Positive Negative Patient A Patient BControl Control

Name: ________________________________

Date: ____________________Period: ______

Unit 1 MI: How to Fight Infection Test Review Guide: 6.25 pts Extra Credit on Summative Category—Due Thursday 10.29.15

1.1: The Mystery Infection1. What are medical interventions? What are categories of medical interventions?

2. Describe the ELISA results shown.

3. When treating this outbreak a pharmacist is asked to fill a prescription for an antibiotic medication and performs a serial dilution. She places 25 ml of the antibiotic and 100 ml of saline in a mortar and blends the mixture. This is Sample A. She then transfers 50 ml of this dilution into another container with 100 ml of saline; this mixture is Sample B. Lastly, she transfers 75 ml of this dilution into a container with 100 ml of saline; this mixture is Sample C. Using spectrophotometry, she determined the concentration of Sample C is 5 x 10-3 g/mL.

a. Draw a diagram of the serial dilution she performed. What are the tube dilution, final dilution, and antibiotic concentration for Sample A, B, and C?

4. Create the resulting DNA gel, horizontal chromatogram, and vertical chromatogram given the following sequence and the left primer: CTGG and right primer: GGT. GATCTGGAGATTAGTGGAGGTCATGGACC

1.2: Antibiotic Treatment5. Draw and label a bacterial cell with the appropriate structures.

This review guide does not review every concept on your test!

6. What are two reasons why gram-negative bacteria are different than gram-positive bacteria?

7. How is a zone of inhibition test conducted? Based on the figure, the bacterium is most susceptible to which antibiotic?

8. Describe the three methods of horizontal gene transfer.

1.3: The Aftermath—Hearing Loss9. Label the diagram, then explain the path of sound from generation to perception.

10. Based on the audiogram provided, what is an appropriate prognosis and medical intervention for the patient?

1.4: Vaccination11. How do vaccines activate the human immune system?

12. Why are restriction enzymes and ligase important in making recombinant DNA vaccines?

13. An epidemiologist wants to perform a study to determine if exposure to CT scans causes an increased incidence of cancer. The individuals chosen for the study are people who have been exposed to CT scans and people who have not been exposed to CT scans. What type of study will be performed – a case control or a cohort? Explain your answer.

Unit 1 MI: How to Fight Infection Test Study Guide—Test Friday October 30 th , 2015 (37 MC, 2 of 3 Short Answer) What is a medical intervention? What are the main categories of interventions that function to maintain human health? (1 MC) How do scientists gather evidence during the potential outbreak of an infectious disease? (1 MC) What is the goal of PCR? What are the steps involved in PCR? (1 MC) How is DNA sequenced? Create/interpret a horizontal/vertical chromatogram and gel DNA profile. (1 MC) How can DNA sequences be used to identify disease pathogens? (1 MC) How can the ELISA be used to detect disease? What is the procedure of an ELISA? What is a negative/positive result? (1 MC) Calculate TD, FD, serial dilutions, dilutions, and the concentrations of diluent samples and stock solutions? (1 MC, Short Answer) Why is it important for doctors to know the concentration of disease antigen present in a patient’s system? (1 MC) What steps do scientists take to diagnose, treat, and prevent future spread of a disease outbreak? (1 MC) What is the anatomy and physiology of a bacterial cell? (1 MC) How are gram-positive bacteria different from gram-negative bacteria? (1 MC) What are the four types of antibiotics we discussed? How does each class of antibiotics work to fight bacterial infections? (1 MC) What is a zone of inhibition test? What does the test show? (1 MC) What is antibiotic resistance? How can you tell if a bacterium is resistant or susceptible? (1 MC) How does antibiotic resistance occur? What methods do bacteria use to share antibiotic resistant genes? (3 MC) What methods confer antibiotic resistance? (1 MC) Why should antibiotics be taken as prescribed? (1 MC) What is the anatomy and physiology of the human ear? (2 MC) What is the path of sound from generation to perception in the brain? (1 MC) How do frequency and amplitude affect how humans interpret sound? (1 MC) What are the types of hearing loss? What causes the types of hearing loss? What medical intervention is appropriate? (2 MC) What is a rinne test? What is a sound-in noise test? What can the results show? (1 MC) Diagnose a patient with the appropriate type of hearing loss and suggest a medication intervention. (1 MC, Short Answer) What is immunity? What is passive immunity and active immunity? How is each established? (1 MC) What are vaccines? How do vaccines activate the human immune system? How does an antibody relate to an antigen? (1 MC) What are the different types of vaccines? (1 MC) How has vaccination impacted disease trends in our country? (1 MC) What is attack rate? How is it calculated? What conclusions can be made given attack rates? (1 MC) What is the function of ligase and restriction enzymes? How can these be used to produce vaccines? (1 MC What is recombinant DNA technology? How does this relate to plasmids, ligase, restriction enzymes, vectors, bacterial cells, and

genetic engineering? (2 MC, Short Answer) How can engineered plasmids be inserted into bacterial cells? (1 MC) What is a case control study? What is a cohort study? Determine if a study is case control or cohort. (1 MC)

*Time will be the limiting factor of the test, you need to be able to solve problems quickly – or move on and then come back*

or virus

Perform extraction and purification to create the recombinant DNA vaccine using the altered plasmid with the pathogen antigen.

Inject a healthy patient with the recombinant DNA vaccine – active

immunity