calculation Formula Result Result

% Sensitivity True Positives

True Positives + False Negatives X 100

175_ 175 + 0 x100

100%

% Specificity True Negatives

True Negatives + False Positives X 100

625___ 625 + 3 x100

99.52%

Predictive value of a

positive test

True Positives

True Positives + False Positives X 100

175__ 175 + 3 x100

98.31%

Predictive value of a

negative test

True Negatives

True Negatives + False Negatives X 100

625__ 625 + 0 x100

100%

* Calculations made after qPCR and sequence confirmation

15Proprietary & Confidential

Sequencing Results

• 175/176 positive samples by qPCR were able to be sequenced

• 1 sample (A-7-25) with a CT 33.95 was not able to be sequenced. • It is possible that there are point mutations in this positive sample in the

sequencing primer regions, which were designed based on a few T. foetus and a single S. moskowitzi sequences from GenBank

• Most importantly, none of the samples reported S. moskowitzi DNA sequences

16Proprietary & Confidential

Overall results

• 95.6 % agreement was reached between Study Lab (KSVDL) using Life technologies MagMAXTM and VetMAXTM T. foetus reagents and the feeder laboratories

• 1:5 Pooling it is likely to miss 4% of the positives• 1:3 Pooling it is likely to miss 3.5% of the positives

• DNA sequencing• 175/176 positive samples were confirmed to be T. foetus, the 176th

sample could not be sequenced with the primers designed for this study

17Proprietary & Confidential

AcknowledgementsLalitha Peddireddi, KSVDL – performed the study at KSVDLLee Effinger, ODA-Animal Health LaboratoryMarilyn Simunich, Idaho State Dept. of AgricultureCate O’Connell, Life TechnologiesMangkey Bounpheng, Texas Veterinary Medical Diagnostic LaboratoryDawn Bueschel, NMDA Veterinary Diagnostic ServicesMuthu Chengappa, Kansas State Veterinary Diagnostic LaboratoryAlfonso Clavijo, Texas Veterinary Medical Diagnostic LaboratoryKris A. Clothier, California Animal Health & Food Safety Lab SystemHemant K. Naikare, Texas Veterinary Medical Diagnostics LaboratoryJeff Zinza, Life TechnologiesMary Anne Williams, Life Technologies