Cancer Letters 330 (2013) 208–216

Contents lists available at SciVerse ScienceDirect

Cancer Letters

journal homepage: www.elsevier .com/ locate/canlet

Kindlin-2 promotes genome instability in breast cancer cells

0304-3835/$ - see front matter � 2012 Elsevier Ireland Ltd. All rights reserved.http://dx.doi.org/10.1016/j.canlet.2012.11.043

⇑ Corresponding authors. Addresses: Department of Pathology, Peking UniversityHealth Science Center, #38 Xue Yuan Rd., Beijing 100191, China (W. Fang),Department of Anatomy, Histology and Embryology, Peking University HealthScience Center, #38 Xue Yuan Rd., Beijing 100191, China (H. Zhang). Tel./fax: +861082802424.

E-mail addresses: wgfang@bjmu.edu.cn (W. Fang), Hongquan.Zhang@bjmu.edu.cn (H. Zhang).

1 These authors contributed equally to this study.

Ting Zhao a,b,c,1, Lizhao Guan a,b,1, Yu Yu a,b, Xuelian Pei a,b, Jun Zhan a,b, Ling Han d, Yan Tang a,b, Feng Li a,b,Weigang Fang a,c,⇑, Hongquan Zhang a,b,⇑a Key Laboratory of Carcinogenesis and Translational Research, Ministry of Education, Peking University Health Science Center, Beijing 100191, Chinab Department of Anatomy, Histology and Embryology, Peking University Health Science Center, Beijing 100191, Chinac Department of Pathology, Peking University Health Science Center, Beijing 100191, Chinad Department of Medical Genetics, Peking University Health Science Center, Beijing 100191, China

a r t i c l e i n f o

Article history:Received 29 May 2012Received in revised form 26 November 2012Accepted 27 November 2012

Keywords:Kindlin-2Breast cancerGenome instabilityTumor formation

a b s t r a c t

Kindlin-2, as a focal adhesion protein, has been found to regulate tumor progression. However, the mech-anism underlying Kindlin-2 regulation of tumor progression is largely unknown. Here, we report thatKindlin-2 regulates breast cancer cell proliferation, apoptosis and chromosomal abnormalities in bothgain and loss of function assays. Functionally, overexpression of Kindlin-2 promotes tumor formationin implanted xenograft while knockdown of Kindlin-2 inhibits tumor growth in mice. Mechanistically,an array-based comparative genomic hybridization and karyotype analyses indicate that ectopic expres-sion of Kindlin-2 leads to genome instability in breast cancer cells. Our data suggest a novel mechanismthat Kindlin-2 regulates breast cancer progression by inducing genome instability.

� 2012 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

Kindlin-2 (FERMT-2) is a member of the Fermitin family (alsocalled Kindlin family), which is involved in activating integrinand regulating cell–matrix adhesion [1,2]. Kindlin-2, as a compo-nent of cell–extracellular matrix (ECM) adhesion complexes,directly interacts with the adhesion complex proteins integrin-linked kinase (ILK), migfilin and integrin [3–5]. Functionally,Kindlin-2 has been reported to be an essential component of inter-calated discs and is required for vertebrate cardiac structure andfunction [6]. In addition, Kindlin-2 is also a critical mediator forosteoblast physiology [7] and plays an important role in embryodevelopment [6], wound healing [8] and angiogenesis [9].

Furthermore, the correlations between Kindlin-2 and cancerhave been described, including breast cancer [10], colon cancercells [11], mesenchymal cancer cell [12], malignant mesothelioma[13], gastric cancer [14], bladder cancers [15] and leiomyomas [16].Among them, breast cancer is the second leading cause of cancer-related deaths in women in the western countries ranked afterlung cancer [17]. The heterogeneity of breast cancer, characterized

by distinct clinical and pathologic features, increases the difficultyof cancer treatment. A variety of clinicopathological and molecularmarkers have been confirmed to be effective in choosing anappropriate method of therapy and evaluating the risk of cancerrecurrence [18,19]. Thus, to explore the relationship betweenKindlin-2 and breast cancers is significant for the clinical treat-ment. However, little is known about the correlation betweenKindlin-2 and breast cancer development. Here, we found thatKindlin-2 regulates breast cancer proliferation, apoptosis andsurvival, and in turn induced tumor formation. Mechanistically,we suggested a mechanism that Kindlin-2 regulate breast cancerprogression by inducing genome instability.

2. Materials and methods

2.1. Cell culture

Human breast cancer cell lines (MCF-7, T47D, Hs578T, BT-549 and MDA-MB-231) were obtained from American Type Culture Collection (ATCC, Manassas, VA)and cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Carlsbad,CA) with 10% fetal bovine serum (FBS; Gibco), 100 U/ml penicillin and 100 U/mlstreptomycin (Gibco), in a CO2 incubator with humidified atmosphere containing5% CO2 at 37 �C. MCF-7–Flag, MCF-7–Kindlin-2, Hs578T–Ctrl-shRNA and Hs578T–Kindlin-2–shRNA cell lines were grown in above medium with 200 lg/ml neomycinG418 (Gibco). Growth media were changed every other day.

2.2. Transfection and establishment of stable cell lines

MCF-7 and Hs578T cells were transfected for different purposes, i.e., MCF-7 fortransfection of Flag–Kindlin-2 or Flag vector, while the latter for transfection of con-trol short hairpin RNA (shRNA) or Kindlin-2 shRNA. The vector structures were

T. Zhao et al. / Cancer Letters 330 (2013) 208–216 209

described in An et al. [13]. For transfection, cells were plated in 6-well plates(1.5 � 105 cells/well) 24 h before and transfected with Fugene 6 (Roche Applied Sci-ence, IN, USA) according to the manufacturer’s instructions. Briefly, 5 ll Fugene 6was diluted with 50 ll serum-free antibiotics-free Opti-MEM (Gibco) and wasmixed and incubated at room temperature (RT) for 5 min. Then 1.5 lg DNA wasadded into the diluted Fugene 6 and mixed, followed by incubation at RT. Twentymin later, the Fugene 6-DNA mixture was added into the cell medium. Two dayspost-transfection, cells were cultured under 800 lg/ml Geneticin (G418) selectionuntil the untransfected cells were killed.

2.3. Western blot analyses

Cells were washed with ice-cold PBS and lysed in a PBS-TDS buffer (PBS with 1%Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], 1 mMEDTA, 1 mM phenylmethylsulfonyl fluoride [PMSF], 1 complete inhibitor cocktail[Boehringer Mannheim, Germany]), and centrifuged at 15,000g for 20 min at 4 �Cto obtain clear lysate.

2.4. Real-time quantitative PCR

Total RNA from MCF-7–Flag, MCF-7–Kindlin-2, Hs578T–Ctrl-shRNA andHs578T–Kindlin-2–shRNA cells was extracted by Trizol (Invitrogen, Carlsbad, CA)and quantified. According with the manufacturer’s protocol and the concentrationwas determined spectrophotometrically at A260. 2 lg total RNAs were used for re-verse transcription using MMLV Reverse Transcriptase (Promega, CA, USA). Real-time qPCR was carried out using SYBR Green mix (Applied Biosystems, CA, USA)with the PCR condition: 95 �C 3 min; 95 �C 20 s, 60 �C 1 min, for 35 cycles. Kind-lin-2 primers used in the real-time PCR were: forward sequence,TGTCTCCCCGCTATCTAAAAAAGT; reverse sequence, TGATGGGCCTCCAAGATTCT.GAPDH was used as internal control with the forward sequence CTGAGAACGG-GAAGCTTGT and reverse sequence GGGTGCTAAGCAGTTGGT. Expression of geneswas determined by the comparative CT method (2�DDCT). All genes were normal-ized to GAPDH levels. And the expression of Kindlin-2 in MCF-7 and Hs578T cellswas set as 1. QPCR were analyzed in triplicate and experiments were repeated forthree times.

2.5. WST-1 cell proliferation assay

Cell proliferation was assayed using the WST-1 reagent (Beyotime, Shanghai,China) according to the manufacturer’s protocol. Briefly, cells (2 � 103) were platedin triplicate in 96-well plates. The attached cell populations were measured on day1, 2, 3, 4, 5. Having confirmed the cells in the non-confluent stage, we administered10 ll WST-1 into 100 ll medium. After 2 h reaction at 37 �C, absorbance at 450 nmwas measured by an ImmunoMini NJ-2300 plate reader (System Instrument, Tokyo,Japan). Numbers of viable cells were determined on the basis of their ability tometabolize the tetrazolium salt WST-1 to formazan by mitochondrialdehydrogenases.

2.6. Cell cycle analysis

Trypsinized cells were washed in PBS, then adjusted to 1 � 106/ml and fixed in70% ethanol at �20 �C overnight. The fixed Cells were centrifuged and washed withPBS twice, followed by being treated with 1 mg/ml RNase at 37 �C for at least30 min, and then stained with 50 lg/ml propidium iodide (PI, Sigma–Aldrich).The DNA was analyzed by flow cytometry (FACS) using a BD FACscalibur flowcytometer (Becton Dickinson, CA, USA). The experiment was repeated thrice withdifferent biological samples.

2.7. Annexin V-FITC assay

An apoptosis assay was performed with an Annexin V-FITC Detection Kit(Beyotime, Shanghai, China) according to the instructions of the manufacturer.The cells (1 � 105) were harvested and washed for three times with PBS and thenresuspended in 195 ll binding buffer containing 5 ll Annexin V-FITC (20 lg/ml)for 15 min at RT. The stained cells were added into 190 ll binding buffer containing10 ll PI (50 lg/ml) for 5 min and subsequently analyzed by flow cytometry. Theexperiment was repeated thrice with different biological samples.

2.8. Anchorage-independent colony formation assays

Single-cell suspensions of cells were prepared from monolayer cultures bytreatment with a mixture of 300 U/ml trypsin and 1.5 mM EDTA. Cells were sus-pended in DMEM containing 20% FBS and 0.35% Seaplaque low melting agarose(Sigma–Aldrich), and 2 ml medium containing 500 cells were plated in a 6-wellplate over a 3 ml layer of solidified DMEM/10% FBS/0.6% agarose every well. Colo-nies were photographed after 3 weeks.

2.9. Tumor formation in vivo

Cells (5 � 106) were counted and resuspended with 100 ll PBS, then injectedsubcutaneously into 4-week-old female nude mice (Center of Experimental Ani-mals, Peking University, Beijing, China), which were sacrificed 4 weeks afterimplantation. Tissues from subcutaneous xenografts were used for histologicaland immunostaining examinations. The mice were maintained according to theGuidelines of Animal Experiments by Peking University.

2.10. Histology and immunohistochemistry

Tumors from mice were excised, fixed in buffered formalin (4%), embedded inparaffin and sectioned. Before staining, the slides were deparaffinized through aseries of xylene baths and rehydrated through gradient ethanol baths. For histolog-ical examination, 4 lm sections were stained with hematoxylin and eosin (HE).

For immunohistochemistry, the cells were span down on slides and fixed with4% paraformaldehyde. The tissue slides were immersed in 3% H2O2 for 10 min andwashed with PBS for three times. The tissue sections were then blocked with goatserum for 1 h, using monoclonal antibody Ki67 at 1:100 dilution and incubated at4 �C overnight. After washed with PBS for three times, the slides were incubatedat RT with mouse biotinylated secondary antibodies (Zhongshan), and stained withthe chromogen, DAB (Zhongshan). The nuclei were counterstained with hematoxy-lin. Negative controls without primary antibody were processed in parallel for eachstaining experiment.

Unstained and positively-stained nuclei were scored in 5 fields, and the per-centage of the positively-stained cells was calculated, which was Ki67 labeling in-dex (Ki67 LI).

2.11. Transmission electronic microscopy

Cells were washed twice in PBS, and pellets were fixed with 2.5% glutaralde-hyde for 4 h at 4 �C. After rinsing with cold PBS, the cells were fixed in 1% osmiumtetroxide at RT for 2 h. After dehydration in a graded series of ethanol and then inacetone twice for 15 min, the samples were embedded in Epon812 resin and ace-tone (Vol/Vol, 1:1) for 30 min, followed by 100% Epon812 resin for 1 h. The Epon812resin was solidified at 37 �C for 24 h and at 60 �C for 48 h. Ultrathin 60-nm sectionswere prepared with an LKB ultramicrotome (Ultrotome NOVA; LKB, Broma,Sweden) and stained with uranylacetate and lead citrate for examination by TEM(JEM-1400; JEOL Ltd., Tokyo, Japan).

2.12. Nuclei staining and visualization

Cells were washed with PBS and fixed in 4% paraformaldehyde for 15 min at RT.After washing with PBS, the cells were permeabilized with 0.1% NP40 for 15 min.Then the cells were washed for three times with PBS and incubated with Hoechst33342 (Sigma–Aldrich) to visualize their nuclei. Bright field and nuclei images oftypical fields were obtained with a Zeiss fluorescence microscope equipped witha digital camera. The experiment was repeated thrice with different batch ofsamples.

2.13. Karyotyping analysis

Cells were trypsinized and harvested by centrifugation, resuspended at approx-imately 106 cells per ml in chromosome medium. The cells were treated with Col-cemid (Sigma–Aldrich) for 1 h at 37 �C and centrifuge to collect cells at 4 �C, andthen incubated in pre-warmed 75 mM KCl for 30 min at 37 �C. Precooled metha-nol–acetic acid was used to fix the cells, and then wash slides briefly in a 1:1 mix-ture of 100% ethanol and air dry slides. The result was analyzed using cytoscan(Cytoktype version 6.2, United Biotechnology, USA). The experiment was repeatedthrice with different batch of samples.

2.14. Array-based copy number variation analysis

DNA was isolated using the Wizard kit (Promega, Madison, WI). Extracted DNAwas hybridized on Affymetrix Genome-Wide Human SNP 6.0 array. Experimentprocess and data analyses were performed by CapitalBio Corp. in Beijing, China.

2.15. Statistical analysis

All statistical tests were two-sided and P < 0.05 was considered to be statisti-cally significant using GraphPad Prism software.

3. Results

3.1. Establishment of Kindlin-2 overexpressing stable cell lines

We first screened the expression levels of Kindlin-2 in a varietyof breast cancer cell lines by Western blot analysis. Kindlin-2 was

210 T. Zhao et al. / Cancer Letters 330 (2013) 208–216

found lower expressed in MCF-7 and T47D cells, and higherexpression was shown in Hs578T and MDA-MB-231 cells. Kind-lin-2 was found moderately expressed in BT-549 cells (Fig. 1A).Thus, we established the Kindlin-2 overexpressing stable cellsusing MCF-7, and the Kindlin-2 stably knockdown cells usingHs578T. Both the mRNA and protein levels of Kindlin-2 expres-sions in these stable cells were confirmed by Western blottingand RT-qPCR (Fig. 1B and C). These data indicated that the stablecells with Kindlin-2 overexpression or knockdown were successful.

3.2. Kindlin-2 promoted cell proliferation

To explore the relationship between Kindlin-2 and breast can-cer cell growth, a WST-1 assay was performed to determine theability of cell proliferation. As shown in Fig. 2A, the growth ofMCF-7–Kindlin-2 cells was significantly increased at day 4 com-pared with the controls (Fig. 2A, left). In comparison, the growthof Hs578T–Kindlin-2–shRNA cells was significantly decreased atday 5 compared with the controls (Fig. 2A, right). Due to the pos-sibilities that different cell lines may have variant tolerance tothe expression level of the same protein, we applied a breast can-cer cell line BT-549 that expresses moderate level of Kindlin-2compared to MCF-7 and Hs578T. To rule out this possibility, weoverexpressed Kindlin-2 in BT-549 and found that although Kind-lin-2 could not greatly promote the cell growth Kindlin-2 does en-hance BT-549 cell growth significantly at late stage of cell culture(Supplementary Fig. 1A, P < 0.05). Similarly, knockdown of endog-enous Kindlin-2 in BT-549 cells, we could see a significant slow-down of cell growth at late stage of cell culture (SupplementaryFig. 1B, P < 0.05). These data indicated that Kindlin-2 does play arole in the regulation of cell growth. In addition, the effect of Kind-lin-2 on cell cycle regulation was analyzed. As shown in Fig. 2B andC, the proportion of cells in the G2/M phase was increased in MCF-7 with Kindlin-2 overexpression compared with the controls,

Fig. 1. Expression of Kindlin-2 in various breast cancer cell lines. (A) Total proteins werebasal-type breast cancer cell lines (Hs578T and MDA-MB-231). Then Western blottOverexpression of Kindlin-2 in MCF-7 cells (left panel) and knockdown of endogenouantibody in Western blotting analyses. (C) A real time-qPCR was performed to detect theValues shown are mean ± SEM of three independent experiments. � Stands for P < 0.05 v

whereas knockdown of Kindlin-2 reduced the cells accumulatedin G2/M phase in Hs578T. In BT-549 cells, we found that Kindlin-2 overexpression could enhance the proportion of cells in G2/Mphase in the cell cycle, while knockdown of endogenous Kindlin-2 in BT-549 reduced the proportion of cells in G2/M phase (Supple-mentary Fig. 2A–C). These data suggested that Kindlin-2 isinvolved in the cell cycle regulation. Furthermore, the effect ofKindlin-2 on cell proliferation was also indicated by examinationof Ki67 expression, a marker representing cells in proliferation.Consistent with the result of WST-1 assay, overexpression of Kind-lin-2 markedly enhanced the proportion of cells with Ki67 expres-sion; whereas knockdown of Kindlin-2 obviously decreased theproportion of cell in proliferation compared with the control(Fig. 2D and E). Collectively, these results demonstrated that Kind-lin-2 regulates breast cancer cell proliferation.

3.3. Kindlin-2 regulated apoptosis in breast cancer cells

Annexin V-FITC assay was performed. The apoptotic cells wereprominently reduced in MCF-7 cells with Kindlin-2 overexpressioncompared with the control cells (Fig. 3A, upper panel) in an Annex-in V-based assay. Reversely, knockdown of Kindlin-2 inducedapoptosis in breast cancer cell Hs578T (Fig. 3A, lower panel). Quan-titative analyses supported the notion that Kindlin-2 regulation inboth gain of function and loss of function experiments (Fig. 3B). Inagreement with these findings, transmission electron microscopyshowed that less apoptotic bodies could be seen in cells with Kind-lin-2 overexpression (Fig. 3C, upper panel); whereas cells withKindlin-2 knockdown displayed more apoptotic bodies with con-densed and crescent nuclei as well as vacuoles in the cytoplasm(Fig. 3C, lower panel, arrowed). Quantification of apoptotic bodiesagain indicated that Kindlin-2 protected cell from apoptosis(Fig. 3D). Taken together, these results clearly demonstrated that

extracted from human luminal-type breast cancer cell lines (MCF-7 and T47D) anding analyses were performed using an anti-Kindlin-2 monoclonal antibody. (B)s Kindlin-2 in Hs578T cells (right panel) probed by an anti-Kindlin-2 monoclonal

mRNA level of Kindlin-2 in the cells with Kindlin-2 overexpression or knockdown.s. control group.

Fig. 2. Kindlin-2 regulated breast cancer cell growth. (A) Cells were plated in 96-well plates at an initial density of 2000 cells/well. The growth curve was made by measuringcell growth every 24 h by a WST-1 cell proliferation assay. Left panel: Cell growth curve for MCF-7 overexpressing Kindlin-2. Significant difference in cell growth was seen atday 4; right panel: Cell growth curve for Hs578T with Kindlin-2 knockdown. Significant difference in cell growth was seen at day 5. (B) Left panel, upper: flow cytometryanalyses for a cell cycle change in MCF-7 cells with Kindlin-2 overexpression; lower: flow cytometry analysis for a cell cycle change in Hs578T cells with Kindlin-2knockdown. The Y axis represents the cell counts, and X axis represents the DNA content. (C) The cell counts in G2/M phase were quantified for both MCF-7 and Hs578T cellswith Kindlin-2 overexpression or knockdown. Values shown are mean ± SEM of three independent experiments. � Stands for P < 0.05. (D) Cells in proliferation under Kindlin-2overexpression or knockdown were immunostained with an anti-Ki67 antibody. Bars, 100 lm. (E) The percentage of Ki67-positive cells was quantified. Values shown aremean ± SEM from three independent experiments.

T. Zhao et al. / Cancer Letters 330 (2013) 208–216 211

Kindlin-2 plays an important role in the regulation of apoptosis inbreast cancer cells.

3.4. Kindlin-2 promoted anchorage-independent colony formationin vitro and tumor growth in vivo

Given that Kindlin-2 regulated breast cancer cell proliferationand protected cells from apoptosis, we would like to examine the

role of Kindlin-2 in the control of tumor growth. In a soft agar as-say, we found that overexpression of Kindlin-2 markedly enhancedthe anchorage-independent growth of breast cells with more colo-nies formation and increased colony size compared with the con-trol (Fig. 4A, upper panel). In contrast, colony forming efficiencyof Hs578T cells with Kindlin-2 knockdown by shRNA was reducedcompared with the controls (Fig. 4A, lower panel). Quantificationof Kindlin-2 regulated breast cancer cell colony formation in vitro

Fig. 3. Kindlin-2 regulated breast cancer cell apoptosis. (A) Cells were stained using Annexin V for analyzing the cell apoptosis. Upper: Reduced proportion of apoptotic cellsin MCF-7 with Kindlin-2 overexpression. Lower: Increased proportion of apoptotic cells in Hs578 with Kindlin-2 knockdown. (B) A statistical analysis was performed for (A) toquantify the apoptotic cells in the indicated cells with Kindlin-2 overexpression or knockdown. Data were presented as mean ± SEM from three independent experiments. (C)Apoptotic bodies were visualized under the transmission electronic microscopy in cells with Kindlin-2 overexpression or knockdown respectively. Upper: less apoptoticbodies were seen in MCF-7 cells with Kindlin-2 overexpression. Lower: more apoptotic bodies were seen in Hs578 cells with Kindlin-2 knockdown. Bars, 1 lm. (D)Quantification for apoptotic bodies in (C). Values shown are mean ± SEM from three independent experiments. � Stands for P < 0.05.

212 T. Zhao et al. / Cancer Letters 330 (2013) 208–216

has been shown in Fig. 4B. Furthermore, Kindlin-2 promoted tumorgrowth in vivo has been examined using cells with Kindlin-2 over-expression or knockdown. Tumor growth can be seen in mice im-planted with MCF-7–Kindlin-2, while no tumor growth has beenobserved in the control panel since the parental MCF-7 cells areestrogen-dependent for their growth (Fig. 4C, upper panel). Ad-versely, tumor growth can be seen in Hs578T–Ctrl-shRNA cellssince Hs578T are estrogen-independent cells for their growth,whereas knockdown of Kindlin-2 in Hs578T led to no tumorgrowth within 4 weeks (Fig. 4C, lower panel). The sizes andweights of these tumors were measured and quantified (Fig. 4Dand E). However, when estrogen was applied to the mice tumorsgrowth in MCF-7 cells can be observed (data not shown). To lookinto the morphological changes caused by Kindlin-2 overexpres-sion or knockdown in the tumor tissues, Hematoxylin and eosin-stained tumor sections were shown in Fig. 4F. The tumors derivedfrom MCF-7–Kindlin-2 cells displayed numerous hyperchromaticnuclei with karyokinesis, pleomorphism (Fig. 4F, black arrowed),necrosis (Fig. 4F, red arrowed) and high density of microvessels(Fig. 4F, empty arrowheads), which were typically seen in breastcancer cell induced xenografts. In comparison, tumors formed byHs578T–Ctrl-shRNA cells, no necrosis or karyokinesis was ob-served. These results indicated that tumors derived from Kindlin-2 overexpressing cells displayed looks more malignant than

Hs578T cells. All together, our results strongly indicated a role ofKindlin-2 in promoting tumor growth in vivo.

3.5. Overexpression of Kindlin-2 led to genome instability in breastcancer cells

In order to uncover the underlying mechanism of tumor forma-tion promoted by Kindlin-2, we performed a CNV analysis withMCF-7 cells stably overexpressing Kindlin-2 as well as the controlcells. Analyses of the aCGH data showed that the majority of genecopy numbers were changed greatly, with both amplification anddeletion of specific regions in the genome that indicated a largegeneration of the chromosomal abnormalities (Fig. 5A). These datasuggest that Kindlin-2 may be involved in the regulation of chro-mosomal instability. To test this idea, we performed metaphasekaryotype analyses in both MCF-7–Kindlin-2 and MCF-7 controlcells. We observed that the copy numbers of chromosome weremarkedly changed in MCF-7–Kindlin-2 cells in comparison withthe control cells (Fig. 5B and C). In addition, overexpression ofKindlin-2 led to a significant increase in the numbers of chromo-somal breaks, fragments, chromatid breaks and gaps as comparedto the controls (Fig. 5D). These findings suggested a possibility thatmitotic abnormalities may lead to chromosome breakage. To thisend, we examined various mitotic errors in MCF-7 cells with

Fig. 4. Kindlin-2 promoted tumor formation in breast cancer cells. (A) Soft agar assays were performed for determination of the anchorage-independent growth in breastcancer cells with Kindlin-2 overexpression or knockdown separately. Cells were seeded in soft agar and after 3 weeks cell colonies were photographed. Bars, 250 lm. (B) In(A) colonies larger than 50 lm in diameter were counted. Values are shown as mean ± SEM from three independent experiments. (C) Orthopedic tumor growth in mice breastfat pads. 5 � 106 cells of MCF-7-Control and MCF-7–Kindlin-2 or Hs578T–Ctrl-shRNA and Hs578T–Kindlin-2–shRNA were injected separately into the subaxillary breast fatpads of the female nude mice. After 4 weeks, tumors formed were dissected. No tumor growth was found in MCF-7-Control or Hs578T–Kindlin-2–shRNA groups. (D) Tumorgrowth curve showed the tumor sizes of MCF-7–Kindlin-2 group (upper) and Hs578T–Ctrl-shRNA group (lower). Data are expressed as mean ± SD from a representativeexperiment. (E) The average weight of tumors of MCF-7–Kindlin-2 group (upper) and Hs578T–Ctrl-shRNA group were quantified and plotted. Values are means ± SD from arepresentative experiment. (F) Histological analyses of tumors. Hematoxylin and eosin staining were performed for paraffin-embedded tissue sections from xenograftedtumors. Red arrow indicates a necrosis within tumor. Black arrow indicates hyperchromatic nuclei with karyokinesis, pleomorphism, and the empty arrowheads point to themicrovessels. � Stands for P < 0.05. Bars (upper), 100 lm; bars (lower), 50 lm.

T. Zhao et al. / Cancer Letters 330 (2013) 208–216 213

214 T. Zhao et al. / Cancer Letters 330 (2013) 208–216

Kindlin-2 overexpression by nuclear staining. As indicated inFig. 6A and B. Near to 20% of the control cells in mitosis showedabnormal chromosome segregation including anaphase bridges(17%), lagging chromatin (1.3%), chromosome missegregation(12%) and micronucleus (3.8%). In contrast, close to 50% of Kind-lin-2 overexpression cells in mitosis had defects of chromosomesincluding anaphase bridges (48%), lagging chromatin (24%), chro-mosome missegregation (44%) and micronucleus (10%). Thus, cellswith Kindlin-2 overexpression exhibited 2-fold more mitotic de-fects than the control cells. Overall, these data indicated that Kind-lin-2 overexpression promoted chromosomal abnormality inbreast cancer cells, which in turn led to genome instability, a hall-mark of human cancer.

Fig. 5. Kindlin-2-induced genome instability in breast cancer cells. (A) An array based comcontrolled by MCF-7 cell with empty vector. Chromosomal abnormalities were detectdeletion profile of specific regions of all the chromosomes. (B) Karyotype analyses of MArrow pointed to the chromosomal gap, and empty arrowheads represent chromosomacontrol and MCF-7–Kindlin-2 separately, and seven cells were counted for total numbeindependent experiments. (D) Quantification of premature chromatic separation in 20 miexperiments. � Stands for P < 0.05.

4. Discussion

Previous studies have shown that Kindlin-2 functions mainly asan important regulator of integrin activation. Kindlin-2 was foundto be required for integrin outside-in signaling that is essential forintegrin signaling and cell-ECM adhesion regulation [20,21]. Kind-lin-2 controls cell migration, proliferation, survival, and differenti-ation [22–25]. Although the deficiency of Kindlin-2 is oftendeleterious, an abnormally high level of Kindlin-2 might be alsodisease-related. So far, deregulation of Kindlin-2 has been observedin various types of human cancers. For example, Gozgit et al.showed that Kindlin-2 was involved in breast cancer cell invasion[10] and An et al. has found that Kindlin-2 regulated malignant

parative genomic hybridization was performed using MCF-7–Kindlin-2 stable cells,ed throughout the chromosomes. The image showed an overall amplification andCF-7-control (left panel) and MCF-7–Kindlin-2 (right panel) cells were performed.l fragments. (C) The numbers of chromosomes per cell were quantified in MCF-7-

rs of chromosomes at each condition. Values are shown as mean ± SEM from threetotic cells per experiment. Values are shown as mean ± SEM from three independent

Fig. 6. Overexpression of Kindlin-2 induced mitotic errors in breast cancer cells. (A) Representative photos of various mitotic errors including lagging chromatin, anaphasebridges, chromosome missegregation and micronucleus in Kindlin-2-overexpressing cells are demonstrated. Arrow represent anaphase bridges, and empty arrowheadsrepresent lagging chromatin. (B) Cells with mitotic errors as displayed in (A) were quantified. Data are expressed as mean ± SEM from three independent experiments. �

Stands for P < 0.05.

T. Zhao et al. / Cancer Letters 330 (2013) 208–216 215

mesothelioma cell adhesion and migration [13]. However, the roleof Kindlin-2 in breast cancer progression is still elusive. In the pres-ent study, we scrutinized the functional roles of Kindlin-2 in breastcancer cell progression by showing that Kindlin-2 regulates cellproliferation both in vitro and in mice tumor xenografts. We alsorevealed a role of Kindlin-2 in the regulation of cell cycle progres-sion by demonstrating that overexpression of Kindlin-2 promotedbreast cancer cells into the G2/M phase, suggesting an engagementof Kindlin-2 in the cell mitosis. Given that Kindlin-2 play an impor-tant role in the regulation of cell proliferation, we also identified arole of Kindlin-2 in the prevention of breast cancer cells from apop-tosis, for which we had a previous similar finding in prostate can-cer cells [26]. These findings suggest that targeting Kindlin-2 mayshed a light on breast cancer therapeutics.

The array-based CNV analysis in Kindlin-2 overexpressed breastcancer cells revealed remarkable changes in gene copy numbers,suggesting a relationship between Kindlin-2 and genome instabil-ity. A number of previous studies have suggested that the majorityof solid tumors, including breast cancer, exhibit genome instabilitywith chromosomal rearrangements [27]. Along with progressiveinstability of the genome, cells are prone to develop large-scaleabnormalities, for example, aneuploidy and chromosome structureaberrations including translocations, inversions, amplifications anddeletions due to defective DNA segregation and recombination[28,29]. Accumulation of various genetic abnormalities reflectsthe heterogeneous nature of cancer. The aneuploidal cancer gen-ome is characterized by either additional or missing chromosomes

and is caused by defects in mitotic checkpoints, affecting propersegregation of chromosomes during cell division [30], abnormityof chromosomes leads to tumorigenesis and is observed in themajority of solid tumors [31].

Karyotyping analysis on Kindlin-2 overexpressing cells showedthat the gene copy numbers were reduced accompanied with moreabnormalities in chromosomes. For lagging chromatins at mitosisin anaphase, micronucleus may be formed after cytokinesis. In-deed, we noticed these phenomena in abnormal mitosis in Kind-lin-2 expressing cells. It was known that lagging chromatin atanaphase represents a potential source of aneuploidy. After cytoki-nesis occurs, a lagging chromatin may give rise to a monosomicdaughter cell and a trisomic one in 50% of cases [32–34], causingchromosome instability and aneuploidy, which play a critical rolein tumor development and progression [35,36]. In addition, in-creased proportion of micronucleus was found in Kindlin-2 over-expressing cells as well. Studies have demonstrated thatmicronucleus are mainly derived from lagging chromatin that iscoated by nuclear membrane at the end of the mitosis [37], frag-ments formed by chromatin bridge breakage stay outside of nu-cleus [38], and abnormal chromosome segregation [39].Micronucleus is an indicator of chromosome damages, and iswidely used to detect chromosomal instability caused by exoge-nous and endogenous factors as well as the biological end pointof chromosome instability and a marker for cancer risk [40–42].Therefore, the major chromosomal abnormalities can be identifiedin breast cancer cells with Kindlin-2 overexpression, suggesting a

216 T. Zhao et al. / Cancer Letters 330 (2013) 208–216

cytogenetic interpretation for Kindlin-2 regulation on breast can-cer progression.

Taken together, our present study demonstrated a novel mech-anism that Kindlin-2 regulates breast cancer progression by induc-ing genome instability. Targeting to Kindlin-2 may inhibit tumorgrowth and cause apoptosis and thus shed a light on breast cancertherapeutics.

Acknowledgements

This work was supported by Grants from the MSTC2010CB912203 and 2010CB529402, NSFC Grants 30830048,31170711,81230051 and 81101495, ‘‘111 Project’’ from Ministryof Education of China, Beijing Natural Science Foundation7120002, BMU20120314 and Leading Academic Discipline Projectof Beijing Education Bureau to H.Z.

Appendix A. Supplementary material

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.canlet.2012.11.043.

References

[1] E. Montanez, S. Ussar, M. Schifferer, M. Bosl, R. Zent, M. Moser, R. Fassler,Kindlin-2 controls bidirectional signaling of integrins, Genes Dev. 22 (2008)1325–1330.

[2] Y.Q. Ma, J. Qin, C. Wu, E.F. Plow, Kindlin-2 (Mig-2): a co-activator of beta3integrins, J. Cell Biol. 181 (2008) 439–446.

[3] Y. Tu, S. Wu, X. Shi, K. Chen, C. Wu, Migfilin and Mig-2 link focal adhesions tofilamin and the actin cytoskeleton and function in cell shape modulation, Cell113 (2003) 37–47.

[4] S. Ussar, H.V. Wang, S. Linder, R. Fassler, M. Moser, The Kindlins: subcellularlocalization and expression during murine development, Exp. Cell Res. 312(2006) 3142–3151.

[5] S. Tadokoro, S.J. Shattil, K. Eto, V. Tai, R.C. Liddington, J.M. de Pereda, M.H.Ginsberg, D.A. Calderwood, Talin binding to integrin beta tails: a final commonstep in integrin activation, Science 302 (2003) 103–106.

[6] J.J. Dowling, E. Gibbs, M. Russell, D. Goldman, J. Minarcik, J.A. Golden, E.L.Feldman, Kindlin-2 is an essential component of intercalated discs and isrequired for vertebrate cardiac structure and function, Circ. Res. 102 (2008)423–431.

[7] G.Y. Jung, Y.J. Park, J.S. Han, Mediation of Rac1 activation by kindlin-2: anessential function in osteoblast adhesion, spreading, and proliferation, J. Cell.Biochem. 112 (2011) 2541–2548.

[8] Y. He, P. Esser, V. Schacht, L. Bruckner-Tuderman, C. Has, Role of kindlin-2 infibroblast functions: implications for wound healing, J. Invest. Dermatol. 131(2011) 245–256.

[9] E. Pluskota, J.J. Dowling, N. Gordon, J.A. Golden, D. Szpak, X.Z. West, C. Nestor,Y.Q. Ma, K. Bialkowska, T. Byzova, E.F. Plow, The integrin coactivator kindlin-2plays a critical role in angiogenesis in mice and zebrafish, Blood 117 (2011)4978–4987.

[10] J.M. Gozgit, B.T. Pentecost, S.A. Marconi, C.N. Otis, C. Wu, K.F. Arcaro, Use of anaggressive MCF-7 cell line variant, TMX2-28, to study cell invasion in breastcancer, Mol. Cancer Res. 4 (2006) 905–913.

[11] X. Shi, Y.Q. Ma, Y. Tu, K. Chen, S. Wu, K. Fukuda, J. Qin, E.F. Plow, C. Wu, TheMIG-2/integrin interaction strengthens cell-matrix adhesion and modulatescell motility, J. Biol. Chem. 282 (2007) 20455–20466.

[12] X. Shi, C. Wu, A suppressive role of mitogen inducible gene-2 in mesenchymalcancer cell invasion, Mol. Cancer Res. 6 (2008) 715–724.

[13] Z. An, K. Dobra, J.G. Lock, S. Stromblad, A. Hjerpe, H. Zhang, Kindlin-2 isexpressed in malignant mesothelioma and is required for tumor cell adhesionand migration, Int. J. Cancer 127 (2010) 1999–2008.

[14] Z. Shen, Y. Ye, L. Dong, S. Vainionpaa, H. Mustonen, P. Puolakkainen, S. Wang,Kindlin-2: a novel adhesion protein related to tumor invasion, lymph nodemetastasis, and patient outcome in gastric cancer, Am. J. Surg. 203 (2012) 222–229.

[15] S. Talaat, S. Somji, C. Toni, S.H. Garrett, X.D. Zhou, M.A. Sens, D.A. Sens, Kindlin-2 expression in arsenite- and cadmium-transformed bladder cancer cell linesand in archival specimens of human bladder cancer, Urology 77 (2011) e1501–e1507.

[16] K. Kato, T. Shiozawa, J. Mitsushita, A. Toda, A. Horiuchi, T. Nikaido, S. Fujii, I.Konishi, Expression of the mitogen-inducible gene-2 (mig-2) is elevated inhuman uterine leiomyomas but not in leiomyosarcomas, Hum. Pathol. 35(2004) 55–60.

[17] B.A. Kohler, E. Ward, B.J. McCarthy, M.J. Schymura, L.A. Ries, C. Eheman, A.Jemal, R.N. Anderson, U.A. Ajani, B.K. Edwards, Annual report to the nation onthe status of cancer, 1975–2007, featuring tumors of the brain and othernervous system, J. Natl. Cancer Inst. 103 (2011) 714–736.

[18] C.M. Perou, T. Sorlie, M.B. Eisen, M. van de Rijn, S.S. Jeffrey, C.A. Rees, J.R.Pollack, D.T. Ross, H. Johnsen, L.A. Akslen, O. Fluge, A. Pergamenschikov, C.Williams, S.X. Zhu, P.E. Lonning, A.L. Borresen-Dale, P.O. Brown, D. Botstein,Molecular portraits of human breast tumours, Nature 406 (2000) 747–752.

[19] F. Bertucci, D. Birnbaum, Reasons for breast cancer heterogeneity, J. Biol. 7(2008) 6.

[20] H. Larjava, E.F. Plow, C. Wu, Kindlins: essential regulators of integrin signallingand cell-matrix adhesion, EMBO Rep. 9 (2008) 1203–1208.

[21] D.S. Harburger, M. Bouaouina, D.A. Calderwood, Kindlin-1 and -2 directly bindthe C-terminal region of beta integrin cytoplasmic tails and exert integrin-specific activation effects, J. Biol. Chem. 284 (2009) 11485–11497.

[22] R.O. Hynes, Integrins: bidirectional, allosteric signaling machines, Cell 110(2002) 673–687.

[23] B. Garcia-Alvarez, J.M. de Pereda, D.A. Calderwood, T.S. Ulmer, D. Critchley, I.D.Campbell, M.H. Ginsberg, R.C. Liddington, Structural determinants of integrinrecognition by talin, Mol. Cell 11 (2003) 49–58.

[24] M. Kim, C.V. Carman, T.A. Springer, Bidirectional transmembrane signaling bycytoplasmic domain separation in integrins, Science 301 (2003) 1720–1725.

[25] J.G. Lock, B. Wehrle-Haller, S. Stromblad, Cell-matrix adhesion complexes:master control machinery of cell migration, Semin. Cancer Biol. 18 (2008) 65–76.

[26] X. Gong, Z. An, Y. Wang, L. Guan, W. Fang, S. Stromblad, Y. Jiang, H. Zhang,Kindlin-2 controls sensitivity of prostate cancer cells to cisplatin-induced celldeath, Cancer Lett. 299 (2010) 54–62.

[27] P.J. Stephens, D.J. McBride, M.L. Lin, I. Varela, E.D. Pleasance, J.T. Simpson, L.A.Stebbings, C. Leroy, S. Edkins, L.J. Mudie, C.D. Greenman, M. Jia, C. Latimer, J.W.Teague, K.W. Lau, J. Burton, M.A. Quail, H. Swerdlow, C. Churcher, R. Natrajan,A.M. Sieuwerts, J.W. Martens, D.P. Silver, A. Langerod, H.E. Russnes, J.A.Foekens, J.S. Reis-Filho, L. van‘t Veer, A.L. Richardson, A.L. Borresen-Dale, P.J.Campbell, P.A. Futreal, M.R. Stratton, Complex landscapes of somaticrearrangement in human breast cancer genomes, Nature 462 (2009) 1005–1010.

[28] J.B. Geigl, A.C. Obenauf, T. Schwarzbraun, M.R. Speicher, Defining‘chromosomal instability’, Trends Genet. 24 (2008) 64–69.

[29] D. Pellman, Cell biology: aneuploidy and cancer, Nature 446 (2007) 38–39.[30] B.A. Weaver, D.W. Cleveland, Does aneuploidy cause cancer?, Curr Opin. Cell

Biol. 18 (2006) 658–667.[31] M. Rizzoni, C. Tanzarella, B. Gustavino, F. Degrassi, A. Guarino, E. Vitagliano,

Indirect mitotic nondisjunction in Vicia faba and Chinese hamster cells,Chromosoma 97 (1989) 339–346.

[32] R.R. Marshall, M. Murphy, D.J. Kirkland, K.S. Bentley, Fluorescence in situhybridisation with chromosome-specific centromeric probes: a sensitivemethod to detect aneuploidy, Mutat. Res. 372 (1996) 233–245.

[33] M. Izzo, A. Antoccia, F. Degrassi, C. Tanzarella, Immunofluorescence analysis ofdiazepam-induced mitotic apparatus anomalies and chromosome loss inChinese hamster cells, Mutagenesis 13 (1998) 445–451.

[34] S. Sen, Aneuploidy and cancer, Curr. Opin. Oncol. 12 (2000) 82–88.[35] E. Wiechec, Implications of genomic instability in the diagnosis and treatment

of breast cancer, Expert Rev. Mol. Diagn. 11 (2011) 445–453.[36] J. Catalan, G.C. Falck, H. Norppa, The X chromosome frequently lags behind in

female lymphocyte anaphase, Am. J. Hum. Genet. 66 (2000) 687–691.[37] D. Gisselsson, T. Jonson, A. Petersen, B. Strombeck, P. Dal Cin, M. Hoglund, F.

Mitelman, F. Mertens, N. Mandahl, Telomere dysfunction triggers extensiveDNA fragmentation and evolution of complex chromosome abnormalities inhuman malignant tumors, Proc. Natl. Acad. Sci. USA 98 (2001) 12683–12688.

[38] G.C. Falck, J. Catalan, H. Norppa, Nature of anaphase laggards and micronucleiin female cytokinesis-blocked lymphocytes, Mutagenesis 17 (2002) 111–117.

[39] M.E. Crespo-Lopez, A. Lima de Sa, A.M. Herculano, R. Rodriguez Burbano, J.L.Martins do Nascimento, Methylmercury genotoxicity: a novel effect in humancell lines of the central nervous system, Environ. Int. 33 (2007) 141–146.

[40] S. Bonassi, A. Znaor, M. Ceppi, C. Lando, W.P. Chang, N. Holland, M. Kirsch-Volders, E. Zeiger, S. Ban, R. Barale, M.P. Bigatti, C. Bolognesi, A. Cebulska-Wasilewska, E. Fabianova, A. Fucic, L. Hagmar, G. Joksic, A. Martelli, L. Migliore,E. Mirkova, M.R. Scarfi, A. Zijno, H. Norppa, M. Fenech, An increasedmicronucleus frequency in peripheral blood lymphocytes predicts the risk ofcancer in humans, Carcinogenesis 28 (2007) 625–631.

[41] R.A. El-Zein, M.B. Schabath, C.J. Etzel, M.S. Lopez, J.D. Franklin, M.R. Spitz,Cytokinesis-blocked micronucleus assay as a novel biomarker for lung cancerrisk, Cancer Res. 66 (2006) 6449–6456.

[42] B. Vogelstein, K.W. Kinzler, Cancer genes and the pathways they control, Nat.Med. 10 (2004) 789–799.