Lab Manual

UNIVERSITY OF OTTAWA Faculty of Science

Biochemistry

BCH 3356

MOLECULAR BIOLOGY LABORATORY Fall 2011

LABORATORY MANUAL

Coordinator: Luc Poitras Technicians: Christian Prud’homme Marc Fredette Jean Kan

Biosciences 202 and 211 30 Marie Curie

i

Table of Contents

Schedule ........................................................................................................................................ iii

General information ..................................................................................................................... iv

Objectives .................................................................................................................................. iv

Organization ............................................................................................................................... v

Attendance ................................................................................................................................. v

Safety in the Laboratory ............................................................................................................. v

WHIMIS ...................................................................................................................................... vi

Evaluation ................................................................................................................................. vii

Assignments ..................................................................................................................... vii

In Lab performance .......................................................................................................... vii

Lab Notebook .................................................................................................................. viii

In lab teaching ................................................................................................................. viii

Laboratory reports .......................................................................................................... viii

Exams ................................................................................................................................ ix

General introduction for Laboratory class I-IV ............................................................................ 1

Introductory Laboratory

Basic techniques and Polymerase Chain Reaction (PCR) amplification .................................... 3

Laboratory Class I

Amplification of a target DNA sequence by PCR ..................................................................... 17

Laboratory Class II

Ligation of PCR products into a cloning vector ....................................................................... 31

Laboratory Class III

Bacterial transformation of the ligation products .................................................................. 47

Laboratory Class IV

Screening for recombinant plasmid and DNA sequencing ...................................................... 59

General introduction for Laboratory class V-VIII ........................................................................ 75

Laboratory Class V

Protein expression ................................................................................................................... 77

Laboratory Class VI

Protein purification .................................................................................................................. 89

ii

Laboratory Class VII

Western analysis and enzymatic assay (Part I) ..................................................................... 103

Laboratory Class VIII

Western analysis and enzymatic assay (Part II) .................................................................... 115

Appendices

Appendix

SI (Système International) units and prefixes ............................................................... 121

Appendix A

Laboratory notebook .................................................................................................... 122

Appendix B

In-Lab teaching .............................................................................................................. 127

Appendix C

Laboratory reports ........................................................................................................ 128

Appendix D: Calculations

Appendix D1 : Serial dilution ......................................................................................... 130

Appendix D2 : Beer-Lambert Law ................................................................................. 132

Appendix D3 : Percentage of error ............................................................................... 134

Appendix D4 : Insert/vector molar ratio for ligation .................................................... 135

Appendix D5 : Bacterial competency ............................................................................ 136

Appendix E : Techniques

Appendix E1 : Agarose gel casting ................................................................................ 137

Appendix E2 : Estimation of length and amount of DNA bands ................................... 138

Appendix E3 : DNA purification by affinity chromatography ....................................... 139

Glossary ................................................................................................................................. 140

iii

Schedule fall 2011

Section Schedule

Detailed Schedule

WEEK LAB Due dates

1 September 12-15 Introduction

2 September 19-22 Lab 1 : PCR amplification

3 September 26-29 Lab 2 : Ligation

4 October 3-6 Lab 3 : Transformation First assignment report for

section Materials and methods, results and discussion

5 October 10-13 No lab

6 October 17-20 Lab 4 : Screening and DNA sequencing Second assignment report for

section introduction

7 October 24-27 Reading week

8 Oct 31-Nov 3 Practical Exam

9 November 7-10 Lab 5 : Protein expression First Formal Lab report

10 November 14-17 Lab 6 : Protein purification

11 November 21-24 Lab 7 : Western and enzymatic assay

12 Nov 28-Dec 1 Lab 8 : Western and enzymatic assay

13 December Final Exam

14 December 12-15 No Lab Second Formal Lab report

LAB SECTION

DAY/TIME

AA, AB Monday / 11:30 – 17:30

BA, BB Tuesday / 13:00 – 19:00

CA Wednesday / 11:30 – 17:30

DA, DD Thursday / 11:30 – 17:30

All sections DGD Thursday / 8:30 – 10:00, TBT333

All sections DGD Friday / 14:30 – 16:00, MNT203

iv

General information

Web site: Course BCH3356 – Molecular Biology Laboratory is on the virtual campus of the University of Ottawa. On this site, you will find this manual, video demonstrations of specific techniques, lab results as well as discussion forums.

Lab coordinator: Luc Poitras Office: GNN170A, Tel; 2039

Office/lab hours: Monday to Thursday 13:00 to 17:00 [email protected]

Teaching Assistants (TAs): During the course of this lab, you will be supervised by a TA. Each TA will be responsible for eight lab stations corresponding to 16 students. TAs will evaluate your In-lab performance, mark your assignments and your lab reports as well as answer your questions.

A list containing the contact information for all TAs will be available on virtual campus.

Objectives:

The Molecular Biology Laboratory (BCH3356) is intended to introduce you to a variety of techniques required to conduct research in the field of molecular biology. During the course of this laboratory, you will first employ these techniques to characterize a mutation that has been introduced into the gene coding sequence of an enzyme. Subsequently, you will express and purify this enzyme with the goal of assessing the effect of this mutation on the enzyme’s enzymatic activity. Upon completion of this project, you should have gained an understanding of the techniques and skills used in a molecular biology laboratory. In addition, you will learn to write laboratory reports modeled on those present in scientific literature. We can summarize these goals into five specific objectives:

1. To provide you with essential laboratory skills and 'hands on' experience in performing basic molecular biology techniques.

2. To introduce you to the theory behind each technique and to describe common applications of each methodology in molecular biology.

3. To teach you how to explore the scientific literature and to use various bioinformatics web sites.

4. To provide you with experience in scientific communication, in the form of In-lab teaching and laboratory reports.

5. To prepare you for a future career in research.

mailto:[email protected]

v

Course Organization:

1. There will be seven laboratory sections from Monday to Thursday. All laboratory sessions will be held in the afternoon from 11:30 to 17:30 or from 13:00 to 19:00 (See Section schedule on page iii).

2. The first laboratory session (Introduction) will take place on the week of September 12th. During this session you will be grouped in teams of two students (If you do not have a partner, we will help you find one). Your group number will determine the TA who will supervise your lab work.

3. Following the introduction session, there will be eight 6-hour sessions (See Detailed schedule on page iii).

4. Every week, two discussion groups will be held. You can choose to attend one of the two sessions. Thursday’s DGD will be held in Tabaret 333 (TBT333) from 8h30 to 10h whereas Friday’s DGD will be presented in Montpetit 203 (MNT203) from 14h30 to 16h. Topics covered at the DGD will include: the theory behind the techniques used in the lab, exercises involving common calculations seen in molecular biology and lectures on how to write scientific reports. Attendance at the DGD is highly recommended.

Attendance:

1. Attendance at laboratory sessions is compulsory. If you miss a laboratory session, you need to justify your absence to the course coordinator and provide the necessary documentation. Medical certificates issued by a licensed physician must be provided. For an unjustified absence, a mark of zero (0) will be automatically assigned for the corresponding laboratory session.

2. Absences at two lab sessions or more, even if they are justified, will result in a final grade of “Incomplete” for the BCH3356 lab. If you have two justified laboratory absences, consult the lab coordinator as soon as possible in order to make up for the missed sessions on a different day.

Safety in the laboratory

It is extremely important to work safely in a laboratory environment. Please read y the following general guidelines carefully:

General Laboratory guidelines

There will be no drinking, eating or makeup application in the laboratory at any time.

Long hair must be tied back or restrained.

Never pipette anything by mouth.

Your lab coat must be worn and properly fastened at all times. It must not be worn in non-laboratory areas. Failure to wear a lab coat will result in expulsion from the lab and loss of marks for that experiment. This rule will be strictly enforced.

vi

Wear latex or plastic gloves to protect your skin from exposure to chemicals or infectious materials. (This is normally indicated in the lab manual). Gloves will not be provided by the lab, you will have to buy them.

You must remove your gloves and immediately wash your hands before leaving the laboratory and at any time after handling materials known or suspected to be contaminated. You may also have to remove your gloves to handle certain instruments. Gloves should be removed carefully and disposed with other laboratory waste. If you have, or think you are developing, a latex allergy, be sure to inform your TA or a member of the staff.

Wear safety glasses for all procedures. Contact lenses should only be worn when other forms of corrective eyewear are not suitable. Contact lenses should not be worn when you are working with volatile solvents.

Use a fume hood when working with volatile chemicals.

Keep your working space clean and free from clutter. Personal belongings such as books, bags and coats should be left in lockers outside the lab.

Familiarize yourself with the location of fire extinguishers, eye wash stations, showers and first aid stations.

Dispose of waste in the appropriately labeled containers. If you are not sure, ask first.

If an accident or a spill occurs, or if you believe that you have been exposed to hazardous materials, start a washing procedure and inform your TA or a member of the staff immediately.

WHIMIS Federal legislation such as the Workplace Hazardous Materials Information System (WHIMIS)

requires that all hazardous substances, including microorganisms, be labeled and that a Material Safety Data Sheet (MSDS) accompany each hazardous substance. An MSDS describes hazardous properties, handling and storage precautions, as well as decontamination procedures for a particular substance. Through different computers in the lab, you have online access to the MSDS for all reagents used during a laboratory session (Click on the MSDS Search icon on the desktop window). You can also use the links provided in the lab manual.

http://www.hc-sc.gc.ca/ewh-semt/occup-travail/whmis-simdut/index-eng.php

vii

Evaluation: The Molecular Biology laboratory will be marked according to the following scheme:

Your lab TA will be evaluating all components related to the assignments, in-lab performance and teaching. A different TA will be correcting your lab reports.

1. Assignments (10%) Most labs include a section: To be individually handed to your TA when entering the lab. The Introduction lab assignment will be completed during the lab session whereas the remaining 9 assignments are to be completed before entering the following lab. All assignments will be equally weighted.

2. In Lab performance (10%) In Lab performance will be assessed based on technical ability and the quality of your results:

1. Technical ability (5%): Your TA will evaluate your dexterity, precision, work organization and efficiency as well as the proper use of equipment. Also, your TA will evaluate your compliance with the safety guidelines provided by this manual and staff members. You will not be responsible for cleaning glassware: however you will be required to leave a tidy work station. Ice buckets must be emptied and excess reagents disposed as demonstrated by your TA.

2. Quality of results (5%): The quality of your lab results generally reflects the quality of your work in the lab. Therefore, the quality of your lab results will be taken into consideration for the in lab performance assessment.

Evaluation of in lab performance should not be considered as a strict marking

scheme since a number of marks may get subtracted every time an incorrect action or behavior is noticed.

viii

3. Lab notebook (10%) You are expected to record all your experimental work in a personal lab notebook.

Guidelines for the maintenance of your laboratory notebook are listed in Appendix A. Lab notebooks will be initialed by your TA twice at every session. It is your responsibility to ask your TA to initial your notebook (1) immediately upon your arrival and (2) just before your departure from the lab. Your TA will initial your notebook immediately below the very last lane of written information.

Notebooks will be assessed by the coordinator at two different occasions during the

semester. The first assessment will be done randomly during any of the laboratory classes and a second, more formal assessment will be done at the end of lab 8.

These two assessments will be equally weighted (5% each).

4. In lab teaching (10%)

During the course of this lab, you will be asked to do two or three presentations. The objective of these teaching presentations is to highlight important experimental aspects of each laboratory and to stimulate discussion among students and TAs. Understanding these aspects will help you better appreciate the molecular principles that underlie molecular biology techniques.

At the end of each class section in this manual there is a subsection called, Reading Materials for Teaching Topics. These teaching topics are to be taught during down times by pre-designated groups. The number beside each teaching topics corresponds to the group in charge of preparing and delivering the teaching lesson.

In lab teaching sessions are to be prepared and presented in groups (the regular lab groups). Each presentation should fit within a timeslot of 5-10 minutes and you only have access to a chalk and a black board for illustrating information (Power Point slideshows are not possible).

Every group will have the opportunity to present 2 or 3 times during the semester. The form that will be used for the evaluation of the teaching sessions is an adapted version of the one used for the Biochemistry Seminar class (BCH4932).

In lab teaching marks will be assigned by TAs. All teaching sessions will be equally weighted.

5. Laboratory reports (25%: 2.5 % for each of the two assignment reports and 10% for

each of the two formal laboratory reports)

The semester is divided in two modules, subcloning and protein purification. You will be required to produce a complete laboratory report (formal report) for each module.

Before handing in your first formal laboratory report, you will be required to prepare two short assignment reports (or drafts). The first draft report will be about the <Materials and methods>, <Results>, and <Discussion> sections of the PCR reaction performed in Lab 1. The second draft report will be the <Introduction> of your formal

ix

lab report. The purpose of these two short assignment reports is to provide you with some feedback before you hand in your first formal laboratory report. Each assignment report is worth 2.5%. Full marks will be assigned as long as a satisfactory assignment is submitted. Half marks will be assigned if a draft report receives an unsatisfactory rating.

All assignment reports should be prepared according to the guidelines that are provided in A Guide to Writing in the Sciences. This book, which is essential for BCH3356, can be purchased at the University of Ottawa bookstore (≈ 20$). Additional suggestions on how to organize and write your report are provided in Appendix C. The marking scheme that will be used by the TA in charge of evaluating your report is also provided in the same appendix.

All lab reports are to be directly handed in to the lab coordinator at your arrival in the lab at the due dates indicated in the Detailed Schedule on page iii. Late reports will be penalized at the rate of 10% per day.

Your report can be prepared and submitted in pairs OR on an individual basis. Laboratory reports will be evaluated by a TA, different then your regular TA, who

has been specifically assigned for marking lab reports. In preparing your reports, you will use only your own data. Use of results,

calculations or sentences from previous reports or any other non-quoted sources will be considered plagiarism. Any explicit discordance between your report and the recorded data from the lab session will be also considered as evidence of plagiarism. According to the Academic Regulations of the University, section 9B, academic fraud, including plagiarism and falsified data, may result in severe sanctions (see http://www.uottawa.ca/plagiarism.pdf). Any evidence of plagiarism will result in an academic fraud report to the Faculty.

6. Exams (35%)

a. In lab practical exam (10%) A practical exam will be administered on an individual basis during the

regular laboratory classes scheduled on the week of Oct 31-Nov 3. Every student will prepare a reaction mixture for PCR amplification and assess the products of, one treatment and one negative control, by agarose gel electrophoresis. Analytical skills will also be assessed by written questions to be answered during the downtime of the PCR amplification.

For this exam, each laboratory section will be divided in two groups: the team member whose last name comes first alphabetically should attend the first three hours of the laboratory session while the other partner must attend the second half of the laboratory session.

Evaluation will be based on the quality of PCR products (5%) and analytical skills to be assessed through your written answers (5%).

b. Final exam (25%) The faculty of Science will release a date for a final exam which counts for

25% of your final mark. The final exam will assess your general understanding of

http://www.uottawa.ca/plagiarism.pdf

x

the concepts described in the lab manual and your ability to analyze and interpret experimental results.

The content of the final exam will be based on the specific objectives (<Underlying molecular principles> and <Analytical skills>) listed at the beginning of each laboratory class. The questions from the assignments are also representative of what you should expect for the final exam.

One full DGD will be dedicated to review the final exam from last year.

General Introduction for Lab I-IV 2011

1

General Introduction for Laboratory I-IV

Recombinant DNA technology

In 1953, Francis Crick and James Watson made one of the most important discoveries of the 20th century by determining the structure of DNA (1). A few years later, in 1957, Francis Crick proposed one of the “central dogmas” of biology by suggesting that information passed from DNA to RNA to the proteins (2). Francis Crick made another ground breaking discovery in 1961 when he discovered that individual amino acids were specified by specific codons in the DNA sequence (3). These discoveries paved the way for the development of recombinant DNA technology which is also referred to as genetic engineering. Recombinant DNA refers to an artificially made piece of DNA that has been created by combining two or more unique DNA sequences into a single recombinant molecule. To achieve this, a series of powerful techniques were designed to manipulate, modify and even create new DNA sequences not found in nature.

The main objective of the BCH3356 Molecular Biology Laboratory is to give you the

opportunity to become familiar with the most commonly used techniques in recombinant DNA technology. More specifically, we will manipulate and characterize the DNA sequence and the protein product of an enzyme called T7 RNA polymerase. T7 RNA polymerase was first discovered in the T7 Bacteriophage (Enterobacteria Phage T7), a phage capable of infecting various bacteria, including several E. coli strains (4). RNA polymerase catalyzes the synthesis of RNA in a 5’ to 3’ direction. T7 RNA polymerase is often used in molecular biology since it can synthesis RNA from any piece of DNA located downstream of its specific promoter, the T7 promoter (whose length is around 20 base pairs).

In the first half of the semester (Laboratory I to IV), you will be provided with a

recombinant plasmid vector containing the coding sequence of one of three T7 RNA polymerase sequences. One of these sequences contains a point mutation that results in the substitution of a glutamic acid for an alanine, a second one has a mutation substituting a serine for an alanine and the last sequence is the wild type sequence. Through PCR amplification and subcloning techniques, you will transfer the coding sequence of your T7 RNA polymerase to a plasmid vector that is suitable for protein production (pTrcHisB)and identify which version of the T7 coding sequence you have received. You will express, purify and charactherize your specific T7 RNA polymerase recombinant protein in the second half of the semester.

At the beginning of each laboratory section in the manual, you will find a short introduction

on the theory and principles of each technique involved in a specific lab session. Complementary information will be provided by your lab TA and by the TA in charge of the preceding week’s DGD.

Introductory Laboratory 2011

3

BASIC TECHNIQUES AND POLYMERASE CHAIN REACTION (PCR) AMPLIFICATION

OVERVIEW

This introductory laboratory quickly reviews some basic laboratory skills that you learned last year in the Introduction to Biochemistry: BCH2333 laboratory component. These skills are crucial for successful experiments in molecular biology. By the end of this introductory laboratory, you should feel comfortable with the hands-on procedures listed in the Learning objectives.

At the beginning of this lab, groups of students (2 or 3 if needed) will be formed. However, for this laboratory session, all protocols are to be completed on an individual basis.

LEARNING OBJECTIVES Underlying molecular principles

Understand the underlying principles of a PCR amplification Hands-On skills

Use a pipettor to transfer micro-volumes

Prepare serial dilutions

Prepare a suitable microenvironment for an enzyme assay

Measure the UV absorbance of a DNA solution to estimate its concentration

Amplify DNA using PCR

Cast an agarose gel

Load DNA samples onto an agarose gel and proceed to electrophoresis Analytical skills

Estimate the concentration of a DNA solution based on its absorbance at 260nm

Assess the size and amount of DNA fragments visible on an agarose gel picture

Estimate PCR amplification yield by comparing the amount of DNA amplified to the amount of DNA template initially added to the reaction mixture


4

BACKGROUND

A. PCR amplification

In 1983, Kary Mullis developed a new technique, called Polymerase Chain Reaction or PCR, to amplify specific pieces of DNA from a few copies to millions of copies using a DNA polymerase and short complementary DNA fragments known as primers (5-6). Since then, PCR has revolutionized medical and biological research. Several years after their discovery, Mullis and his colleagues further improved PCR by using a thermostable DNA polymerase isolated from the hot-spring bacterium Thermus aquaticus, the Taq polymerase.

Amplification of DNA by PCR occurs through a repetitive series of three fundamental steps that define one PCR cycle (see Figure 1):

Step 1: Denaturation: During this step, a high temperature is necessary to convert double stranded DNA (dsDNA) into single stranded DNA (ssDNA). This step is essential so that each primer can access and anneal to its complementary single-stranded DNA template (2nd step). If the denaturation step is too short, or if the temperature is too low, dsDNA will be partially denaturated and can renature rapidly. On the other hand, if the temperature is too high, or if the denaturation step is too long, excessive loss of enzyme activity will occur with each cycle. For instance, Taq DNA polymerase has a half-life of more than two hours at 92.5°C, 40 minutes at 95°C, but only 5 minutes at 97.5°C. To overcome this problem, more stable DNA polymerases have been engineered. In this laboratory, for instance, you will be using Phusion High-Fidelity DNA polymerase (NEBiolabs). Step 2: Primer annealing: The melting temperature (Tm) of primers is of critical importance in designing the parameters of a successful PCR amplification. A simple formula for estimating the Tm of short DNA oligonucleotides is:

Tm = 64.9°C + 41°C x (# of G’s and C’s – 16.4)/N

Where N is the total number of nucleotides.

The annealing temperature (Ta), which is sometimes confused with the Tm, corresponds to the temperature of the thermocycler during the annealing step. The Ta is adjusted according to the length and the relative GC content composition of the primers. A rule of thumb is to use a Ta value that is about 5°C below the lowest Tm of the two primers. One consequence for using a Ta value that is too low is that one or both primers might anneal to sequences other than their true targets, as internal single-base mismatches or partial annealing may be tolerated. This incorrect annealing can lead to "non-specific" amplification (extra amplification products that can be seen on an agarose gel) and reduced yield of the desired product. A consequence of a Ta that is too high is lower amplification, as the likelihood of primer annealing is reduced.

Annealing does not take long: most primers will anneal efficiently within 30 sec or less.

http://www.neb.com/nebecomm/products/productF-530.asp


5

Step 3: Primer extension: This is the DNA synthesis step mediated by a DNA-dependent DNA polymerase. A heat-stable DNA polymerase is required to withstand the denaturing steps carried out at 95-98°C. Many commercial DNA polymerases were originally purified from a thermophilic bacterium such as Thermus aquaticus, which lives in hot springs. Optimal extension activity occurs at about 72°C.

DNA extension can be initiated only at a free 3’ end. It is the annealing of primers onto their complementary target sequences that generates the necessary free 3’ ends for priming DNA extension. Depending on the pH and salt concentration, the rate of nucleotide incorporation for Taq DNA polymerase at 72°C varies from 35 to 100 nucleotides per second, although the extension rate for the Phusion High-Fidelity polymerase used in this lab is significantly higher.

Figure 1. Overview of the process of PCR amplification of a target DNA sequence. This schematic describes the first 3 cycles of a PCR reaction. You should notice that by the end of the third cycle only 2 out of the 8 amplified copies have the correct lengths. To better understand how the target fragment gets selectively amplified during the subsequent PCR cycles, make sure to watch this animation on PCR amplification: http://www.dnalc.org/ddnalc /resources/pcr.html.

(http://scienceblogs.com/insolence/upload/2007/06/PCR.jpg)

http://www.dnalc.org/ddnalc/resources/pcr.html

http://www.dnalc.org/ddnalc/resources/pcr.html


6

A PCR reaction usually involves 25-40 amplification cycles. A final extension step of 5-10 min is usually added at the end of the very last PCR cycle to ensure the full extension of all DNA fragments.

PCR primer design will be further discussed in the Background section of Laboratory class I. B. Agarose gel electrophoresis of DNA

Gel electrophoresis is a technique used to separate macromolecules – especially proteins and nucleic acids - that differ in size, charge or conformation (7). When charged molecules are placed in an electric field, they migrate toward either the positive (anode) or negative (cathode) electrode according to their charge. In contrast to proteins, which can have either a net positive or net negative charge, nucleic acids have a negative charge at neutral pH, due to their backbone phosphate groups of. The relative migration distance of each molecule is determined by the charge density of the molecule and the resistance of the matrix (or gel) media to the passage of the molecule.

In DNA/RNA agarose electrophoresis (8), a gel of agarose is cast in the shape of a horizontal

thin slab, with wells for loading the sample close to the cathode (usually indicated by a black wire). The gel is immersed within an electrophoresis buffer that provides ions to carry a current and some type of buffer to maintain the pH at a relatively constant value.

Agarose is a polysaccharide extracted from seaweed. Agarose gels are prepared by mixing

agarose powder with buffer solution to a final concentration of 0.5 to 2%, followed by heating until a clear solution is obtained. Most commonly, ethidium bromide (final concentration 0.5 fg/mL) is added to the gel at this point to facilitate visualization of DNA after electrophoresis. However, as ethidium bromide is toxic mutagen, we will instead use a safer DNA stain, known as SYBR safe® (Invitrogen). After cooling the agarose solution to about 55 °C, it is poured into a casting tray containing a sample comb and allowed to solidify at room temperature or in the cold. The porosity of the gel is inversely related to the agarose concentration. By varying the concentration of agarose, fragments of DNA from about 200 to 50,000 bp can be separated.

The higher the agarose concentration, the "stiffer" the gel will be and the smaller the size

of the DNA or RNA fragments that can be separated. Following separation, DNA fragments will be visualized by staining with SYBR safe®. This fluorescent dye intercalates between bases of DNA and RNA. It is often incorporated into the gel so that staining occurs during electrophoresis, but the gel can also be stained after electrophoresis by soaking in a dilute solution of SYBR safe®. DNA or RNA fragments appear as green bands when the gel is exposed to UV light. Fragments of linear DNA migrate through agarose gels with a mobility that is inversely proportional to the log of their molecular weight. Circular forms of DNA migrate in agarose differently from linear DNAs of the same mass. Several factors have important effects on the mobility of DNA fragments in agarose gels, and can be used to advantage in optimizing separation of DNA fragments. These factors include: % agarose concentration, voltage (as the voltage applied to a gel is increased, larger fragments migrate proportionally faster than small fragments), the choice of electrophoresis buffer and SYBR safe®. The molecular weight of a

http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Nucleic-Acid-Purification-and-Analysis/Nucleic-Acid-Gel-Electrophoresis/nucleic_acid_gel_electrophoresis/Nucleic-Acid-Stains/SybrSafe-A-better-DNA-gel-stain.html


7

linear DNA sample can be estimated by running a mixture of linear DNA fragments of known size under the same conditions (Figure 2). Figure 2. AlphaQuant™ 1 DNA molecular weight marker (Cell Biosciences). The AlphaQuant™ 1 molecular weight marker has 14 DNA fragments ranging in size from 200 base pairs (bp) to 10,000 bp. Fixed amounts of each DNA fragment were mixed to produce this ladder. The amount of each DNA fragment is dependent on the volume of ladder that was loaded on your

agarose gel. For example, 5 microliters (L) of ladder contains 100 ng of the 10,000 bp DNA

fragment whereas 10 L contains 200 ng of the same fragment. It is important to keep in mind that the distance travelled by a DNA fragment is dependent on its length.

http://www.cellbiosciences.com/consumables_alphaimager.html


8

PROCEDURES REVISION OF YOUR BASIC LABORATORY SKILLS

Performing experiments in a biochemistry lab involves basic skills such as pipetting, vortexing and preparing dilutions of concentrated solutions. You should have mastered these skills in your second year Introduction to Biochemistry laboratory (BCH2333). In these exercises, we will review these basic laboratory skills and make sure that you are comfortable performing them. Before performing these exercises you should watch the following videos:

Introduction to pipettes (10:04) or (http://www.youtube.com/watch?v=NvDTRVxOoZY)

Gel electrophoresis Part 1 (13:05) or (http://www.youtube.com/watch?v=3ukaT_Ih9d8)

Gel electrophoresis Part 2 (8:13) or (http://www.youtube.com/watch?v=_QxxB65Gi78)

Ecological practices (3:53) or (http://www.youtube.com/watch?v=a1Zyev4BBMs)

Safety procedures (2:30) or (http://www.youtube.com/watch?v=Q7o1FGFKcvM) Exercise 1: Pipetting (individual exercise)

1. Pipet the following volumes directly on your lab bench (use water): 1 L, 2 L, 5 L, 10

L and 50 L.

2. Now pipet 1 L by misusing the pipettor (e.g. go to the second position) and put this

droplet beside the true 1 L volume. Try to do the same with the other volumes.

In the preparation of a microenvironment this kind of error is disastrous; you could end up with twice as much buffer as required and this could inhibit the enzyme or reduce its activity.

3. Also practice rinsing 1 L of water in a 10 L droplet that is present in a 0.5 mL micro centrifuge tube.

Make sure you are comfortable with pipetting before proceeding to the second exercise.

Exercise 2: Pipetting and mixing viscous solution (individual exercise)

One of the most common mistakes observed in the biochemistry lab is not properly mixing enzymatic reactions. In this molecular biology lab, you will be using a variety of enzymes. These enzymes are most often provided in a storage buffer containing a high percentage of glycerol (25-50%). This glycerol acts as a cryoprotectant. Storage buffers are often viscous and therefore, need to be mixed well when transferred to a reaction mix.

http://www.youtube.com/watch?v=NvDTRVxOoZY

http://www.youtube.com/watch?v=3ukaT_Ih9d8

http://www.youtube.com/watch?v=_QxxB65Gi78

http://www.youtube.com/watch?v=a1Zyev4BBMs

http://www.youtube.com/watch?v=Q7o1FGFKcvM


9

1. Transfer 1 L of a 50% glycerol solution into a 20 L droplet of water that is present in a 0.5 mL micro centrifuge tube without mixing (a blue dye was added to the glycerol solution to help you visualize the effect of the glycerol).

2. Now, mix the solution using a 10 L micropipettor.

Because of their high density and viscosity, enzyme storage solutions tend to fall at the bottom of the reaction mix after transfer. Consequently, enzymes won’t be well distributed in your reaction mix. Furthermore, a majority of enzymes will be inhibited by the high concentration of glycerol present at the bottom of the tube.

Exercise 3: Pipetting accuracy and dilution skills (individual exercise)

You will now prepare a serial dilution of a concentrated solution of Brilliant Blue R. The absorbance at 559nm of your diluted samples will be read on a spectrophotometer. Once plotted on a graph, the r-squared value of the linear regression of your result should be close to one. If you obtain an R-squared value which is less than 0.98 or a slope value that is outside of the 0.025-0.035 interval, you will be asked to repeat this exercise.

1. You will be given a Brillant Blue R solution at a concentration of 2 g/L, prepare 6

dilutions (5, 10, 15, 20, 25 and 30 g/mL) in a final volume of 1000 L each (see Table 1). Prepare these dilutions in labeled 1.5 mL centrifuge tubes. Table 1. Dilution experiment

Components 5 g/mL Dilution

10 g/mL Dilution

15 g/mL Dilution

20 g/mL Dilution

25 g/mL Dilution

30 g/mL Dilution

Brillant Blue R sol. at

2 g/L (L)

2.5

Water

(L)

997.5

Final volume

(L)

1000 1000 1000 1000 1000 1000

2. Transfer 900 L of each dilution into 6 pre-identified 1 mL cuvettes. Prepare an extra

cuvette with 900 L of water.

3. Zero the spectrophotometer at 559 nm with water (extra cuvette) and read the absorbance of your samples.

4. Note the R-squared and slope values given by the spectrophotometer.

5. Discuss the absorbance, R-squared and slope values obtained with your TA.


10

BASIC MOLECULAR LABORATORY TECHNIQUES

The aim of the next three experiments is to prepare you for future molecular biology laboratory sessions. The quality of your results won’t be assessed today and therefore, you should take advantage of this opportunity to ask questions and make sure you are comfortable with all three procedures. Experiment #1: PCR amplification on a cDNA fragment encoding for the rat serum albumin (Individual exercise)

You will be amplifying a fragment of a DNA template containing the cDNA sequence for rat serum albumin (V01222.1 or http://www.ncbi.nlm.nih.gov/nuccore/55627) using two primers:

Primer forward: 5'- GGAAGTGTGTAAGAACTATGCTGAGG -3'

Primer reverse: 5'- GTGATGTGTTTAGGCTAAGGCTTCT -3'

Usually in a PCR experiment, you have a minimum of 3 samples: a positive control, a negative control and the test sample. For today’s exercise each student will prepare only 2 control samples (negative and positive) for PCR amplification. In the negative control, water is used instead of the DNA template, and in the positive control, a template will be provided. Keep all your samples on ice until they are transferred into the thermocycler preset to 4⁰C.

1. Prepare two PCR reactions as indicated in the table below.

2. PCR reactions should be setup in labeled PCR tubes (0.2 mL). Each student should use the following format to label their tubes: Group #, + or – (positive and negative controls) and the first letter of your family name (e.g. Luc Poitras, Group 14 = 14+P and 14-P).

Table 2. PCR reactions setup

PCR Components

Concentration of the stock

sample

Target concentration

in reaction tube

Volume per reaction: Positive control

Volume per reaction: Negative control

H2O (Brown tube) 29.5 L 39.5L

PCR Buffer (Blue tube) 10X 1X 5.0 L 5.0L

MgCl2 (Purple tube) 50 mM 1.5 mM 1.5 L 1.5L

dNTPs (Green tube) 10 mM 0.2 mM 1.0L 1.0L

Forward primer (Pink tube) 10 M 0.2 M 1.0L 1.0L

Reverse primer (Yellow tube) 10 M 0.2 M 1.0 L 1.0L

DNA template (Clear tube) 0.01 ng/L 0.1 ng/50L 10.0L -

Taq DNA polymerase See TA 5 U/50 L 1.0L 1.0 L

Total volume 50L 50L

http://www.ncbi.nlm.nih.gov/nuccore/55627


11

3. After adding all the components, mix thoroughly, close the lid and load your two samples in the pre-cooled thermocycler.

4. The thermocycler will run the following PCR program for this experiment:

I. Initial denaturation: 95°C 1 min II. Denaturation: 95°C 30 sec

III. Annealing: 55°C 30 sec IV. Extension: 72°C 30 sec V. Repeat step II to IV 19 times

VI. Final extension: 72°C 10 min VII. Hold temperature: 4°C

5. While you wait for your PCR to be completed, you can proceed to Experiment #2.

6. Once the PCR reaction is completed, retrieve your two tubes and proceed to the

electrophoresis procedure (Experiment #3). Experiment #2: Analysis of plasmid DNA by absorbance at 260nm and 280nm, and by agarose gel electrophoresis (to be done during PCR amplification; individual exercise)

You will be provided with an aliquot of plasmid DNA at an unknown concentration. Using a spectrophotometer, you will be required to calculate its concentration and then determine the 260/280 ratio. Once you know the concentration, you will load 50 ng of the plasmid DNA on an agarose gel to validate your calculation.

1. Prepare a 1:50 dilution of the unknown DNA solution in a final volume of 1.0mL. Water

should be used for the dilution.

2. Transfer this dilution into a 1.5 mL spectrophotometer cuvette. Prepare a second cuvette with 1mL of water for the blank.

3. Read the absorbance of your DNA dilution at 260nm (Remember that 1 OD260 = 50

g/mL of dsDNA).

4. Once the concentration of the DNA solution has been determined, prepare an aliquot

that contains 50 ng of plasmid DNA in a final volume of 10 L.

5. Add 3.5 L of water and 1.5 L of 10X DNA loading buffer.

6. Load your aliquot on a 1% agarose gel.


12

Your TA will also load a standard aliquot containing 50 ng of plasmid DNA. Your sample will be compared to this standard to determine your accuracy. Future in lab performance marks will reflect your accuracy in performing similar tasks. Experiment #3: Analysis of the PCR amplicons by agarose gel electrophoresis.

Your TA will demonstrate the procedure for casting a 1% agarose gel as described in Appendix E1, and then some groups will be required to cast extra gels for the analysis of the PCR amplicons and plasmid DNA aliquots (Experiment #2). Pay attention to the demonstration because every team will be asked to cast an agarose gel at least once this semester.

1. Transfer 2 L from each PCR reaction to two 1.5 mL micro centrifuge tubes containing 7

L of water and 1 L of 10X DNA loading buffer. Make sure that your tubes are labelled properly.

2. Close your tubes and mix the solution by gently flicking the tube. Collect the solution from the wall of the tube by using a centrifuge (Your TA will demonstrate how to use the centrifuge, please wait until you know how to use it before proceeding to this step.)

3. Load your samples onto the agarose gel (Make sure your put your name on the sign-up

sheet). Your TA will load 5 L of AlphaQuant™ 1 molecular weight marker in two pre-assigned wells.

4. Run the gel at 100 volts until the bromophenol blue, which is used as a tracking dye, gets halfway through the gel (It should correspond roughly to the distance travelled by a 150 bp DNA fragment).

5. A picture of your gel will be taken using a gel documentation system (AphaImager mini). Analysis of the gel will be achieved using the Alphaview™ software. If you want to use this software at home, a copy of this software, as well as the documentation on how to use it, is available on the virtual campus of this course (Useful material folder). This software was also installed on some computers at the CUBE.

If your PCR reaction did not succeed, you will be asked to prepare two more PCR

reactions. The support staff will do the electrophoresis of your PCR repeats and post the gel pictures on the course virtual campus. Students repeating the PCR exercise should fill the DNA Loading Sample Form to facilitate the identification of the different wells on the posted gel pictures.


13

ASSIGNMENT

This week, you will have to complete two separate assignments. You should answer questions from the first assignment before leaving the lab today. Your second assignment needs to be handed at the beginning of lab #1 next week (see next page).

ASSIGNMENT TO BE HANDED TO YOUR TA BEFORE LEAVING THE LAB ( /10 Marks)

1. Show your full calculations for the preparation of your diluted samples of Exercise #3.

Prepare a summary table (similar to Table 1) with the volume of Brilliant Blue R and water needed for each dilution, the absorbance obtained for each dilution as well as the corresponding theoretical absorbance values calculated from the Beer-Lambert equation (see Appendix D2) using a coefficient of extinction of 30 L g-1 cm-1 and a cell path length of 1 cm. (Don’t forget to put a title for your table). Add ( /3 Marks)

2. Refer to your agarose gel picture containing your PCR amplicon and estimate the

amount of DNA that was amplified within the total PCR mixture (50 L) (see Appendix E2 on how to quantify DNA on agarose gel). What’s the experimental amplification factor you obtained for your reaction? In other words, by how many times was the initial amount of template DNA amplified (for this part of the question you have to assume that the length of template is similar to the length of the PCR product)? Provide your full calculation details. Also attach a copy of your gel picture. ( /3 Marks)

3. Show your full calculations for the preparation of your plasmid DNA sample (50

ng/10L). Refer to the picture of your agarose gel to assess the percentage error for the preparation of your DNA aliquot (see Appendix E3 for percentage error example). This can be done by visually comparing the intensity of your band, which directly relates to the amount of DNA, with the DNA marker loaded by your TA. If your percentage error is significant, at which step would you suspect that an error could have been made? Are visual estimates of band intensities on agarose gel accurate? ( /4 Marks)


14

ASSIGNMENT TO BE HANDED IN INDIVIDUALLY TO YOUR TA WHEN ENTERING NEXT WEEK LAB

( /10 Marks)

1. Access the nucleotide database of NCBI (http://www.ncbi.nlm.nih.gov/) and perform a search for “T7 RNA polymerase gene”. In order to get the coding sequence of the T7 RNA polymerase, which database results should you choose? Once you have selected results from this specific database, you will have to narrow your search by choosing a source organism, what is the source organism for T7 RNA polymerase? From the list of entries you now have, what is the important piece of information (other than “T7 RNA polymerase gene”) should you be looking for in the underlined blue title? Indicate the specific GenBank entry number for the T7 RNA polymerase gene you found. (Do not choose the sequence with the accession number M38308.1, this sequence is a variant of the sequence you will be using for the lab). ( /3 Marks)

2. Once you have retrieved the proper DNA sequence for the T7 RNA polymerase, access

the option <Pick Primers> (see below).

The <Pick Primers> tool offers two main options. You can submit a request without specifying any forward or reverse primers and, in this case, the server returns a list of optimal pairs of primers that could be used to amplify the gene of interest. Notice that most pairs of primers are designed to amplify only one part of the gene of interest. How many pairs of primers are suggested? Explain why none of those pairs of primers can be used for the subcloning exercise you will complete during the semester? ( /3 Marks)

3. Now proceed to a new request by specifying the forward and reverse primers you will be using in the Lab #1 (see page 21 and 22). This can be done by typing the appropriate DNA sequence in each of the two boxes circled in the figure below. To be successful in this alignment, why should you use only the nucleotides of your primers that are complementary to the DNA template and omit the nucleotides coding for the recognition site of a restriction enzyme? A hard copy of your alignment results should be appended to your answer and handed in to your TA. ( /2 Marks)

http://www.ncbi.nlm.nih.gov/



15

4. What’s the theoretical length of the expected PCR product to be amplified during Lab 1? Be as accurate as possible when describing the expected length, i.e. specify the exact number of nucleotides to be contained in the PCR amplicon. Justify your answer by specifically referring to your BLAST alignment result from question #3 and your primer sequences. ( /2 Marks)


16

REFERENCES

1. Watson, JD and Crick FH., Molecular structure of nucleic acids; a structure for

deoxyribose nucleic acid. Nature. 1953; 171(4356): pp 737-8.

2. Crick FH, Griffith JS and Orgel LE., Codes without commas. Proc Natl Acad Sci U S A. 1957; 43(5): pp 416-21.

3. Crick FH, Barnett L, Brenner S and Watts-Tobin RJ. General nature of the genetic code for proteins. Nature. 1961; 192: pp 1227-32.

4. Chamberlin, M., McGrath, J., and Waskell, L. New RNA polymerase from Escherichia coli infected with bacteriophage T7. Nature. 1970; 228, pp 227-31.

5. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 1985; 230(4732): pp 1350-4.

6. Mullis, K and Faloona F., Specific Synthesis of DNA In Vitro Via a Polymerase Catalyzed Chain Reaction, Methods in Enzymology. 1987; 155 : pp 335-50.

7. Voët, D and Voët, J. Biochemistry, 3rd Ed., (2007) John Wiley &Sons, Section 6.4, pp 144.

8. Voët, D and Voët, J. Biochemistry, 3rd Ed., (2007) John Wiley &Sons, Section 6.6C, pp 156.

Web references for the materials used in the lab Phusion DNA polymerase: http://www.neb.com/nebecomm/tech_reference/polymerases/phusion_high.asp SYBR safe: http://www.invitrogen.com/sybrsafe AlphaQuant™ 1 molecular weight marker 2http://www.cellbiosciences.com/consumables_alphaimager.html

Laboratory Class 1: Amplification 2011

17

AMPLIFICATION OF THE T7 RNA POLYMERASE CODING SEQUENCE BY PCR

OVERVIEW

The purpose of this course is to make use of recombinant DNA technology to purify an enzyme, T7 RNA polymerase, in sufficient amounts so that its function can be assessed. As a first step, we will employ a PCR-based subcloning strategy to transfer the coding sequence of a T7 RNA polymerase mutant into a destination plasmid vector, the pTrcHisB vector. During this laboratory session, you will be provided with a recombinant plasmid vector containing the coding sequence (cDNA) of one of three T7 RNA polymerase sequences. You won’t know until the end of laboratory session #4 which sequences you received. In fact, you will be required to identify which T7 RNA polymerase sequence you received as well as the position of the point mutation where applicable. As a first step in our PCR-based subcloning, we will PCR amplify the coding sequence of your polymerase mutant using primers that were specially designed to ensure proper ligation into the destination plasmid vector. Following this PCR amplification, the resulting amplicon will be purified and assessed by agarose gel electrophoresis to ensure that a product with the appropriate length has been made.

LEARNING OBJECTIVES

Underlying molecular principles

List and explain the different steps involved in PCR

Explain the underlying principle for the QIAquick spin column

Hands-On skills

Amplify a target DNA sequence of interest using PCR

Perform agarose gel electrophoresis

Perform a BLAST alignment

Purify a PCR amplicon using a Wizard SV Gel and PCR Clean-up system

Analytical skills

Design PCR primers with proper 5’ and 3’ ends for subcloning at specific restriction site(s) within a destination vector

Estimate the size and amount of DNA fragments on an agarose gel by relative comparison to quantitative DNA markers

Refer to the picture of an agarose gel to discuss the specificity of PCR amplification

Refer to the picture of an agarose gel to estimate the PCR amplification yield (# of copies amplified)

Use BLAST alignment to predict the length of PCR amplicons


18

BACKGROUND A. PCR Amplification

Please refer to the Background section of the Introductory Lab to refresh your memory on the basic principles of PCR amplification. B. Design of PCR primers

PCR is a very sensitive technique that requires the oligonucleotide primers to be appropriately designed to ensure specific amplification with low background signal. A thorough understanding of the underlying mechanism for the PCR amplification of each of two DNA strands is essential for successful primer design. This semester, we will amplify the coding sequence of the T7 RNA polymerase. The template sequence that will be given to you is a complementary DNA, or cDNA, fragment of the T7 RNA polymerase mRNA (Figure 1). Therefore, we can assign the following nomenclature to the two strands of your cDNA:

Sense strand: this is the DNA strand that corresponds to the mRNA sequence, except for U’s that are substituted with T’s. By convention, the sequence of a gene is represented as its sense strand and is displayed 5’ to 3’. The sense strand is also referred as the coding strand.

Antisense strand: This is the strand that is complementary to the sense strand. Because the two DNA strands are antiparallel (they are side-by-side but in opposite directions), the sequence of the antisense corresponds to the reverse complement of the sense strand.

Figure 1. Conversion of an mRNA into cDNA. The first step in the production of a cDNA is the conversion of the messenger RNA (mRNA) into a complementary DNA strand. This is done by using a DNA polymerase called Reverse transcriptase forming the antisense strand (First strand cDNA synthesis). Then, RNaseH is used to remove the mRNA and the second strand of the cDNA is subsequently synthesized by the DNA polymerase I (in combination with specific primers). The newly synthesized strand corresponds to the sense strand. In this representation, ATG corresponds to the start codon (AUG in the mRNA) and the TGA (UGA in the mRNA) represents the stop codon (for simplicity, only one of the three stop codons is shown). The polyadenine tail of the transcript is designated by five adenines.


19

To delineate the two ends of the PCR amplicon, two primers are necessary, a forward and a reverse primer: FORWARD primer:

By convention, this sequence reads identical to the coding sequence of the mRNA molecule or the sense strand of your cDNA.

Anneals to the antisense (non-coding) strand to initiate elongation of the sense strand from its 5’ to 3’ ends

REVERSE primer:

This sequence reads as the reverse complement of the mRNA molecule or the antisense strand of your cDNA.

Anneals to the sense (coding) strand to prime elongation of the antisense strand.

Figure 2. Forward and reverse primers. When amplifying a cDNA, the forward primer sequence will anneal near the start codon on the antisense strand of the cDNA (see A and B). Inversely, the reverse primer will anneal near the stop codon region on the sense strand of the cDNA. The 5’ to 3’ polymerization activity of the Taq DNA polymerase will synthesize a new strand of DNA from the 3’ end of each primer (C) generating an antisense strand from the reverse primer and a sense strand from the forward primer.

Once you have selected a region you want to amplify, you need to design your primers by following these basic general rules:

Primers usually have a length of 17-28 nucleotides;

The primer’s base composition should be 50-60% (G+C);

Primers 3’-end should have one or two terminal C or G’s. This allows a firm adhesion of primer’s 3’ terminal nucleotides onto the template;

Runs of three or more consecutive C’s or G’s within primers may promote mispriming at GC-rich sequences (because of the stability of annealing); this problem is more common when genomic DNA is used as a template;

The 3'-ends of the forward and reverse primers should not be complementary (i.e. they should not be able to anneal to each other) to prevent the formation of primer dimers;


20

Finally, the melting temperature (Tm) of your primers should be optimized for your PCR

conditions (see Background section of the Introductory Lab). C. PCR Subcloning

Subcloning is a technique used to move a particular gene of interest from a point of origin (parent plasmid vector, genomic DNA, etc) into a suitable destination vector. In this laboratory, you will subclone your PCR product which corresponds to the coding sequence of the T7 RNA polymerase into the XhoI and EcoRI recognition sites of your destination plasmid vector, pTrcHisB (Figure 3 and 4). To successfully achieve this insertion, it is necessary to engineer the PCR primers to include the appropriate restriction site at each of the two ends. Figure 3. pTrcHisB map (Invitrogen). We will be using the pTrcHisB destination vector for the subcloning of the T7 RNA polymerase. Once digested by XhoI and EcoRI, our PCR amplicon will be inserted into a pTrcHisB vector which was previously digested with the same enzymes (boxes). Important features of the vector are also displayed on this map: the Ptrc hybrid promoter, the lac operator and the 6 Histidine tag (6xHis). These features will be further discussed in the second half of the semester. The ATG start codon for the fusion protein is also displayed on the map (dashed line box). Figure 4. Multiple cloning site (MCS) of the pTrcHisB vector. This sequence corresponds to nucleotides 361 to 604 of the pTrcHisB vector. You can easily notice the reading frame dictated by the vector start codon (ATG in bold at position 413). Translation of the MCS is provided below the nucleotide sequence. Restriction sites used in our PCR-based subcloning are XhoI (CTCGAG) and EcoRI (GAATTC) (both sites are shown in boxes).

http://products.invitrogen.com/ivgn/product/V36020

http://products.invitrogen.com/ivgn/product/V36020


21

Specific aspects of the destination plasmid need to be considered when engineering PCR primers for subcloning:

1. The reading frame of your T7 RNA polymerase needs to be adjusted to the reading frame provided by the destination vector. The ATG of the T7 RNA polymerase will not be the start codon of our fusion protein during translation. The ATG start codon is located upstream the 6xHis tag in the pTrcHisB vector (position 413-415 on the pTrcHisB sequence, see Figure 4). Therefore, the reading frame will be dictated by the pTrcHisB vector.

2. As mentioned before, restriction sites will be inserted in our PCR primers in order to insert the PCR amplicon into the destination vector. Because certain restriction enzymes inefficiently cleave recognition sequences located at the very end of a DNA fragments, it is advisable to include at least 3-4 additional bases in front of a restriction recognition site to optimize the cutting efficiency of your restriction enzymes.

Figures 5 and 6 illustrate the different parts of the two PCR primers you will be using to

amplify your T7 RNA polymerase mutant during this lab session. In the Manual section of virtual campus, you will find two supplementary figures (Supplementary Figures 1 and 2) describing the amplification process of the T7 RNA polymerase using the T7RNA.FWR and T7RNA.REV primers during the first and second cycles of the PCR.

Figure 5. Engineering of the T7 RNA polymerase Forward primer (T7RNA.FWR) 1 2 3 4

1 : Three extra nucleotides to ensure optimal XhoI activity 2 : XhoI recognition site 3 : One extra G to maintain the reading frame 4 : Coding sequence (open reading frame) of the T7 RNA polymerase. ATG of the T7 RNA polymerase is shown in bold.

5' - TATCTCGAGGATGAACACGATTAACATCGCTAAG - 3'

TAT CTCGAG G ATGAACACGATTAACATCGCTAAG


22

Figure 6. Engineering of the T7 RNA polymerase Reverse primer (T7RNA.REV) 1 2 3

1: Three extra nucleotides to ensure optimal EcoRI activity 2: EcoRI recognition site 3: Coding sequence for the 3’ end of the T7 RNA polymerase cDNA. This sequence is the reverse complement of the sense strand.

5' - TATGAATTCTTACGCGAACGCGAAGTCC - 3'

TAT GAATTC TTACGCGAACGCGAAGTCC


23

PROCEDURES

EXPERIMENT #1: PCR amplification of the T7 RNA polymerase insert

You will be provided with an aliquot of a recombinant plasmid containing the wild type coding sequence or one of the two mutant T7 RNA polymerases to be subcloned into pTrcHisB, the destination plasmid vector. For today’s experiment, we will be amplifying the coding sequence of your T7 RNA polymerase aliquot. You will also perform a negative control. This control is used to assess for the presence of background amplification and, therefore, we will substitute the DNA template for water.

1. Use a 1.5 mL microcentrifuge tube to prepare a Master mix for 3 reactions even though you only have 2 samples (experimental treatment and - control). The addition of sufficient reagents for an extra reaction will ensure you don’t run out of the Master mix for the last sample. Respect the sequence indicated in the table when adding the reagents. Ask your TA for the Phusion polymerase. Keep your reagents and master mix on ice at all times. Failure to do so will result in a loss of in lab performance marks and also result in failed reactions.

2. Label 2 PCR tubes (T7 pol and – control). You should also add your group number on the

lid) and add 90 L of the master mix into each one. Mix your master mix well before transferring it to the PCR tubes.

3. Your TA will supply the DNA template (0.05 ng/L). This aliquot contains a recombinant plasmid vector with the full length sequence for your mutant T7 RNA polymerase to be used as the DNA template for your experimental treatment. Record your mutant

template number in your lab notebook. Add 10 L of the aliquot into the appropriate

PCR tube (0.5ng of template DNA) and add 10 L of water to your negative control. Keep all your tubes on ice until they are transferred into the thermocycler pre-set to 4°C.

PCR Components

Concentration of the stock

sample

Desirable concentration

in reaction tube

Volume per reaction:

(L)

Master Mix for 3

reactions

(L)

H2O (Brown tube) 63.5 L

5X Phusion HF buffer (Blue tube) 5X 1X 20.0 L

dNTPs (Green tube) 10 mM 0.2 mM 2.0 L

T7RNA.forward (Pink tube) 10 uM 0.2 M 2.0 L

T7RNA.reverse (Yellow tube) 10 uM 0.2 M 2.0 L

Phusion DNA polymerase 2 U/L 1U/50 L 0.5 L

Total volume 90 L 270 L


24

4. The thermocycler will run the following PCR program for this experiment:

I. Initial denaturation: 98°C 30 sec II. Denaturation: 98°C 10 sec

III. Annealing: 55°C 30 sec IV. Extension: 72°C 45 sec V. Repeat step II to IV 4 times

VI. Denaturation: 98°C 10 sec VII. Annealing: 65°C 30 sec

VIII. Extension: 72°C 45 sec IX. Repeat step VI to VIII 29 times X. Final extension: 72°C 10 min

XI. Hold: 4°C

EXPERIMENT #2: Purification of the T7 RNA polymerase PCR amplicon.

In this experiment, we will purify your T7 RNA polymerase amplicon using the Promega Wizard SV Gel and PCR Clean-up System®. Purification of your amplicon is necessary because the conditions (pH, salt concentrations, etc.) used for PCR amplification are not necessarily compatible with the conditions to be used for the restriction digest to be performed next week. The process works via binding of DNA to silica at high ionic strength, and release at low ionic strength. Addition of chaotropic salts, such as guanidine, create a salt bridge between the negatively charged phosphate groups of the DNA and the silica column.

This figure, taken from the Promega Wizard handbook, represents a schematic of the purification procedure with the Wizard SV Gel and PCR Clean-up System. (a PDF copy of this handbook can be found in the “Useful resources” folder of the course virtual campus.)

http://www.promega.com/resources/protocols/technical-bulletins/101/wizard-sv-gel-and-pcr-cleanup-system-protocol/





25

5. Retrieve your tubes from the thermocycler. Transfer 2 L of each PCR reaction (T7 RNA and - control) into two labeled microcentrifuge tubes. Make sure to write a U on the lid of your T7 RNA polymerase aliquot (U for Unpurified). The - controls will not be purified as it will not be used for ligation next week. Proceed to the next step with your remaining T7 RNA polymerase PCR reaction.

6. Combine the remaining fraction of your T7 RNA polymerase PCR amplicon (about 98 L)

with 1 volume of the Membrane binding Solution (98 L) and mix thoroughly.

7. Place a SV Minicolumn into a 2 mL collection tube.

8. Apply your sample to the SV Minicolumn and incubate for 60 sec at RT.

9. Centrifuge for 60 sec at 13 000 RPM. Discard the flow-through and return the column to the collection tube. Your PCR amplicon is now attached to the silica column. However there are also contaminants present that need to be removed.

10. To remove these contaminants from your PCR amplicon, add 700 L of the Membrane Wash Solution to the column and centrifuge for 1 min at 13 000 RPM.

11. Discard the flow-through and place the column back in the same tube. Add 500 L of the Membrane Wash Solution and Centrifuge for 5 min at 13 000 RPM. This should remove any residual ethanol contained in the Wash buffer from your SV Mini column. It is crucial to eliminate residual ethanol left inside the column since it will prevent or lower the solubilization of DNA in water and, therefore, lower the amount of DNA that can be eluted.

12. Discard the flowthrough and return the column to the collection tube, being careful not to wet the bottom of the column with the flowthrough. Centrifuge again for 1 min at 13 000 RPM to evaporate any Ethanol residue on the column.

13. Place the column in a clean 1.5 mL micro centrifuge tube and add 50 L of water directly onto the center of the membrane. (Be careful not to touch the membrane with the tip of the pipette.) Incubate your SV Minicolumn at RT for 1 min (this step is really important to permit the complete desorption and resolubilization of your DNA), and then centrifuge for 1 min at 13 000 RPM to elute your purified T7 amplicon.

14. Discard the column and keep the 1.5 mL microcentrifuge tube containing your purified

T7 RNA polymerase amplicon. Transfer 2 L of your purified amplicon into a new 1.5 mL microcentrifuge tube. This aliquot will be analyzed in parallel with your unpurified T7 amplicon (refer to Step 5) by agarose gel electrophoresis (Experiment #3). The remaining of your purified T7 RNA polymerase amplicon will be stored at -20°C until next week. Label your tube with your group number and give it to your TA.


26

EXPERIMENT #3: Agarose gel electrophoresis

You will now analyze your PCR product by agarose gel electrophoresis. Four groups will be sharing one gel (4 samples x 4 groups = 16 wells). Your TA will decide who will be responsible for preparing a gel.

15. Cast a 1% agarose gel as described in Appendix E1.

16. Your different amplicons should first be mixed with the loading buffer before being loaded onto the gel. You should have 4 sample tubes: 2 PCR controls and the purified

(Step 14) and unpurified (Step 5) T7 amplicon. Add 7 L of water and 1L of 10X loading buffer into each tube. Mix the contents of each tube thoroughly.

17. Load 5 L of each of your 4 samples and reserve one lane for the DNA ladder (5L) near the middle of the gel. To facilitate the identification of samples, please fill the “Loading log sheet”.

18. Carry out electrophoresis at 100V until the dark blue dye (bromophenol blue) has moved about halfway down the gel. It takes about 40 min to properly separate the DNA bands. Shorter electrophoresis times might result in partial overlapping of DNA markers and inaccurate length estimate of your PCR products.

19. Take a picture of your gel using the AlphaImager™ mini. All the gel pictures will be posted on the BCH3356 virtual campus so you can retrieve and analyze your results. Ask for a print out of your gel picture to be inserted in your notebook. If your PCR amplification failed, you will be required to prepare another set of PCR reactions before leaving the lab. If this is your case, make sure that your second set of PCR tubes are properly labeled and handed in to your TA before leaving the lab. Your PCR reactions will be amplified overnight and ONE MEMBER OF THE TEAM should be designated to come back to the lab the following morning (9-12AM) to purify and analyze the amplicon by agarose gel electrophoresis. This is necessary to ensure that all students can use their own amplicon for ligation next week. Since only one technician will be present to assist you, book a specific time on the log sheet.


27

ASSIGNMENT

This week’s assignment can be divided into two separate sections. Questions 1 to 3 will evaluate the knowledge you acquired during this laboratory session whereas, question 4 is intended to serve as preparation for your next lab (Laboratory class 2: Ligation).


( /10 Marks)

1. Two different annealing temperatures were used for the PCR amplification (see step 4). ( /3 Marks)

a. Use a diagram to illustrate which specific part of the forward and reverse primers can anneal onto the DNA template for the very first PCR cycle. Your diagram should specify the specific base pairs of the two DNA hybrids (one for the forward primer and one for the reverse primer).

b. Refer to the formula for calculating oligonucleotide melting temperatures presented on page 2 to estimate the melting temperature for the DNA hybrids formed between the forward primer and the DNA template at (1) the very first and (2) very last PCR cycle.

c. What was the rationale for using two different annealing temperatures in the PCR amplification procedure?

2. A rough appreciation of the length of your amplicon can be obtained by visually

comparing its position against the DNA markers. But a better estimate can be obtained by plotting the log of the length of the DNA markers (on the Y axis) versus the distance traveled on the agarose gel (on the X axis; see also Appendix E2 for an example). Prepare this plot to obtain an accurate estimate of the length of your PCR amplicon. Notice that for the purpose of this course, you are expected to systematically generate a standard curve for every gel picture you analyze. All standard curves must be included in the appendix of your laboratory reports. ( /3 Marks)

3. Estimate the recovery yield for the purification of your T7 amplicon with the Wizard PCR

clean-up system. Provide all your calculation details. How comparable is your recovery yield to the value that is claimed by the manufacturer (90-95%)? ( /1 Mark)

4. A group of students from last year completed ligation under conditions similar to the

ones you will be using this week. Refer to the gel picture obtained by this group to fill the summary table provided hereafter. You should assume a ligation molar ratio of insert/plasmid of 7:1 and that you will use 30ng of plasmid for the ligation. A molar ratio of 7:1 means that there should be 7 molecules of insert for every molecule of plasmid. Your calculations should take into consideration that samples had been diluted with water and the 10X loading buffer before being loaded onto the gel. Assuming that the length of your PCR amplicon and vector are 2571bp and 4304bp respectively. 1)


28

Estimate the concentration of the purified digested insert and plasmid (gel below). 2) Using the concentrations obtained in 1), fill the table with the appropriate volume of the different components of the ligation reaction. Please include all your calculations. In the lab next week, you will have to perform similar calculations with your own experimental results before you can proceed with ligation. ( /3 Marks)

Ligation reaction H2O

(L)

Purified and

digested plasmid

10ng

(L)

Purified and

digested PCR

amplicon

(L)

Ligation buffer

5X

(L)

Ligase

(1U/L)

(L)

Total volume

(L)

Purified and digested plasmid

+ purified and digested PCR

amplicon

2

40


29

READING MATERIALS FOR IN LAB TEACHING TOPICS

GROUPS 1, 9 and 17: Promega Wizard SV Gel and PCR Clean-up System (Promega handbook). See also reference #2 and 3.

a) What’s the molecular structure of the packing medium inside the column? b) The binding buffer contains a chaotropic agent, guanidine. What’s the purpose of adding

guanidine in the binding buffer? c) What’s the maximum retention capacity of the column? d) Do you think the column might have been oversaturated when your PCR product was

purified? GROUPS 2, 10 and 18: SYBR Safe DNA stain. See also reference #4 and 5.

a) What is the chemical structure of SYBR (look for SYBR green)? b) Is SYBR Safe really safe for humans? c) Can SYBR Safe be used for staining single-stranded DNA and RNA? d) Describe the two binding modes of SYBR Safe with dsDNA. e) Can salts affect the binding of SYBR Safe onto DNA?

GROUPS 3, 11 and 19: Phusion High-Fidelity DNA polymerase

a) Define the following concepts: fidelity, processivity and yield b) Discuss the relative effectiveness of Phusion High-Fidelity for amplifying DNA compared

with other enzymes. GROUPS 4, 12 and 20: A Guide to Writing in the Sciences, Results and Discussion (pp. 15-26)

a) Figure versus table? b) Guidelines for the preparation of complete figures and tables. c) Organization and contents of the sections results and discussion.


http://www.invitrogen.com/sybrsafe

http://www.neb.com/nebecomm/products/productF-530.asp


30

REFERENCES

1. Boom R, Sol CJ, Salimans MM, Jansen CL, Wertheim-van Dillen PM, van der Noordaa J. Rapid and simple method for purification of nucleic acids. J Clin Microbiol. 1990 Mar;28(3):pp. 495-503.

2. http://www.qiagen.com/resources/info/qiagen_purification_technologies_1.aspx

3. http://bitesizebio.com/articles/how-silica-spin-column-dna-and-rna-preps-work/

4. http://www.invitrogen.co.uk/site/us/en/home/References/Molecular-Probes-The-Handbook/Technical-Notes-and-Product-Highlights/SYBR-Safe-DNA-Gel-Stain.html

5. Zipper H, Brunner H, Bernhagen J, Vitzthum F. Investigations on DNA intercalation and surface binding by SYBR Green I, its structure determination and methodological implications. Nucleic Acids Res. 2004 Jul 12;32(12):e103.

Web references for the materials used in the lab Phusion DNA polymerase: http://www.neb.com/nebecomm/tech_reference/polymerases/phusion_high.asp Promega Wizard SV Gel and PCR Clean-up System:


http://www.qiagen.com/resources/info/qiagen_purification_technologies_1.aspx

http://bitesizebio.com/articles/how-silica-spin-column-dna-and-rna-preps-work/

http://www.invitrogen.co.uk/site/us/en/home/References/Molecular-Probes-The-Handbook/Technical-Notes-and-Product-Highlights/SYBR-Safe-DNA-Gel-Stain.html

http://www.invitrogen.co.uk/site/us/en/home/References/Molecular-Probes-The-Handbook/Technical-Notes-and-Product-Highlights/SYBR-Safe-DNA-Gel-Stain.html

Laboratory Class 2: Ligation 2011

31

LIGATION OF THE T7 RNA POLYMERASE AMPLICON INTO THE pTRCHISB PLASMID VECTOR

OVERVIEW

The primers used last week to amplify the insert coding for T7 RNA polymerase had been engineered with a recognition sequence at their 5’ ends. This week, you’ll use the appropriate restriction enzymes, XhoI and EcoRI, to digest your amplicon as well as the destination plasmid vector, pTrcHisB. These enzymes will generate compatible “sticky” ends necessary for the insertion of T7 RNA polymerase insert into the pTrcHisB vector to form a recombinant plasmid, pTrcHisB/T7. The last step will be to seal the nicks by forming phosphodiester bonds using T4 DNA ligase


Discuss the functional organization of the different components of the cloning vector to be used for ligation, pTrcHisB

Explain the procedure for preparing recombinant DNA plasmids

Explain the difference between directional and non-directional cloning and discuss the benefits and limitations of each strategy

Hands-On Skills

Digest plasmid and a PCR product with restriction enzymes

Purify restriction digests using the Wizard SV Gel and PCR Clean-up system

Quantify DNA by agarose gel electrophoresis

Ligate DNA fragments using T4 ligase Analytical Skills

Design or engineer PCR primers for subcloning

Estimate the size and amount of DNA bands on an agarose gel by comparison with quantitative DNA markers

Estimate the recovery yield for the purification of digests with the Wizard SV Gel and PCR Clean-up system


32

BACKGROUND A. Cloning strategies

In this laboratory session, we will transfer our T7 RNA polymerase amplicon into our destination vector, pTrcHisB. Most plasmid vectors have a multiple cloning site in which several unique restriction endonucleases recognition sites can be found. In order to transfer our amplicon in the destination vector, we first need to digest both DNA fragments with two pre-determined endonucleases, XhoI and EcoRI. This process will ensure that the ends of the amplicon and our vector are compatible. To complete this first step of the subcloning process, we will join both DNA fragments using T4 DNA ligase. The following Background sections will provide more in-depth information about digestion and ligation.

B. Restriction Enzymes

Restriction endonucleases (also known as restriction enzymes) are enzymes that recognize and cleave double-stranded DNA within specific recognition sequences. During restriction, an endonuclease cuts each of the two strands to generate a double-strand cut. Cleavage is the result of hydrolysis, a reaction in which water is added across a bond, thereby breaking it. In this case, water is added across the phosphodiester bond, cleaving the two adjacent nucleotides (Figure 1). The cleavage mediated by restriction enzymes yields 5’-phosphate and 3’-hydroxyl termini (Figure 2). By contrast, nucleotides are joined by condensation reactions, in which phosphodiester bonds are formed by splitting out a water molecule. DNA and RNA polymerases and DNA ligases are enzymes that function via condensation.

Figure 1. Cleavage of a phosphodiester bond. Cleavage of the phospho diester bond is achieved through hydrolysis reaction (a water molecule is added to break the bond). Notice that the result of this hydrolytic cleavage reaction generates one segment of DNA with a hydroxyl group at the 3' position, and a second segment with a phosphate group at the 5' position. Figure modified from http://chem wiki.ucdavis.edu

http://en.wikipedia.org/wiki/Restriction_endonuclease

http://chemwiki.ucdavis.edu/Organic_Chemistry/Organic_Chemistry_With_a_Biological_Emphasis/Chapter_10%3A_Phosphoryl_transfer_reactions/Section_10.4%3A_Phosphate_diesters


33

As mentioned before, restriction enzyme cut a specific DNA sequence called a restriction site. These sequences are specific to each restriction enzyme. Restriction sites are often palindromic sequences. This means that the 5’ to 3’ nucleic acids sequence you read on one strand is identical to the 5’ to 3’ sequence on the complementary strand (See Figure 2.) For example, the EcoRI restriction site can be read GAATTC on both strands (always remember that DNA sequences are read in a 5’ to 3’ orientation). Three types of ends can be produced by restriction endonucleases; cohesive 5’ overhangs, cohesive 3’ overhangs and blunt ends. Cohesive 5’ and 3’ overhangs are preferably chosen for preparing DNA fragments to be ligated since blunt-end ligations are less efficient than cohesive-end ligations and require higher concentrations of both DNA ligase and the DNA to be ligated. Figure 2 Types of ends produced by restriction endonucleases. Depending on the restriction enzyme you use, you will cut DNA at a specific position and you will generate three possible types of ends. Three examples are displayed in this figure. (A) The EcoRI enzyme recognizes the 5’-GAATTC-3’ sequence and performs the hydrolysis of the phosphodiester bond linking the guanine (G) and the adenine (A) on both strands generating cohesive 5’ overhang ends. (B) KpnI cuts between the two cytosines (C) of the 5’-GGTACC-3’ sequence to generate cohesive 3’ overhang ends. (C) By cutting between the T and A of the 5’-GATATC-3’ sequence, EcoRV generates blunt ends.

C. Ligation Principle

Double-stranded DNA fragments with compatible cohesive termini or blunt ends can be covalently joined (ligated) in an ATP-dependent reaction that involves the formation of phosphodiester bonds between 5'-phosphate residues and 3'-hydroxyl residues. A common enzyme used in molecular biology laboratories for the ligation of DNA fragments (for example, the insertion of a DNA fragment into a linearized plasmid vector) is T4 DNA ligase (Figure 3). In ligation reactions, the optimal ratio of vector to insert DNA depends on the vector (lambda,

http://www.fermentas.com/catalog/modifyingenzymes/t4dnaligase.htm


34

cosmid, plasmid, or M13 phage), the size of the DNA fragments, and the nature of the DNA termini (cohesive vs blunt ends). A good compromise for ligation is an insert:vector molar ratio

of 3:1 with 20-75 ng of vector DNA in a reaction volume of 40 L. The amount of ligase needed, the temperature of the reaction and the incubation time can vary considerably depending upon the type of ligation that is being carried out (Cohesive end or blunt end). Once ligated, DNA can then be introduced into prokaryotic cells through transformation (to be done next week). Figure 3. Formation of a phospho diester bond through ligation. A new phosphate diester bond can be formed between the 3' hydroxyl and 5' phosphate ends of two DNA strands by using an enzyme called T4 DNA ligase in the presence of ATP. Figure taken from: http://chemwiki.ucdavis. edu

It is important to note that the ligation process can proceed without the 5’ phosphate on one of the DNA strands (Figure 3, DNA-2). Thus we can artificially block ligation by removing the 5’ phosphate of thic DNA strand. This dephosphorylation can be achieved using an enzyme called Alkaline Phosphatase. This enzyme can hydrolyze monoester bonds but not diester bonds (Figure 4). Dephosphorylation is often used in non-directional ligation strategies since it can prevent can self-ligation of the plasmid vectors digested with only one enzyme (See the next section on Ligation strategies). Figure 4. Dephosphorylation of DNA ends. Alkaline phosphatase hydrolyzes the monoester bond between the 5’phosphate and the oxygen atom at the end of a DNA fragment. D. Ligation Strategies

There are two basic strategies for ligating DNA fragments into plasmid vectors depending on the kind of termini in the insert and vector:

http://chemwiki.ucdavis.edu/Organic_Chemistry/Organic_Chemistry_With_a_Biological_Emphasis/Chapter_10%3A_Phosphoryl_transfer_reactions/Section_10.4%3A_Phosphate_diesters


35

a) Directional ligation: This is when two different enzymes are used to produce non-complementary (non-cohesive) protruding DNA termini. This prevents recircularization of the vector and also ensures that the insert is oriented in a specific direction inside the vector (Figure 4).

Figure 4. Directional ligation. In this example, XhoI and EcoRI were used to digest the destination vector as well as the insert. Compatibles DNA ends were created at both ends of the insert and in the circular plasmid vector. Only one ligation orientation is possible with this strategy. To illustrate the reading frame concept, arrows were placed where open reading frame are found. After ligation, you should noticed that the open reading frame of the vector and insert are in the same orientation and this results in one long open reading frame.


36

b) Non-directional ligation: Non-directional ligation occurs when only one enzyme is used

to produce either blunt or protruding ends (Figure 5). This strategy can result in the formation of undesirable, recircularized plasmid molecules without any insert. As mentioned before, alkaline phosphatase should be used to avoid recircularization of the vector when non-directional ligation is performed.

Figure 5 Non-directional ligation. In this example, only one restriction enzyme was used to digest the vector and the insert (XhoI). Following ligation, three molecules could potentially be found: a recombinant molecule in which the insert was inserted in the wrong orientation (bottom left), a recombinant molecule in which the insert was inserted in the right orientation (bottom center) and a recircularized vector (bottom right).This semester, we will be subcloning the coding sequence of the T7 RNA polymerase in a specific orientation to match the reading frame of the pTrcHisB vector and therefore, it will be a directional ligation.


37

E. Control Treatments for Ligation

The following controls are usually recommended for ligation:

Positive control: usually a plasmid vector that has been digested with only ONE enzyme. In the presence of T4 ligase, the open plasmid should be recircularized.

Negative control: a doubly digested plasmid with non compatible termini. In this lab, you will pre-digest pTrcHisB with both XhoI and EcoRI to generate incompatible overhangs so that self-ligation cannot occur. Notice that a partial digest for which the plasmid is cut with only one of the two restriction enzymes would result in compatible termini that might be ligated.

These controls are ONLY for the ligation portion of the experiment (that will verify that

your ligase enzyme is functioning properly, and that your restriction enzymes cut appropriately). These controls are in ADDITION to the controls that will be included for the bacterial transformation portion of the lab next week.


38

PROCEDURES

There is three parts to this week experiment. First, our T7 RNA polymerase amplicon (hereafter referred to as T7 amplicon) and our destination vector, pTrcHisB will be digested using XhoI and EcoRI. Both digests will be further purified using the Wizard PCR clean-up column for removing any contaminants (buffer salts, cofactors, ect.) that might interfere and lower the activity of T4 ligase, which is the enzyme to be used for ligation. Finally, we will prepare our ligation reactions. Part A: Digestion of the T7 amplicon and the pTrcHisB vector by XhoI and EcoRI.

1. You will be provided with 2.5 g/25 L of the plasmid vector pTrcHisB. Prepare the restriction digest of your PCR amplicon and pTrcHisB as described in the table below. Use the remaining fraction of the undigested pTrcHisB for preparing:

1) An undigested control containing 0.1 g of pTrcHisB in a final volume of 9 L to be electrophoresed at steps 8-9 (sample 1).

2) An aliquot containing 40 ng in a final volume of 40 L. This latter aliquot (40

ng/40 L) of the undigested pTrcHisB is to be handed in to your TA for storage at -70°C. This undigested aliquot will serve as a positive control for the transformation protocol to be completed next week.

2. Digest your two samples for 2 hour at 37°C.

3. While waiting for your digests, prepare the agarose gel you will require at step 8 (4-5

groups can share one gel).

4. At the end of the 2 hour incubation, add 2 L (1 U/L) of Shrimp Alkaline Phosphatase (SAP) to the vector digestion sample and put it back in the water bath for 30 min. Under normal circumstances, you shouldn’t have to dephosphorylate your vector since you are using two different enzymes. This step was added to ensure that vector re-ligation cannot occur and to help avoid false positives in later labs. During the dephosphorylation procedure keep the T7 amplicon digestion in the 37°C water bath.

Sample Sample volume

(L)

H2O

(L)

10X Buffer React 3

(L)

XhoI [10units/L]

(10 units)

EcoRI [10units/L]

(10 units)

Final volume

(L)

T7 Amplicon

40 L 1 L 1 L 100 L

pTrcHisB

(2 g) 20 L 1 L 1 L 100 L


39

5. Inactivate the SAP by transferring the vector digestion sample from the 37°C water bath to a 65°C heat block. Incubate for 15 min.

6. Clean up your doubly digested PCR amplicon and pTrcHisB samples using the Wizard PCR clean-up column as described in Appendix E3.

7. Transfer 2 L of your doubly digested and purified pTrcHisB in a tube already containing

38 L of water. This aliquot will serve as a negative control for the transformation next week and it has to be handed in to your TA for storage at -70°C.

Part B: Estimation of the concentration of your purified doubly digested amplicon and vector.

Before proceeding Part C of the experiment, you need to estimate the concentration of your purified amplicon and vector by agarose gel electrophoresis to figure out the appropriate volumes to be used for ligation.

8. Cast a 1% agarose gel as described in Appendix E1 (4-5 groups can share one gel) and prepare your DNA aliquots to be electrophoresed as explained in the figure below.

Notice that only 5 L of the Alpha Quant DNA ladder are to be loaded onto the gel.

9. Prepare your DNA aliquots to be electrophoresed as follows:

1) 9 L of undigested pTrcHisB vector from step 1 + 1 L of 10X loading buffer

2) 2.5 L of purified digested pTrcHisB vector + 6.5 L of H2O + 1 L of 10X loading buffer.

3) 2.5 L of purified digested T7 amplicon + 6.5 L of H2O + 1 L of 10X loading buffer.

10. Proceed with electrophoresis at 100 V for about 40 min and take a picture of your gel using the AlphaImager™ mini. Request a print out of your gel picture to be inserted into your laboratory notebook.


40

Part C: Ligation of doubly digested T7 RNA polymerase amplicon into doubly digested pTrcHisB.

Before you proceed with ligation, you have to estimate the concentrations of your PCR amplicon and pTrcHisB samples. This can be done by comparing intensities of the DNA bands of your samples to those of the DNA markers (see Appendix E2).

Sometimes the amplicon and pTrcHisB bands are hardly visible on agarose gel due to

technical difficulties during the purification. If this is your case, first consult your TA to discuss whether you should use your samples for ligation or borrow someone else`s samples (ligation in presence of low concentrations of DNA is rarely successful).

11. Refer to your agarose gel results to estimate the concentrations of your T7 RNA polymerase amplicon and pTrcHisB samples. Use your estimated concentrations to fill the table below targeting an insert:vector molar ratio of 7:1 and 40 ng plasmid. An example of an insert:vector molar ratio calculation is provided in appendix D4.

12. Prepare your ligation reactions as described in the table below. First, add all components except the T4 ligase, mix thoroughly, and quick spin all your tubes. Your TA will add the T4 ligase, then mix and quick spin all your tubes again.

Treatments Description

H2O

(L)

pTrcHisB digested

with XhoI

(L)

Doubly digested pTrcHisB

40 ng

(L)

Doubly digested T7 RNA

pol. amplicon

(L)

Ligation buffer

5X

(L)

T4 DNA ligase

(L)

Total volume

(L)

I (T7 amplicon

+pTrcHisB)

Digested and purified T7

amplicon and pTrcHisB

0 8 2 40

II (Negative control)

Digested and purified pTrcHisB

alone.

0 8 2 40

III (Positive control)

pTrcHisB digested with

XhoI only. 21 0 8 2 40

1 You will be provided with an aliquot of pTrcHisB that had already been digested with XhoI (20

ng/L)

13. Incubate the ligations overnight in a thermocycler pre-set to 16°C. Tomorrow the Technical Staff will store your samples at -70°C. Next week, you will require these ligation products for the transformation protocol. All ligation tubes should be clearly labeled with your group number and the treatment number (Gr2-I, Gr2-ii, Gr2-iii).


41

14. Before leaving the lab, give the leftovers of your pTrcHisB and amplicon samples to your

TA.


42

ASSIGNMENT


( /10 Marks)

1. Restriction digest of pTrcHisB Refer to your agarose gel picture and discuss whether your destination plasmid vector, pTrcHisB, had been properly digested. What could be an indicator that the plasmid vector was partially digested? ( /1 Mark)

2. Lengths of doubly digested and purified pTrcHisB and PCR amplicon Refer to your agarose gel picture to plot the log of the length of the DNA markers (on the Y axis) vs the mobility as measured by the distance traveled on the agarose gel (on the X axis; see also Appendix E2 for an example). ( /3 Marks)

a. What is the exact expected length for (1) your PCR amplicon and (2) pTrcHisB plasmid vector after the digest with EcoRI and XhoI? For this question, you should be as specific as possible and provide the exact number of base pairs for each of the two samples. Explain your reasoning. ( /1.5 Marks)

b. What was the experimental length you obtained by comparison to the DNA markers for (1) your PCR amplicon and (2) pTrcHisB? Are the expected lengths for the amplicon and pTrcHisB plasmid comparable with the ones measured from the agarose gel? ( /1.5 Marks)

3. Subcloning Primer design is an essential skill for successful PCR amplification. ( /3

Marks) a. Why is it important to maintain the reading frame of the insert in frame with the

reading frame of the poly-His tag when engineering primers? ( /1 Mark) b. Explain how the forward primer was modified (addition, removal, substitution or

nucleotides) to keep the reading frame of the DNA insert coding for T7 RNA polymerase in frame with the reading frame of the poly-His tag. ( /1 Mark)

c. Identify to first 10 amino acids that will be present at the N-terminus when your T7 RNA polymerase is translated from the recombinant pTrcHisB/T7 plasmid. ( /1 Mark)

4. Transformation. The table below (see next page) shows approximate colony numbers (mock results) you might expect for some of the transformation treatments (See next laboratory session for more details of each condition). ( /3 Marks)

a. A couple of transformant colonies can be observed for the negative ligation control (transformation treatment II: pTrcHisB without any inserts), although none should be theoretically expected. Can you propose a molecular mechanism explaining how the pTrcHisB pre-digested with EcoRI and XhoI can be recircularized once in a while? ( /1.5 Marks)

b. Determine the competency of the competent bacteria used in this experiment (see appendix D5). ( /1.5 Marks)


43

Treatment

Transformation

Mock

# colonies (LB-agar plate

with ampicillin)

I pTrcHisB + T7 Insert 48

II pTrcHisB without any insert DNA (negative control for ligation)

5

VI Positive transformation treatment with undigested pTrcHisB (1 ng)

50 (10X dilution)


44


Groups 5, 13 and 21: Plasmid conformations and mobility on agarose gel vs oxidative stress: http://www3.interscience.wiley.com/cgi-bin/fulltext/113449269/PDFSTART

a) How could you assess if a plasmid was completely digested by a restriction enzyme or not by exclusively considering the results from agarose gel electrophoresis?

b) Could you estimate the size of a supercoiled plasmid using the Alphaquant1 DNA ladder?

Groups 6, 14 and 22: T4 DNA ligase

a) What are the different possible controls for a ligation treatment? b) Discuss the difficulties sometimes encountered when DNA ligation is completed with T4

DNA ligase. Groups 7, 15 and 23: A Guide to Writing in the Sciences (pp. 10-11 and 23-26)

a) Introduction versus abstract Groups 8, 16 and 24: A Guide to Writing in the Sciences, References (pp. 26-30 and 33-35)

a) When should a reference be included? b) Plagiarism versus referencing

http://www3.interscience.wiley.com/cgi-bin/fulltext/113449269/PDFSTART

http://www.neb.com/nebecomm/products/productm0202.asp


45

REFERENCES

General references

1. Endonucleases: http://onlinelibrary.wiley.com/doi/10.1002/0471142727.mb0301s31/pdf

2. Ligases : http://onlinelibrary.wiley.com/doi/10.1002/0471142727.mb0314s94/pdf

3. Phosphatases : http://onlinelibrary.wiley.com/doi/10.1002/0471142727.mb0310s00/pdf

Web references for the materials used in the lab EcoRI: http://www.neb.com/nebecomm/products/productr0101.asp XhoI: http://www.neb.com/nebecomm/products/productr0146.asp Shrimp Alkaline Phosphatase or SAP http://www.fermentas.com/en/products/all/modifying-enzymes/phosphatases-kinase/ef051-shrimp-ap T4 DNA ligase http://tools.invitrogen.com/content/sfs/manuals/t4dnaligase_1U_man.pdf

http://onlinelibrary.wiley.com/doi/10.1002/0471142727.mb0301s31/pdf



http://www.neb.com/nebecomm/products/productr0101.asp

http://www.neb.com/nebecomm/products/productr0146.asp

http://www.fermentas.com/en/products/all/modifying-enzymes/phosphatases-kinase/ef051-shrimp-ap

http://www.fermentas.com/en/products/all/modifying-enzymes/phosphatases-kinase/ef051-shrimp-ap

http://tools.invitrogen.com/content/sfs/manuals/t4dnaligase_1U_man.pdf

Laboratory Class 3: Transformation 2011

47

BACTERIAL TRANSFORMATION OF THE LIGATION PRODUCTS

OVERVIEW

Last week, your T7 RNA polymerase PCR amplicon was ligated into the pTrcHisB vector at the XhoI and EcoRI restriction sites. In this laboratory, you will recuperate your ligation products and use them to transform competent E coli cells. You will then plate your transformation mixtures on agar plates containing the ampicillin antibiotic, and only the successfully transformed cells having integrated an intact copy of pTrcHisB or pTrcHisB/T7 will survive and grow. Next week, you will count the transformant colonies and analyze some of the colonies to confirm the presence of the expected recombinant plasmid, pTrcHisB/T7.

LEARNING OBJECTIVES


Explain the concept of cell competence and the procedure for making cells competent

List and explain the genetic features of the DH5 cell line that justify its common use for subcloning

Hands-On Skills

Prepare competent E. coli cells

Transform competent cells

Cast agar plates

Inoculate agar plates with bacterial suspensions under sterile conditions Analytical Skills

No results to be generated this week (colonies will only be counted next week)


48

BACKGROUND

A. Bacterial Transformation

Genetic transformation is a process in which a bacterial recipient can take up exogenous DNA. Artificial transformation of bacterial cells with plasmid DNA has become a routine procedure, yet the mechanism by which the hydrophilic DNA molecule is transported across the plasma membrane is still poorly understood. A complete transformation process includes: the development of cell competence (Figure 1, step 1), addition of plasmid DNA (step 2), uptake (step 3) and selection of phenotypic trait such as resistance to ampicillin (step 4).

To enhance the efficacy with which bacterial cells take up DNA and become transformed, bacteria are made “competent”. E. coli is normally made competent for uptake of exogenous DNA in the laboratory by artificial means that usually involve chemical treatments. The importance of divalent cations, especially Ca2+, for inducing competence is well established; the

transformation efficiency of E. coli DH5, for instance, is nearly 106 transformants per µg of plasmid DNA in presence of 50 mM Ca2+ compared to less than 10 transformants per µg of plasmid DNA without Ca2+ (J Bacteriol 1995, 177:486). The mechanism by which the negatively charged DNA gets transported across the plasma membrane involves the formation of transitory coordination complexes between lipopolysaccharides, Ca2+, and the phosphate groups within the plasmid DNA backbone (Biomacromol 2008, 9:2501).

Step 4 displays screening of transformant cells using a selective medium. In the lab, you will use an agar plate with ampicillin to screen for successfully transformed cells containing pTrcHisB, as this vector has a gene coding for resistance to ampicillin.

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=7814343&dopt=Abstract

http://www.ncbi.nlm.nih.gov/pubmed/18698848


49

B. Antibiotic Resistance

DNA vectors such as plasmids usually contain a resistance gene for facilitating the screening of cells that have been successfully transformed. pTrcHisB contains a gene coding for β-lactamase, an enzyme hydrolyzing the β-lactam ring of ampicillin. Bacteria having integrated an empty or a recombinant pTrcHisB molecule can therefore survive in the presence of ampicillin, although all other non-transformed cells cannot. This selection process is very valuable because bacterial transformation is relatively exceptional with only a very small percentage of competent cells being transformed. C. Sterile Conditions

Sterile conditions refer to laboratory practices to avoid exposing preparations to bacteria, mold, and other contaminants. Sterile conditions are important in this experiment to prevent contamination of your LB agar plates. At the ampicillin concentration found in agar (200

g/mL), most microorganisms will not survive (bactericidal effect), although the growth of many others will only be retarded (bacteriostatic effect) and some microorganisms will not be affected at all. If contaminants are transferred onto the agar plates during inoculation, ideally only the transformant cells will be able to actively grow. But after a couple of days, the ampicillin concentration remaining in agar will be lowered due to degradation (The half life of ampicillin is approximately 2-5 days) or metabolism by transformant cells, and the bacteriostatic effect is lessened. This explains why initially `clean` agar plates might become contaminated after a couple of days.

For the purpose of this lab, maintenance of sterile conditions is imperative as your plates will be kept in the lab for one week – you will only return to the lab by next week for counting colonies and proceeding to the inoculation of some liquid cultures (see lab 4). The following general guidelines will help you maintain a sterile environment:

http://en.wikipedia.org/wiki/Beta-lactam_antibiotic

http://www.youtube.com/watch?v=j2a36DJpdbo


50

Maintain a clean work area by washing with 70% ethanol before and after transformation

Wear clean gloves

Avoid talking or breathing directly above agar plates, media bottles or tubes that are open

Set up your work area so that you don’t have to manipulate or move things directly above your plates

Always work near the flame (working distance should be less than 20cm)

Use a new, sterile pipettor tip for every transfer and keep your tip box closed as much as possible to minimize cross contamination

Keep the lids of your tubes closed when not using your samples

The lids of microcentrifuge tubes can be easily contaminated by contact with non-sterile surfaces (e.g., your fingers) or by air borne particles. Be careful when transferring solutions from one tube to another.

Media can be also contaminated by contact with non-sterile surfaces or by air borne organisms. Open lids and coverings carefully avoiding contact with any part of the cover that may contact the media; minimize the amount of time the container is exposed to air.

Work near a flame when opening tubes or dishes to decrease air borne contamination.

D. Why are we using the DH5 E. coli Cells?

The DH5 cell line has been designed for routine cloning applications. Some features

contributing to the stability of the DH5cell line and making it suitable for cloning purposes are:

F- : Does not carry the F+ plasmid for conjugation. An important step in ensuring biosafety since it prevents accidental dissemination of plasmids.

http://upload.wikimedia.org/wikipedia/commons/6/6d/DH5alpha.pdf


51

RecA1- : Lack of the RecA1 functional protein that is necessary for DNA recombination. A RecA1- cell line therefore minimizes unwanted recombination between plasmid and bacterial chromosome.

EndA- : Lack of the functional endonuclease EndA. EndA+ cell lines have been observed to degrade plasmid DNA during long term storage.

DeoR and nupG: Permits uptake of larger sized plasmids

LacZM15: Deletion of the alpha portion of the beta-galactosidase gene. Allows screening of transformant colonies based on their color (blue/white screening), but only with certain plasmid vectors. Blue-white screening is not possible with pTrcHisB.

E. Important Considerations: TRANSFORMATION CONTROLS

Controls should be included to assess the efficacy of the experimental procedure when transforming competent cells. The specific controls you will be doing in the lab this week are:

Positive transformation control: Competent E. coli cells will be transformed with the undigested pTrcHisB that contains the resistance gene to ampicillin, Ampr. This control will allow you to calculate the transformation efficiency. It is the efficiency with which competent cells can take up exogenous DNA and survive the antibiotic selection process. Transformation efficiency is always represented as the number of transformants or colony forming units (cfu) per microgram of DNA used for the transformation (See Appendix D5)

Negative transformation control: Competent cells will be incubated without any plasmid DNA. This treatment is to assess for background resistance of the competent

DH5 cells to ampicillin without any plasmid DNA.

Notice that these controls, which verify competence and absence of background ampicillin resistance of bacteria, strictly refer to the transformation portion of the experiment. These transformation controls are in ADDITION to the controls that were included in the ligation portion of the experiment


52

PROCEDURES

Your TA will demonstrate how to prepare agar plates with ampicillin (200g/mL). It is important that you can cast your agar plates at the very beginning of the lab to get them ready for plating today’s transformation. Over incubation of the liquid agar with ampicillin at high temperature (45-60°C) might also result in ampicillin degradation. Before performing this exercise you should watch the following video: Sterile conditions (10:04) or (http://www.youtube.com/watch?v=j2a36DJpdbo) Part A: Preparation of Competent Bacteria

Yesterday, 2 mL of Luria Bertani (LB) liquid broth without ampicillin was inoculated with a

colony of DH5 cells by the Technical Staff, and this inoculated broth was incubated overnight at 37°C on a rotary shaker (225 cycles/min). At their arrival in the lab this morning, the Technical Staff members transferred 1 mL of this overnight LB liquid culture, which had reached the stationary phase by then, into a flask containing 100 mL of fresh LB medium without ampicillin. The flask was then kept under vigorous agitation at 37°C until an optical density at 600nm of ~0.25-0.30 was reached (about 2 hours). It is important to note that this optical density was chosen due to time constraints (an optimal optical density would be around 0.6). At your arrival in the laboratory, you will be provided with 10 mL of this liquid culture.

1. Pour 10 mL of the DH5 liquid culture into a centrifuge tube and immediately chill the tube on ice for 15 min. Also ensure that the two working solutions of 0.1M CaCl2 s and 0.1M CaCl2 plus 15% glycerol are on ice.

2. Centrifuge the cells for 10 min at 3,300g and 4°C.

3. Discard the medium and gently resuspend the pellet of cells in 5 mL of cold 0.1M

CaCl2 (DO NOT VORTEX). E. coli cells treated with CaCl2 have very weak cell walls. They will easily lyse and die if vortexed or handled roughly. This will result in your transformation failing due to insufficient competent cells.

4. Keep the cells on ice for 30 min.

5. Centrifuge the cells for 10 min at 3300g and 4°C.

6. Remove the supernatant and gently resuspend the cell pellet in 1.0 mL 0.1 M CaCl2 solution containing 15% glycerol. (DO NOT VORTEX)

7. Your cell preparation is now ready for transformation. Keep your tubes on ice until

you are ready to proceed with the transformation.

http://www.youtube.com/watch?v=j2a36DJpdbo


53

Part B: Transformation of Competent DH5a Cells with Ligation Products

You will transform DH5 cells made competent in Part A with aliquots of the ligation treatments performed last week.

8. Gently transfer 100 L of you competent cells prepared at step 7 into six different pre-labelled microcentrifuge tubes (Your tubes should be labelled with your group and the treatment number, see table below). Keep all your tubes on ice.

9. Add 40 L of each plasmid DNA source into the appropriate tube (see table below). Mix well by gently tapping the tubes. Do not vortex as the cells are fragile at this point.

Treatment

Description of the transformation

Volume of

DH5

(L)

Volume of DNA

(L)

I pTrcHisB XhoI/EcoRI + T7 amplicon XhoI/EcoRI (Ligation treatment I)

100 40

II pTrcHisB alone, digested by XhoI/EcoRI (Ligation treatment II, Negative control for the ligation)

100 40

III pTrcHisB digested by XhoI only (Ligation treatment III, Positive control for the ligation)

100 40

IV No DNA (1st negative control for the transformation)

100 0

V pTrcHisB digested by Xho/EcoRI, no T4 DNA ligase

(aliquot of 40 L from Step 7 of Lab Class 2) (2nd negative transformation treatment)

100 40

VI 40 ng of undigested pTrcHisB (aliquot of 40 ng in 40

L put aside at Step 1 of Lab Class 2) (Positive transformation treatment)

100 40

10. Incubate on ice for 30 min.

11. Transfer the tubes to a rack placed in a water bath preheated to 42°C and incubate

for exactly 1 min. Do not shake the tubes.

12. Transfer the tubes to ice and allow the cells to chill for 2 min.


54

13. Carefully add 0.5 mL of LB broth to each tube and transfer the tubes to a shaking incubator (225 cycles/min) set at 37°C for 45 min.

At the end of this incubation, proceed to step 14 with treatment I to V and to step 15.for treatment VI.

14. Pipet 100 L of each bacterial suspension onto the pre-identified LB-Ampicillin agar plate, and then spread the bacteria evenly over the entire plate surface.

15. Prepare 100X and 1000X dilutions of the treatment VI solution. While preparing your dilutions, you should make sure that the minimum volume you will transfer on your

agar plate is 10 L.

16. Leave your agar plates at room temperature until the liquid is completely absorbed - this should take about 20 min. Your TA will inform you where to put your plates. The Support Staff members will put all agar plates at 37°C for 24 hrs, and then transfer them at 4°C until colony counting is done next week. All plates will be put upside down to prevent condensation on the lid; condensation droplets falling back onto the agar surface would result in cross contamination among the colonies.


55

ASSIGNMENT


( /10 Marks)

1. Plasmid copy number The concept of copy number is an important factor to consider when preparing a minipreparation of plasmid DNA. ( /3 Marks)

a) Define what is a plasmid copy number? ( /1 Mark) b) Is the pBR322-derived pTrcHisB considered a low or high copy number plasmid?

Why? ( /1 Mark) c) What is a reasonable range for the copy number value to expect for the

pTrcHisB/T7 plasmid you will purify in this lab? ( /1 Mark)

2. Digestion of recombinant plasmids Predict the expected DNA bands for the XhoI/EcoRI digest of (1) pTrcHisB and (2) pTrcHisB/T7 (your recombinant plasmid vector with the T7 RNA polymerase insert) using NebCutter. You should first generate the exact sequence of your recombinant plasmid vector, and then paste this sequence into NebCutter. Don’t forget to take into consideration the ligation details. Explain your reasoning and insert a copy of the pTrcHisB/T7 sequence you used as well as a copy of your NebCutter results. ( /4 Marks)

3. DNA sequencing The PCR amplification that occurs during a sequencing reaction results in linear amplification, though conventional PCR amplification with two delineating primers gives exponential amplification. ( /3 Marks)

a. What does linear amplification mean? ( /1 Mark) b. How many strands of DNA are amplified from a one single double-stranded

template after 20 cycles of (1) a conventional PCR amplification and (2) a sequencing PCR amplification? ( /2 Marks)

http://tools.neb.com/NEBcutter2/index.php


56


Groups 1, 9 and 17: Writing A Guide to Writing in the Sciences, Scientific writing style (pp. 80-90) Groups 2, 10 and 18: Bacterial transformation: Plasmid DNA binding onto E. coli cell surface (Biomacromolecules 2008, 9:2501)

a) Several molecular techniques and details are covered in this article, but you don’t need to cover all of them. Simply emphasize the underlying molecular principle for DNA binding onto the cell surface.

Groups 3, 11 and 19: Chemical transformation versus electroporation of E. coli. (See reference 4 to 6)

a) Explain to your colleagues the principle of chemical transformation and electroporation of E. coli.

b) Discuss the advantages and disadvantages of both transformation methods. Make sure to talk about the transformation efficiency.

Groups 4, 12 and 20: Bacterial transformation: Role of membrane potential (J Biotechnol 2006, 127:14).

a) Explain how membrane potential varies throughout the transformation protocol.





57

REFERENCES

1. Huang R, Reusch RN. Genetic competence in Escherichia coli requires poly-beta hydroxybutyrate/calcium polyphosphate membrane complexes and certain divalent cations. J Bacteriol. 1995 Jan;177(2):pp 486-90.

2. Panja S, Aich P, Jana B, Basu T. Plasmid DNA binds to the core oligosaccharide domain of LPS molecules of E. coli cell surface in the CaCl2-mediated transformation process. Biomacromolecules. 2008 Sep;9(9):2501-9.

3. http://www.mfa.od.ua/page55.htm

4. http://www.mfa.od.ua/page61.htm

5. http://www.ejbiotechnology.cl/index.php/ejbiotechnology/article/view/v13n5-11/1234 Web references for the materials used in the lab

DH5http://tools.invitrogen.com/content/sfs/manuals/subcloningefficiencydh5alpha_man.pdf

http://www.mfa.od.ua/page55.htm

http://www.mfa.od.ua/page61.htm

http://www.ejbiotechnology.cl/index.php/ejbiotechnology/article/view/v13n5-11/1234

http://tools.invitrogen.com/content/sfs/manuals/subcloningefficiencydh5alpha_man.pdf

Laboratory Class 4: Screening and sequencing 2011

59

SCREENING FOR RECOMBINANT PLASMID AND DNA SEQUENCING

OVERVIEW

This week, we will finalize the sub-cloning procedure of the T7 insertion in pTrcHisB. You will first inoculate and screen five transformant colonies to confirm the presence of the T7 insert into the pTrcHisB/T7 plasmid. You should obtain at least one positive transformant colony out of your five inoculates. You will then sequence the T7 insert from your positive clone to identify the point mutation that had been introduced in the coding sequence of the mutant you received at the beginning of the semester.

The positive transformant cell line you will identify this week, i.e., the one for which the expected insert will be confirmed, will be put aside and used for the second part of the course that will relate with the expression, purification and functional assessment of your T7 RNA polymerase mutant.

LEARNING OBJECTIVES


Identify and explain the main procedural steps for the (mini)preparation of plasmid DNA by alkaline lysis.

Identify and explain the main procedural steps for DNA sequencing Hands-On Skills

Inoculate a liquid culture with a transformant colony

Isolate plasmid DNA (miniprep)

Digest recombinant plasmid DNA to screen for a given DNA insert

Sequence DNA

Cryopreserve a cell culture in glycerol-supplemented liquid medium Analytical Skills

Analyze and discuss transformation results

Discuss the efficacy of ligation based on the number of colonies obtained for the different treatments

Estimate the transformation yield in # colonies/g plasmid DNA

Select appropriate restriction enzymes to screen for the presence of a DNA insert in recombinant plasmids

Use Nebcutter to simulate restriction digests and predict the size of the expected DNA fragments

Use nucleotide BLAST to analyze DNA sequencing results

Assemble the individual sequencing results to reconstruct the whole sequence of your DNA insert coding for T7 RNA polymerase


60

BACKGROUND A. Minipreparation of plasmid DNA

You will isolate plasmid DNA using a small scale or minipreparation protocol that was first designed by Dr. Birnboim, a cross-appointed member of the uOttawa Biochemistry, Microbiology and Immunology department. The research article in which the miniprep procedure was first described still constitutes one of the most commonly referred article nowadays in science (1). The miniprep protocol permits the rapid isolation of small amounts of

plasmid DNA (1-10 g). The plasmid isolation procedures make use of the covalently closed circular nature of bacterial plasmids and their small size in relation to the bacterial chromosome. In the alkaline lysis method that you will be using, bacterial cells are lysed in a solution containing NaOH and sodium dodecyl sulphate (SDS) (Figure 1.). Effective lysis of bacterial cells is a key step in plasmid isolation and it directly affects DNA yield and quality. The alkaline conditions (pH 12-12.5) denature both the chromosomal DNA and the plasmid DNA and SDS denatures proteins. The solution is then neutralized with potassium acetate. Under these renaturing conditions, the plasmid DNA, whose two strands remained intertwined during the alkaline lysis, rapidly reanneals. The chromosomal DNA cannot renature as quickly and is therefore trapped along with proteins in an insoluble complex. The precipitate is removed by centrifugation and the plasmid is precipitated from the supernatant through the addition of

ethanol. Typical yield for the alkaline lysis protocol is about 1-2 g of plasmid DNA per mL of liquid culture. Figure 1. Alkaline lysis protocol for plasmid purification. This procedure takes advantage of the fact that plasmids are relatively small closed circular DNA molecules and bacterial chromosomal DNA is much larger. This difference in size allows for selective precipitation of the chromosomal DNA and cellular proteins from plasmids. Once the cells are lysed under conditions which denature both nucleic acids and proteins, the solution is neutralized by the addition of Potassium Acetate. During neutralization, chromosomal DNA and proteins precipitate because it is impossible for them to renature correctly (due to their large size). Plasmids renature correctly and stay in solution, effectively separating them from chromosomal DNA and proteins. Figure modified from Qiagen.

http://www.qiagen.com/literature/qiagennews/0299/992lysis.pdf


61

B. DNA Sequencing

Different methods can be used for sequencing DNA. In this lab, you will be using the enzymatic base-specific chain termination procedure, which is essentially a ‘special’ PCR amplification. The PCR and the sequencing reactions will be performed at the McGill University’s Sequencing Center and the sequencing results will be posted, usually within one week, through the Nanuq server.

As mentioned before, our samples will be sequenced using a Chain terminator method also known as the Sanger method (named after its developer Frederick Sanger) (2-3). This method was further improved by the use of fluorescent terminators. Here is a more detailed description of the different steps involve in the sequencing of your samples:

Step 1: PCR amplification In the enzymatic sequencing procedure, the DNA to be sequenced is denatured and

annealed with a single primer that delineates the origin of sequencing. One peculiar feature of PCR-based sequencing is the use of a mixture of regular deoxynucleotides (dNTPs) and altered dideoxynucleotides (ddNTPs) whose hydroxyl group on 3’C of the deoxyribose sugar has been substituted with H (Figure 2). These ddNTPs, which are found in much lower proportions than the dNTPs, can bind to DNA polymerases and be transferred at the 3’ end of the elongating strand, but they prevent the addition of any further nucleotides upon their incorporation. All PCR amplicons are therefore characterized by a single terminator ddNMP at their 3’ ends, and the identity of the chain-terminating nucleotide can be determined by tagging each ddNTP with a distinctive dye.

Applied Biosystems introduced BigDyesTM, which consist of a fluorescein energy donor dye directly linked to an energy acceptor dichlororhodamine dye. Together the dyes make up an energy-transfer system that provides significantly greater sensitivity compared to single dyes. BigDyes also exhibit improved color resolution, a property that allows better base-calling. The additional sensitivity conferred by energy transfer dyes means that less template is needed for a sequencing reaction, a feature that is valuable for sequencing very large templates and even for direct sequencing of genomic DNA.

Figure 2 Structure of a deoxynucleotides (dNTPs shown in A) and dideoxynucleotides (ddNTPs shown in B).

https://genomequebec.mcgill.ca/nanuqAdministration/j_security_check?service=http%3A%2F%2Fci19.genome.mcgill.ca%3A8080%2FnanuqAdministration%2F

http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_040741.pdf


62


63

Figure 2. DNA sequencing. The double strand DNA template is first denatured by heat and then, the temperature is lowered so that the oligonucleotide primer can hybridize to its complementary sequence (step 1). The free 3’ hydroxylated group is recognized by DNA polymerase and elongation occurs until the addition of a dideoxynucleotide (ddNTPs) stops the reaction (step 2). A limited amount of ddNTPs is used in order to have fragments of various sizes, each one having a ddNTP at its 3’ end (see fragments on the left of the capillary). DNA fragments are then separated according to their sizes using by capillary electrophoresis (step 3). At the end of the capillary, a laser beam excites the dyes linked to the ddNTP (step 4). The resulting fluorescence is recorded by a photomultiplier (step 5) and a computer converts this signal into a graphic representation of the sequence called, a chromatogram (step 6). A colour version of this figure is available in the manual section of your virtual campus.

Step 2: Analysis of PCR amplicons by capillary electrophoresis A mixture of DNA fragments with different lengths is obtained upon PCR

amplification, but another step is required to resolve the fragments and identify their terminal ddNs. Capillary electrophoresis (CE) chromatography is commonly used for resolving the mixture of amplicons generated by PCR-based sequencing. In CE, DNA

separation is achieved in a fused-silica capillary with a 25-100 m diameter. The high ratio of surface area to volume of the small capillary tube serves to efficiently dissipate heat produced during electrophoresis, allowing the use of higher electric fields that can decrease the run time and improve DNA resolution.

Step 3: Automated base-calling

The time profile of the fluorescence signal (color and intensity) is recorded at the output of the capillary tube throughout the analysis run of the PCR sequencing product. The fluorescence signal is then analyzed with a computer to determine the DNA sequence (this procedure is usually referred as base-calling analysis: a nucleotide is assigned to each fluorescence peak based on its fluorescence spectrum).

This animation: http://www.wellcome.ac.uk/Education-resources/Teaching-and-education /Animations/DNA/WTDV026689.htm provides a good resume of the Sanger sequencing method.

http://www.wellcome.ac.uk/Education-resources/Teaching-and-education/Animations/DNA/WTDV026689.htm

http://www.wellcome.ac.uk/Education-resources/Teaching-and-education/Animations/DNA/WTDV026689.htm


64

PROCEDURES

Part A: Inoculation of transformant Colonies into Liquid Culture Medium

One member of your team will be required to come to the lab between 8-11:00am on the day preceding your regular laboratory class, except for Monday sections that are to return to the lab on the preceding Thursday morning. You should plan about 30 min to complete the work. You should therefore arrive in the lab by 10:30am at the latest to make certain you can exit the lab by 11:00am.

You will inoculate five bacterial colonies from your transformation treatment I into five culture tubes. Pick colonies that are well delineated to avoid cross contamination among neighboring colonies. Inoculated cells will grow and divide rapidly (up to ~109 cells/mL of liquid broth) and each cell will contain several copies of the recombinant plasmid vector.

1. Count your transformant colonies.

Treatment

Description of the transformation

Volume of

(L)

Volume of DNA

(L)

Number of colonies

I pTrcHisB XhoI/EcoRI + T7 amplicon XhoI/EcoRI (Ligation treatment I)

100 40

II pTrcHisB alone, digested by XhoI/EcoRI (Ligation treatment II, Negative control for the ligation)

100 40

III pTrcHisB digested by XhoI only (Ligation treatment III, Positive control for the ligation)

100 40

IV No DNA (1st negative control for the transformation)

100 0

V pTrcHisB digested by XhoI/EcoRI, no T4 DNA ligase (2nd negative transformation treatment)

100 40

VIa 40 ng of undigested pTrcHisB 100X dilution (Positive transformation treatment)

100 40

VIb 40 ng of undigested pTrcHisB 1000X dilution (Positive transformation treatment)

100 40

2. You need five polystyrene snap cap tubes (17mm X 100mm) each containing 5 mL of

LB broth with 100 g/mL ampicillin.


65

3. Examine your agar plate for transformation treatment 1 and identify five well delineated colonies. Use a marker to identify the five colonies to be inoculated.

4. Use a sterile plastic tip to slightly touch the external surface of a colony, and then

simply drop the tip into a culture tube containing 5 mL of LB broth with ampicillin

(100 g/mL). Repeat the inoculation procedure for your four other colonies.

5. Quickly vortex your culture tubes and put them back on a rack. The Support Staff will transfer all tubes in a shaking incubator (200 rpm) at 37°C.

Part B: Minipreparation of plasmid DNA (miniprep)

6. Recover and vortex the five culture tubes, which you inoculated yesterday, to resuspend the cells.

7. Transfer 0.5 mL of each of your five culture tubes into a distinct, labelled 1.5 mL

microcentrifuge tube.

Those five microfuge tubes are to be kept on ice until you can identify, by restriction digest (Part C), which one(s) contain(s) the expected pTrcHisB/T7 recombinant plasmid. Once you have identified at least one positive clone, you will retrieve the appropriate tube and proceed to its cryopreservation as described at step 25.

8. Centrifuge your five polystyrene culture tubes at 3,000g for 5 min using the

centrifuge with a swinging bucket rotor. Discard the supernatant.

9. Add 100 L of Resuspension Buffer (50mM Glucose, 25mM Tris-HCl pH8.0, 10mM

EDTA, RNase A 20g/mL) into each of your tubes, and then vortex at high speed to resuspend the pellets. Once the pellets have been completely resuspended, transfer the contents of each polystyrene culture tube into a pre-labeled 1.5 mL microcentrifuge tube.

10. Add 200 L of Lysis Buffer (1% SDS, 0.2N NaOH) into each of your 1.5 mL tubes and mix the content by inverting the tubes five times. Observe how the properties of the samples have changed.

Do not vortex, shake or incubate your minipreparations for more than 5 min to minimize shearing of genomic DNA. Breakdown of genomic DNA into small fragments is not desirable as the smaller fragments might be extracted along with plasmid DNA.

11. Immediately add 150 L of K-acetate buffer (3M potassium, 5M acetate, pH4.8) into each of you tubes. Mix thoroughly by inverting your tubes 3 times.


66

12. Centrifuge your tubes at maximum speed for 5 min to pellet cell debris and chromosomal DNA.

13. Use a 1 mL pipettor to transfer about 75-80% of the supernatants into clean 1.5 mL

microcentrifuge tubes. Avoid transferring any of the white precipitate. If some of the precipitate gets transferred, it can be removed with a pipet tip.

14. Add 900 L ethanol 95-99% that has been pre-cooled to -20°C. Mix well by shaking.

15. Centrifuge at maximum speed for 5 min.

16. Discard the supernatants. Add 1 mL of 70% ethanol in each tube and rinse the pellets by vortexing for 5-10 sec (pellets do NOT have to be completely resuspended). Centrifuge again at maximum speed for 5 min then invert the tubes over absorbent paper for ten minutes to drain out the remaining ethanol.

After the 75% ethanol wash, the pellets tend to weakly adhere to the bottom of the tubes: be careful not to lose your plasmid DNA pellets!

17. Resuspend each pellet in 50 L of water. Part C: Analysis of the Minipreparations by Restriction Digest and Cryopreservation of One Positive Clone

18. Prepare a Master mix to digest your five minipreps knowing that you will digest 3 L

of each minipreps in a final volume of 20 L (do not forget to add 1 more reaction to the master mix to create a buffer zone so you don’t run short of your master mix)

Components Volume per reaction

(L)

Volume of the master mix (6 reactions)

(L)

H2O 13 78

10X Buffer H 2 12

EcoRI (10 Units/L) 1 6

XhoI (10 Units/L 1 6

Total volume 171 1022

1Three microliters of plasmid DNA will be added for a final digestion volume of 20 L.

2To verify that your calculation were done properly, you can divide the total volume of Master mix by

the number of reactions and you should get the total volume of one reaction (102L/6

reactions=17L)

19. Transfer 17 L of master mix into 5 labelled 1.5 mL microcentrifuge tubes.


67

20. Add 3 L of each miniprep to the corresponding tube.

21. Mix each tube well and incubate for at least one hour at 37°C.

22. Cast a 1% agarose gel with a 20-well comb. Two groups can share one gel as follows: a. Lanes 1-10: 5 digested and 5 undigested samples from 1st group

b. Lane 11: 5 L of the Alpha Quant DNA ladder c. Lanes 12-20: 5 digested and only 4 undigested samples from 2nd group.

Each TA will choose one volunteer to cast an extra 1% agarose gel to be used in step 24.

23. Prepare your samples to be loaded on the agarose gel as follows:

a. Digested samples (5X): Mix 13.5 L of each digest with 1.5 L of 10X loading buffer

b. Undigested controls (4-5X see note below): Mix 1.5 L of each miniprep with 12

L of H2O and 1.5 L of 10X loading buffer (1.5 L of an undigested miniprep

represents approximately the same DNA amount as 13.5 L of its digested preparation: band intensities should be similar).

One of the two groups sharing a gel will only be able to load 4 undigested controls (see Step 22).

24. Load 15 L of each digested or undigested miniprep sample along with 5 L of the DNA ladder, and then carry out electrophoresis at 100V for about 40 minutes. Take a picture of your results.

25. Refer to your gel picture to identify one positive colony whose band profile

corresponds to the expected bands for pTrcHisB/T7. This positive miniprep is to be used as a template for DNA sequencing (Part D). You should also retrieve the transformant cell line corresponding to your positive miniprep among the five cell lines that were put on ice at step 7. You will require this cell line next week for the protein expression procedure. Cell cultures can be cryopreserved for long periods of time if frozen at -70°C in presence of 25% glycerol. Add the appropriate volume of glycerol to your positive cell culture (0.5 mL) to reach a final concentration of 25% glycerol, invert a few times to homogenize the content, and then hand in your tube to your TA who will store it at -70°C.

Part D: DNA Sequencing

Each sequencing reaction can accurately sequence about 600 to 800 bp. In this experiment, you will use five sequencing reactions to ensure the full coverage of your T7 RNA polymerase insert containing about 2,655bp. Once the five sequencing results will be returned to you, your


68

challenge will be to examine the overlaps among the five sequencing results to deduce the complete sequence of your insert. The assembly process of different sequencing results is commonly referred to as gene assembly.

The five sequencing primers you will use for priming DNA sequencing are:

Seq F1: 5’CACTCGACCGGAATTATCG3’

Seq F2: 5’GGGCACGTCTACAAGAAAGC3’

Seq F3: 5’TACAAAGCGATTAACATTGCGC3’

Seq F4: 5’GCTGAGCAAGATTCTCCGT3’

Seq F5: 5’GCTGCTGGCTGCTGAGGTC3’

26. Retrieve the miniprep corresponding to your positive transformant and purify it using the Wizard PCR clean-up system as explained in Appendix E3 with one important

modification. You should use 35 L of water for the final elution volume instead of

50 L (see step 8 in Appendix E3). This modification will help ensure that the final concentration of the purified plasmid DNA is enough to meet the minimum concentration requirement for DNA sequencing.

The procedure for DNA sequencing is relatively straightforward, but very sensitive. The

amount of DNA template is critical: either a too low or a too high concentration of DNA can significantly reduce the number of nucleotides that can be read or sequenced. To ensure a good estimate of the DNA concentration of your purified miniprep product to be sequenced, an aliquot will be electrophoresed along with a quantitative DNA ladder (AlphaQuant1). Your miniprep DNA could also be quantified by reading the absorbance at 260nm, but that approach

would require too much of your purified 35 L sample.

27. Combine 2 L of your purified plasmid to be sequenced with 7 L of water and 1 L of the 10X loading buffer in a microcentrifuge tube. Mix, and then load the whole volume on a 1% agarose gel. Electrophorese at 100V for about 40 min.

28. Take a picture of your gel and accurately estimate the concentration of your purified

recombinant plasmid DNA.

The minimal concentration required for proceeding to DNA sequencing is 100 ng/L. If your concentration is below that minimum threshold, you will have to borrow the sequencing results of another group having worked with the same mutant number.

DNA sequencing will be performed at the McGill and Genome Quebec Innovation Centre in

Montreal. Samples are to be labeled as Day_lab#_Group#_Mutant#_Primer (e.g. Monday_202_Gr8_M2_SeqF1). You will be asked to enter your sample names in an electronic file to be directly sent to the sequencing centre along with your samples. The sample names you enter will be the ones used when the sequencing results are posted.


69

29. Samples are to be loaded on a 96 well plate with 1 row for each group. Load 5 L of

your purified DNA plasmid into each of the first five wells of your lane, and 10 L of the appropriate primer in each of the next five wells. It is very important that you follow these guidelines when loading the 96 well plates. Ask your TA or the Technical Staff if you unsure about the loading order.


70

ASSIGNMENT


( /10 MARKS)

1. Analysis of your polymerase sequence. Access the Nanuq server and retrieve your sequences (F1 to F5). Go to the NCBI web site, in the Popular Resources window, choose the BLAST option. In this BLAST window, select the nucleotide blast option. You are now ready to perform a multiple alignment between the coding sequence of the T7 RNA polymerase and your sequencing results. The top and bottom figures respectively illustrate the alignment options and a graphical summary of a set of returned alignment results. In this example, the two DNA stretches do not overlap at all as they align at two distinct regions along T7 RNA polymerase. ( /5 Marks)

https://genomequebec.mcgill.ca/nanuq



71

a. Did you successfully sequence the whole length of your DNA insert coding for T7 RNA polymerase? If not which part(s) were not sequenced? How would you proceed to sequence missing parts? ( /1 Mark)

b. By looking at the nucleotide-nucleotide alignment, can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase? Please indicate your mutant number to help your TA validate your result. ( /2 Marks)

c. Provide a copy of your sequencing results as well as a printout of the sequence alignment figure (same as the one provided as example).( /2 Marks)

2. The overview figure provided in Part A of Laboratory class 5 shows the planning for the

protein expression control aliquots. Explain the information that will be obtained from each of the two extra sets of controls that will be done collectively: ( /5 Marks)

a. First set of extra controls A liquid culture of DH5 cells transformed with a recombinant pTrcHisB/T7 will be induced with water instead of IPTG. A 1 mL aliquot is will be withdrawn at time zero and after 2hr incubation. ( /2.5 Marks)

b. Second set of extra controls A liquid culture of DH5 cells transformed with an empty pTrcHisB will be induced with IPTG. A 1 mL aliquot will be withdrawn at time zero and after 2hr incubation. ( /2.5 Marks)


72


Groups 5, 13 and 21: Specificity of the DNA sequencer, Applied Biosystems model 3730. This is the sequencer model to be used at McGill for sequencing your DNA. Groups 6, 14 and 22: Explain how Illumina sequencing works: https://www.uppnex.uu.se/uppnex-book/technologies/solexa-sequencing http://www.wellcome.ac.uk/Education-resources/Teaching-and-education/Animations/DNA/WTX056051.htm Groups 7, 15 and 23: BLAST tutorials: http://www.digitalworldbiology.com/BLAST/index.html Groups 8, 16 and 24: Interpretation of sequencing chromatogram: http://seqcore.brcf.med.umich.edu/doc/dnaseq/interpret.html

http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_041894.pdf

https://www.uppnex.uu.se/uppnex-book/technologies/solexa-sequencing

http://www.wellcome.ac.uk/Education-resources/Teaching-and-education/Animations/DNA/WTX056051.htm

http://www.wellcome.ac.uk/Education-resources/Teaching-and-education/Animations/DNA/WTX056051.htm

http://www.digitalworldbiology.com/BLAST/index.html

http://seqcore.brcf.med.umich.edu/doc/dnaseq/interpret.html


73

REFERENCES

1. Birnboim HC, Doly J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 1979 Nov 24;7(6):pp. 1513-23.

2. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977 Dec;74(12):pp. 5463-7.

3. Sanger F. The early days of DNA sequences. Nat Med. 2001 Mar;7(3):pp. 267-8.

Web references for the materials used in the lab Big Dyes: http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_040741.pdf Nanuq server: https://genomequebec.mcgill.ca/nanuq

General Introduction for Lab V-VIII 2011

75

General Introduction for Laboratory V-VIII

Gene expression is the process by which information from a gene is used to guide the synthesis of a functional protein product. There are several steps in the gene expression process, including transcription, translation and some post-translational modifications. The second part of the semester involves a series of experiments to be performed with your

transformant DH5 clone containing the recombinant plasmid vector with containing your T7 RNA polymerase insert, pTrcHisB/T7.

You will first use your positive transformant cell line selected in laboratory class 4 to inoculate a liquid culture and induce the expression of the T7 RNA polymerase protein. Notice that your expressed protein constitutes a fusion, or chimeric, protein because the His tag has been merged to the N-terminal end of T7 RNA polymerase.

Upon completion of the induction protocol, the cells will be harvested and lysed to prepare a total protein extract. Your fusion protein will be further purified using a His tag affinity chromatography column. Your fusion protein containing a His tag will be selectively retained within the column, and all other peptides will be eluted and collected in the flowthrough fraction.

Once eluted from the affinity column, your T7 RNA polymerase fusion protein will be analyzed by SDS-PAGE and Western analysis. For your western analysis, you will be using an antibody that has been specifically raised against the His tag. SDS-PAGE experiments will assess the presence as well as the length of your fusion protein whereas Western analysis will confirm that the purified protein contains the His-tag.

Finally, you will evaluate the enzymatic activity of your mutant fusion T7 RNA polymerase. This will be achieved by comparing RNA transcription assays using your mutant T7 RNA polymerase in parallel with assays using a wild type T7 RNA polymerase.

Laboratory Class 5: Protein Expression 2011

77

PROTEIN EXPRESSION

OVERVIEW

This week, you will be performing the first step in the expression of your fusion T7 RNA polymerase. Induction of the fusion protein’s expression will be achieved using genetic components of the lac operon which are present in the pTrcHisB/T7 construct in combination with an analog of allolactose (IPTG). Notice that your expressed protein constitutes a fusion or chimeric protein because the His tag had been merged at the N-terminal end of T7 RNA polymerase. Upon completion of the induction protocol, the cells will be harvested and lysed to prepare a crude bacterial protein extract. Your fusion protein will be further purified next week by His tag affinity chromatography.


Explain the genetic components of the lac operon regulating the IPTG-inducible

expression of T7 RNA polymerase in the TrcHisB/T7 and DH5 system Hands-On Skills

Inoculate and grow a transformant DH5 cell line

Assess the cell growth phase by absorbance at 600nm

Induce protein expression by adding IPTG

Harvest cells from a liquid culture

Prepare one buffer solution to be used in laboratory class 6 Analytical Skills

No results to be generated this week


78

BACKGROUND

Expression of the T7 RNA polymerase from the recombinant T7/pTrcHisB construct is tightly regulated by a repressor system. To get a better understanding of today’s experiment, we need to have knowledge of how the different genetic components of the lac operon interact with each other (Section A. lac operon) and also, how the pTrcHisB plasmid takes advantage of the lac operon’s genetic components to regulate the expression of the T7 RNA polymerase insert subcloned in the pTrcHisB plasmid vector (Section B. pTrcHisB expression regulation). A. lac operon.

In E.coli, the lac operon is necessary for the transport and metabolism of sugar (1). This operon is formed by a cluster of three consecutive genes: the β-galactosidase (z), the β-galactoside permease (y) and the β-galactoside transacetylase (a). Its transcription is tightly regulated by the constitutively expressed lacI repressor (Figure 1). In the absence of lactose, the lacI repressor binds to the lac operator (lac O) located downstream of the operon promoter and consequently, represses transcription of the operon. In the presence of lactose, this repression

is lifted. The metabolism of lactose by the -galactosidase produces a metabolite called allolactose, (see Figure 2A). This metabolite can bind to the repressor, causing a change in conformation. The repressor is now unable to bind to the operator, the lac promoter is de-repressed and transcription is allowed. Figure 1. lac operon. (A) Structure of the lac operon: promoter of lacI (p in white box) and of the operon (p in gray box), repressor (i), operator (o) and the genes (z, y and a). (B) In absence of lactose, the lacI repressor (i), which is constitutively expressed, binds to the lac operator (o) and thus prevents the transcription of the z, y and a genes by the lac promoter (p). (C) When lactose is present in the cell, it is metabolized into allolactose (inducer). This metabolite acts as an inducer by binding to the repressor lacI and consequently, reducing the affinity of this repressor for the operator element. The de-repression of the lac operon leads to the transcription of the three lac genes. This figure was taken from Biochemistry, 6th Edition.


79

B. Engineering of the pTrcHisB vector for protein expression

The pTrcHisB plasmid vector takes advantage of the lac operon transcription system. Key genetic components of the operon were inserted in the pTrcHisB vector. The lacI repressor (coded by the vector itself) binds to the lac operator present in the trp-lac hybrid promoter (Ptrc) and represses the expression of the T7 RNA polymerase located after this promoter (Figure 3A).

The induction of the fusion protein’s expression is achieved by using an analog of allolactose: the Isopropyl-β-D-thio-galactoside (IPTG) (Figure 2A). In laboratories, IPTG is used mainly because, in contrast to allolactose, IPTG cannot be hydrolyzed and therefore, its concentration remains constant. Once IPTG is added to the culture, it binds to the lacI repressor. This binding will lower the affinity of the repressor for the operator and therefore, the lacI repressor will no longer be able to bind to the operator (Figure 2B). This release of the repression will allow transcription of the fusion T7 RNA polymerase to occur.

O

O

H

HH

OH

H

OH

H OH

OH OH

O

OH

HH

H

OH

H OH

H O

H

HH

OH

H

OH

H OH

O

OH

O

OH

HH

H

OH

OH

H OH

H

-galactosidase

A)

B)

Lactose Allolactose

Isopropyl--D-thio-galactoside (IPTG)

O

H

HH

OH

H

OH

H OH

OH

S

CH3

CH3

Figure 2. (A) Conversion of lactose into allolactose by the -galactosidase. (B) Molecular

structure of the Isopropyl--thio-galactoside (IPTG).


80

Figure 3. Induction mechanism of the pTrcHisB plasmid vector. The lacI gene is present on the pTrcHisB plasmid vector. This gene is constitutively expressed and translated (step 1 and 2). (A) In absence of inducer, the lacI repressor binds to the lac operator which is located just after the Ptrc promoter (step 3). This binding leads to the repression of the transcription (step 4). (B) In presence of an inducer (IPTG), the lacI repressor binds to the inducer and therefore, is removed from the lac operator (step 3). Transcription via the Ptrc promoter can now proceed (step 4).


81

PROCEDURES

The present laboratory class involves extensive downtimes during which you will be required to prepare the buffer solutions to be used next week for the His tag affinity chromatography (see pre-assigned solutions below). The solutions will be put aside and returned to you by next week. The solutions will be shared by all students working under the supervision of the same TA. This means that the results of all your colleagues might be affected if you make a ‘boo-boo’ when preparing your solution. Be careful and ask your TA or someone else to verify your calculations. Before the lab, you should watch the following videos on solution’s preparation and on how to use a pH meter:

Solution preparation (5:32) or (http://www.youtube.com/watch?v=EHT0ChvArF8)

How to use a pH meter (10:02) or (http://www.youtube.com/watch?v=dN4yOJaarpE)

Groups 1, 9 and 17

These groups will be in charge of preparing the 1st set of extra controls (see schematic on next page)

Groups 2, 10 and 18

These groups will be in charge of preparing the 2nd set of extra controls (see schematic on next page)

Groups 3, 11 and 19

Prepare 60 mL of 8X Binding Buffer (4 M NaCl, 160 mM Tris-HCl, 80 mM imidazole, pH 7.9)

Groups 4, 12 and 20

Prepare 20mL of 8X Wash Buffer (4 M NaCl, 350 mM Tris-HCl, 320 mM imidazole, pH 7.9)

Groups 5, 13 and 21

Prepare 20mL of 4X Elute Buffer (1M imidazole, 2 M NaCl, 80 mM Tris-HCl, pH 7.9)

Groups 6, 14 and 22

Prepare 10 mL of 4X Strip Buffer (2 M NaCl, 400 mM EDTA, 80 mM Tris-HCl, pH7.9)

Groups 7, 15 and 23

Prepare 10 mL of 8X Charge Buffer (400 mM NiSO4)

Groups 8, 16 and 24

Prepare 100 mL of 1X T7 Storage Buffer (30 mM HEPES, 0.15M K-Acetate, 0.25 mM EDTA, 0.05% Tween 20, 1 mM DTT, pH 7.5)

http://www.youtube.com/watch?v=EHT0ChvArF8

http://www.youtube.com/watch?v=dN4yOJaarpE


82

Part A: Induction of the expression of the T7 RNA polymerase

Step 1 is to be completed between 8-10:30am on the day preceding your regular lab class. Monday groups are to return to the lab on the preceding Thursday morning. You should plan about 20 min to complete the inoculation procedure.

The schematic below is a summary of this week’s experiment (presented in A). Groups 7, 15 and 23 will be asked to do the 1st set of extra controls (B) whereas groups 8,16 and 24 will have the responsibility of preparing the 2nd set of extra controls (C).


83

1. Put your tube with your cryopreserved transformant cell line on ice until it is

completely thawed. Then transfer 10 L of your cell culture into a snap-cap tube

containing 3 mL of liquid LB medium with 100 g/mL ampicillin. Put your inoculated tube in the shaking incubator at 37°C.

2. Recover your inoculated snap cap tube from the incubator and transfer 0.5 mL of

the cell suspension into a flask containing 50 mL of liquid LB+AMP. Return your inoculated flask to the shaking incubator at 37°C for 2 hours.

You can now prepare the solution that was assigned to your group and that will be used for the His tag affinity chromatography next week.

3. After 2 hr of growth, check the A600 of your cell culture. This can be done by

swirling the flask gently to homogenize the contents of the flask, tilting the flask to fill the sidearm with some liquid broth, and then inserting the sidearm into the aperture of the spectrophotometer to read the absorbance at 600nm. If the absorbance is below 0.25, return your flask in the incubator for another 30 min before verifying the absorbance again.

Culture flask with a sidearm

A reference aliquot (before induction) is to be put aside before proceeding to induction with IPTG. This initial aliquot is to be compared with a second aliquot to be sampled at the end of the induction with IPTG (after induction; see steps 6 and 8).

4. Transfer 1mL of the culture into a 1.5 mL microfuge tube. This non induced aliquot

(before induction control) is to be used to prepare a total protein extract at Step 8. The groups that are responsible for the collective controls should also take a sample at this step.

5. Figure out the volume of a 100 mM IPTG stock that should add to your culture to

obtain a final concentration of 1 mM. Add the IPTG to the flask and put it back in the shaking incubator at 37°C for 2 hours.

6. Transfer 1 mL of the culture into a 1.5 mL microfuge tube. This IPTG-induced

aliquot (after induction control) is to be used to prepare of a total protein extract


84

at Step 8. The groups that are responsible for the collective controls should also take a sample at this step.

7. Transfer the contents of your flask into a 50 mL Nalgene centrifuge tube and

centrifuge at 6,000g for 5 min. Discard the supernatant and freeze your pellet of cells at -20°C until next week.

Next week, only your IPTG-induced cell pellet will be used for the purification of your His-tagged T7 RNA polymerase by His tag affinity chromatography. The other two 1 mL aliquots put aside at steps 4 and 6 are to be kept for SDS-PAGE analysis to be done in lab 6.

8. Recuperate the two 1 mL aliquots put aside at Steps 4 and 6, and centrifuge them

for 1 min at 13,000 rpm. Discard the supernatants and resuspend each cell pellet in

25 L of distilled water, which is a strong hypotonic environment triggering cell

bursting and release of cytosolic proteins. Add 25 L of 2X Loading Buffer to each of your two tubes. These two aliquots are to be stored; you will recuperate those aliquots for SDS-PAGE analysis to be done in lab 6.

The extra two series of controls prepared by pre-designated groups should be similarly mixed with the 2X loading buffer and returned to the TA. Those controls are to be assessed by SDS-PAGE next week, lab 6.


85

ASSIGNMENT


( /10 MARKS)

1. Coefficient of extinction of the T7 RNA polymerase First retrieve the amino acid sequence for the T7 bacteriophage T7 RNA polymerase from NCBI. Adjust the wild type T7 RNA polymerase sequence to take into consideration the few extra amino acids that were added at the N terminus of your recombinant T7 RNA polymerase. Then access ProtParam Tool and paste the amino acid sequence of your recombinant T7 RNA polymerase to estimate its extinction coefficient. Use the extinction coefficient you obtained to estimate the protein concentration of a stock solution for which a 20X dilution gives an absorbance of 0.7 at 280nm. Provide a hard copy of the print out generated from Prot Param Tool. ( /3 Marks)

2. Coefficient of extinction of a mixture of E.coli proteins The relative abundance of Tyr

and Trp in proteins is 3.2% and 1.3%, respectively (Expasy). Each tyrosine and tryptophan residue has a cumulative contribution to the global extinction coefficient of a protein of 1480M-1cm-1 and 5540M-1cm-1, respectively (Anal Biochem, 1992). Refer to those values to estimate the extinction coefficient for a complex mixture of proteins. For this question, you should assume that the average length of E. coli proteins is around 360 amino acids. ( /2 Marks)

3. Purification controls In laboratory session 6, you will purify your recombinant T7 RNA polymerase. During the purification procedure, you be asked to keep 5 aliquots (see Procedures section of laboratory session 6 and also Table 1 in Procedures section of laboratory session 7). ( /5 Marks)

a. Explain the information to be obtained from each these aliquots. ( /3 Marks) b. Which coefficient of extinction should you use for each aliquot? ( /2 Marks)

http://www.expasy.ch/tools/protparam.html

http://expasy.org/tools/pscale/A.A.composition.html



86


Groups 1, 9 and 17: Choice of host and vector for protein amplification, page 8 and 9 from: http://130.15.90.245/methods/handbooks%20and%20manuals/the%20recombinant%20protein%20handbook.pdf Groups 2, 10 and 18: GST gene fusion system, describe this other system of recombinant protein production, page 2 to 6 from: https://homes.bio.psu.edu/people/faculty/lai/lab/protocols/GST%20Gene%20Fusion%20System.pdf Groups 3, 11 and 19: Production of recombinant protein in vitro: http://www.ambion.com/techlib/basics/translation/index.html Groups 4, 12 and 20: How to optimize your recombinant protein yield: Summarize these four sections from the web site below: 1) Optimization of expression levels 2) Improving protein solubility 3) improving protein stability and 4) Decreasing protein toxicity. http://www.embl.de/pepcore/pepcore_services/protein_expression/ecoli/index.html

http://130.15.90.245/methods/handbooks%20and%20manuals/the%20recombinant%20protein%20handbook.pdf

http://130.15.90.245/methods/handbooks%20and%20manuals/the%20recombinant%20protein%20handbook.pdf

https://homes.bio.psu.edu/people/faculty/lai/lab/protocols/GST%20Gene%20Fusion%20System.pdf

https://homes.bio.psu.edu/people/faculty/lai/lab/protocols/GST%20Gene%20Fusion%20System.pdf

http://www.ambion.com/techlib/basics/translation/index.html

http://www.embl.de/pepcore/pepcore_services/protein_expression/ecoli/index.html


87

REFERENCES

1. Beckwith JR. Regulation of the lac operon. Recent studies on the regulation of lactose metabolism in Escherichia coli support the operon model. Science. 1967 May 5;156(3775):597-604.

Web references for the materials used in the lab

Laboratory Class 6: Protein purification 2011

89

PROTEIN PURIFICATION BY AFFINITY CHROMATOGRAPHY

OVERVIEW

At the end of last week lab, bacterial cells were harvested by centrifugation. This week, you will proceed to the purification of the T7 RNA polymerase by Immobilized Metal ion Affinity Chromatography or IMAC. You will have to quantify your purified recombinant protein by UV absorbance. Finally, you will perform a SDS-PAGE analysis of the IPTG induction controls (harvested during Lab session #5).

LEARNING OBJECTIVES


Explain the underlying principle for immobilized metal ion affinity chromatography (IMAC) used to purify recombinant proteins with a His tag

Hands-On Skills

Lyse cells and prepare a crude protein extract

Use IMAC to purify your recombinant his-tagged T7 RNA polymerase

Quantitate proteins by UV absorbance

Perform SDS-PAGE Analytical Skills

Plan the procedure for the purification of your his-tagged T7 RNA polymerase by affinity chromatography; establish a list of important samples to be kept for further quantitation and SDS-PAGE analysis

Discuss the efficacy of the His tag affinity chromatography based on your own set of experimental results

Discuss the information that can be derived from the analysis of different controls for the IPTG-inducible protein expression


90

BACKGROUND A- Immobilized Metal ion Affinity Chromatography (IMAC)

IMAC was first described by Porath et al. in 1975 (1). It was developed to fractionate protein extracts based on their affinity for metal ions. Years later, this technique was adapted by Hochuli et al. to purify recombinant proteins that were engineered with a group of adjacent histidines attached at the C or N-terminus (2).

a) Principle of the IMAC The molecular principle of the IMAC purification is based on the formation of a

coordination bond between an immobilized metal ion (usually Ni2+ or Co2+) and an electron donor present on the recombinant protein to be purified. During this laboratory session, we will be using an IMAC column called His-Bind ® (Novagen). These columns are composed of agarose beads that are covalently linked to a metal chelater known as iminodiacetic acid (IDA). The IDA molecules chelate nickel ions (Ni2+) that can form co-ordination bonds with others substances (Figure 1A.). Looking at Figure 1A, you can observe that 3 sites of the coordination bond are available for interaction with metal ions (Site 1 to 3 that are occupied by water molecules).

b) Purification of His-tagged proteins by IMAC. As mentioned before, purification of His-tagged proteins by IMAC was first

described by Hochuli et al. (2). Histidine residues were chosen mainly because they have a strong affinity for metal ions (3-4). They are present in most proteins, but due to the fact that they are mildly hydrophilic, they are not always found on the protein surface. We can therefore use IMAC to specifically purify recombinant proteins by using plasmid vectors that have been genetically engineered to add histidine-tag (six consecutive histidines) to the C or N-terminals of recombinant proteins. These adjacent histidines can interact with the metal-ions of the IMAC column via the nitrogen of the imidazole ring (Figure 1B). These interactions between metal ions and proteins are extremely complex. They can also be the combined effect of electrostatic (or ionic), hydrophobic, and/or donor-acceptor (coordination) interactions (5).

c) Elution of His-tagged proteins bound to the IMAC column.

Imidazole is used to elute recombinant His-tag proteins bound to the Ni2+ of the IMAC column. An excess of imidazole is added to the column and this results in a competition between histidine and imidazole for the coordination bonds. The excess of imidazole in the column leads to the displacement of the histidines and therefore, the elution of the recombinant proteins (Figure 1C).

http://www.merck-chemicals.com/usa/life-science-research/his-bind-columns/EMD_BIO-70971/p_uuid?attachments=brochure


91

Figure 1. Immobilized Metal ion Affinity chromatography.(A) A nickel ion (Ni2+) is held in place by a molecule of iminodiacetic acid, also called IDA (HN(CH2CO2H)2), which is covalently attached to an agarose bead (gray box). The Ni2+ ion is at the center of a coordination bond formed by the nitrogen and the two carboxyl oxygen’s of the IDA molecule, as well as three molecules of water. (B) When recombinant His-tagged proteins are added to this column, nitrogen from the imidazole ring of the histidines will replace the three molecules of water in the coordination bond. (C) An excess of imidazole is added to the column to eluate the recombinant proteins.

B- PAGE (Polyacrylamide Gel Electrophoresis)

When an electric potential difference is applied to two electrodes immersed in a solution of substances whose molecules bear an electric charge, the electrostatic attraction causes movement of the charged particles towards the electrode of opposite charge. This phenomenon is called electrophoresis and may lead to discharge at the electrode, electrolysis, if the particle reaches it at the appropriate potential. The sample is usually applied to a porous solid support, such as a gel, wetted with the appropriate buffer. The porous support not only decreases diffusion but it also provides a ‘molecular sieving’ effect. For proteins separation, the most common support is a gel of polyacrylamide poured between 2 glass plates forming a very thin vertical slab (Figure 2).

The rate of electrophoretic migration of a protein is a function of the voltage gradient, the pore size of the support matrix and the charge and "size" of the protein; the latter parameter combines both molecular weight and conformational effects (6-8). The overall size of a protein molecule is determined by the folding of the protein and by the presence of intra- or intermolecular disulphide bridges. These bridges can hold the folded molecule together or form polymers of protein molecules by linking different molecules together. To be able to distinguish between these folding and bridging effects, the sample can be treated to insure that all molecules have the same conformation, thereby making migration solely dependent upon molecular weight and electrical conditions. This treatment involves dissolving the sample in a

buffer containing 1-2% sodium dodecyl sulfate (SDS, a detergent) and 0.5-1.0 M -mercaptoethanol (SHCH2CH2OH). Mercaptoethanol reduces -S-S- cross-linked polymers to monomers and SDS binds to all proteins at a high ratio (1.4 g SDS/ g protein) and also unfolds


92

the protein at the same time. Since SDS is negatively charged at the pH used for the electrophoresis, the SDS-protein complex becomes negative with a charge density that is independent of the protein size. Thus, the mobility in SDS-polyacrylamide gel electrophoresis (SDS-PAGE) is independent of the intrinsic protein charge or conformation and is solely dependent on the protein molecular weight. A linear relationship is obtained when the log molecular weight of standards is plotted against mobility, thus serving as one of the major means to determine protein molecular weight. This technique (SDS-PAGE) has become the most widely used techniques for determining the molecular weight of a protein (6) and is now generally used to analyse proteins in conjunction with the Western blot method.

Once separated, the components of the sample may be recognized by a variety of means such as staining with Coomassie Blue R or other stains. Figure 2: Slab gel electrophoresis apparatus

In order to determine the molecular weight of a protein on a SDS-PAGE gel, we need to have a reference marker. In this lab, you will be using a molecular weight marker called, RainbowTM ladder. This ladder is a mixture of individually colored and purified proteins of known molecular weights (Figure 3).

Figure 3. Rainbow colored protein molecular weight marker separated by SDS-PAGE (Full range). Molecular weight is expressed in kiloDaltons (e.g. 225 = 225 kDa or 225,000 Da) For a

recommended loading volume of 5 L, the different marker

bands add up to a total of 7.5 g. Figure from GE Healthcare.

http://www.gelifesciences.com/aptrix/upp01077.nsf/Content/Products?OpenDocument&moduleid=40405


93

PROCEDURES

Important reminders:

Only your IPTG-induced pellet obtained from the 50mL cell culture last week will be used for the purification of your recombinant T7 RNA polymerase.

You will generate several protein samples throughout the purification of your recombinant His-tagged T7 RNA polymerase. Make sure to keep all your samples.

Make sure to properly label all your protein fractions, estimate their concentrations by absorbance at 280nm, and put them at -20⁰C until next week for the analysis by SDS-PAGE. Remember that you should use the corresponding buffer to set the zero on the spectrophotometer (e.g. you should blank the spectrophotometer with the wash buffer when you will try to estimate the concentration of the wash controls)

Your final fraction containing your purified his-tagged recombinant T7 RNA polymerase should be mixed before being stored at -20⁰C. This is the only fraction that will be assessed for enzyme activity next week. BE CAREFUL TO LABEL IT AND STORE IT PROPERLY!

Part A: Cell Lysate Preparation

1. Resuspend your cell pellet from last week in 10 mL ice-cold 1X Binding Buffer.

2. Set the knob of the sonicator to half power and sonicate your cell suspension for 1 min while maintaining your tube on ice. Let your tube on ice for 1 min. Repeat sonication/cooling two more times.

Sonication helps solubilize proteins, but it also shears DNA. Always keep your tube on ice during sonication to prevent overheating and protein denaturation.

3. Centrifuge your sonicated cell suspension at 14,000g for 20 min at 4°C. Then put your

tube on ice. This fraction is to be loaded on the IMAC column at Step 9.

4. Take a 50L sample of your sonicated cell extract and put it in a 1.5 mL microcentrifuge tube. This solution will be your “Input Control”.

Part B: His-Tag Affinity Chromatography

Column Preparation


94

This part involves the stripping and recharging of the column with Ni+2 ions. The Monday groups should omit this part because they will be supplied with new, ready-to-use columns.

4. Remove the bottom and top column caps and allow the remaining stripping buffer to

flow through. Discard this fraction.

Put the caps in a ‘safe’ place so you can recover them to seal your column when you have completed the process of purification. We need to reuse these columns and a column without its cannot be reused.

5. Add 3 bed volumes of distilled water onto the column and let it flow through. The

column bed corresponds to the matrix that is packed into the column. For the column you use, the bed volume is 1.25 mL.

When pouring a solution into a column, make sure that the level of liquid has just reached the bed surface before proceeding to another solution. If another solution is added while some liquid from the previous step still remains above the resin, the transferred solution will be diluted and this might negatively affect the chromatography process. On the other hand, avoid extended delays between steps as the surface of the bed resin might dry out.

6. Add 5 bed volumes of 1X Charge Buffer and let it flow through the column (column

should turn to a blue/green color).

7. Add 3 bed volumes of 1X Binding Buffer and run through column.

Purification of His-Tagged Proteins

8. After the Binding Buffer has drained, load column with prepared cell extract (10 mL). Take a 1.5 mL aliquot of this 10 mL solution after it has gone through the column (Flowthrough control).

9. Wash column with 12.5 ml 1X Binding Buffer. Take a 1.5 mL aliquot of this 12.5 mL solution after it has gone through the column (Wash 1 control).

10. Wash column with 7.5 ml 1X Wash Buffer. Take a 1.5 mL aliquot of this 7.5 mL solution after it has gone through the column (Wash 2 control).

11. Elute protein from column with 7.5 ml 1X Elute Buffer in a 15 mL tube. The solution coming out of your column contains your recombinant T7 RNA polymerase. Keep this solution on ice until the “Desalting procedure”.


95

Keep all the protein fractions you generated from the purification procedure so you can assess their concentrations by absorbance at 280nm BEFORE leaving the lab. You should measure the absorbance at 280nm of all your controls as well as your purified protein (see table in question 1 of the assignment).

Column Stripping

12. Wash column with 3 column bed volumes of 1X Strip Buffer. Allow half of the buffer to run through column and then cap both ends of the column. Return the capped column back to TA.

Part C: Desalting of the Purified His-Tagged T7 RNA Polymerase

Some contaminants that are found in the elution buffer, especially the high imidazole concentration, might interfere with the activity of your recombinant T7 RNA polymerase that will be assessed next week. In this experiment, you will use a centrifugal filter column with a molecular weight cut-off of 50kDa for substituting the elution buffer (250 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9) of your eluted fraction with T7 Storage Buffer (30 mM HEPES, 0.15 M K-Acetate, 0.25 mM EDTA, 0.05% Tween 20, 1 mM DTT, pH 7.5). The underlying principle for buffer substitution is to use a column with a filter that allows small molecules to flow through, but not the larger ones. After the solution has been filtered, the appropriate buffer is used to resuspend the large molecules that stayed inside the column. The figure below illustrates the procedure to be used.

13. Transfer the final eluted sample from Part B by filling the inner column provided in the tube. Notice that not all of your eluted sample can fit into the column tube, but you will be able to add the remaining fraction after the first centrifugation.

14. Centrifuge at 4,000g using a swinging bucket for 8 min.


96

15. Transfer the rest of the purified protein sample into the column tube, and centrifuge

again at 4,000g for 8 min.

It is recommended to have approximately 500 L left in the column before adding the second fraction. If too much is left inside your column after the first centrifugation, you can simply centrifuge for another 5 min before loading the remaining fraction. The rate of filtration during centrifugation can vary significantly due to the occlusion of the pores with large cell fragments. Never let the membrane dry out completely.

16. Fill up the inner column with T7 storage buffer and centrifuge at 4,000g again for 10 min.

17. Repeat step 16.

18. Transfer the solution remaining in the inner column to a 15 mL conical centrifuge tube and fill it up to 2 mL with T7 Storage Buffer.

Part D: SDS-PAGE Analysis of IPTG Induction Controls

In this section, the protein profile of the different controls that were prepared by some groups in lab 5 will be compared to your IPTG-induced sample. For the electrophoresis, you will be using two pre-cast gradient gels (4-20% acrylamide).

19. Each TA will run two gels. The loading sequence of samples to be analyzed are provided

in the two tables below. (Remember that these loading volumes include the 2X loading buffer pre-added in lab 5)


97

Table 1. Loading sequence on gel #1

Table 2. Loading sequence on gel #2

20. Heat all samples, except the Rainbow marker, in a thermocycler at 95°C for 5 min. After

Lane Sample Loading volume

(L)

1 Rainbow marker (7.5ug/5ul) 5

2 Groups 1, 9 or 17: 1 mL aliquot before induction 10

3 Groups 1, 9 or 17: 1 mL aliquot after induction 10













Lane Sample Loading volume

(L)

1 Rainbow marker (7.5ug/5ul) 5



4 1st set of extra controls: (no induction - first 1 mL aliquot) 10

5 1st set of extra controls: (no induction - second 1 mL aliquot) 10

6 2nd set of extra controls: 1 mL aliquot before induction 10

7 2nd set of extra controls: 1 mL aliquot after induction 10

8

9

10

11

12

13

14

15


98

the sample has been boiled, briefly spin down your tubes to collect your sample at the bottom.

21. Assemble the gel support and position the gels in the electrophoresis apparatus.

Prepare 1X Running (HEPES) Buffer and fill the upper and lower chambers. The running buffer in the outer chamber should be at least halfway between the tops of the short and the long glass plates. The level of the buffer in the inner chamber should be at least 3 cm above the bottom edge of the gel sandwich.

22. Load 10 L of each sample, but only 5 L of the Rainbow markers. Position the tip above the well and insert it not more than 1mm into the well, and slowly release the sample.

Do not force the pipette tip too far into the well as this will separate the plastic casing around the gel and let your sample diffuse into the surrounding buffer. This will cause the entire gel to fail.

23. Run the gel at 150V until the blue tracking dye gets close to very bottom of the gel

(about 30 to 45 minutes).

Gel staining

24. After electrophoresis, place your gel into a microwavable tray containing about 100 mL of distilled water, and microwave for 90 seconds without a lid. then discard water.

25. Discard the water and repeat step 24.

26. Add distilled water to fully cover your gel and transfer the tray onto the waver for for 5

minutes under gentle agitation. Discard water wash from gel.

27. Use the pump dispenser to add just enough of the GelCode Blue Stain Reagent to cover your gel, and microwave without a lid for 1 minute or until the solution begins to boil. Do not let solution boil to evaporation.

28. Remove the tray from the microwave oven, put the lid on it and transfer the tray onto

the waver for 5 min under gentle agitation.

29. To destain, discard staining reagent in the sink and replace with 200 mL of distilled water. Incubate on the orbital waver with the lid on for about 10 min or until bands become clearly visible.

30. Gels are to be scanned so results can be posted on the course website. Your TA will

coordinate the scanning and file saving procedures.


99

ASSIGNMENT

ASSIGNMENT TO BE HANDED IN INDIVIDUALLY TO YOUR TA WHEN ENTERING NEXT WEEK

LAB ( /10 MARKS)

1. Complete this table with regard to the protein amounts obtained at the different

purification steps. Protein quantification for the purified aliquot should be based on the ε280 you estimated for the recombinant T7 RNA polymerase in lab 5 assignment. All other fractions should be converted into protein amounts based on the ε280 you estimated for a complex protein mixture. Please include your calculations. ( /3 Marks)

2. Based on your results in the above table, can you estimate the percentage of the His-tagged T7 RNA polymerase in the total protein preparation of the IPTG-induced treatment? ( /2 Marks)

3. Next week, you will initiate the Western analysis with the protein fractions you put aside different protein fractions while purifying your His-tag T7 RNA polymerase by affinity chromatography. The first step will be to run a SDS-PAGE. The amounts of protein the aliquots to be prepared for the Western analysis, as well as those for the staining with the Gel Code Blue Staining Reagent, are provided in the following table (see next page). Refer to the concentration obtained in Question #1 to calculate the volume of each fraction to be loaded. Please include your calculations. ( /5 Marks)

Control fraction Absorbance at

280 nm

Protein concentration

(g/L)

Total volume of

the fraction

(L)

Total amount of

protein

(g)

Input control

Flowthrough control

Wash1 control

Wash2 control

Elution control

Purified protein


100

Lane Sample

Sample volume

(L)

2X Loading buffer

(L)

Loading volume

(L)

1 Rainbow marker (7.5ug/5ul) - - 5

2 Input control, 5 g or a maximum of 12.5 L

3 Flowthrough control, 5 g or a maximum of 12.5 L

4 Wash1 control, 1 g or a maximum of 12.5 L


6 Elution control, 0.5 g or a maximum of 12.5 L

7 Purified protein, 0.5 g or a maximum of 12.5 L

-8- --------------------------Blank: cut zone-------------------------- -------- ----------- -----------









101


Groups 5, 13 and 21 : Statistical determination of the extinction coefficients of Trp and Tyr in proteins. Anal Biochem 200:74 (1992) Groups 6, 14 and 22 : Short review on Immobilized Metal Ion Affinity Chromatography: Trends in Analytical Chemistry 1988 7:254-259. Groups 7, 15 and 23 : How SDS-PAGE works. Make sure to talk about native PAGE versus denaturing PAGE. http://bitesizebio.com/articles/how-sds-page-works/ Groups 8, 16 and 24 : Review article on how to concentrate proteins: http://bitesizebio.com/articles/the-in%E2%80%99s-and-out%E2%80%99s-of-protein-concentration-%E2%80%93-semi-permeable-membranes/ (You should present all three parts: Semi-permeable membrane, protein precipitation and chromatography)


http://www.sciencedirect.com/science?_ob=MImg&_imagekey=B6V5H-44WBXNW-1H-2&_cdi=5787&_user=1067359&_orig=browse&_coverDate=08%2F31%2F1988&_sk=999929992&view=c&wchp=dGLbVtz-zSkzV&md5=866310bd6d69ddca1446737dc3d90eba&ie=/sdarticle.pdf

http://www.sciencedirect.com/science?_ob=MImg&_imagekey=B6V5H-44WBXNW-1H-2&_cdi=5787&_user=1067359&_orig=browse&_coverDate=08%2F31%2F1988&_sk=999929992&view=c&wchp=dGLbVtz-zSkzV&md5=866310bd6d69ddca1446737dc3d90eba&ie=/sdarticle.pdf

http://bitesizebio.com/articles/how-sds-page-works/

http://bitesizebio.com/articles/the-in%E2%80%99s-and-out%E2%80%99s-of-protein-concentration-%E2%80%93-semi-permeable-membranes/

http://bitesizebio.com/articles/the-in%E2%80%99s-and-out%E2%80%99s-of-protein-concentration-%E2%80%93-semi-permeable-membranes/


102

REFERENCES

1. Porath J, Carlsson J, Olsson I, Belfrage G. Metal chelate affinity chromatography, a new approach to protein fractionation. Nature. 1975 Dec 18;258(5536): pp598-9.

2. Hochuli E, Döbeli H, Schacher A. New metal chelate adsorbent selective for proteins and peptides containing neighbouring histidine residues. J Chromatogr. 1987 Dec 18;411: pp177-84.

3. Hemdan ES, Zhao YJ, Sulkowski E, Porath J. Surface topography of histidine residues: a facile probe by immobilized metal ion affinity chromatography. Proc Natl Acad Sci U S A. 1989 Mar;86(6): pp1811-5.

4. Arnold FH. Metal-affinity separations: a new dimension in protein processing. Biotechnology (N Y). 1991 Feb;9(2): pp151-6.

5. Gutiérrez, R. , Valle, E. M. Martín del and Galán, M. A.(2007) 'Immobilized Metal-Ion Affinity Chromatography: Status and Trends', Separation & Purification Reviews, 36: 1, pp71-111.

6. Voet, D. and Voet, J. (2004). Biochemistry, 3rd Ed. John Wiley & Sons, 6.4, p65 and p144.

7. Hames, B.D. (1990). One-dimensional polyacrylamide gel electrophoresis. In “Gel Electrophoresis of Proteins”, 2nd Ed. (Hames & Rickwood). IRL Press (London), p 1

8. Ninfa, A.J. and Ballou, D.P. (1998). Fundamental Laboratory Approaches for Biochemistry and Biotechnology. Fitzgerald Sciences Press (Mar), p 127.

9. Mach H, Middaugh CR, Lewis RV. Statistical determination of the average values of the extinction coefficients of tryptophan and tyrosine in native proteins. Anal Biochem. 1992 Jan; 200 (1):pp 74-80.

10. Porath, J. (1988) Trends Anal. Chem. 7, pp 254-259. Web references for the materials used in the lab His bind http://www.merck-chemicals.com/usa/life-science-research/his-bind-columns/EMD_BIO-70971/p_uuid?attachments=brochure Desalting column (Amicon® Ultra-4 Centrifugal Filter Units) http://www.millipore.com/catalogue/item/ufc805096 Precise™ Protein Gels (4-20% gradient gel) http://www.piercenet.com/instructions/2161472.pdf



http://www.millipore.com/catalogue/item/ufc805096

http://www.piercenet.com/instructions/2161472.pdf

Laboratory Class 7: Western analysis and enzyme assay 2011

103

WESTERN ANALYSIS AND ENZYMATIC ASSAY (PART I)

OVERVIEW

This week, you will analyze your purified T7 RNA polymerase by SDS-PAGE. This analysis will provide an assessment of the size as well as the abundance of the recombinant protein. You will also begin a Western analysis that should confirm that the purified protein contains the His-tag.

During this lab session, you will also optimize of the enzymatic assay that you will use to evaluate the activity of your mutant T7 RNA polymerase. These optimized conditions will be used next week to perform a formal evaluation of the enzymatic activity of your mutant enzyme in comparison to the wild type enzyme.

LEARNING OBJECTIVES


Explain the different steps of Western analysis

Explain the different steps of in vitro transcriptional assay

Explain the principle for the colorimetric detection with alkaline phosphatase Hands-On Skills

Assess protein size and relative abundance by SDS-PAGE

Transfer protein bands from SDS-PAGE to blot membrane by electrophoretic transfer

Immunodetect His-tagged T7 RNA polymerase by Western analysis

Assess the enzyme activity of your His-tagged T7 RNA polymerase mutant in parallel to its wild type version

Prepare an agarose gel and proceed to the electrophoresis of RNA samples Analytical Skills


Refer to your detection results to discuss the sensitivity and specificity of the Western analysis


104

BACKGROUND

A. SDS-PAGE on gradient gels

In gradient SDS PAGE, proteins migrate from lower to higher concentrations of polyacrylamide. As the gel pores decrease in size, the migration rate of proteins also decreases. One benefit of gradient gels compared to a gel of only one acrylamideconcentration is a better resolution of the protein bands. This can be explained by the constant focusing effect acting on the bands throughout the electrophoresis run: the molecules at the front are delayed as they are moving through a higher concentration area while those behind can catch up due to a faster migration through lower acrylamide concentration. A drawback is the difficulty of transferring proteins from a gradient gel because ‘’these are tightly caught by the gel network at their pore limits’’ (Anal Chim Acta 1998, 372:91). The electrophoresis run is longer, and protein transfer is more difficult as the proteins get more tightly captured in a fine-mesh network. This problem can lead to less effective protein transfer and lower signal in Western analysis. This issue is easily solved by proceeding with longer transfer times for gradient gels then for regular gels having a steady acrylamide concentration. B. Protein transfer onto PVDF membrane

Protein transfer from polyacrylamide gels can be accomplished by electrophoretic transfer that is done by placing the buffer-soaked gel-membrane "sandwich" between plate electrodes (semi-dry transfer). Figure 1 depicts the different components of the “sandwich” in a semi-dry transfer

Figure 1. Components of the semi-dry protein transfer sandwich.

In the lab this week, you will be using a PVDF membrane with high binding capacity, 140-

150 g/cm2 membrane, allowing for efficient protein retention.

http://www.ingentaconnect.com/content/els/00032670/1998/00000372/00000001/art00343

http://en.wikipedia.org/wiki/Pvdf


105

C. Detection of an antigen by western blotting.

The immune probing of your his-tagged T7 RNA polymerase will be achieved with a primary monoclonal anti-His tag antibody able to bind with any polypeptide labelled with a stretch of 6 histidine residues. Denaturing conditions are used to ensure full linearization and optimal exposure of the His tag for binding of the anti-His tag antibody (the His tag could remained concealed within the protein core under non denaturing conditions). You will be using a polyclonal secondary antibody raised against the constant or Fc fragment of the primary antibody that has been conjugated with alkaline phosphatase. This enzyme, which mediates the conversion of a colorless substrate into an insoluble blue product, is responsible for the colorimetric detection. (Figure 2)

Figure 2. Detection of the recombinant His-taggedT7 RNA polymerase by western blotting. (A) Summary of the various steps in a western blotting procedure. (B) This cartoon is a zoom in of the antigen-antibody complex which is representative of your western blot membrane at the end of the western blot procedure (step 7).


106

D. Enzymatic activity of the T7 RNA polymerase

The T7 RNA polymerase catalyzes the synthesis of RNA in a 5’ to 3’ direction. T7 RNA polymerase is often used in molecular biology since it can synthesis RNA from any piece of DNA located downstream of its specific promoter, the T7 promoter. T7 RNA polymerase is relatively easy to assay as its activity doesn`t require any cofactors. The four essential reagents for assessing T7 RNA polymerase activity are:

An enzyme source, which will be your recombinant T7 RNA polymerase

A DNA template T7 RNA Polymerase exhibits extremely high specificity for its cognate promoter sequence. The DNA template to be used in a transcription assay for T7 RNA polymerase should therefore contain the T7 promoter motif, 5’ T AAT ACG ACT CAC TAT A3’, upon which the T7 RNA polymerase can bind and initiate transcription. In this experiment, you will use a plasmid pre-digested with a restriction enzyme as the DNA template. The linearization of the plasmid DNA template is desirable to ensure that transcription can be terminated at a specific position and, therefore, ensure that all transcripts are the same length. In the lab, you will be provided with an open DNA template derived from a recombinant pBluescript vector whose transcription product should be approximately 1.8 kb.

Free ribonucleoside triphosphates

Pyrophosphatase is added to remove inorganic pyrophosphate, a T7 polymerase inhibitor that is released during the transcription assay.

(Optional) RNA inhibitor is facultative, but highly recommended for preventing the enzymatic degradation of the transcribed product.

In the protocol that you will use, the transcription product will be assessed by agarose gel electrophoresis. Transcription activity will therefore be estimated based on the intensity of the RNA transcript visible on an agarose gel. In research labs, diethylpyrocarbonate (DEPC) is used to inactivate any contaminating ribonucleases, which will quickly digest your RNA transcript. Buffer and water are treated with DEPC before performing the transcription assay. However, since DEPC is toxic and volatile, our solutions won’t be treated with DEPC and therefore, you should be extremely careful while preparing your enzymatic assay. Samples collected during the enzymatic assay should always be kept on ice. You should also proceed quickly when loading your agarose gel with your RNA samples.


107

PROCEDURES Part A: Electrophoresis of the purification samples on SDS-PAGE gel

You will be using a pre-cast gradient gel with 4-15% acrylamide. If necessary, your TA will assist you in using the electrophoretic cell.

1. Prepare aliquots for electrophoresis by mixing them with an equal volume of 2X Sample Loading.

Table 1. Loading sequence on SDS-PAGE gel (Question 3 of last week’s assignment).

Please check with your TA before making your samples to ensure that your calculated volumes are correct.

2. Refer to steps 18-28 of Experiment D in lab 6 for details on the preparation and staining

of SDS-PAGE.

At the end of the electrophoresis, place the gel on a clean surface and cut it at Well #8 with a blade. The first part of the gel corresponding to Lanes 1 to 7 will be transferred to the PVDF membrane whereas the second part of the gel (Lanes #9 to 15) will be stained using the Gel code blue staining reagent

Lane Sample

Sample volume

(L)

2X Loading buffer

(L)

Loading volume

(L)








-8- --------------------------Blank: cut zone-------------------------- -------- ----------- -----------









108

Part B: Electrophoretic semi-dry protein transfer

3. Carefully remove the piece of the gel dedicated to the transfer and place it in a 500 mL plastic dish containing 200 mL of Transfer Buffer (25mM Tris, 192mM glycine, pH 8, 20% methanol). Wash with gentle shaking for 15 minutes.

4. Meanwhile, cut a piece of PVDF membrane the same dimensions (7cm x 5cm) as your

gel. You should cut one corner of the membrane diagonally so that you can orient the membrane correctly after transfer. Prepare the membrane for transfer as follows:

a. Soak the membrane in methanol for a few seconds. The colour will change

from opaque white to uniform, translucent gray. Be careful working with the methanol as it is toxic. Do not get any methanol on exposed skin and wipe up any spills immediately.

b. Soak the membrane in distilled water for at least 2 minutes. c. Soak the membrane in transfer buffer for at least 10 minutes.

The membrane should not be allowed to dry out during any of the above hydration steps. If any drying occurs (opaque areas appear on the membrane), perform quick rinses as in steps 4a-c above. Handle the membrane on the edges with forceps at all times!! Finally, make sure to smooth out any air bubbles between each layer of the transfer assembly. Air bubbles will prevent efficient transfer of the proteins and will make subsequent analysis difficult.

5. Transfer will be carried out using the BioRad Transblot semi-dry transfer unit. The unit

is large enough to simultaneously accommodate four SDS-PAGE gels.

6. Assemble the Trans Blot Semi-Dry Transfer System as follows:

http://www.bio-rad.com/LifeScience/pdf/Bulletin_9002.pdf


109

a. Load the bottom of the transfer unit (the platinum anode) with two sheets of filter paper pre-soaked in the Transfer Buffer and cut to the same size as your membrane. Be careful not to introduce any air bubbles.

b. Roll a pipette or glass rod over the surface of the paper to exclude all air bubbles that would interfere with ionic conductivity and protein transfer.

c. Place your pre-soaked PVDF membrane on top of the filter paper and roll out any air bubbles.

d. Carefully lift the gel from the transfer buffer, place it on top of the membrane and roll a pipette or test tube over the gel to make sure that good contact is achieved with the membrane.

e. To complete this 'sandwich' put a piece of transfer buffer-saturated filter paper on top of the gel and remove any air bubbles.

f. Place the cathode of the transfer unit on top of the stack, being careful not to disturb the stack.

g. Place the safety cover on the unit and connect the cables (these are colour-coded, too).

7. Transfer is done at 0.3A for 45 minutes.

8. Turn off the power supply, remove the cover and carefully peel off the upper layer of

filter paper and the gel, without the membrane.

9. Rinse the membrane two times for 5 min in a plastic dish with 50 mL of PBS+Tween20 0.05%. Maintain gentle agitation during the rinses.

If the transfer was successful, the colored markers should be visible on the membrane.

10. At this point the transfer membrane can be sealed wet in a plastic bag and stored at

4°C until next week. Part C: Optimization of the T7 RNA polymerase enzymatic assay

The procedure below only provides general guidelines. This week’s goal is for you to optimize an experimental procedure that will assess the relative activity of your mutant T7 RNA polymerase preparation compared to a wild type preparation. Your TA will supply you with a preparation of the wild type version of T7 RNA polymerase that was prepared under the same conditions as the ones you used for purifying your mutant T7 RNA polymerase. The three following aspects should be taken into consideration while planning your protocol:

http://www.bio-rad.com/B2B/BioRad/br_frameset.jsp?BV_SessionID=@@@@1054174466.0994353543@@@@&BV_EngineID=fallgeclghmbemfcfkmcgjjdlm.0&nextPage=ProductCategory&categoryPath=%2fCatalogs%2fLife+Science+Research%2fBlotting%2fProtein+Blotting%2fProt%20

http://www.bio-rad.com/B2B/BioRad/br_frameset.jsp?BV_SessionID=@@@@1054174466.0994353543@@@@&BV_EngineID=fallgeclghmbemfcfkmcgjjdlm.0&nextPage=ProductCategory&categoryPath=%2fCatalogs%2fLife+Science+Research%2fBlotting%2fProtein+Blotting%2fProt%20


110

Plan your work to make an effective use of the two full laboratory sessions that are dedicated to assay the enzymatic activity of your enzyme preparation. It is recommended that you plan a preliminary investigation with a couple of samples for the first week, and then refine your experimental plan for the second week according to your initial data.

You will be provided with enough reagents to perform a total of 20 reactions, including all the controls. You will not have access to additional reagents, so plan your experiments carefully.

You can decide to setup your reactions in two different ways: 1) you can prepare 3 to 5 individual reactions and start the incubation at the same time. At each time point, you will take out a reaction from the water bath and put it on ice. 2) you can also combine 3-5 transcription assay reactions into a larger reaction solution and take out aliquot of the assay reaction at specific time points. (See Figure 4 for example of optimization).

Figure 4. Examples of enzymatic assay. In A), four individual reactions are prepared. One reaction will be kept on ice as a To control. The remaining three reactions will be placed in a water bath at 37°C. At each specific time point (T1 to T3), one reaction will be taken out of the water bath and placed on ice to stop the reaction. In the second method (B), 3 to 5 reactions


111

are combined in one tube to create a master reaction. Before you start the incubation, a 5 to 10

L aliquot is taken and transfered to a new tube on ice which is pre-labeled (T0). The master

reaction is then transferred to a water bath at 37°C. At each time point, you will take a 5-10 L aliquot and transfer it to a new tube. You should notice that all aliquots should be kept on ice. General Guidelines for the Transcription Assay

Mixture for one in vitro transcription assay with a final volume of 10L

o 75 ng of DNA template (1 L @ 75 ng/L)

o 2.0 L of 5X Transcription buffer

o 1.25 L of 10mM NTP mix (Invitrogen)

o 0.5 L of RNaseOut RNase inhibitor (40U) (Invitrogen)

o 0.5 L of Pyrophosphatase 100U/mL

o 0.5-1.5 g of T7 RNA polymerase source

o Complement to 10 L with water

1. Incubate @ 37°C for up to 30 min.

2. Remember that each time you take an aliquot or take out a reaction from the water bath, you should immediately mix with DEPC-treated 10X Loading Buffer.

3. Keep all your reaction on ice until you have collected all your samples.

4. Proceed to electrophoresis and take a picture of your agarose gel.


112

READING MATERIALS FOR TEACHING TOPICS

Groups 1, 9 and 17: Advantages and disadvantages of different staining methods for protein gel: Coomassie blue, silver nitrate and SYPRO red staining: http://www.piercenet.com/browse.cfm?fldID=b06ffe8f-5056-8a76-4e15-af49e5f5a91f http://probes.invitrogen.com/media/pis/mp12000.pdf

Groups 2, 10 and 18: Wet versus semi-dry gel transfer in western blotting: http://www.abcam.com/ps/pdf/protocols/WB-beginner.pdf http://www.millipore.com/immunodetection/id3/proteintransfer

Groups 3, 11 and 19: Western blotting: http://www.millipore.com/immunodetection/id3/western_blotting

Groups 4, 12 and 20: Antibodies tutorial: http://www.millipore.com/immunodetection/id3/antibodiestutorial

http://www.piercenet.com/browse.cfm?fldID=b06ffe8f-5056-8a76-4e15-af49e5f5a91f

http://probes.invitrogen.com/media/pis/mp12000.pdf

http://www.abcam.com/ps/pdf/protocols/WB-beginner.pdf

http://www.millipore.com/immunodetection/id3/proteintransfer

http://www.millipore.com/immunodetection/id3/western_blotting

http://www.millipore.com/immunodetection/id3/antibodiestutorial


113

REFERENCES

1. Yamaoka T. Pore gradient gel electrophoresis: theory, practice, and applications. Analytica Chimica Acta, 1998, Vol 372, 1, Oct 19, pp. 91-98.

Web references for the materials used in the lab PVDF membrane http://www.roche-applied-science.com/proddata/gpip/3_7_4_15_2_1.html BioRad Transblot semi-dry transfer unit http://www.bio-rad.com/LifeScience/pdf/Bulletin_9002.pdf

http://www.roche-applied-science.com/proddata/gpip/3_7_4_15_2_1.html

http://www.bio-rad.com/LifeScience/pdf/Bulletin_9002.pdf


115

WESTERN ANALYSIS AND ENZYMATIC ASSAY (PART II)

OVERVIEW

This week, you will finish the Western analysis. You will also complete the formal evaluation of your T7 RNA polymerase’s enzymatic activity.

LEARNING OBJECTIVES


Explain the different steps of Western analysis

Explain the different steps of in vitro transcriptional assay

Explain the principle for the colorimetric detection with alkaline phosphatase Hands-On Skills


Transfer protein bands from SDS-PAGE to blot membrane by electrophoretic transfer

Immunodetect His-tagged T7 RNA polymerase by Western analysis

Assess the enzyme activity of your His-tagged T7 RNA polymerase mutant in parallel to its wild type version

Prepare an agarose gel and proceed to the electrophoresis of RNA samples Analytical Skills


Refer to your detection results to discuss the sensitivity and specificity of the Western analysis


116

PROCEDURES

Part A. Completion of the western blot analysis

Blocking membrane

1. Recuperate your membrane and transfer it to a plastic dish with 50 mL of blocking buffer (TBS, 0.05% Tween20, 5% non-fat dry milk). Put your plastic dish onto the waver and incubate for 30 min with gentle mixing. TBS: 20mM Tris, 500mM NaCl, pH 7,4

Primary anti-His antibody binding

2. A 12000X dilution of the commercial anti-His antibody has already been prepared by the Support Staff. Place the membrane between plastic sheets provided by your TA and seal 3 of the sides with a vacuum sealer. Place your membrane inside the space between the plastic sheets and pipette all 3 mL of the pre-diluted primary antibody (TBS, 0.05% Tween20) onto the protein side of the membrane. Carefully push out all air bubbles between the membrane and the baggie before sealing the 4th side. Place the bag with your membrane onto the waver for 1 hr, but gently massage the bag content with your fingers every 10-15 min to ensure complete mixing.

Binding of secondary rabbit anti-mouse IgG conjugated with alkaline phosphatase

3. Cut away all four sides of the baggie and discard the antibody/buffer solution.

4. Wash the membrane with 50 mL of wash buffer (TBS, 0.05% Tween20) for 10 min with gentle mixing. Discard the wash buffer and repeat the wash one more time.

5. Re-block the membrane with 50 mL of blocking buffer (TBS, 0.05% Tween20, 5% non-fat dry milk) for 10 min with gentle mixing. Discard the blocking buffer and repeat one more time.

6. A 3000X dilution of the commercial secondary antibody has already been prepared by the Support Staff. Place the membrane in a new baggie (refer to step 11) containing 3 mL of the pre-diluted secondary antibody and put on the waver for 1 hour. Again gently massage the bag every 10-15 min.

7. Decant and discard the antibody/buffer.

8. Wash the membrane with 50 mL of wash buffer (TBS, 0.05% Tween20) for 10 min with gentle mixing. Discard the wash buffer and repeat three more times.

9. Rinse the membrane with 50 mL of distilled water for about 30 sec. Discard water and


117

repeat the rinse procedure one more time. Discard the water of the second rinse.

10. Apply 5 mL of Western Blue® Substrate and monitor the appearance of the blue bands. Reaction takes about 30 sec to 2 min. Longer reaction times will result in higher background. The reaction can be stopped at any time by quickly decanting the Western Blue Substrate and substituting it with distilled water. You can rinse with water one or two more times to completely remove the Western Blue® Substrate.

11. Ask your TA to show you how to scan your membrane result.

Part B: Enzymatic activity of the mutant T7 RNA polymerase Last week, you perform the optimization of your enzymatic assay. You are now ready to

evaluate the activity of your mutant polymerase in comparison to the wild type polymerase that was provided

http://www.promega.com/products/biochemicals-and-labware/biochemical-buffers-and-reagents/western-blue-stabilized-substrate-for-alkaline-phosphatase/


118


Groups 5, 13 and 21: Principle of chromogenic western blotting: http://www.piercenet.com/browse.cfm?fldID=5A423056-5056-8A76-4E25-1E5F9C0596B2 Groups 6, 14 and 22: Principle of chemiluminescence (ECL) western blotting. http://www.gelifesciences.com/aptrix/upp00919.nsf/Content/4DE67EABFB9A9D25C1257628001CDC12/$file/28955347AD.pdf (page 7-12) Groups 7, 15 and 23: Recent studies of T7 RNA polymerase mechanism: FEBS Letters (1998) 440 264-267 Groups 8, 16 and 24: Frequently asked questions about the T7 RNA polymerase : http://www.neb.com/nebecomm/products/faqproductM0251.asp

http://www.piercenet.com/browse.cfm?fldID=5A423056-5056-8A76-4E25-1E5F9C0596B2

http://www.gelifesciences.com/aptrix/upp00919.nsf/Content/4DE67EABFB9A9D25C1257628001CDC12/$file/28955347AD.pdf

http://www.gelifesciences.com/aptrix/upp00919.nsf/Content/4DE67EABFB9A9D25C1257628001CDC12/$file/28955347AD.pdf

http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T36-3VCK6GX-3&_user=1067359&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000051243&_version=1&_urlVersion=0&_userid=1067359&md5=f091403189a28bd50cb9eddb18ba0e4b

http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T36-3VCK6GX-3&_user=1067359&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000051243&_version=1&_urlVersion=0&_userid=1067359&md5=f091403189a28bd50cb9eddb18ba0e4b

http://www.neb.com/nebecomm/products/faqproductM0251.asp


119

REFERENCES

Web references for the materials used in the lab Anti-His antibody (GE Healthcare) http://www.gelifesciences.com/aptrix/upp01077.nsf/Content/Products?OpenDocument&moduleid=164402 Secondary rabbit anti-mouse IgG conjugated with alkaline phosphatase http://www.sigmaaldrich.com/etc/medialib/docs/Sigma/Datasheet/6/a4312dat.Par.0001.File.tmp/a4312dat.pdf Western blue® substrate http://www.promega.com/products/biochemicals-and-labware/biochemical-buffers-and-reagents/western-blue-stabilized-substrate-for-alkaline-phosphatase/



http://www.sigmaaldrich.com/etc/medialib/docs/Sigma/Datasheet/6/a4312dat.Par.0001.File.tmp/a4312dat.pdf

http://www.sigmaaldrich.com/etc/medialib/docs/Sigma/Datasheet/6/a4312dat.Par.0001.File.tmp/a4312dat.pdf



Appendix 2011

121

SI (système international) units and prefixes SI Units: Length: meter (m) Mass: kilogram (kg) Time: second (s) [lower case] Electric current: ampere (A) Amount of substance: mole (mol) Non-SI units sometimes used: liter (L or l) used to measure volume. Dalton (Da) or unified atomic mass unit (u). One dalton is equal to 1.66×10−27 kg. Minute (min), hour (h), day (d) as units of time. SI prefixes:

SI prefix SI symbol Decimal value 10x (scientific)

value

pico- p 0.000000000001 10-12

nano- n 0.000000001 10-9

micro- µ 0.000001 10-6

milli- m 0.001 10-3

centi- c 0.01 10-2

deci- d 0.1 10-1

(no prefix) 1 100

deca- da 10 101

hecto- h 100 102

kilo- k 1,000 103

mega- M 1,000,000 106

giga- G 1,000,000,000 109

tera- T 1,000,000,000,000 1012

References: SI units: http://www.bipm.org/en/si/base_units/

SI prefixes: http://www.bipm.org/en/si/si_brochure/chapter3/prefixes.html

http://www.bipm.org/en/si/base_units/

http://www.bipm.org/en/si/si_brochure/chapter3/prefixes.html

Appendix A: Lab notebook 2011

122

Tips for maintaining a laboratory notebook

One important skill that you will acquire in this laboratory course is the proper use and maintenance of a laboratory notebook. Your lab notebook should help keep you organized, but skillful notebook use is developed by most students only through continued special effort. Don’t hesitate to ask your TA for advice on the maintenance of your laboratory notebook.

For the purpose of BCH3356 you will be working in pairs. The maintenance of your lab notebook is therefore crucial for effective communication with your partner. Guidelines for the maintenance of your laboratory notebook are listed below.

1. Notebook preparation and general rules

o Find a durable hard-bound notebook; do not use a spiral bound notebook as sheets can be removed. We recommend the blue notebook “lab notes” that is sold by the bookstore in the University Center.

o Write your full name, the course code, your section and group number, as well as your email, on the front and/or first page of your notebook.

o If your notebook is not already numbered, number all pages (one side is enough).

o Devote pages 2 to 4 to a Table of Contents. o Use a pen, not pencil, for all entries. Write legibly! o If you make a mistake, draw a line through the word or number rather than

obliterating the error with an ink blob. Never use correction liquid/tape. o Write down everything, even if it seems insignificant. It could later become

extremely useful to better understand what happened.

2. Before the laboratory session

Start a new page indicating the date, the title of the lab session, the purpose of the experiments, the techniques to be used, prelab calculations required by the lab manual and any questions that you may have about the performance of the experiment or the corresponding theoretical background.

Prepare a flow chart showing your time management during the labs and the coordination of the workload with your partner. You need to plan ahead of time how to divide and share tasks with your partner. Break the lab session into blocks and indicate the experimental steps you expect to be performing during each time interval. The WHEN and WHO aspects should be emphasized in your flow chart. Flow charts should be prepared in pairs and before attending each laboratory class.


123

Get your note book initialed by the TA before you start your lab.

3. During the lab session

Annotate any required calculations, any variation from the manual protocol, all your readings from instruments (like a spectrophotometer). Remember to always include units.

Record equipment details such as brand and model.

Record all your observations

Record your measurements, in a table format when appropriate.

Have your note book initialed before you leave.

4. After the lab session

Further analysis of your results, graphics and calculations when preparing your lab report. (Not all final graphics and tables need to appear on your lab-book).

All printout containing experimental results (gel pictures …) should be included in your lab manual along with a descriptive annotation. (Make sure that added printouts do not cover or obscure other entries).


124

5. Examples of lab-book recordings a) Good and bad (missing titles, page numbers...) table of contents (see next page).


125

b) Good and bad (missing information) results recording


126

c) Good (pointing specific protocol steps, equation provided, variables identified...) and bad (difficulty to understand what was done, no units for final result...) calculations recording.

Appendix C: In Lab Teaching 2011

127

Evaluation criteria for in lab teaching

The purpose for the in lab teaching sessions is not for the students to prepare and deliver extensive lectures, but to simply clarify some important aspects for the underlying principles behind the experimental procedures. Some of the reference documents for the teaching sessions CANNOT be completely covered within 5-10 min! You might be required to make some editorial decisions with regard to the specific aspects that are the most important and relevant for BCH3356. The teaching sessions are also intended to promote exchange and discussion among students.

Below expectations (2.5/5) Meets expectations (3.5/5) Excellent (4.5/5)

Timeline Less than 5 min. Between 5 and 10 min. Between 5 and 10 min.

Knowledgeable

Presenter seemed to not understand what he had to present

Take home message missing or confusing

Underlying molecular principle(s) were not covered

Presenter was able to deliver his talk

At least one important aspect was not discussed

Underlying molecular principle(s) briefly overviewed

Presenter knew the material very well

The most important aspects and their relevance to BCH3356 were emphasized

Underlying molecular principle(s) clearly explained

Overall planning of the presentation

Incohesive flow of information

Presentation was more or less fluid

Presentation was well structured and it was easy to follow the progression

Interaction with others

Presenter was on delivery mode with not much opportunities for audience to step in

Minimally engaging presentation

• Engaging presentation (questions, opportunities for others to ask for clarifications, …)

Other comments or suggestions for the presenter

Appendix C: Laboratory reports 2011

128

Tips for writing lab reports

Your lab reports should be organized as described in A Guide to Writing in the Sciences,

which is available at the university bookstore at ~$20. The main sections of this book will be

further discussed in the lab via the in lab teaching topics, but every student is expected to read

the book – a couple of hours should be enough as it’s concise and easy to read. The table below

provides specific guidelines for BCH3356.

Section Verbs Contents

Title Concise, but specific and descriptive

Purpose has to be stated

Doesn’t have to be a complete sentence

Abstract Active present except for findings which should be introduced in the past tense

See steps 1-6 at p. 23

Introduction Present tense to describe well established aspects

Past and passive for describing the hypothesis or research goal that was assessed

Past and passive for brief summary of methodology that had been used

Present tense to describe well established aspects Past and passive for describing the hypothesis or research

goal that was assessed Past and passive for brief summary of methodology that

had been used

Materials and methods

Past and passive voice at 3

rd person

Don’t use a flowchart and don’t list the different

procedural steps, but “Describe what you did and explain

how, providing sufficient details for readers to assess the

reliability of your methods.”

Results Past tense at 3rd

person First part of a lab report to be written

Decide whether a table or a figure is more appropriate to effectively communicate the results

Organize your tables and figures so they could be self-sufficient

“Do not interpret the data here”, but simply describe what was obtained

Descriptive text is to be used to highlight the key results that were obtained. Be explicit and corroborate your statements with numbers whenever possible. Something like “A DNA fragment with an approximate length of 1200bp (lane 3, Figure 4) was amplified by PCR.”

Discussion Past tense at 3rd

person when referring to results

Present when referring to well established facts

Past when referring to specific results from an article

Emphasize the results: your statements should first emphasize your results not what textbooks are saying. In other words, “distinguish between facts (results show or indicate that …) and speculation (might, could).”

“What do the findings mean?”

Conclusion is in the last paragraph

Bibliography and references

Expended referencing style is to be used throughout the text

Avoid lab manual and websites

Bibliography is to be formatted as in middle of p.29 and lower half of p. 33 of writing guide)

Appendix C: Laboratory reports 2011

129

BCH3356 Lab report marking scheme

Section Key aspects to be covered MARK

Title

Purpose

Concise

Descriptive of what was done

Results are facultative

/5

Abstract

Concise

State the research goal or hypothesis

Indicate the experimental approach used

Report the most important results

State the conclusion

/5

Introduction

Introduce the general context relevant to the study and highlights the importance of research in this area

Review the key concepts relevant to appreciating the report

Elaboration of the scientific context: known vs unknown

Statement of the hypothesis or research goal

Importance of the study

/15

Materials and methods

Reader should get enough information to be able to repeat the study

Not a list of procedural steps

Written for a purported audience of 3rd year university students

Equipment names and model numbers

3rd person, past tense, and passive voice

References to original methods

Computer programs are indicated (BLAST, …)

/10

Results

Past tense (results were obtained)

Proper format for figures

Data are described, not interpreted

Enough text to appreciate conclusions that are stated in Discussion section

Descriptive text explicitly refers to the experimental results

Proper presentation format of results (tables versus figures)

Tables and figures are self-descriptive

Descriptive titles and headings, labeling of axes with units, consistent number of significant digits, …

/15

Discussion

Results are discussed, analyzed and interpreted: should directly refer to the experimental results (explanations should explicitly refer to appropriate figure and table numbers)

What’s the meaning of your results?

Are the results consistent with expectations?

Conclusion is stated at the end

Present tense

Distinguish between facts and speculation

/25

Références

Minimum of five original articles or technical manual of instructions

Relevance of references (do not refer ``common knowledge``

Expanded referencing style (p. 28-29 in writing guide)

Proper formatting of the bibliography at the end (list of references formatted as in p.29 and 33 of writing guide)

Lab manual and websites will NOT be considered as acceptable references

/10

Writing style

Grammar and punctuation

Proper verb tenses

Clarity: avoid jargon and use scientific terminology

Conciseness: do NOT overuse adverbs and adjectives

Forcefulness: emphasize your key ideas

/10

Appendix D: Calculations 2011

130

Appendix D1

CiVi = CfVf where i refers to the initial solution and f to the final solution

1st dilution: 2nd dilution:

C0 x V1 = (C0/10) x Va (C0/10) x V2 = (C0/100) x Vb

V1 = (C0/10) x Va V2 = (C0/100) x Vb C0 (C0/10)

V1 = Va/10 V2 = Vb/10

Example

You want to do a 1/5 serial dilution of a 2 mM solution of compound A. You decide to do 3 dilutions

in a 1ml volume. What will be the final concentration of compound A in each dilution? What will be the

values of V1, V2 and V3 (in fact it should be the same value)?

See next page for the solution.

Serial Dilution:

V1 V2 V3

1:10 1:10 1:10

Va

C0/10

Vb

C0/100

Vc

C0/1000 STOCK: C0

C0/100

CCCCCCCCCC

CC


131

If C0 = 2mM and Va, Vb , Vc = 1mL: Concentration of your three dilutions should be: Stock solution: 2 mM 1st dilution: C0/5 = 0.4 mM 2nd dilution: C0/25 = 0.08 mM 3rd dilution: C0/125 = 0.016 mM Value of Va, Vb and Vc:

1st dilution: 2nd dilution: 3rddilution:

C0 x V1 = (C0/5) x Va (C0/5) x V2 = (C0/25) x Vb (C0/25) x V2 = (C0/125) x Vc

V1 = (2 mM/5) x 1 mL V2 = (2 mM/25) x 1mL V2 = (2 mM/125) x 1mL

2 mM (2 mM/5) (2 mM/25)

V1 = (2 mM/5) x 1 mL V2 = (2 mM/25) x 1mL V2 = (2 mM/125) x 1mL

2 mM (2 mM/5) (2 mM/25)

V1 = 1 mL/5 V2 = 1 mL/5 V2 = 1 mL/5

V1 = 0.2 mL V2 = 0.2 mL V2 = 0.2 mL

V1 V2 V3

1:5 1:5 1:5

Va

C0/5

Vb

C0/25

Vc

C0/125 STOCK:

2mM C0/100

CCCCCCCCC

C CC


132

Appendix D2

The Beer-Lambert law

A UV-visible spectrum is a plot of the amount of light absorbed by a molecule versus the wavelength of the incident light in the range of 180 to 800 nm. A given band in a spectrum is characterized by the wavelength at which the absorbance intensity is a maximum (λmax) and by the intensity of the absorbed light. The number, position and relative intensity of bands is characteristic of each molecule and can be used for the identification of compounds. Usually bands in the region of 200-340 nm (UV) are indicative of π electrons (aromatic groups or double bonds), whereas bands in the region 340-800 nm (visible) are representative of multiple double-bond conjugation. Proteins absorb light strongly in two different regions of the UV spectrum. The C=O of the peptide bond absorbs strongly between 190 nm and 220 nm. Aromatic side chains, such as phenylalanine, tyrosine, and tryptophan absorb strongly around 280 nm. The purine and pyrimidine bases of DNA and RNA absorb strongly around 260 nm. The concentrations of protein and DNA in solution are often estimated from the A280 and A260 of the solution, respectively.

The absorbance intensity is related to the concentration by the Beer-Lambert law:

Where A is the absorbance at a specific wavelength, Io is the intensity of incident light, It is the transmitted intensity, ε is the absorption coefficient at the specified wavelength, c is the concentration of compound and l is the path length of the cell (cuvette). Any spectrophotometer shows optimal precision (minimal relative error) when the absorbance is 0.434. With many instruments, readings of absorbance above 2 are not reliable since the light reaching the detector approaches its sensitivity limit. Also, the relative contribution of stray light (light with a different λ from the one being measured) increases at high absorbance, thus the real value of the absorbance is underestimated.

The Beer-Lambert equation is an analytical tool used very often to measure the concentration of biochemicals in solution. It is important to note that the absorption properties of most molecules can be affected by pH, solvent polarity, temperature etc. For example, both the εmax and λmax for tyrosine change substantially depending on the pH of the solution. These changes are due to alterations in the protonation state of the tyrosine hydroxyl group.

Experiment standards (of known concentrations of a specific compound) are often used to measure the concentration of an experimental solution containing the same compound. This could be achieved by doing the following transformation on the Beer-Lambert law:


133

Since the is the same for the standard and the unknown (we are measuring the absorbance of the same specific compound), we can further transform our Beer-Lambert equation:

Therefore, if you have the concentration of the standard solution (cStandard) as well as its absorbance (AStandard), you can determine the concentration of your solution of unknown concentration by using its absorbance:


134

Appendix D3

Percentage of error.

The percentage of error can be useful to explain if your experiment was done properly or

not. In this formula (see below), the experimental value is the value that you experimentally got in the lab (if you kept a good record of your experimental results, this information should be in your lab notebook). Sometime the theoretical value will be given to you; but in most occasions you should have an idea of what you are supposed to get at the end of the procedure (in theory). If you get a percentage of error close to 0%, it means that everything went well. If you get a negative error value, your experimental value is smaller than the theoretical value and therefore, you got less than expected. If your experimental value is higher than your theoretical value, you got more than expected. You should notice that in almost all the percentage of error calculations you will be doing this semester, it will be a loss of materials and therefore, you will get a negative percentage of error value.

Example:

You have to purify 2 g of DNA using a purification procedure. At the end of the procedure,

you quantify your DNA and you found that you have 1 g. What is the percentage of error? First, you can determine easily the theoretical value: If everything works perfectly, you should

get 2 g at the end of the purification. Therefore, your theoretical value is 2 g.

You can now assume that 50% of the DNA was loss during the purification.


135

Appendix D4 Molar ratios for ligations

Calculation of the insert to vector molar ratio for a ligation is a critical step in a ligation procedure since it will have a major impact on the outcome of your ligation. Typically, insert to vector molar ratios vary from 1:1 to 10:1. In general, a ratio of 3:1 will be used as a starting point. To calculate the amount of DNA needed from each component (insert and vector), you need to know the length of your insert and vector as well as the quantity of vector you are planning to use for your ligation. The mass of a DNA fragment can be calculated by multiplying the number of base pairs of this fragment by the average molecular weight of a nucleotide (660 Da):

Now, if you want to do a 1:1 ratio of insert to vector:

We can simplify the equation:

or

To this equation, you can add the ratio (for example an insert to vector ratio of 10:1):

or

Example: You want to ligate 40 ng of vector with ratio of insert to vector of 8:1. Assuming that the length of your vector and insert are respectively 4000 bp and 1000 bp, how much insert should you add to the reaction?


136

Appendix D5 Bacterial competency

In order to prepare bacteria to take foreign DNA (e.g. plasmid), we need to make them “competent” (see Introduction of lab #3). This procedure makes the cells “competent” but also renders them more fragile. A good practice would be to evaluate the “competency” of your competent cells. If your preparation of competent cells is good, you will get many colonies when you transform a plasmid of known concentration. If your preparation of competent cells is poor, many of them will die during the subsequent transformation procedures and the rest of them won’t take up any DNA. Therefore, you will not get many colonies after transformation. The competency of a stock of competent cells can be determined by calculating how many E. coli colonies are successfully transformed per microgram of plasmid DNA used in the transformation. Competent cells prepared using a chemical method (CaCl2 method) should give

~105-107 colonies per g of plasmid DNA transformed. A poor preparation will be about ~10 4 /

g or less. Here is an example calculating the level of competency of preparation of competent bacteria: You did a transformation with your new stock of competent cells. You used 10 ng of plasmid and you got 100 colonies on your petri dish. Knowing that you only plated 1/10 of your transformed bacteria, what is the level of competency of your bacterial stock? With 10 ng, you get 100 colonies but this is only 1/10 of the transformation and therefore, you have to multiply by the dilution factor (10x). 100 colonies X 10 (dilution factor) for 10 ng 1000 colonies for 10ng or

100000 colonies for 1 g or

105 colonies/g

Appendix E: Techniques 2011

137

Appendix E1

1% Agarose gel casting

1. If necessary, prepare 1 liter of 1X TAE buffer using the 25X stock solution available. Write down your name and the preparation date on the flask.

2. In a 500 mL Kimax flat bottle (see figure) prepare 100 mL of 1%

(weight/volume) agarose in 1X TAE buffer.

3. To prevent evaporation, the plastic lid should be loosely added mto the bottle, but not tightened.

Tightening the lid could lead to pressure buildup into the bottle during heating and possible explosion.

4. Microwave until the agarose is completely dissolved in 3 x 30 sec pulses. Do not

allow the agarose to boil over!

5. Allow the agarose solution to cool down to 50-55˚C (if the agarose is too hot it will warp the gel mold).

6. Add 10 L of the 10000X stock SYBR Safe per 100 mL of gel.

7. Pour the agarose solution slowly into a casting tray fitted with a 20-well comb. Dislodge any bubbles.

8. The gel should be ready (cooled, hardened and translucent) in about 30 min.

9. Once the gel has hardened, remove the comb carefully. Pouring a little buffer on the

surface of the gel around the comb can help.

10. Transfer the gel into the electrophoresis tank and add 1X TAE buffer up to 5mm above the gel upper surface – the gel should be completed covered.

For 1 litre of 25X TAE buffer

121g Tris base (2-amino-2-hydroxymethyl-propane-1,3-diol)

28.6 mL glacial acetic acid

50 mL 0.5M Na2EDTA (pH 8.0)

Add H2O up to 1000 mL


138

Appendix E2

Quantitative DNA Ladder and estimation of length and amount of DNA bands

A quantitative DNA ladder contains known amounts of DNA molecules of different lengths.

It is applied to an agarose gel as a reference to estimate the size and mass of an unknown DNA

band by comparison. The information below shows how one can derive an equation describing

the log(length) vs mobility for the markers, and then use this equation to predict the length of

an unknown.

Length of an unknown

The mobility of the unknown in the gel picture above is ≈ 13.8. The graph shows that a

linear regression between log(length) vs mobility has a high fit (r2=0.997). One can estimate the

length of the unknown on the gel at the top right by substituting its mobility, which is ≈13.8, in

the regression equation. This gives a log(length) equal to 2.921 and a length value of 833bp.

Amount of an unknown

The intensity of a band is directly related with the number of SYBR Safe molecules bound

onto the DNA and therefore, the number of bp or amount of DNA. A visual estimate of the

intensity of the unknown band indicates that it is roughly the same as the 10000bp marker. Its

amount can therefore be estimated as 100ng, i.e the amount of DNA in the 10000bp marker.


139

Appendix E3

DNA purification by affinity chromatography (Promega Wizard PCR Clean-up system)

1. Combine your DNA sample with 1 volume of Membrane binding Solution and mix thoroughly.

2. Place a SV Minicolumn in a 2 mL collection tube.

3. Apply your sample to the SV Minicolumn and incubate 60 sec at RT.

4. Centrifuge 60 sec at 13 000rpm. Discard flow-through and return the column to the

collection tube. Your DNA is now attached to the silica column.

5. Clean your DNA from impurities, add 700 L of Membrane Wash Solution to the column

and centrifuge for 1min at 13 000rpm.

6. Discard flow-through and place the column back in the same tube. Add 500 L of

Membrane Wash Solution and centrifuge for 5 min to completely eliminate residual

ethanol contained in the Wash buffer.

It is crucial to eliminate residual ethanol left inside the column since it will prevent or

lower the solubilization of DNA in water and, therefore, lower the amount of DNA

that can be eluted.

7. Discard the flowthrough and return the column to the collection tube, being careful not

to wet the bottom of the column with the flowthrough. Centrifuge again for 1 min to

evaporate any Ethanol residue on the column.

8. Place the column in a clean 1.5 mL micro centrifuge tube, add 50 L of water directly

onto the center of the membrane, (careful not to touch the membrane with the tip of

the pipette) incubate at RT for 1 min (this step is really important to permit the

complete desorption and resolubilization of your DNA), and then centrifuge for 1 min

at 13 000rpm to elute your DNA.

9. Discard the column and keep the 1.5 mL microcentrifuge tube containing your purified DNA.

Glossary 2011

140

Glossary

Affinity chromatography “… is a method of separating biochemical mixtures, based on a highly specific

biological interaction such as that between antigen and antibody, enzyme and substrate, or receptor and ligand.” (Wikipedia)

In BCH3356, you will be using his-tag affinity chromatography to purify your recombinant T7 RNA polymerase

Amplicon

Amplicons “… are pieces of DNA formed as the products of natural or artificial amplification events.” (Wikipedia)

In the context of BCH3356, an amplicon will specifically refer to the amplification product obtained from a PCR reaction (an amplicon is assumed to be the same as a PCR product)

Analytical skills

“The ability to visualize, articulate, and solve complex problems and concepts, and make decisions that make sense based on available information.” (Wikipedia)

In the context of BCH3356, the concept of analytical skills refers to the capacity to critically and thoroughly analyze and interpret experimental results: statements and conclusions should specifically refer to and be consistent with the experimental results!

Annealing

“In genetics, (annealing) means for DNA or RNA to pair by hydrogen bonds to a complementary sequence, forming a double-stranded polynucleotide. The term is often used to describe the binding of a … primer to a DNA strand during a polymerase chain reaction. The term is also often used to describe the reformation (renaturation) of complementary strands that were separated by heat (thermally denatured).” (Wikipedia)

Bacterial transformation

“A genetics lab procedure where bacteria are induced to accept and incorporate into their genome foreign pieces of cell-less, isolated DNA, often in the form of a plasmid. The DNA to be introduced usually contains a selectable marker so that the bacteria which successfully incorporate the DNA can be selected for.” (BioScience Dictionnary)

Base-calling

A computer-based analytical algorithm used to identify the nucleotide bases corresponding to the peaks within a fluorescence trace recorded by the detector of a DNA sequencer

http://en.wikipedia.org/wiki/Affinity_chromatography

http://en.wikipedia.org/wiki/DNA

http://en.wikipedia.org/wiki/Amplicons

http://en.wikipedia.org/wiki/Analytical_skill

http://en.wikipedia.org/wiki/Annealing_(biology)

http://www.bioscience.ws/dictionary/index.shtml?search=Genetics

Glossary 2011

141

BLAST alignment A computer-based analytical algorithm used to compare and align primary sequences

of amino acids (proteins) or nucleotides (DNA or RNA). BLAST stands for Basic Local Alignment Search Tool, but the specific meaning for the

BLAST-based alignment approach is beyond the scope of BCH3356 Cloning

Broadly speaking, cloning refers to the action of generating multiple copies of something.

In the context of BCH3356, cloning will refer to molecular cloning that is the procedure of isolating a defined DNA sequence and obtaining multiple copies of it in vivo.

Cloning vector

“A small, self-replicating DNA molecule - usually a plasmid or viral DNA chromosome - into which foreign DNA is inserted in the process of cloning genes or other DNA sequences of interest. It can carry inserted DNA and be perpetuated in a host cell.” (BioBasics Biotech Canada)

Important features of a cloning vector include the capacity to integrate and carry a foreign DNA fragment into a host cell, and then to self-replicate once it has been inserted within a cell.

Several terms are used in the scientific literature for referring to a cloning vector, including plasmid vector, expression vector, cloning expression vector and vector.

In BCH3356 your will be using the plasmid vector, pTrcHisB (the p at the front indicates that it is a plasmid vector).

Competency

The ability of a cell to take up extracellular or naked DNA from its environment. For the purpose of BCH3356, the concept of competency will specifically refer to the

artificially induced competency “… that arises when cells in laboratory cultures are treated to make them transiently permeable to DNA”. (Wikipedia)

Control treatment

Experimental controls are intended to minimize artefacts “The simplest forms of controls are positive and negative controls. Positive controls

are controls confirm that the procedure is effective in observing the effect (therefore minimizing false negatives). Negative controls confirm that the procedure is not observing an unrelated effect (therefore minimizing false positives).” (Wikipedia)

Electropherogram A plot of results from an analysis done by electrophoresis In the context of DNA sequencing, an electropherogram shows a trace of fluorescence

recorded at the output of the capillary electrophoresis unit (see example below).

http://www.biobasics.gc.ca/english/View.asp?x=696&mid=412

http://en.wikipedia.org/wiki/Competence_(biology)

http://en.wikipedia.org/wiki/Negative_control

Glossary 2011

142

Hands-on skills

Expertise or experimental knowledge exercised in the performance of some task Capabilities to effectively execute laboratory procedures Capabilities to effectively use, handle and troubleshoot laboratory equipments (the

know how skills) Require basic knowledge about underlying principles of executed task

Melting temperature

“… is the midpoint of the temperature at which 1/2 of the DNA molecules are denatured and 1/2 are annealed.” (Baylor College of Medicine)

“The temperature at which a double-stranded DNA or RNA molecule denatures into separate single strands. The Tm is characteristic of each DNA species and gives an indication of its base composition. DNAs rich in G:C base pairs are more resistant to thermal denaturation than A:T rich DNA since three hydrogen bonds are formed between G and C, but only two between A and T.” (FAO Biotechnology Glossary)

Plasmid vector

A special type of cloning vector in which the ‘carrier’ is a circular plasmid Primer

“A short DNA or RNA fragment annealed to a template of single-stranded DNA, providing a 3´ hydroxyl end from which DNA polymerase extends a new DNA strand to produce a duplex molecule.” (FAO Biotechnology Glossary)

Quantitative DNA ladder

Set of usually equimolar DNA markers allowing estimation of length and amount of DNA fragments analyzed by gel electrophoresis.

The Alpha Quant 1 quantitative DNA ladder is used in BCH3356 (see Appendix E2) Recombinant DNA

“… is a form of DNA that does not exist naturally, which is created by combining DNA sequences that would not normally occur together.” (Wikipedia)

In molecular biology, recombinant DNA refers to DNA that has been engineered in vitro, and therefore differs from in vivo genetic recombination.

Recombinant plasmid (vector)

A plasmid into which an exogenous DNA had been inserted in vitro by ligation

http://www.fao.org/docrep/003/X3910E/X3910E16.htm

http://www.fao.org/docrep/003/X3910E/X3910E19.htm#TopOfPage

http://en.wikipedia.org/wiki/Recombinant_DNA

Glossary 2011

143

In BCH3356, the DNA fragment coding for T7 RNA polymerase was inserted into pTrcHisB to form the recombinant plasmid pTrcHisB/T7

Recombinant protein

A protein whose amino acid sequence is encoded by a recombinant DNA In BCH3356, the his-tagged T7 RNA polymerase to be expressed and purified is a

recombinant protein Sensitivity

The lower significant signal (should be above background signal) that can be detected through an experimental procedure

For example, the sensitivity of the agarose gel procedure used as described in the BCH3356 Lab Manual is in the range of 5-20ng

Specificity

The discrimination capacity of a test or procedure to detect a given signal For example, enzymes usually exhibit a fairly high substrate specificity (only the proper

substrate can bind and trigger enzyme catalysis) Subcloning

“The … transfer of of a cloned fragment of DNA from one vector to another.” (Nexxus Glossary of Life Sciences)

“…a technique used to move a particular gene of interest from a parent vector to a destination vector” to better suit the requirements of a specific application or experimental context

In BCH3356, the gene coding for T7 RNA polymerase is subcloned from an unknown parent vector into pTrcHisB

Western analysis

“A procedure in which proteins separated by electrophoresis in polyacrylamide gels are transferred (blotted) onto nitrocellulose or nylon membranes and identified by specific complexing with antibodies that are … tagged with a labelled secondary protein.” (MondoFacto dictionnary)

http://www.nexxusscotland.com/life_scienchttp:/www.nexxusscotland.com/life_science/training_and_careers/glossarye/training_and_careers/glossary

http://www.nexxusscotland.com/life_scienchttp:/www.nexxusscotland.com/life_science/training_and_careers/glossarye/training_and_careers/glossary

http://www.mondofacto.com/facts/dictionary?Western+blot+analysis

Documents

Lab Manual