Kinase regulation of MHC-I in tumors Brea et. alcancerimmunolres.aacrjournals.org/content/canimm/early/2016/09/28/2326... · Kinase regulation of MHC-I in tumors Brea et. al Kinase

Kinase regulation of MHC-I in tumors Brea et. al

Kinase regulation of Human MHC Class I Molecule Expression on Cancer Cells

Elliott J. Brea1,6, Claire Y. Oh1,6, Eusebio Manchado3, Sadna Budhu2, Ron S.Gejman1,6, George Mo1, Patrizia Mondello1, James E. Han1,6, Casey A. Jarvis1, David Ulmert1, Qing Xiang4, Aaron Y. Chang1,6, Ralph J. Garippa4, Taha Merghoub2, Jedd D. Wolchok2,6,Neal Rosen1,6, Scott W. Lowe3,5,6, David A. Scheinberg1,6* Affiliations: 1Molecular Pharmacology Program, 2Immunology Program, 3Cancer Biology and Genetics Program,4RNAi Core Facility, Memorial Sloan-Kettering Cancer Center New York, NY USA, 10065. 5Howard Hughes Medical Institute, New York, NY, 10065, USA. 6Weill Cornell Medicine, New York, New York, USA, 10021 *To whom correspondence should be addressed: [email protected] Running title: Kinase regulation of MHC-I in tumors Keywords: Immunotherapy, Kinases, Antigen presentation, TCR mimic, T cell therapy, MAPK Funding: The study was supported by US National Institutes of Health grant R01 CA 55349 (D.A.S.), P01 CA23766 (D.A.S.), Diversity Research Supplement for the P01CA023766 (E.J.B., D.A.S), MARF (D.A.S.), P30 CA008748, NCI Grant NIH T32CA062948 (C.Y.O.), NIGMS T32GM07739 (E.J.B), Memorial Sloan Kettering Cancer Center’s (MSKCC’s) Experimental Therapeutics Center and the Lymphoma Foundation and Tudor and Glades funds. Competing interests: D.A.S. is an inventor of the ESKM technology described in this paper and licensed by Memorial Sloan Kettering Cancer Center to Novartis. Corresponding author: David A. Scheinberg, MD, PhD; Molecular Pharmacology Program; Experimental Therapeutics Center; Leukemia Service; Memorial Sloan Kettering Cancer Center; 1275 York Avenue, NY, NY, 10065; 646-888-2190 phone 646-888-2195 office 646-422-0296 fax [email protected]

on December 30, 2019. © 2016 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 28, 2016; DOI: 10.1158/2326-6066.CIR-16-0177

http://cancerimmunolres.aacrjournals.org/


2

Word count: 5586 Figures: 5





3

Abstract: The major histocompatibility complex I (MHC-I) presents antigenic peptides to

tumor-specific CD8+ T cells. The regulation of MHC-I by kinases is largely unstudied,

even though many patients with cancer are receiving therapeutic kinase inhibitors.

Regulators of cell surface HLA amounts were discovered using a pooled human kinome

shRNA interference–based approach. Hits scoring highly were subsequently validated

by additional RNAi and pharmacologic inhibitors. MAP2K1 (MEK), EGFR, and RET

were validated as negative regulators of MHC-I expression and antigen presentation

machinery in multiple cancer types, acting through an ERK output–dependent

mechanism; the pathways responsible for increased MHC-I upon kinase inhibition were

mapped. Activated MAPK signaling in mouse tumors in vivo suppressed components of

MHC-I and the antigen presentation machinery. Pharmacologic inhibition of MAPK

signaling also led to improved peptide/MHC target recognition and killing by T cells and

TCR-mimic antibodies. Druggable kinases may thus serve as immediately applicable

targets for modulating immunotherapy for many diseases.

Introduction Major histocompatibility complex class I molecules (MHC-I) generally present

short peptides from either foreign or native intracellular proteins on the cell surface in an

HLA-restricted manner for recognition by CD8+ T cells via their T cell receptor (TCR)

(1). MHC-I is an essential protein for CD8+ cytotoxic T cell responses, effective

vaccination, adoptive T cell therapies, hematopoietic stem cell transplantation, and

organ rejection, among many important physiologic processes and therapeutic

manipulations. In addition, recently developed therapeutic TCR-based constructs and

TCR-mimic antibodies are directed to MHC/peptide complexes (2–5).





4

Although immunotherapies for cancer, infectious disease, and autoimmune

disease continue to gain use as effective therapeutic strategies, the mechanisms

underlying the control of presentation of foreign antigens or self-tumor antigens are only

partially understood and currently not exploited clinically (6). Reduced cell surface

presentation of tumor antigens on MHC-I is an important obstacle to effective

immunotherapy with adoptively transferred T cells, TCR constructs, tumor vaccines, and

TCR-mimic antibodies (7–12).

We hypothesized that signaling pathways driven by kinases also may regulate

surface MHC-I expression and that these could identified in loss- or gain-of-function

genetic screens using specific antibodies to detect MHC-I cell surface expression.

Previously, a genome-wide screen provided evidence that regulators of MHC-II could be

identified by RNAi knockdown (13). We decided to target a mesothelioma cell line for

our proof of concept, due to its robust expression of HLA and the need for more

effective therapies for this disease. Moreover, immunotherapies, such as the CTLA-4

blocking antibody tremelimumab, that rely on antigen presentation on MHC-I, are

currently being tested in mesothelioma (14). To identify signaling pathways that regulate

HLA expression in this model, we conducted an shRNA screen of currently annotated

human kinases, as it affords the immediate possibility of targeting identified kinases for

which inhibitors already exist. Among ‘hits’ identified in the screen were kinases that

negatively regulate HLA, including MAP2K1 (MEK1) and EGFR. In addition, we

discovered that DDR2 and MINK1 increase surface MHC-I. These pathways, the effects

of their inhibition, and the positive consequences of inhibition on MHC antigen

presentation, TCR-based recognition of the MHC/peptide complexes and subsequent





5

killing were explored. The use of loss- and gain-of-function screens to uncover

regulators of MHC-I could have broad implications for understanding and treating

multiple diseases with pathophysiology related to antigen presentation.





6

Materials and Methods Cell lines and culture conditions: After informed consent on Memorial Sloan-Kettering

Cancer Center (MSK) Institutional Review Board–approved protocols, peripheral blood

mononuclear cells (PBMCs) from HLA-typed healthy donors and patients were obtained

by Ficoll density centrifugation. The sources for obtaining human mesothelioma cell

lines JMN and Meso34 are described previously and were verified as unique cell lines

by IMPACT sequencing (Supplementary Table 1) (3). HEK293T, PC9, SKMEL5,

UACC257, SW480, CFPAC1, H827, H1975, H1299, and A549 were obtained from

ATCC between the years 2012 and 2016 and were not further validated. The TPC1 cell

was obtained from Dr. James Fagin lab, where the cell line was validated by IMPACT

sequencing, and used from 2014-2016. (Memorial Sloan-Kettering Cancer Center). The

B16-F10 melanoma line was originally obtained from I. Fidler, and used from 2015-

2016, and was not further validated (MD Anderson Cancer Center). Cell lines were

maintained 2-3 months in RPMI supplemented with 10% FBS and 2 mM L-glutamine

unless otherwise mentioned. HEK293T were grown in Dulbecco’s modified media with

10% FBS and 2 mM L-glutamine. Cells were checked regularly for mycoplasma.

ADCC: The HLA-A*02:01 positive mesothelioma cell lines JMN and Meso34, along with

the melanoma cell line SK-MEL5 were used in the ADCC assay as a target. Antibodies

(3 μg/ml) ESKM (15), PRAME, or its isotype control hIgG1 were incubated with target

cells and fresh healthy donor PBMCs at different effector/target ratios for 6 hours, along

with indicated doses of vehicle or trametinib in RPMI supplemented with 10% FBS. The

supernatant was harvested, and the cytotoxicity was measured by a 51Cr release assay

(Perkin Elmer).





7

Clonogenic killing assay: B16F10 cells were treated with either 0.1% DMSO or 1 uM

trametinib for 72 h. B16F10 cells (1 x 104) were then used as targets and in vitro–

activated Pmel T cells (5 x 104) as effectors isolated from the spleen of pmel

(GP100) B6.Cg-Thy1a/Cy Tg(TcraTcrb)8Rest/J mice (Jackson Labs).

Pooled RNAi screening: A custom shRNA library targeting the full complement of 526

human kinases was designed using miR30-adapted DSIR predictions refined with

“sensor” rules (six shRNAs per gene) and constructed by PCR-cloning a pool of

oligonucleotides synthesized on 12k customized arrays (Agilent Technologies and

CustomArray) as previously described (16). The list of genes was obtained from

KinBase Database (http://kinase.com/human/kinome/) and was manually curated. After

sequence verification, 3156 shRNAs (5-6 per gene) were combined with positive control

HLA-A– and negative-control Renilla–targeting shRNAs at equal concentrations in one

pool. JMN mesothelioma cells stably expressing the Tet-On rt-TA3 gene were used.

This pool was subcloned into the TRMPV-Neo vector and transduced in triplicates into

Tet-on JMN mesothelioma cancer cells using conditions that predominantly lead to a

single retroviral integration and represent each shRNA in a calculated number of at

least 1,000 cells (Fig. 1A). Transduced cells were selected for 6 days using G418

(1 mg ml−1, Invitrogen); at each passage more than 3 x 107 cells were maintained to

preserve library representation throughout the experiment. After induction, T0 samples

were obtained (~3 x 107 cells per replicate, n = 3) and cells were subsequently cultured

in the presence of doxycycline (2 μg ml−1) to induce shRNA expression. After four days

(Tf), about 3 x 106 shRNA-expressing (dsRed+/Venus+) cells were sorted for each





8

replicate using a FACSAriaII (BD Biosciences). DAPI negative, dsRed+/Venus+ cells

were sorted by FACS into three populations of BB7 low, BB7 middle, and BB7 high

binding (Fig. 1). Genomic DNA from Tf samples was isolated by two rounds of phenol

extraction using PhaseLock tubes (5prime) followed by isopropanol precipitation. Deep-

sequencing template libraries were generated by PCR amplification of shRNA guide

strands as previously described (10). Libraries were analyzed on an Illumina Genome

Analyzer at a final concentration of 8 pM; 50 nucleotides of the guide strand were

sequenced using a custom primer (miR30EcoRISeq,

TAGCCCCTTGAATTCCGAGGCAGTAGGCA). Hits with lower than 100 reads from the

Illumina HiSeq were eliminated because they were not above background.

Relative representations of each individual shRNA were determined and compared in

each given sorted population. We separated hits phenotypically into negative regulators

(the population one standard deviation below the mean fluorescence intensity) or

positive regulators (the population one standard deviation above the mean fluorescence

intensity) of HLA-A*02:01. The ratio of the shRNA ranking between the high and low

population was compared, with a high ratio indicating a putative negative regulator of

surface HLA-A*02:01. The scoring criteria for a gene being a negative regulator of HLA-

A*02:01 was based on having two or more shRNA constructs score in the top 5% for

fold difference in relative representation between BB7 high population and BB7 low

population, with other constructs scoring within 1 SD of the mean fold change. The gene

products with at least two shRNA sequences in the top 5% ratio were selected for

further validation by other methods. The same discovery pipeline was used for





9

identifying positive regulators of HLA-A*02:01. For validation, the LT3GEPIR shRNA

vector was used (17) ( Supplementary Table S2). Cells were transduced and selected

with puromycin, then induced with doxycycline (2 μg/ml) for 96 h before evaluating BB7,

W6/32, ESK, or PRAME expression by flow cytometry.

Antibodies: Antibodies used for flow cytometry and western blot analysis are described

in Supplementary Table S3. Monoclonal antibodies (mAbs) used for flow cytometry

were specific for HLA-A02 (BB7.2), pan–HLA-ABC (W6/32), WT1 peptide RMF bound

to HLA-A02 (ESK1), PRAME peptide ALY bound to HLA-A02 (Pr20), H2-Kb (AF6-

88.5.5.3), and H2-Kq (KH114). Other antibodies used in this report are also listed in

Supplementary Table S3.

Real-Time PCR: Total RNA was extracted using Qiagen RNA Easy Plus(Qiagen;

#74134) after cells were treated for 48 h with indicated inhibitor. RNA

was converted into cDNA using qScript™ cDNA SuperMix (Quanta Biosciences

Gaithersburg, MD USA). Real-time assays were conducted using TaqMan realtime

probes (Life Technlogies) for human HLA-A (Hs01058806_g1), B2M

(Hs00187842_m1), TAP1 (Hs00388677_m1), TAP2 (Hs00241060_m1), and TBP

(Hs00427620_m1) with 50 ng cDNA. For assessment of gene expression using

RT-PCR PerfeCTa. FastMix. II (Quanta), reactions were carried out in

triplicates using standard thermocycling conditions (2 min at 50 °C, 10

min at 95 °C, 40 cycles of 15 sec at 95.C, and 1 min at 60 °C). TBP

was used as internal control and the ΔΔCT method was used for relative mRNA

calculations.





10

Promoter based studies: GLuc luciferase promoter was obtained from Genecoepia

(GeneCoepia Rockville, MD USA) with the B2M promoter cloned upstream of the GLuc

enzyme. Normalization was done to SEAP (under the constitutively active SV40

promoter). Cells were seeded at 5E3 cells/well and treated with indicated drugs for 72

hours. Luminescence quantitation was assayed using the Secrete-Pair Dual

Luminescence Assay Kit (GeneCoepia Rockville, MD USA).

Flow cytometric studies: Cell lines were seeded in triplicate in a 6-well tissue culture

plate at a density of 1E5 cells/well, and allowed to adhere overnight. The next day, cells

were treated with either vehicle control (0.1% DMSO), drugs or inhibitors at indicated

concentrations. Cells were then isolated at 72 hours after inhibitor treatment, and

washed with PBS. Cells were subsequently stained with BB7.2 (HLA-A02–specific

mAb), W6/32 (HLA-ABC–specific mAb), or AF6-88.5.5.3 (H2-Kb–specific mAb,

Ebiosciences). Cells were stained with propidium iodide for viability. Cells were

analyzed on BD Accuri C6 flow cytometer.

Overexpression of β2M: Human β2M cDNA was cloned into the MSCV Puromycin vector

Overexpression of mutant EGFR and NRAS: The pBABE retroviral vector encoding

either EGFR harboring the L858R mutation was used to stably transduce H1299 cell

line using HEK293T/Amphoteric cells and were selected in puromycin (2.5 μg/ml) for 5

days. EGFR L858R was a gift from Matthew Meyerson (Addgene plasmid # 11012).

For overexpression of NRAS the pBABE NRAS Q61K plasmid was used to transduce

H827 cells similar to described above, and selected in puromycin (2 μg/ml). pBabe N-

Ras 61K was a gift from Channing Der (Addgene plasmid # 12543).





11

Small molecule inhibitor studies: Compounds were obtained from SelleckChem

(Houston, TX USA). Drugs were used at sub-cytostatic doses by titration using the Cell

Titer Glo assay (Promega). All drugs were used in vitro at indicated doses in 1% DMSO.

Experiments were performed at least twice with similar results, and data shown are

representative.

siRNA knockdown: The JMN cell line was treated with a control scrambled siRNA, or

siRNA against STAT1, STAT3, and RelA. Cells were treated with the indicated drug 24

h after siRNA knockdown for 72 h before assaying for surface HLA-A by flow cytometry.

shRNA construct details are in Supplementary Table S2.

Transgenic EGFR L858R mouse model: FVB CC10-rtTA/EGFR-L858R mice were

obtained as a kind gift from the Harold Varmus lab. Mice were bred in accordance with

MSKCC institutional review board under protocol 96-11-044. Mice used for the

experiment were heterozygous for CC10-rtTA and EGFR-L858R as detected by

quantitative PCR genotyping. At 4-6 weeks of age, mice were put on doxycycline via

food pellets (625 mg/kg) (Harlan-Teklad) for > 6 weeks. Mice were imaged by

anesthetizing under 2% isoflurane and lung field images were acquired on a Bruker

4.7T Biospec scanner (Bruker Biospin Inc.) magnetic resonance imager (MRI) in the

small animal imaging core at MSKCC. Images were analyzed with Osirix Imaging

Software (Geneva, Switzerland). Once confirmed to have reticulonodular appearances

and consolidations by axial and coronal MR images, consistent with previous data

published on the transgenic mice (18).

Mice were sacrificed once confirmed to have lung tumors (non induced control

mice were also used, which genotypically were identical but did not receive dox diet).





12

The lungs were isolated and treated with collagenase IV in HBSS with Ca2+ and Mg2+

for 1 h 37ºC. Cells were then collected, blocked with mouse FcR block (Miltenyi),

counted, and stained with mouse CD45 (30-F11, Biolegend), human EGFR(AY13 clone,

Biolegend), and mouse H2-Kq (KH114, clone Abcam) antibodies. Flow cytometry

analysis was performed on Fortessa (BD Biosciences).

CC10/L858R microarray data: Expression data from tissue isolated from WT and EGFR

L858R transgenic mice were obtained from a previous study (GSE17373) and were

selected for statistically significant data (P < 0.05) for PDCD1 (PD-1), CD274 (PD-L1),

TAP1, TAP2, H2-Kd, and B2M gene expression between tumor bearing EGFR L858R

lung tissue and normal lung tissue (19,20).

Results

Pooled shRNA screen identified gene products regulating surface HLA-A*02:01 Loss or gain of function screens serve as starting points for identifying new

regulators of protein expression and function. We used an shRNA library against the

550 currently annotated human kinases to perform a custom pooled screen. For each

gene, six shRNA constructs were cloned into the TRMPV retroviral vector, a tetracycline

regulated vector that couples a mir30 based shRNA to a red fluorescent protein, which

allows easy tracking and sorting of cells productively expressing an shRNA (Fig. 1A)

(16). Knockdown of HLA-A*02:01 by use of an shRNA to this gene product in the same

vector was tested as a positive control and caused strong knockdown by both western

blot analysis and flow cytometry (Fig. 1B).

The amount of MHC-I and antigen presentation on surface HLA-A*02:01 is an

important determinant of efficacy for certain immunotherapies (21). We decided to use





13

the human mesothelioma cell line JMN as the target for these studies, which has stable

HLA-A*02:01 expression and which has been used as a target of MHC-I directed

therapies in vitro and in vivo (22). As a tool to show the impact of HLA modulation on

antigen recognition and potential for TCR-based killing, we used TCR mimic antibodies

that recognize peptide/MHC-I complexes. Knockdown of HLA-A substantially decreased

the killing efficacy of the TCR mimic antibody ESKM against the JMN mesothelioma cell

line (Supplementary Fig. S1). JMN was analyzed for presence of a predefined subset of

mutations using the MSK IMPACT platform (Supplementary Table S1). No mutations or

significant copy number alterations were observed in the HLA-A*02:01 or B2M genes.

The JMN cell line was screened with an shRNA library against the human

kinome, as described in the Methods, for genes acting as negative or positive regulators

of surface HLA-A, detected by flow cytometry with the HLA-A*02:01 specific mAb BB7.2

and fluorescence-activated cell sorting was used to sort populations based on HLA

expression (illustrated as in Fig. 1C). The top 5 hits are listed (Supplementary Table

S4).

Based on this analysis, MAP2K1 and EGFR were identified as important

negative regulators of surface HLA-A*02:01. We chose to further investigate EGFR and

MEK because of the availability of clinically approved drugs targeting these kinases

both in NSCLC and metastatic melanoma respectively (23), as well as extensive use of

immunotherapy.

EGFR is a receptor tyrosine kinase that binds epidermal growth factor and is

frequently found to be activated by mutation in NSCLC. Activated EGFR signals through

multiple downstream pathways, including the MAPK pathway. shRNA constructs





14

against MAP2K1 and EGFR showed a large increase in relative representation in the

BB7-high sorted population versus the BB7-low population, indicative of a negative

regulator of HLA-A*02:01 surface expression (Fig. 1D). We validated each of these

genes with independent shRNA knockdown to the gene products and saw significant

increases in HLA-A*02:01 by flow cytometry (Fig. 1E). These effects were seen not only

with HLA-A*02:01, but with total HLA-A, B, and C, suggesting coordinated control of all

HLA surface expression, as measured with the W6/32 mAb (Supplementary Fig. S4).

These findings were reproduced in multiple mesothelioma cell lines (Supplementary Fig.

S3A and B). The RET protooncogene was also identified as potential target, but was not

further studied at this time because no inhibitor of adequate specificity was available

(Supplementary Fig. S3C).

We identified examples of positive genetic regulators of HLA-A, including two

putative positive regulators DDR2 and MINK1 (Supplementary Table S4;

Supplementary Fig. S4A and S4B), and confirmed their activity as well using siRNA

knockdown (Supplementary Fig. S4C). Therefore, the kinase screen discovered multiple

positive and negative regulators of HLA expression, each of which in principle could be

explored further for mechanism and clinical utility. The top five negative regulators

evaluated were confirmed by additional study, whereas three of the five top positive

regulators were validated (SupplementaryTable S2).

The MAPK pathway regulates MHC-I Multiple potent small molecule inhibitors exist for EGFR and MEK, with several

already FDA approved, and others currently in clinical trials for various cancers (23). Of

note, the initial screen was performed in a cell line with EGFR activation and an





15

identified EGFR mutation (Supplementary Table S1) (24). We tested, in multiple cell

lines, the ability of inhibitors to phenocopy the loss of kinase expression leading to

increased HLA-A expression seen with shRNA. Cell surface HLA-A*02:01 expression

increased in response to MEK inhibition for 72 h with the selective MEK inhibitor

trametinib in mesothelioma cell lines with activated MAP kinase signaling (Fig. 2A). JMN

and PC9, a NSCLC cell line with an activating EGFR mutation (del E746-A750),

responded to the EGFR inhibitor afatinib, whereas the Meso34 cell line without an

EGFR mutation did not respond to afatinib at the same dose, demonstrating selectivity

for activation mutations in the MAPK pathway leading to a response to HLA-A up-

regulation (Supplementary Table 1). We detected an effect of MAP kinase pathway

inhibition on upregulation of HLA-A in the context of gain-of-function mutations or

activation of other targets in the MAP kinase pathway, such as the KRAS G12V

mutation in the SW480 and CFPAC-1 cell lines, the RET/PTC1 gene rearrangement in

the TPC1 thyroid cell line, and the BRAF V600E mutation seen in the UACC257 and

SK-MEL-5 melanoma cell lines (Fig. 2A). The MEKi trametinib did not affect surface

HLA-A expression on normal PBMC cells, showing that this effect is specifically seen in

cells with activated signaling.

To confirm that the increased HLA expression on the cell surface had important

functional significance for enhanced presentation of antigens, we quantified the cell

surface MHC/peptide epitope density by use of TCR mimic mAb selective for two well-

validated tumor-associated epitopes presented by HLA-A*02:01, a WT1 peptide and a

PRAME 300 peptide (25,26). Consistent with the increased surface HLA-A*02:01





16

expression, we also observed increased binding of the two TCR-mimic antibodies upon

inhibition of MEK and EGFR (Fig. 2B).

We confirmed the regulatory activity of the pathway in a gain-of-function

experiment by further stimulating the ERK pathway with EGF. The binding of EGF to the

EGFR suppressed surface HLA-A and HLA-A, B, C, providing additional confirmation of

the importance of the MAPK pathway in regulating surface MHC (Fig. 2C).

The mechanism by which the MAP kinase pathway suppresses HLA-A was

unknown. Given that many cancers have activating mutations in specific genes in the

MAP kinase pathway, we investigated inhibition of the identified hits in cell lines

harboring mutations in EGFR, or downstream in Ras. We used a panel of NSCLC cell

lines with activating mutations in EGFR, such as the delE746-A750 in H827, or

L858R/T790M mutation in H1975. The delE746-A750 confers sensitivity to erlotinib,

whereas the T790M confers resistance to erlotinib and to other first generation EGFR

inhibitors, but is sensitive to afatinib (27). We also used EGFR wild-type NSCLC lines

with downstream mutations, such as activating NRAS Q61K in H1299 or KRAS G12S in

A549.

Use of the EGFRi erlotinib and afatinib upregulated surface MHC-I if the cell line

had the sensitizing mutation, whereas all responded to trametinib MEKi (Fig. 2D and

2E). The sensitivity to EGFRi erlotinib and afatinib upregulating surface MHC-I was not

observed with downstream activating RAS mutations. Expression of the activating

EGFR mutation L858R suppressed MHC-I in H1299 NRAS Q61K mutant cell lines (Fig.

2F).





17

H827 responded more strongly to EGFRi by erlotinib than MEKi by trametinib,

despite their similar suppression of pERK, a downstream marker of MEK activity. The

combination MEKi and EGFRi was equivalent to EGFRi alone. (Fig. 2G). We introduced

the NRAS Q61K mutation, shown to cause resistance to EGFRi and persistent

activation of the MAPK pathway in H827. Use of the EGFRi still had an effect on surface

MHC-I despite no change in pERK output on the H827 NRAS Q61K cell line (Fig. 2H).

This could be due to activation of parallel signaling pathways in EGFR mutant cancers

or differential stimulation of ERK. Thus, the MAPK pathway is not the only determinant

of EGFR-mediated regulation of surface MHC-I. Given that both EGFR and MEK are

involved in signaling via the MAP kinase pathway, these data validate the importance of

this pathway in regulating surface HLA-A and MHC-I.

Interferon-γ (IFNγ) is a well-known regulator of MHC-I via the JAK/STAT pathway

(28,29). We asked whether a combination of IFNγ with the kinase inhibitors would have

additive effects on HLA expression (Supplementary Fig. S5A, B, C). Both IFNγ and

afatinib (in EGFR mutant H1975 lung cancer cells), and IFNγ and trametinib (in Braf

mutant SK-MEL5 and UACC257 melanoma cells), alone, each increased expression of

cell surface HLA molecules, as measured by antibodies to HLA-A*02:01 or pan HLA-A,

B, C. The combination of the IFNγ and the drug had greater effects than either alone,

consistent with the involvement of two different pathways. PCR analysis of TAP1

showed that this internal component of the antigen presentation machinery was also

upregulated by IFNγ by 10 to 25 fold in all three cell lines. β2-Microglobulin was also

upregulated 4 to 7 fold with IFNγ treatment in all three lines. There were minimal

increases in these two proteins in response to the two kinase inhibitors in H1975 and





18

UACC257. However in SK-MEL5, trametinib increased both proteins alone and was

additive with interferon.

HLA-E is another component of the antigen presentation pathway that presents

MHC molecule–bound peptides and may be involved in downregulating NK cell immune

responses to cancers (30). IFNγ and afatinib (in EGFR mutant lung cancer cells) did not

affect HLA-E levels (Supplementary Fig. S5D). Trametinib, in Braf mutant SK-MEL5

melanoma cells, increased cell surface HLA-E molecules, but did not do so in UACC257

cells. IFNγ also variably upregulated HLA-E in the two melanoma lines, and the

combination of drugs was more effective in increasing HLA-E in UACC257 cells

(Supplementary Fig. S5E and F). Although an upregulation of HLA-E might be

expected to partially counter the effects of upregulation of classic MHC seen in these

cells, the net effect was to improve cytolytic activity.

Improving immunotherapy by inhibiting MAPK pathway We next tested the effects of modulating HLA-A*02:01 expression on the efficacy of

immunotherapies that depend on HLA-A*02:01 upregulation and antigen presentation,

by use of pmel-1 T cells expressing a TCR that reacts with gp100 and use of two

different TCR mimic antibodies whose function also depend on peptide/MHC-I

expression. The TCR mimic antibody ESKM, which targets a peptide from WT1 in the

context of HLA-A*02:01, and Pr20m, which targets a peptide from PRAME, were used

as easily quantifiable surrogate tools for measuring the potential therapeutic

consequences of upregulation of HLA-A*02:01-based antigen targets as a consequence

of MEK inhibition. The cytotoxicity of ESKM against the JMN and Meso34 human

mesothelioma cell lines were increased by MEK inhibition with trametinib (Fig. 3A and





19

B), which was used at a non-cytotoxic dose (Supplementary Fig. S6). Increased

cytotoxicity of the Pr20m mAb was also observed with use of the MEKi trametinib in the

SK-MEL-5 human melanoma cell line, validating this observation with multiple targets in

multiple cell lines (Fig. 3C).

Finally, specific killing by T cells increased after upregulatingMHC-I with MEKi.

The pmel-1 gp100-specific mouse T cells were more effective at killing of the gp100

positive target B16F10 melanoma cells following trametinib treatment, which correlated

with pERK inhibition and MHC-I upregulation (Fig. 3D, E, and F) (31). Therefore,

improved recognition as a result of the increased expression of MHC-I and its presented

peptides using three different target antigens by TCR or TCR mimics had significant

consequences for cytotoxic activity.

Mechanism of MAPK regulation of MHC-I We hypothesized that the inhibition of the MAP kinase pathway might act on

other components of the antigen presentation machinery in addition to MHC-I

molecules, thus allowing increased epitope expression in the more abundant cell

surface HLA molecules. Indeed, EGFR and MEK inhibition produced an increase in

mRNA gene expression of HLA-A along with other key components of the antigen

presentation pathway and MHC-I structure, such as TAP1, TAP2, and β2M, (Fig. 4A).

The JMN and Meso34 cells at t = 1 h were sensitive to trametinib at doses less than 10

nM as previously reported, but required higher doses to sustain inhibition of pERK at t =

72 h due to strong feedback (Supplementary Fig. S7A vs B). Doses of trametinib were

chosen over the IC50 of MEK by using pERK as a readout of MEK inhibition at 72 h





20

(Supplementary Fig. S7B and C). These data correlated with previous findings that

BRAF mutant cell lines are the most sensitive to MEK inhibition, when compared to

BRAF wild-type cell lines harboring further upstream mutations (32). A time course

showed maximal inhibition of MEK at 3 h, with maximal increases of HLA-A and β2M at

72 h (Supplementary Fig. S8). Surface HLA-A increased in a dose dependent manner

with increasing MEK inhibition in both melanoma and mesothelioma (Fig. 4B). The

phenotypes observed are unlikely from off-target effects of the drug, given the dose

response on pERK expression and the plateau of the dose response of surface HLA-A.

Antibodies against pERK, along with total ERK1/2, were used to show dose-

responsive increases in response to trametinib inversely correlated with HLA-A protein

expression. The increase of β2M much greater than that of HLA complexes in multiple

cell lines, consistent with the gene expression data (Fig. 4C). EGFRi with erlotinib also

caused a dose-dependent increase in HLA-A and β2M (Fig. 4D). Because β2M is

required for surface presentation of HLA, A,B, C and stability of the MHC-I molecules on

the cell surface, we investigated the potential role of β2M in controlling cell surface HLA-

A expression. Overexpression of β2M increased cell surface HLA-A and pan HLA-ABC,

phenocopying the effect of MEK inhibition (Fig. 4E), which was regulated by multiple

regulatory domains in the promoter region, including the ISRE site, E box, and NF-κB

sites. Using a luciferase-based promoter assay, we demonstrated that upon addition of

MEKi, a dose-dependent increase in activity on the HLA-A and B2M promoters was

observed (Fig. 4F). Knockdowns of STAT1, STAT3, and RelA (a component of NF-κB

complex) were performed on JMN cells, along with treatment with MEKi. STAT1





21

knockdown had the largest inhibition of upregulation of surface HLA-A after MEKi,

suggesting a role for STAT1 in responses to MEKi (Fig. 4G).

MAPK activation causes in vivo suppression of MHC-I and increased PD-1/L1 We confirmed that these observations on MHC regulation and antigen

presentation machinery were not limited to in vitro models. Microarray profiling of the

lung bearing tumors from transgenic EGFR L858R, which activates the MAPK pathway,

compared to normal lungs, demonstrated suppression of mouse MHC-I and antigen

presentation components H2-K/D, and β2M, thereby confirming the effects of this

pathway in vivo (Fig. 5A) (19). Upregulation of PD-1 and PD-L1 markers in the tumors

was also observed as previously published (20).

Expression of EGFR L858R in the transgenic mice, given doxycycline for > 6 wk,

was demonstrated by increased binding of a human EGFR-specific fluorescently

labeled mAb (Fig. 5B). Mice were confirmed to have development of lung

adenocarcinoma by MR, with development of a reticulonodular infiltrate in the lung,

consist with previous publications (18). The CD45–hEGFR+ population in the lung in the

EGFR L858R–expressing mice demonstrated decreased binding of a MHC-I–specific

mAb by flow cytometry, when compared to a wild-type mouse which did not express the

EGFR L858R mutation (Fig. 5C).

Discussion Immunotherapy of cancer is emerging as a successful and important component

of treatment. MHC molecules presenting antigens are the target of multiple therapeutic

strategies that involve vaccines, T cells or TCRs, TCR mimic antibodies, or T cell

checkpoint blockade. The latter, a highly effective recent example in cancer therapy,





22

appears to require presentation of neoantigens on MHC-I on the surface of cancer cells

(33–35). Most immunotherapies have focused on enhancing intrinsic effector cell

mechanisms for modulating the immune response, either by directly activating the

effector T cells or by relieving their suppression. In distinct contrast, here we propose an

alternative approach, whereby the antigenic targets on the cancer cells themselves are

modulated to improve TCR-based killing. The ability to regulate such responses by

selectively affecting target cells could have an important impact on both disease and

therapy. We propose that kinases are a readily druggable pathway that might be used in

conjunction with immunotherapy to enhance efficacy. The beneficial effect of the

combination of immunotherapy with kinase inhibition was shown in mouse models of

combined PD-1/PD-L1 blockade with MEKi (36). A second model, of adoptive T cell

therapy in combination with MEKi in BRAF mutant murine melanoma, has demonstrated

superiority to single agents alone (37). Our work has provided a new understanding of

another mechanism why these combination therapies may be more effective, wherein

upregulated MHC-I and antigen presentation on the target cells, essential for the

adaptive immune response, improves TCR-based recognition and killing. Indeed, many

of the patients treated currently with immunotherapies also receive kinase inhibitor

therapies as distinct treatments.

The loss- and gain-of-function screen described here allowed unbiased

interrogation of the currently annotated human kinases for their regulation of cell surface

MHC-I. We then explored mechanistically how such kinase regulators could be inhibited

for altering surface expression of MHC-I, as a way of validating the screen,

understanding the process, and also for extending the findings to functional modulation





23

of a model immunotherapy proof of concept that directly depends on MHC-I

presentation. In this case, we were able to specifically isolate the MHC as the sole

target of the therapy by use of therapeutic TCR mimic antibodies directed to antigens

presented by MHC.

This study also provides support for the use of a flow cytometry–based loss-of-

function pooled shRNA screen in the study of the regulation of other cell surface

molecules, and potentially intracellular antigens as well. This technique will allow many

laboratories without robotics and high-throughput flow cytometry equipment to

investigate pathways that can be easily perturbed with loss-of-function RNAi screens or

other techniques, such as CRISPR loss-of-function.

Here we have demonstrated the effect of the MAPK pathway on MHC-I, in vitro

and in vivo. However, therapeutic applications in humans of the combination of

available immunotherapies and pharmacologic kinase inhibition, to increase MHC-I

surface expression and antigen presentation, will be complicated and difficult to predict,

because T cells and NK cells also rely on similar kinase signaling pathways for

activation. More work needs to be done to determine optimal pathways or schedules or

doses to target MHC in tumor cells specifically, while sparing signaling pathways of the

effector cells (38). Some studies suggest conflicting effects of MEKi on T cell effector

function, which may be dependent on the tumor model evaluated (39,40). These effects

cannot be simply modeled in mice. Empirically derived optimal dosing and schedules

will be needed in in vivo models and in humans to show that use of kinase inhibition to

regulate immunotherapy has therapeutic benefits while sparing immune effector cells of

the detrimental effects (40–42). These investigations will be complicated by the effects





24

of some of the drugs on the cellular effectors themselves, the variable effects on the

cancer cells depending on their specific mutations, the time frames required to

upregulate the responses (about 3 days in the experiments here) and the time required

for the effects to wash out of the cancer cells and the effectors.

The data provide a mechanistic explanation of how MHC-I is regulated by the

MAPK pathway. MHC-I mRNA expression is regulated through upstream enhancer

elements, with involvement of the NF-κB transcription factor (43,44). MHC-I is also

induced by TNF, IL1, IFNβ, and IFNγ, which upregulates HLA-A via the JAK/STAT

pathway (28,29). The CIITA transcription factor can also act on MHC-I gene expression

(45). IFNγ can increase MHC-I and antigen presentation, but thus far its use has had

limited applications (46). We show here that combining the kinase inhibitors with IFNγ

in vitro can have additive effects on HLA expression, TAP1, and β2M. This may be of

benefit in vivo as IFNγ may be elaborated locally at tumor sites from tumor infiltrating

lymphocytes at steady state or in response to other immunotherapies, such as check

point blockade.

MEK has been proposed by others to be a regulator of MHC-I expression. EGFR

inhibition can augment MHC-I and MHC-II expression in keratinocytes (47). MEK was

previously identified as a negative regulator of HLA-A*02:01 in esophageal and gastric

cancer by Mimura et al. (48). We validated these targets in the screen as important

negative regulators of MHC-I and discovered a mechanistic role of the MAP kinase

pathway in regulating surface levels of MHC-I. Our data directly link to immune-

oncologic applications in humans, by demonstrating potent upregulation of MHC-I in a

wide variety of cancers, including melanoma and NSCLC, which are currently the





25

subject of FDA-approved therapies which depend upon on antigen presentation, such

as checkpoint blockade with mAbs ipilibumab, pembrolizumab, and nivolibumab. In

addition, by demonstrating that an FDA-approved MEKi upregulated MHC-I, the results

support the clinical testing of combination therapies, which could advance this concept

into human therapy. We characterized these effects on MHC-I in cells with activating

mutations in the MAP kinase pathway with various genotypic lesions, such as activating

EGFR mutations, BRAF mutations, and RAS mutations. Finally we also showed the

mechanism was active in RET-translocated thyroid cancer. The sum of these data

support the importance of MAPK pathway in regulating MHC-I quite broadly, while

providing new mechanistic insights.

Finally, our findings are immunologically significant. Upregulation induced by

MEK inhibition resulted in superior cytotoxic activity of TCR mimic antibodies (directed

to specific MHC presented antigens) and TCR-based therapy with a pmel-specific

murine T cell model. We further show, in a transgenically engineered mouse model in

vivo, that activating this pathway reduces expression of the components of the antigen

presentation machinery, along with MHC-I. This gain-of-function experiment is crucial to

proving that activation of MAPK can cause decreased MHC-I in vivo.

Activating EGFR mutations may contribute to immune escape, due to PD-L1

expression. Downregulation of MHC-I, which was observed from our study, may also

contribute to this finding (20). While demonstrating combination therapy with EGFRi and

checkpoint blockade would be rational, the transgenic EGFR mice have shown dramatic

tumor reduction and cures with EGFRi as monotherapy, leaving little window to show

synergism in currently existing mouse models with checkpoint blockade (18). Our data





26

also suggest that using combination therapy with MAP kinase inhibition can be

powerful, not only as a direct cancer therapy to prevent growth, but also indirectly to

promote immunotherapy.

HLA genes are a risk factor for autoimmune diseases such as ankolysing

spondylitis and multiple sclerosis (49–51). In addition to upregulation by certain kinases,

we showed downregulation of MHC-I through new kinase targets. These targets are not

currently addressed by immunosuppressive therapies, which inhibit the effector arm of

the immune response with concomitant toxicity. These new targets warrant additional

investigation into altering the course of autoimmune diseases by investigating the

efficacy of specific kinase inhibitors and developing appropriate mouse models.

A requirement of many immunotherapies therapies, particularly checkpoint

blockade, is the availability of recognizable antigens that are presented on MHC-I.

Tumors can decrease MHC-I expression, to avoid immune system detection of the rare

neoantigens created in tumors by mutations, and increase inhibitory receptor

expression. By modulating expression of these limited antigens, improved clinical

efficacy may be seen with certain immunotherapies in conjunction with current FDA-

approved small molecules targeting EGFR and MEK. The inhibition of kinase pathways

also caused a more general upregulation of the antigen presentation machinery,

including Tap (responsible for transporting peptides) and β2M (responsible for stabilizing

MHC-I). Many of the recently approved immunotherapies, such as blockade of CTLA-4

or PD-1, release the T cell inhibition promoted by target tumor cells. These

immunotherapies provide a promising approach to addressing multiple malignancies. By





27

rationally combining them with targeted small molecule inhibitors, novel synergistic

treatment strategies may be developed.

Acknowledgments: We thank T. Dao, L. Dubrovsky, D. Pankov, P Lito, D. Solit, E. Pamer, R. Brentjens, M. Will, A. Lujambia and A. Scott for their helpful discussions. We thank Y. Li and A. Younes for use of their equipment.





28

References: 1. Agrawal S, Kishore MC. MHC Class I Gene Expression and Regulation. J

Hematother Stem Cell Res. 2000;9:795–812.

2. Morgan RA, Dudley ME, Wunderlich JR, Hughes MS, Yang JC, Sherry RM, et al.

Cancer regression in patients after transfer of genetically engineered

lymphocytes. Science. 2006;314:126–9.

3. Dao T, Yan S, Veomett N, Pankov D, Zhou L, Korontsvit T, et al. Targeting the

intracellular WT1 oncogene product with a therapeutic human antibody. Sci Transl

Med. 2013;5:176ra33.

4. Yee C, Thompson JA, Byrd D, Riddell SR, Roche P, Celis E, et al. Adoptive T cell

therapy using antigen-specific CD8+ T cell clones for the treatment of patients

with metastatic melanoma: In vivo persistence, migration, and antitumor effect of

transferred T cells. Proc Natl Acad Sci. 2002;99:16168–73.

5. Chapuis AG, Ragnarsson GB, Nguyen HN, Chaney CN, Pufnock JS, Schmitt TM,

et al. Transferred WT1-reactive CD8+ T cells can mediate antileukemic activity

and persist in post-transplant patients. Sci Transl Med. 2013;5:174ra27.

6. Pardoll DM. The blockade of immune checkpoints in cancer immunotherapy. Nat

Rev Cancer. 2012;12:252–64.

7. Mellman I, Coukos G, Dranoff G. Cancer immunotherapy comes of age. Nature.

Nature Publishing Group; 2011;480:480–9.

8. Adams JL, Smothers J, Srinivasan R, Hoos A. Big opportunities for small

molecules in immuno-oncology. Nat Rev Drug Discov. Nature Publishing Group;

2015;14:603–22.

9. Chiappinelli KB, Zahnow CA, Ahuja N, Baylin SB. Combining Epigenetic and





29

Immunotherapy to Combat Cancer. Cancer Res. 2016;1683–90.

10. Campoli M, Ferrone S. HLA antigen changes in malignant cells: epigenetic

mechanisms and biologic significance. Oncogene. 2008;27:5869–85.

11. Leone P, Shin E-C, Perosa F, Vacca A, Dammacco F, Racanelli V. MHC Class I

Antigen Processing and Presenting Machinery: Organization, Function, and

Defects in Tumor Cells. JNCI J Natl Cancer Inst. 2013;105:1172–87.

12. Kageshita T, Hirai S, Ono T, Hicklin DJ, Ferrone S. Down-Regulation of HLA

Class I Antigen-Processing Molecules in Malignant Melanoma. Am J Pathol.

1999;154:745–54.

13. Paul P, Van Den Hoorn T, Jongsma MLM, Bakker MJ, Hengeveld R, Janssen L,

et al. A Genome-wide Multidimensional RNAi Screen Reveals Pathways

Controlling MHC Class II Antigen Presentation. Cell. Elsevier Inc.; 2011;145:268–

83.

14. Calabrò L, Morra A, Fonsatti E, Cutaia O, Amato G, Giannarelli D, et al.

Tremelimumab for patients with chemotherapy-resistant advanced malignant

mesothelioma: an open-label, single-arm, phase 2 trial. Lancet Oncol. Elsevier;

2013;14:1104–11.

15. Veomett N, Dao T, Liu H, Xiang J, Pankov D, Dubrovsky L, et al. Therapeutic

Efficacy of an Fc-Enhanced TCR-like Antibody to the Intracellular WT1

Oncoprotein. Clin Cancer Res. 2014;20:4036–46.

16. Zuber J, McJunkin K, Fellmann C, Dow LE, Taylor MJ, Hannon GJ, et al. Toolkit

for evaluating genes required for proliferation and survival using tetracycline-

regulated RNAi. Nat Biotechnol. Nature Publishing Group, a division of Macmillan





30

Publishers Limited. All Rights Reserved.; 2011;29:79–83.

17. Fellmann C, Hoffmann T, Sridhar V, Hopfgartner B, Muhar M, Roth M, et al. An

Optimized microRNA Backbone for Effective Single-Copy RNAi. Cell Rep.

2013;5:1704–13.

18. Politi K, Zakowski MF, Fan P-D, Schonfeld EA, Pao W, Varmus HE. Lung

adenocarcinomas induced in mice by mutant EGF receptors found in human lung

cancers respond to a tyrosine kinase inhibitor or to down-regulation of the

receptors. Genes Dev. 2006;20:1496–510.

19. Regales L, Gong Y, Shen R, de Stanchina E, Vivanco I, Goel A, et al. Dual

targeting of EGFR can overcome a major drug resistance mutation in mouse

models of EGFR mutant lung cancer. J Clin Invest. American Society for Clinical

Investigation; 2009;119:3000–10.

20. Akbay EA, Koyama S, Carretero J, Altabef A, Tchaicha JH, Christensen CL, et al.

Activation of the PD-1 Pathway Contributes to Immune Escape in EGFR-Driven

Lung Tumors. Cancer Discov. 2013;3:1355–63.

21. Rivoltini L, Barracchini KC, Viggiano V, Kawakami Y, Smith A, Mixon A, et al.

Quantitative correlation between HLA class I allele expression and recognition of

melanoma cells by antigen-specific cytotoxic T lymphocytes. Cancer Res.

1995;55:3149–57.

22. Dao T, Yan S, Veomett N, Pankov D, Zhou L, Korontsvit T, et al. Targeting the

Intracellular WT1 Oncogene Product with a Therapeutic Human Antibody. Sci

Transl Med. 2013;5:176ra33-176ra33.

23. Flaherty KT, Robert C, Hersey P, Nathan P, Garbe C, Milhem M, et al. Improved





31

Survival with MEK Inhibition in BRAF-Mutated Melanoma. N Engl J Med.

2012;367:107–14.

24. Brevet M, Shimizu S, Bott MJ, Shukla N, Zhou Q, Olshen AB, et al. Coactivation

of Receptor Tyrosine Kinases in Malignant Mesothelioma as a Rationale for

Combination Targeted Therapy: J Thorac Oncol. 2011;6:864–74.

25. Chang, Aaron, Dao, Tao, Scott, Andrew, Dubrovsky, Leonid, Liu, Cheng,

Scheinberg D. A Therapeutic TCR Mimic Monoclonal Antibody for Intracellular

PRAME Protein in Leukemias. Am Soc Hematol. 2015.

26. Krug LM, Dao T, Brown AB, Maslak P, Travis W, Bekele S, et al. WT1 peptide

vaccinations induce CD4 and CD8 T cell immune responses in patients with

mesothelioma and non-small cell lung cancer. Cancer Immunol Immunother.

2010;59:1467–79.

27. Cross DAE, Ashton SE, Ghiorghiu S, Eberlein C, Nebhan CA, Spitzler PJ, et al.

AZD9291, an irreversible EGFR TKI, overcomes T790M-mediated resistance to

EGFR inhibitors in lung cancer. Cancer Discov. American Association for Cancer

Research; 2014;4:1046–61.

28. Girdlestone J, Isamat M, Gewert D, Milstein C. Transcriptional regulation of HLA-

A and -B: differential binding of members of the Rel and IRF families of

transcription factors. Proc Natl Acad Sci U S A. 1993;90:11568–72.

29. Wolchok JD, Vilček J. Induction of HLA class I mRNA by cytokines in human

fibroblasts: comparison of TNF, IL-1 and IFN-β. Cytokine. 1992;4:520–7.

30. Kochan G, Escors D, Breckpot K, Guerrero-Setas D. Role of non-classical MHC

class I molecules in cancer immunosuppression. Oncoimmunology.





32

2013;2:e26491.

31. Budhu S, Loike JD, Pandolfi A, Han S, Catalano G, Constantinescu A, et al. CD8+

T cell concentration determines their efficiency in killing cognate antigen-

expressing syngeneic mammalian cells in vitro and in mouse tissues. J Exp Med.

2010;207:223–35.

32. Solit DB, Garraway LA, Pratilas CA, Sawai A, Getz G, Basso A, et al. BRAF

mutation predicts sensitivity to MEK inhibition. Nature. 2006;439:358–62.

33. Rizvi NA, Hellmann MD, Snyder A, Kvistborg P, Makarov V, Havel JJ, et al.

Mutational landscape determines sensitivity to PD-1 blockade in non-small cell

lung cancer. Science (80- ). American Association for the Advancement of

Science; 2015;348:124–8.

34. Snyder A, Makarov V, Merghoub T, Yuan J, Zaretsky JM, Desrichard A, et al.

Genetic Basis for Clinical Response to CTLA-4 Blockade in Melanoma. N Engl J

Med. 2014;371:2189–99.

35. Van Allen EM, Miao D, Schilling B, Shukla SA, Blank C, Zimmer L, et al. Genomic

correlates of response to CTLA4 blockade in metastatic melanoma. Science (80-

). American Association for the Advancement of Science; 2015;350:207–11.

36. Liu L, Mayes PA, Eastman S, Shi H, Yadavilli S, Zhang T, et al. The BRAF and

MEK Inhibitors Dabrafenib and Trametinib: Effects on Immune Function and in

Combination with Immunomodulatory Antibodies Targeting PD1, PD-L1 and

CTLA-4. Clin Cancer Res. 2015;

37. Hu-Lieskovan S, Mok S, Homet Moreno B, Tsoi J, Robert L, Goedert L, et al.

Improved antitumor activity of immunotherapy with BRAF and MEK inhibitors in





33

BRAF(V600E) melanoma. Sci Transl Med. 2015;7:279ra41.

38. Kortum RL, Rouquette-Jazdanian AK, Samelson LE. Ras and extracellular signal-

regulated kinase signaling in thymocytes and T cells. Trends Immunol.

2013;34:259–68.

39. Ebert PJR, Cheung J, Yang Y, Kim JM, Belvin M, Mellman I, et al. Article MAP

Kinase Inhibition Promotes T Cell and Anti- tumor Activity in Combination with

PD-L1 MAP Kinase Inhibition Promotes T Cell and Anti-tumor Activity in

Combination with PD-L1 Checkpoint Blockade. Immunity. Elsevier Inc.; 2016;1–

13.

40. Vella LJ, Pasam A, Dimopoulos N, Andrews M, Knights A, Puaux A-L, et al. MEK

inhibition, alone or in combination with BRAF inhibition, affects multiple functions

of isolated normal human lymphocytes and dendritic cells. Cancer Immunol Res.

2014;canimm.0181.2013.

41. Callahan MK, Masters G, Pratilas CA, Ariyan C, Katz J, Kitano S, et al.

Paradoxical activation of T cells via augmented ERK signaling mediated by a RAF

inhibitor. Cancer Immunol Res. 2014;2:70–9.

42. Vella LJ, Andrews MC, Pasam A, Woods K, Behren A, Cebon JS. The kinase

inhibitors dabrafenib and trametinib affect isolated immune cell populations.

Oncoimmunology. 3:e946367.

43. Gobin SJP, Biesta P, Elsen PJ Van den. Regulation of human β2-microglobulin

transactivation in hematopoietic cells. Blood. 2003;101:3058–64.

44. Wolchok D, Goodman A. induction cells of NF-xB may be necessary but is not

sufficient for of H-2 antigens by TNF in J558L murine myeloma. Cytokines.





34

1994;55:7–12.

45. Gobin SJP, Peijnenburg A, Van Eggermond M, Van Zutphen M, Van Den Berg R,

Van Den Elsen PJ. The RFX complex is crucial for the constitutive and CIITA-

mediated transactivation of MHC class I and B2-microglobulin genes. Immunity.

1998;9:531–41.

46. Zaidi MR, Merlino G. The Two Faces of Interferon-γ in Cancer. Clin Cancer Res.

2011;17:6118–24.

47. Pollack BP, Sapkota B, Cartee T V. Epidermal Growth Factor Receptor Inhibition

Augments the Expression of MHC Class I and II Genes. Clin Cancer Res.

2011;17:4400–13.

48. Mimura K, Shiraishi K, Mueller A, Izawa S, Kua L-F, So J, et al. The MAPK

pathway is a predominant regulator of HLA-A expression in esophageal and

gastric cancer. J Immunol. 2013;191:6261–72.

49. Fogdell-Hahn A, Ligers A, Gronning M, Hillert J, Olerup O. Multiple sclerosis: a

modifying influence of HLA class I genes in an HLA class II associated

autoimmune disease. Tissue Antigens. 2000;55:140–8.

50. Brown MA, Kenna T, Wordsworth BP. Genetics of ankylosing spondylitis-insights

into pathogenesis. Nat Rev Rheumatol. 2016;12:81–91.

51. Caroline Robert, M.D and Thomas S. Kupper M. Inflammatory Skin Diseases, T

Cells, and Immune Surveillance — NEJM. N Engl J Med. 1999;341:1817–28.





35

Figure 1. Screen for kinase regulators of surface HLA. A. A TRMPV inducible shRNA

retroviral vector was used for transducing JMN (HLA-A*02:01 positive human

mesothelioma line). TRE is the Tet responsive element, which drives expression of the

fluorophore dsRed and the shRNA hairpin. The constitutive PGK promoter drives the

Venus fluorophore along with Neomycin resistance cassette. B. Western blot and flow

cytometry data showing knockdown of HLA-A using TRMPV retroviral system with a

positive control shRNA to HLA-A02. The shRen is a negative control shRNA designed

against the Renilla gene C. Schema depicting the workflow pipeline for the screen of

regulators of surface HLA-A. D. Waterfall plot showing distribution of shRNA constructs

against MAP2K1 and EGFR as log fold difference between BB7 high sorted population

and BB7 low sorted population. E. shRNA knockdown of MAP2K1 and EGFR in JMN

cells validates them as a negative regulator of surface HLA-A. BB7.2 is a mAb specific

for HLA-A02. shRNA against Renilla was used as a negative control, whereas an

shRNA against HLA-A was used as a positive control. The screen was done in triplicate.

Inhibition experiments were performed at least twice with similar results, and data

shown are representative. Student’s t-test was done to compare each shRNA gene

knockdown MFI to the shRen control. (*≤0.05, **≤0.01, ***≤0.001, ****≤0.0001)

Figure 2. Use of selective EGFRi and MEKi increased cell surface HLA-A expression

and tumor antigen presentation, whereas activation of EGFR caused downregulation of

MHC-I. A. MEK inhibition and EGFR inhibition for 72 h with indicated inhibitors

increased HLA-A (BB7 binding) by flow cytometry in JMN, Meso34, PC-9, UACC257,

SK-MEL-5, SW480, and TPC1 cell lines. 1% DMSO was used as a vehicle control. B.





36

Binding of TCRm antibodies to peptide /MHC epitopes. In blue, use of ESK antibody to

a peptide derived from the oncoprotein WT1 that is presented on HLA-A0201. Binding

increased after inhibition of EGFR and MEK for 72 h in JMN, Meso34, and TPC1. In

red, the PRAME TCRm antibody to an epitope of PRAME tumor antigen presented on

HLA-A0201 on SKMEL5 cells. Experimental setup was similar to A. C. Treatment of

JMN with 10 nM EGF for 72 h, causing activation of the downstream MAPK pathway,

led to decreased surface HLA-A and total HLA-ABC. D. Use of EGFRi erlotinib, along

with MEKi trametinib, on H827 (EGFR E746del-A750 mutation), H1975 (L858R/T790M),

H1299 (EGFR wt, NRAS Q61K), and A549 (EGFR wt/KRAS G12S) to alter surface

HLA-ABC expression. Student t-test was done to compare each treatment to vehicle

control. *P values annotated as in figure 1. E. Western blot analysis showing degree of

inhibition of the MAP kinase pathway on a panel of NSCLC cell lines using 1% DMSO

(D), 100 nM erlotinib (E), 100 nM afatinib (A), or 500 nM trametinib (T). F. H1299 cells

were transduced with retroviral vectors expressing EGFR L858R and were analyzed for

surface pan HLA-ABC using W6/32. Activation of EGFR is demonstrated by western

blot G. EGFR inhibition upregulated surface HLA-ABC more than MEKi, despite

equivalent inhibition of pERK output. H. EGFRi upregulated MHC-I despite downstream

mutations causing constitutive MAPK activation. The NRAS Q61K mutation was

introduced into H827 and cells were treated with EGFRi or MEKi as done in 2G.

Experiments were performed 2-4 times with similar results, and data shown are

representative.





37

Figure 3. Improving cytolysis efficacy by up-regulating cell surface MHC-I.

A. Antibody dependent cellular cytotoxicity assay was performed on JMN human

mesothelioma cell line. Cells were incubated for 72 h with either vehicle control or

trametinib and subsequently exposed to either isotype antibody or ESKM in ADCC

assay B. ADCC assay on Meso34 (human mesothelioma). Experimental setup was

similar to 3A. C. ADCC assay on SKMEL5 (human melanoma) using TCRm mAb

PRAME against the PRAME epitope, experimental setup similar to 3A. D. B16F10 cells

were exposed to pmel-1 (gp100)–specific TCR T cells for 24 h, then killing was

assessed using a clonogenic assay described previously. E. B16F10 pERK protein, as

measured by pERK intracellular staining, in cells treated with vehicle or 1 μM trametinib.

F. B16F10 MHC-I expression assessed by flow cytometry after treatment with 1 μM

trametinib for 72 h. Experiments were performed 2-4 times with similar results, and data

shown are representative.

Figure 4. MAPK signaling suppresses antigen presentation machinery and MAPK

inhibition broadly up-regulates antigen presentation machinery. A. MEK and EGFR

inhibition for 48 h led to increased HLA-A, along with TAP1, TAP2, and β2M in JMN,

Meso34, SK-MEL-5 and UACC257, H827, and PC9 B. Dose dependent increase in

surface HLA-A with increasing MEKi in JMN and SKMEL5. Cells were analyzed by flow

cytometry at 72 h C. MEK inhibition leads to increasing amounts of HLA-A and β2M

protein. Cells were treated with indicating amounts of trametinib (MEKi) for 72 h and

specific antibodies to the indicated proteins were blotted. D. EGFR inhibition led to





38

increasing HLA-A and β2M protein. Experimental setup similar to Fig 4C. E.

Overexpression of β2M led to increased surface HLA-A and HLA-ABC. F. Treatment of

JMN with trametinib for 72 h led to increased activity on the HLA-A and B2M promoters.

The HLA-A and B2M promoter was cloned upstream of the Gaussian Luciferase gene.

SEAP under the CMV promoter was used as a normalization factor. G. Knockdown of

STAT1, on JMN cells treated with MEKi demonstrates role in mediating surface HLA-A

up-regulation. JMN cells were transfected with siRNA against the genes shown and

treated with either DMSO or 1 μM trametinib 24 h after siRNA transfection, then

assayed by flow cytometry for surface HLA-A expression 72 h after treatment.

Experiments were performed 2-4 times with similar results, and data shown are

representative.

Figure 5. Activation of MAPK pathway via activating EGFR mutations causes in vivo

suppression of MHC-I in addition to upregulation of checkpoint blockade. A.

Unsupervised hierarchical clustering microarray expression profiling analysis of lung

tumors from CC10/L858R mice with EGFR L858R tumor bearing lungs (right side,

black) or normal lungs (left side, green) focusing on H2-KD, B2M, TAP1, TAP2, PD-

L1(PDCD1), and PD-1 (CD274) gene expression. B. Flow cytometry data of FVB CC10-

rtTA/TetO EGFR L858R expressing mice. Mice were induced with doxycycline for >6

weeks before sacrificed (mice E-G). Control mice were kept on normal diet, but

genotypically identical (A-D). Lungs were isolated and stained with markers for CD45

(pan leukocyte), hEGFR, and H2-Kq (MHC-I). C. The CD45- lung population was

stained with mouse H2-kq specific mAb. CD45–hEGR– population shows higher MHC-I





39

expression than CD45–hEGFR+ population. Representative MRI images of mouse lungs

are shown for two samples.



















Published OnlineFirst September 28, 2016.Cancer Immunol Res Elliott J Brea, Claire Y Oh, Eusebio Manchado, et al. on Cancer CellsKinase regulation of Human MHC Class I Molecule Expression

Updated version

10.1158/2326-6066.CIR-16-0177doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerimmunolres.aacrjournals.org/content/suppl/2016/09/28/2326-6066.CIR-16-0177.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerimmunolres.aacrjournals.org/content/early/2016/09/28/2326-6066.CIR-16-0177To request permission to re-use all or part of this article, use this link



http://cancerimmunolres.aacrjournals.org/lookup/doi/10.1158/2326-6066.CIR-16-0177

http://cancerimmunolres.aacrjournals.org/content/suppl/2016/09/28/2326-6066.CIR-16-0177.DC1

http://cancerimmunolres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerimmunolres.aacrjournals.org/content/early/2016/09/28/2326-6066.CIR-16-0177


Documents

Kinase regulation of MHC-I in tumors Brea et. alcancerimmunolres.aacrjournals.org/content/canimm/early/2016/09/28/2326... · Kinase regulation of MHC-I in tumors Brea et. al Kinase