Just For Canadian Dentists 2013-09 September October

inside: Continuing dental eduCation CalendarPublications Mail agreeMent #41073506

life+leisure

sePt

eMbe

r/

oc

tobe

r 2

013

where will you meet? puerto rico / big sky / winnipeg / rosarito / kauai >>

+ 50 years of PORSCHE + CORVETTE

+ essential baR TOOlS

+ the gourmet SaNDWICH

+ starting VS buying a practice

win a visa gift card or $1,000 in CE gift certificates! PagE 45

for rIoready

by raIlbc

September/october 2013 Just For canadian dentists 3

Shofu Dentalfull page IFC ad FeatureS

17 riding the rails From BC to Alberta by train

36 ready for Rio This iconic city is everything one imagines —and so much more

ColuMnS

8 photo prescription Take it slow

12 motoring 50 years strong: Porsche 911 and Corvette

14 pay it forward In Guatemala and Haiti with

Dr. Jack Cottrell

27 the wealthy dentist Starting vs buying a practice

42 the hungry dentist Take your sandwich to the next level

43 the thirsty dentist Essential bar tools

SepteMber/oCtober 2013 ContentS

departMentS

5 September/October mix

21 CE calendar

45 sudoku

46 small talk with Dr. Kevin Aminzadeh

ClO

CK

wIS

E FR

Om

TO

P lE

FT: B

. SlI

Gl

(2);

ROC

Ky

mO

un

TAIn

EER

dentistsJ u s t F o r c a n a d i a n

life + leisure

september/october 2013

publisher Linh t. Huynh

editor barb sligl

Art Direction bss creative

contributing editor Janet Gyenes

editorial Assistant Adam Flint

contributors Lucas Aykroyd timothy A. brown michael DeFreitas Dr. Holly Fong Janet Gyenes manfred purtzki Dr. Kelly silverthorn roberta staley Dr. Derek turner cover photo rocky mountaineer

senior Account executive monique Nguyen

Account executives Lily Yu Wing-Yee Kwong

production manager Ninh Hoang

circulation Fulfillment shereen Hoang

ce Development Adam Flint

sales, classifieds and Advertising In print circulation office 200 – 896 cambie street Vancouver, bc V6b 2p6 canada phone: 604-681-1811 Fax: 604-681-0456 email: [email protected]

Just For Canadian Dentists is published 6 times a year by Jamieson-Quinn Holdings Ltd. dba In print publications and distributed to canadian dentists. publication of advertisements and any opinions expressed do not constitute endorsement or assumption of liability for any claims made. the contents of this magazine are protected by copyright. None of the contents of the magazine may be reproduced without the written permission of In print publications.

In print publications200 – 896 cambie street Vancouver, bc V6b 2p6 canada

www.justforcanadiandentists.com

printed in canada.

want to reach us? check out our website!

cover photo Riding the rails from BC to Alberta is a journey back in time and through spectacular scenery like the Fraser Canyon, seen here. Story on page 17.

17 36

Self-leveling

Stackable

F00Zero Flow

F03Low Flow

Shofu Dental Corporation • San Marcos, CA

SN

BFP

-051

2

FFFFFFFFFFFFFFIIIIIIIIIIINNNNNNNNAAAAAAAAAAAALLLLLLLLLLLLLLLLLLLLLLLLYYYYYYYYYYY,, AAAAAAAAAAAAAAAANNNNNNNNNNNNNN IIINNNJJJJEEEEEECCCCCCCCCCCCCCCTTTTTTTTTTTTAAAAAAAAAAAAAAAABBBBBBBBBBBBLLLLLLLLLLLLLEEEEEEEEEEEEEE HHHHHHHHHHHHHHHYYYYYYYYYYYYYBBBBBBBBBRRRRRRRIIIIIIDDDDD RRRRRREESTTORAATTIIVVEEFFFFFFFFFFFFFFFFFFFFOOOOOOOOOORRRRRRRRRRRRR AAAAAAAAAALLLLLLLLLLLLLLLLLLLLLL IIIIIIIIIIIIIIINNNNNNNNNNNNNNNNNNNNDDDDDDDDDDDDDDDDDDDDIIIIIIIIIICCCCCCCCAAAAAAATTTTTTTTIIIOOOOOOOOOOONNNNNNNNNNNNNNSSSSSSSSSSSSS

Scan here for more information on

Giomer Technology& watch the Acid

Neutralization video.

NEW SHADES!B1, B2, C2 & D2

BEAUTIFIL Flow Plus is the next step in the evolution of restorative materials, combining the delivery of a fl owable and the strength, durability, and aesthetics equal to or better than leading hybrid composites.

Visit www.shofu.com or call 800.827.4638

• Indicated in classes I, II, III, IV & V

• Physical properties rival hybrids

• Stackable & sculptable; stays put

• Self-polishing “leveling-effect”

• High radiopacity, beyond enamel

JFCandianDentists BFP 8.13.indd 1 8/14/13 4:58 PM

September/october 2013 Just For canadian dentists 54 Just For canadian dentists September/october 2013

autumn adventure When September rolls by again,

it often feels like the start of a new year, especially for those

of us with school-age children, as our food columnist, Dr. Fong shares (page 42). But whether we have kids or not, we all remember our own student days when fall signalled the unwanted end of lazy summer days and the start of school days in the classroom instead of outside.

These deeply held memories always seem to give September a tinge of nostalgia and sense of a new beginning. It’s my favourite time of year. The glorious colours of deciduous trees (especially the fiery reds of maple trees in my childhood home of Ontario), the earthy scent of fallen leaves, the crisp chill in the air… It’s why I felt such a thrill to see the first tinges of

colour from the Rocky mountaineer train when I rode the rails last fall (page 17). It was like stepping back in time, both because of the historic nature of the journey itself (its tracks completed in 1885) and the nostalgic essence of the fall season.

If autumn (and the onslaught of colder weather!) isn’t your thing, well, the southern hemisphere is now gearing up for its spring and summer. now’s the time to go to Brazil. locals are hitting the beach and getting into full-on holiday mode—especially in Rio. Of course, it’s also a good time to beat the global crowds making their way to this legendary city for the 2014 FIFA world Cup. Oh, and the 2016 Summer Olympics…

Rio de Janeiro deserves all the hype. Besides its stunning natural beauty—surrounded by peaks and coves and

beaches—it’s making a profound effort to clean up its act before taking to the world stage. Visiting a revived favela is a lesson in gratitude and inspiration. And be prepared for overt friendliness—cariocas can’t help but share their happiness (page 36).

Keep the Brazilian theme going with caipirinhas—at home. Our drinks expert tells you how to stock your bar with go-to tools, just in time for settling back indoors and the entertaining season (page 43). And next issue, she gives us the goods on booze and glassware (yes, holiday mayhem is fast approaching).

we should all raise a glass to Dr. Cottrell, who spends his downtime travelling to places like Guatemala and Haiti to fight tooth decay in children without the means for proper dental care (page 14). we love hearing how dentists are making a difference, at home and aboard. let us know if you have a story to share!

Don’t forget to enter our two contests (page 45), and tell us what you’re up to this fall. we want to hear from you; let us know where in the world you’re travelling, photographing, volunteering, working…stay in touch through justforcanadiandentists.com. Enjoy!

[email protected]

f r o m t h e e d i t o r

Providing Dental C.E. Since 1996

ken_CDN_Dentist_ad_4.625x4.875_r1.indd 1 13-06-13 11:27 AM

m i x

B S

lig

l

STaIRWay TO HEaVEN?It certainly feels that way, 2,281m high on this boardwalk that hugs Sulphur Mountain in Banff National Park. Those with vertigo be warned…the 360-degree views of the surrounding Rockies (six mountain ranges!) and valleys are goosebump-inducing. It’s the type of vantage point usually only hardcore experienced alpinists get. And, yes, hardy souls can trek up (a worthy workout of 11km and 700m in elevation gain), but the easy route is to take the gondola (and enjoy yet another viewpoint of Bow Valley). Topside, it’s a short ramble along a rather luxe boardwalk to the summit of Sanson Peak. Here, you’ll find the Cosmic Ray Station (a UNESCO World Heritage Site) and Sanson’s Peak Meteorological Station. Go in the fall for pops of gold amidst the uncut swathe of evergreens—and more peaks than you’re likely to get in a single view anywhere else. Better yet, make it the culmination of a train ride across bC that brings you right into Banff and the threshold of these mountains (see page 17). —B. Sligl

Banff National Park, pc.gc.ca/pn-np/ab/banff/index.aspx; Banff, banfflakelouise.com; Banff Gondola, explorerockies.com/banff-gondola

w h a t / w h e n / w h e r e > S e p t e m b e r / o c t o b e rs t y l e | f o o d | s h o w s | f e s t i v a l s | p l a c e s | g e t a w a y s | g e a r …

trek with a view

Walk this “stairway

to heaven,” then stay just below on the lower slopes of

Sulphur Mountain at the Fairmont Banff

Springs…see page 6.

clockwise from top Scenes from the First Passage to

the West train tour with Rocky Mountaineer—from gourmet fare

to a Kamloops welcome crew (on horseback, no less) and just-turning

autumn colours in the Rockies. Story on page 17.

scenery & history

by rail

gO


m i x

FAR

lEFT

: B. S

lIG

l

S e p t e m b e r / o c t o b e r appetite app

*

castle in the rockies Set on the slopes of Sulphur Mountain, its towers and turrets rising up over the treetops, the

Fairmont Banff Springs has long been the icon of the mountain-surrounded town in Canada’s must-visit Banff National Park (a UNESCO World Heritage Site). The “Castle in the Rockies” is a relic of the railway’s heydey, when grand hotels modelled on French chateaux were luxuri-ous respites en route to the wild west. And that hasn’t changed—this is still the gold-standard stay for guests disembarking the Rocky Mountaineer train (see page 17). Here, it’s the best of both worlds: old-world glam (along with all the expected modern amenities and one very swish spa) on the doorstep of pristine wilderness (see page 5). —B. S. fairmont.com/banff-springs

room with a

stay

m i xindulge + escape

S e p t e m b e r / o c t o b e r

fall must-

list

yum

editor’spick

Through the looking glass

at the Fairmont Banff Springs.

high-

end,

mou

ntain

high

5

1 [taste] Petite Pleasures Purists may think that messing with real maple syrup is sacrilege, but the diminutive infusions by NOBLE are straight from gourmet heaven. The handcrafted syrups (sourced from Quebec and New Hampshire) are anointed with ingredients such as organic, fair-trade Egyptian chamomile blossoms and Tahitian vanilla beans, then aged in bourbon barrels. And since the bottles are so petite, they’re perfectly portable. Stash a couple of these 60ml beauties in your carry-on luggage and elevate those room service pancakes to decadent new heights. $26.95, 6/60 ml bottles; $28.95/450 ml bottle, mikuni.myshopify.com

5 [explore] City alternatives While there’s always “an app for that,” we love the tactile nature of a book for exploring a locale, especially Lomography’s quartet of alternative city guides. Covering London, Berlin, Hong Kong and Vienna, each book is composed of hundreds of analogue travel shots

captured by “Lomographers,” using the film cameras to reveal hidden spots and unusual treasures, accompanied by tips for exploring the city. Have a

hankering for American diner grub in London? Head to Fatboy’s Diner in the Docklands. Want to revel in the ‘80s? Sing a few lines of “Rock Me Amadeus,” in homage to Austrian singer Falco at his Berlin grave site.

$9.90 ea., lomography.ca

3 [gear] taskmaster When high-tech function and low-tech smarts culminate in a simply genius invention, an engineer is likely behind the scenes. That’s the scenario that led to the creation of TaskOne, a super-slim and lightweight iPhone case outfitted with 22 tools made of hardened steel. Strip wires or slice through steak? Tighten screws or crack open a bottle of beer? TaskOne has got you covered. And smart thinking: the 2.5cm knife blade is travel-friendly and removable so you can check it in your bag or leave it at home. $99.99, thetasklab.com

2 [dine] Chef’s table Can’t get a reservation at Chef Thomas Keller’s vaunted restaurant, the French Laundry? No time to stop in at Susur Lee’s eponymous Toronto watering hole en route to Paris? You can’t always squeeze in to your favourite chef’s restaurants, but you can find out what dining spots they recommend—and what dishes they’ve enjoyed—thanks to the new app, Chefs Feed. Follow more than 750 of the world’s best chefs in major cities from Austin to Vancouver and test out their top spots. You never know which celeb chef might be sitting at a table nearby. free, iTunes.com

4 [chill] sound ideas The array of in-ear headphones on the market can be confounding. Look no further than Scandinavian-design collective Urbanears, which mindfully marries sound performance with ergonomics. Medis is compactly constructed with an unmatchable EarClick solution (and four interchangeable ear pads in various sizes) that helps relieve pressure from the earpiece to maximize comfort while reducing outside noise. After all, neither Miles Davis nor Mumford and Sons need be interrupted. Add to that a microphone and remote to pick up calls or skip back to your fave song over and over… $59.99, bestbuy.ca

Perfect the art of escape with these excursion-friendly items sure to make your trip more tasty and trouble freewritten + produced by Janet Gyenes

3

4

1

2

8 Just For canadian dentists September/october 2013

Learn how to take it slow, really slow…Pops of orange cheese and red hats draw the eye as a still spot amidst the blur of movement surrounding on-the-go cheese carriers. Had this scene been “frozen,” the sense of urgency of the bustling market would have been lost amidst a distracting background. Here, blur is a good thing, accentuating the action. This effect is achieved with panning, as with the whitewater-rafting shot, which captures an eye-of-the-tornado feeling.

Send your photos and questions to our

photography guru at feedback@

inprintpublications.com and your shot may be featured in a future

issue!

p h o t o p r e S c r i p t i o n m i c h a e l d e f r e i ta S

Overcast skies and a big crowd greet me as I ready my

cameras at Holland’s world-famous Alkmaar cheese market. Rows of bright orange and yellow Edam and Gouda cheese rounds stretch across the cobblestone square. At the centre of the square, pairs of cheese carriers with bright red hats load Gouda rounds onto wooden sleds fitted with shoulder straps. After loading the rounds, the carriers pull the straps over their shoulders, hoist the sled and dash off to the weigh scales amid a sea of popping flashes.

most of the spectators probably shoot on “auto” so the camera’s computer automatically fires the flash to compensate for low light. In this case, the resulting images probably won’t convey motion well because flash tends to “freeze” action. In order to create an actual ac-tion shot you need to switch from auto mode to shutter priority.

with my flash turned off, I use a combina-tion of slower shutter speeds (between 1/10th and 1/30th seconds) and panning (following) to accentuate the cheese carriers in action. The slower shutter speed conveys action by recording the carriers’ pumping legs and arms as blurs while panning helps streak/blur the distracting background and keep their heads and red hats in fairly sharp focus.

using a slow shutter speed is one of the best ways to simulate action. Of course, “freeze” action shots taken at very fast shutter speeds like 1/550 to 1/1000 seconds (especially in sports) or with a flash are also effective techniques. Freezing a powwow dancer at the peak of a jump or a whitewater raft exploding through a wave will certainly produce great action shots, but motion blurring/streaking is a simple technique that adds drama.

At the 2011 Taos Pueblo Powwow in new mexico, I shot a young aboriginal male’s “grouse” dance at various shutter speeds (be-tween 1/500th and 1/15th seconds). Although all the photos look good, the one shot at 1/30th seconds is my favourite. I used the same technique to capture whitewater rafters on the Gallatin River in southwest montana near yellowstone national Park. Again, the slower version portrays more drama.

Other ideal opportunities for slow shutter

slow it down

Michael DeFreitas is an award-winning photographer who’s been published in a wide variety of travel publications. With his initials, MD, he’s been

nicknamed “doc,” making his photography prescriptions apropos.

Sometimes slow and steady wins the photography race

mIC

HA

El D

EFRE

ITA

S

Follow us on:

Stay up to date with the latest news, product announcements, special offers, articles, and more

Sign up for our newsletter – Digital Trends

Scan the QR code to register.

3Shape TRIOS® Impression-taking has never been easier

3Shape TRIOS® is the next-generation intraoral digital impression solu-tion. Easily create accurate digital impressions and send cases directly to the lab with a single click.

3Shape TRIOS® • Spray- and powder-free for optimal accuracy and patient comfort • Optimized Ultrafast Optical Sectioning software - now 40% faster• Wide range of indications, including implant abutment cases• Instant impression and occlusion validation and smart edit scan tool• Autoclaveable tip with anti-mist heater• Choose TRIOS Color or TRIOS Standard

TRIOS® Pod solution Use TRIOS® with your iPad, laptops, PC’s in your treatment rooms, or with the PCs integrated in your chair units.


speeds include waterfalls and streams in Hawaii, Vespa scoot-ers in Rome, chuckwagon races in BC or tuk-tuks in Bangkok. To accentuate motion for any moving subject you can use two slow-speed techniques: panning/following the subject as it moves or holding the camera steady while allowing the subject to move across/within the frame.

If you want to keep your moving subject in fairly sharp focus while blurring an unattractive or busy background, try the panning method. I used this method for the Alkmaar cheese carriers and the montana whitewater rafting shot.

I used the other method on a recent Hawaii trip to photograph mountain bikers on a back road. I wanted to emphasize people enjoying the Big Island’s outdoors (action) while preserving the beautiful landscape (panning would have blurred the background). The 1/15th second shutter speed recorded the background scenery as sharp while blur-ring the cyclists. I made sure to snap the shot as the cyclists entered the frame.

Camera shake becomes a major problem at slower speeds and it can ruin a shot with unwanted blur, so use a tripod whenever possible. I use a versatile manfrotto ball head on my tripod, but pan and tilt heads also work great. lightly tightening the ball head produces enough friction to keep your camera fairly steady while still allowing you to pan and tilt.

It takes a while to master slow shutter speed photogra-phy so practise these techniques before your next trip and you’ll bring home some cool shots —and score bragging rights on Facebook with your friends.

JFCD_Ad_Print.indd 1 12-10-17 8:40 PM

PRO TIPS on shooting slow > For shots of running water, always use a tripod and shoot between

1/15th and 1 sec. If you shoot too slow you risk “washing out” (overexposing) the water and losing detail, so vary your speeds accordingly.

> When panning, keep your feet apart, tuck your elbows into your body and keep the camera firmly against your face. Follow the subject by twisting/rotating at the hips (not at the shoulders).

> When capturing an object moving across the frame, use your left eye for the viewfinder when the subject is approaching from the right (and vice versa). By tracking the subject out of the corner of one eye and framing with the other, you can shoot as the subject enters the frame.

> When shooting fast moving subjects (with either method) set your camera’s motor drive to continuous and shoot a burst of three or four images. This will improve your chances of getting at least one or two keepers.

> When shooting slow without a tripod, don’t stab or jerk down on the shutter release button. It will produce distracting vertical blurs. Grip your camera tightly, take a deep breath, exhale and smoothly press the shutter release button (and hold it down) until after the shot is recorded.

Gear up a tripod consists of legs and a head, the swivel part that the camera connects to. You can use a variety of heads with any tripod. although heads with three or more adjustment handles/knobs work great for some types of photography, I highly recommend a simple ball head for travel. Mini tripods ($20 – $40 by Joby, Sunpack, Giottos, Vanguard) work well with lighter point-and-shoots and compact DSLrs. Heavier DSLrs (especially those fitted with telephoto lens) require sturdier aluminum or carbon-fibre tripods and heads ($200 – $500 by Manfrotto, Induro, Gitzo).

p h o t o p r e S c r i p t i o n [ c o n t i n u e d ]

Outrank by Rogers

full-pg ad


Chicago Dental Society

full-pg ad

This year saw both an all-new Porsche 911 and all-new Corvette. Coincidentally (or not), 2013 is exactly

50 years since the original 1963 Porsche 911 and Corvette Stingray debuts. A lot has changed since then. I tried to imagine what those early 1960s engineering teams would think of the new models if teleported Star Trek-style 50 years forward to the 2013 Geneva and Detroit Auto Shows respectively.

Our “away teams” would re-materialize at the back of the 2013 show crowds as the drums rolled and the curtains were raised. what gestalt would emerge from our tele-

ported engineers’ first look at the new models? Once

they assimilated the longer, wider and more menacing ethos, I do

think they’d recognize these distant progeny as the offspring of their original creations. Remember, they’d be unaware of the look of the five intervening generations of Corvette (or 911). Proportions, logos and scripts have shown some consistency through these generations—and for the Porsche at least—headlights and taillights too.

I’m surmising the original engineers would have little appreciation of the aerody-namic advances now contained in the body shape and undertray…both of the 1960s models suffered increasing lift with increasing speeds. The modern cars generate desired

downforce at speed. They also have far lower coefficients of drag. The new cars need these aero advancements to safely reach their top speeds of 290kph and more. Some of the braver teleported engineers would have white-knuckled the earliest 1963 versions of these models to reach their claimed top speeds of just more than 210kph.

The show cars would be rotating on an elevated carousel with standing, murmuring crowds all around, and camera flashes pop-ping. The teleported teams would notice how tires and wheels have changed. Their early products employed 15-inch diameter wheels vs 18-inch plus today. Standard issue wheel widths were five to seven inches then; today, 8.5 inches, front, 11 inches, rear. Tire sidewalls were 75% of tire width then, just 30 – 40% now. The load and speed rating for modern

tires are also much higher.

I’m confident our early engineers would peer between the wheel “spokes” to see the original Corvette’s 11-inch diameter drum brakes had evolved into ~13-inch disc brakes (ditto the 2013 911 disc diameters). The acronym ABS (anti-skid braking system) would be latin to our time trav-ellers, as would be

the alphabet soup of all the other electronic control systems aboard. And improved brak-ing performance has progressed to a distance of just 100 feet at 60 miles per hour.

Being engineers, I’d like to think the time-travellers would next migrate to the show’s floor models and “pop the hood.” Past the bolt-ons, they’d see the familiar. Porsche still runs a rear-engined, horizontally opposed six-cylinder, overhead cam engine—though now water-cooled and four-valves per cylinder. The Corvette engine would be even more unadulterated, still running a front-engined, pushrod two-valve-per-cylinder V-8—though

the Stingray’s transmission is now one with the rear-mounted transaxle.

would both away teams be surprised today’s cars run on gasoline, albeit now unleaded? If so, at least they’d be impressed by how much more efficiently the fuel is con-sumed. The original Porsche derived 130hp from its 2.0-litre displacement versus the 350hp from 3.4 litres it gets now. The Corvette improved its base V8 from 250hp from a 5.2-litre displacement to the current 455 hp from 6.2 litres. yet, fuel mileage and non-CO2 emissions are now light years ahead.

Our teams would be sure to sit in the floor models. Those with three pedals and stick-shift would be familiar to them, though their early 4- and 5-speed transmissions are now both 7 speeds. The teams would have little idea of the numerous airbags surround-ing them, or all the crash-worthy engineering and testing now done. The sound and naviga-tion systems would, quite simply, blow their minds…so would the numerous nanny-state warning and hectoring stickers.

Hopefully our away teams would find a way to huddle with some of the cur-rent engineers. “Ja, the Porsche is still a steel unibody, but different,” and “yah, the Corvette body is still fibre-based, but different.” The usual laments about corporate politics, office perks and assigned parking stalls probably haven’t changed much in five decades. But pushing past the work stresses and techno-jargon into their shared passion for these cars, I’m sure the early pioneers would come away confident the current generation carries the flame competently.

Few car companies last 50 years. Fewer still are the car models that last 50 years. Still, would our early teams be disappointed that, after more than 50 years of intervening engi-neering excellence, they’re seeing mostly evo-lutionary changes rather than revolutionary? True, many advancements would be invisible to their eyes. would today’s auto engineers think similarly about evolution/revolution if teleported to 2063?

But free food is free food, and tired sore feet need a rest. I’m banking on Scotty locking onto the away teams from pre-set coordinates to the show’s hospitality areas.

50 years of evolutionwhat would yesteryear’s engineers think of the latest Porsche 911 and Corvette?

m o t o r i n g d r . k e l ly S i lv e r t h o r n

Dr. Kelly Silverthorn is Just For Canadian Dentists’ automotive writer. He tries to keep one convertible and/or one track-day car in the family fleet.

hot! 50 years in the making…the 2013 porsche 911 Carrera 4S Coupe

and original porsche 911 2.0 Coupe.

THE BRIDGEPAST, PRESENT AND FUTURE

149th midwinter meetingCHICAGO DENTAL SOCIET YThe Respected Leader in Scientific Dental MeetingsSM

fe b r u a r y 2 0 – 2 2 , 2 014Registration is just around the corner. Avoid lines, guaranteethe courses you want and save money by registering early.Registration begins Nov. 1. Find more information athttp://on.cds.org/MWMcan14.

Members get in for free!CDS offers FREE MIDWINTER MEETING REGISTRATION*to member dentists. Even if you do not live in the Chicagoarea, you can still join as an associate member. Learn more athttp://on.cds.org/MBRcan14.*Does not include fees for courses or special events tickets.

Come to Chicago for THREE DAYS OF THE BEST in lectures,demonstrations, hands-on participation courses and commercials exhibits.

2014 CDS MWM Canadian Dentist_CDS MWM Dental Products Report Ad 7/31/13 2:45 PM Page 1


Cheryl AndersonNational Sales Manager—Healthcare FinancingPhone: [email protected]

Congratulations You Didn’t Touch Your Cash Or CreditIn the dental profession you always want to preserve your cash and lines of credit so that they can be left in reserve for the unexpected or used to grow your practice in other ways. Think of it—no business ever experiences financial difficulty because it has too much cash on hand.

© 2012 National Leasing Group Inc. All rights reserved. National Leasing, a member of

CANADA’S EQUIPMENT LEASING EXPERTS

The raven-haired teen settled nervous-ly into the blue-cushioned, portable dental chair in the makeshift clinic,

which was open on both sides to create a pathway for a cooling breeze. “Hola, cómo estás? Soy Dr. Jack,” said the tall, bespec-tacled Canadian dentist. The 14-year-old began to shake. “Está bien,” Dr. Jack Cottrell said gently, then asked the teen in Spanish to open her mouth. Cottrell sighed. The girl’s six anterior front teeth were “blown away,” says Cottrell by phone from his Port Perry Dental Centre, 45 minutes northeast of Toronto. like so many Central Americans, the teen’s diet consisted largely of cola drinks and bagged tortilla chips—a blitzkrieg of acid and sugars

that has caused an epidemic of severe tooth decay in the region. “Here is this young lady who would have been walking around with no teeth for the rest of her life,” says Cottrell, who fit a bonded bridge after endodontist Dr. Domenic Delle Donne of milton, Ont., performed a root canal. “we rebuilt her whole smile and when we finished, gave her a mirror. She just lit up. She saw her own beauty,” Cottrell says.

Along with the new smile, the girl was given a toothbrush, toothpaste, instruction on brushing techniques and a warning to

avoid tortilla chips and pop in the future. She was also allowed to pick through the toys and trinkets routinely offered by dentists to their younger patients. The girl chose a ring of clear-cut glass, telling Cottrell: “Este es mi anillo deboda. me voy a casar.” She was betrothed, and this would be her wed-ding band. Thanks to Cottrell, the young Guatemalan’s passage into adult life was marked not only by a pretty ring but good health.

Areas like Central America and Haiti, where Cottrell also goes on dental missions, are about 70 years behind Canada in terms of oral health awareness, prevention and care, he says. The children who come to sit in

his chair have “deci-mated dentitions from walking around with Coke in their bottles and going to sleep with them.” The agrarian economies of latin America have been touched by globaliza-tion, but not its positive aspects. ubiquitous Pepsi and Coca-Cola signs tacked onto the small retail shacks found along roadsides have influenced people’s

eating habits. Rather than buying the

more expensive bottled water, they opt for cheap pop. Bagged tortilla

chips have also replaced locally

grown food—another factor in decay. Teeth rot and infection sets in as a result. left untreated, some people develop abscesses that are so severe they reach the brain, with fatal results. “The ram-pant decay is out of this world,” says Cottrell, whose wife michelle, a dental assistant, travels with him on missions.

Ever since his first international trip to Guatemala’s remote mountains in 2006 with

Feed the Children, Cottrell is convinced of the dramatic power of restorative dental care to boost a community’s health. Some dental missions arranged by other nGOs focus on expediency—extracting diseased teeth rather than restoring them. “It’s helping an immediate problem but it’s not making a dent into how to prevent the problem.” Cottrell upholds the same professional stan-dards on his missions as he does in Canada. Although removing disease is the definition of oral health, says Cottrell, a big portion of that is restoring teeth so that people “feel good about their smile.”

Cottrell worked with Feed the Children until 2009 when it splintered into Speroway, a charity that supports children in Canada and internationally. His work since then has taken him to Guatemala, Honduras, El Salvador, nicaragua and Port-au-Prince, Haiti, where he treated the fractured teeth of sur-vivors of the devastating 2010 earthquake. (His Haitian trips are managed by mission of Hope, which is a partner of Speroway.) On all his missions—usually eight gruelling days of dawn-to-dusk care—the training of local dentists, nurses and doctors is a priority, as is the education of patients to assist with prevention.

Cottrell, whose career spans nearly four decades, is also active on the public policy side of dental care, not only at the provin-cial and national levels but internation-ally. Cottrell has served as president of the Ontario and Canadian Dental Associations and was elected three years ago to the governing council of the world Dental Federation. Cottrell is only the second Canadian ever to hold this prestigious post-ing in the organization’s 110-year history. The federation has significant influence with such august institutions as the united nations and the world Health Organization, which is starting to put more emphasis on prevention of non-communicable dis-eases like diabetes, heart disease and dental disease—conditions that are skyrocketing worldwide due largely to poor diets.

Helping reverse this deadly trend will give not only Cottrell but his patients an-other good reason to smile.

a reason to smileAn Ontario dentist goes on dental missions to combat “rampant decay”

pay i t f o r w a r d r o b e r ta S ta l e y

Roberta Staley is an award-winning magazine editor and writer with experience reporting from the developing world and conflict and post-conflict zones. Staley specializes in medical and science

reporting and is a magazine instructor at Douglas College and Simon Fraser University.

CO

uRT

ESy

OF

SPER

Ow

Ay

Dr. Jack Cottrell and Michelle

Cottrell, working together in Guatemala.


t r a v e l a t h o m e t r a v e l a t h o m e

first passage to the westGliding under city bridges, through valleys and canyons, past still lakes and jagged peaks, a train ride across BC into Alberta is the original scenic tour.

A passenger snaps scenery somewhere near the Continental Divide, en route from BC to Alberta.

Open Road HONDA

full-pg ad

STorY + pHoToGrapHY BY baRb SlIgl


t r a v e l a t h o m e

MNP LLPAD 1/2 pg

bear on the right, bear on the right!” Blankets fly off laps, people tumble out of seats, necks crane to catch a glimpse. The scenery whizzes by, gold streaks of end-of-summer

grass, rolling greens of coniferous-clad hills, shades of grey rock and, um, a “grizzly cow.”

False alarm. Jonny, the train manager and de facto concierge, laughs. “If more than three people see it, it’s a bear.” He tells still-searching passengers riding the rails through BC that a bear is everyone’s most-wanted thing to see. Forget sky-high peaks and glacier-silt-hued waters, it seems a patch of fur is the Holy Grail.

This trip, alas, there’s no grizzly sighting. no matter, there’s plenty to gape at on the historic “First Passage to the west,” Rocky mountaineer’s modern-day version of a jour-ney that’s been happening on these tracks since 1885, when the last spike of this railway was laid. nowadays the passage is a leisurely two-day ride and excuse to sample gourmet fare and simply sit and stare.

we start at the western terminus of this epic railway, backing out of the industrial

landscape of East Vancouver, past graffiti and warehouses. It’s a slow meander through urban Vancouver that feels like its own recon-naissance. we cross the Fraser River under the broad span of the Port mann Bridge and inch through Thornton yard, one of the largest railyards in north America.

As the train picks up speed outside the lower mainland, it chugs through the Fraser Valley, where farmland competes with Greater Vancouver’s spread east. The steep sides of the Cascade and Coast mountains contrast ruler-straight lines of crops ready for harvest. Cows, barns, tractors and snow-capped mount Baker (all 3,319 metres of it) roll by.

In mission, Jonny tells us about Canada’s first train robbery in 1904, when bandits first used the term “hands up!” And our hands do go up shortly thereafter, bringing fork to mouth… we savour the produce of the valley we just glided through (berries, corn, chicken) as we head north into the Fraser Canyon.

The three-course menu is paired with award-winning BC wines: nk’mip Cellars Qwam Qwmt Chardonnay, See ya later Ranch Pinot 3, Sumac Ridge’s Black Sage Vineyard merlot, to name a few. This is the double-decker Gold leaf Service car, after all,

where the glass-dome upper level is about unimpeded views and the lower dining level is about haute cuisine.

Executive Chef Frédéric Couton, who’s trained at michelin-star restaurants in Paris and Geneva, transforms the ingredients (from 120,000 eggs per season to 200 Alberta-beef shortribs per day in the Gold leaf cars) into the locally sourced menu. In the convivial atmosphere of the dining room, where global accents (Aussies, Kiwis, Americans, French, Germans…) mingle over Canadian fare, one couple feels the need to call Jonny over to extol the flavours of the tomato-and-wild-mushroom soup. It is worthy of exclamation. As is the wild BC salmon.

noshing on salmon and hearing about its epic journey up the same Fraser Canyon (of course, our route is decidedly effortless) seems almost sacrilegious as I spot flicks of sil-ver on the river’s surface far below. These fish make their arduous journey over thousands of kilometres, through seemingly impossible-to-breach obstacles (like roiling Hell’s Gate, the narrowest part of the canyon) to spawning grounds—all simply to reproduce.

The train slows to “Kodak speed,” some five km/hour. “Oh là! C’est trop beau,” and

Old-school-cool patterns in a Fairmont Banff Springs suite, where the glamour of the heyday of railway travel is still strong and the rooms all come with a view (see page 6).

Wild BC salmon in the Gold Leaf dining car.

Rail bridge in Kamloops, BC, the overnight stop on the First Passage to the West train tour with Rocky Mountaineer.

Welcome crew in Kamloops, BC.

Gold Leaf car tradition: a Caesar cocktail as the train crosses into Alberta.

Just off the tracks: silt-blue rivers, green-

blanketed hillsides, jagged peaks.

Fine dining in the Gold Leaf car.

The Rocky Mountaineer snakes through the Rockies.

The arid beauty of BC’s Fraser Canyon.


"

YOU WANT MORE FROM YOUR PRACTICE.

Where do you go from here?From balancing your patients’ dental needs to building a strong team, the need for effective planning is critical. Proudly serving dental professionals for more than 20 years, MNP understands the challenges you face. Whether you have just graduated, are starting a new practice or plan to retire, MNP provides a full range of services—from minimizing your taxes and exposure to fraud prevention and succession planning—to help you succeed during any phase of your career.

Contact Calvin Carpenter, CA, Vice President of Professional Services at 1.800.661.7778 or [email protected]



[email protected] • www.ContinuingEducation.NET

Continuing Dental Education Cruises

Ask about our guesttravels free program and aboutplanning a cruise meeting for

your organization

December 22, 2013 Road Map to Planning, Grafting and Restoring Complex Implant Cases9 AGD PACE Credits 9 ADA CERP Credits 7-Night Eastern Caribbean from FloridaFebruary 16, 2014 Simplified and Successful Endodontics for Dental Practitioners9 AGD PACE Credits 9 ADA CERP Credit 7-Night Eastern Caribbean from FloridaMarch 15, 2014 Comprehensive Dentistry: The Pursuit of Excellence14 AGD PACE Credits 7-Night Western Caribbean from FloridaApril 29, 2014 The Pediatric Dental Course You Wished You’d Had in Dental School14 AGD PACE Credits 12-Night D-Day Anniversary European Cruise Rome to CopenhagenJuly 5, 2014 Treatment Planning and Sequencing14 AGD PACE Credits 7-Night Alaska from SeattleAugust 8, 2014 Oral Dermatology and Oral Pathology14 AGD PACE Credits 7-Night Alaska from SeattleAugust 15, 2014 Treatment Planning in the 21st Century9 AGD PACE Credits 9 ADA CERP Credits 7-Night Alaska from SeattleOctober 4, 2014 Oral Dermatology and Oral Pathology14 AGD PACE Credits 7-Night Canada and New England Montreal to BostonOctober 19, 2014 Predictable Treatment Planning:From the Seemingly Simple to the Worn Dentition...and Everything in Between14 AGD PACE Credits 7-Night Western Caribbean from Florida

1-800-422-0711 (727-526-1571) • www.ContinuingEducation.NET

Florida Seller of Travel Reg. #14337

Checkwww.ContinuingEducation.net

for updates to our2014 schedule

plenty of oohs and aahs are overheard as we hug the canyon’s walls. Cameras snap inces-santly as we spot the first golden leaves of fall.

By the time the multi-course lunch is over, we’re almost out of the canyon. There’s a blast of arid heat in the open-air vestibule (and congregation point for camera aficionados on board) and the landscape is desert-like. we’ve gone from the moist greens of the coast and farmland to burnished coppers of arid desert dotted with hoodoos, sage shrubs and giant osprey nests. Jonny tells us that BC is the most ecologically diverse province in Canada, and it’s easy to see those striations in landscape through the glass dome of this train.

Post-lunch, people are nodding off, pleas-antly sated and looking rather dreamy. It’s the mid-afternoon lull, Rocky mountaineer style. The average speed is an easygoing 40 – 50 km per hour, making riding the rails with an afternoon cocktail rather hypnotic. The rhyth-mic clang, combined with the gentle sway, is almost like the beating heart of the train. After a while, it seems in sync with my own.

we turn east and follow the blue-green Thompson River to Kamloops, our stop for the night that’s “no Paris or london,” as one passenger comments, but does boast mounts Peter and Paul, giant, camel-like twin hills.

After a sunset amble along the quiet waterfront and a locally brewed pil-sner at The noble Pig Brewhouse, it’s an early wake-up call to catch sunrise over Peter and Paul before breakfast back aboard the train.

we skirt glassy Shuswap lake in the morning light, passing BC’s lake country and Adams River, where the world’s highest concentration of salmon brings out scores of fishing boats even earlier than us. Soon we’re passing the legendary last spike of the trans-national railway, Craigellachie. The plaque states “A nebulous dream was a reality: an iron ribbon crossed Canada from sea to sea.” we’re on that same track more than 125 years later.

Fittingly, “Day 2 is when the magic hap-pens,” say our hosts. we pass Eagle River and, as if making an entrance, a bald eagle soars over a buffet of spawning Kokanee salmon. Every few minutes there’s another eagle. The water is tinged red from the salmon. “That was worth the trip alone,” says one woman of the mid-September salmon spectacle.

And, yes, there’s a bear. Finally. It’s not a grizzly, but a black bear bounding into the forest. Everyone makes a mental check. Hereafter, the checks come fast and furi-ous: going under Rogers Pass in Connaught

Tunnel, winding through the engineering feat of the Spiral Tunnels, crossing the Continental Divide. At this point, the crew serves liqueur, and most of us put down the cameras, sit back and simply

sip and gaze.Autumn has arrived in the mountains,

with aspens turning a glossy yellow, break-ing up the evergreen spread with pops of gold. we’re now in the big-time mountains of Banff national Park in Alberta. The Rockies elicit an “Oh là là” from my French seatmate. The 3,543-metre behemoth of mount Temple dominates the skyline and, as we continue along the Bow River Valley, the iconic swathe of ice suspended over lake louise, Victoria Glacier, almost seems within grasp.

we reach Banff as the late sun touches the tips of the surrounding mountain peaks. It’s golden hour here. Jonny leaves us with an excerpt of a poem, The Station: “So, stop pacing the aisles and counting the miles. Instead, climb more mountains, eat more ice cream, go barefoot more often, swim more rivers, watch more sunsets, laugh more and cry less. Life must be lived as we go along. The station will come soon enough.” And it does—too soon.

rIDe THe raILS Rocky Mountaineer’s “First Passage to the West” route runs April to October. Start or finish with a stay in Banff (see pages 5 + 6). rockymountaineer.com

if you go +fa l l 2013 + beyond

c ean international guide to ConTInuInG DenTaL eDuCaTIon

puerto rico / big sky / winnipeg / rosarito / kauai … | c a l e n d a r

If you enjoy speaking Spanish, spending US dollars, and seeking adventures both indoors and outdoors, Puerto Rico belongs on your to-do list. This American

territory in the Caribbean has developed amazingly since explorer Ponce de Leon founded the capital city of San Juan in 1521.

In San Juan, home to some 400,000 inhabitants, explore the Castillo de San Cristobal, a seaside, limestone fortress. The Puerto Rico Museum of Art offers 17 galleries, and the top attraction is La Plena, a wild 1954 wall mural by Rafael Tufino that burgeons with skeletons and tambourine players. Hungry? Top-notch waterfront restaurants abound. Feast on lamb sliders and shrimp ceviche at Mist, or wash down red snapper with sangria at Uvva. And make room for Puerto Rico’s signature plaintain-based dish, mofongo.

Many of Puerto Rico’s greatest adventures lie outside San Juan, like ziplining in Toro Verde Nature Adventure Park or exploring El Yunque National Forest. Or, an hour’s

drive west, discover Rio Camuy Cave Park. After a trolley ride down to the southern entrance of this underground system, containing nearly 2,000 caves, you can explore the dark, dramatic setting of limestone carved out by rainwater.

Thick stalactites drip from ceilings up to 200 feet high, with formations shaped like gargoyles and witches. Bats flit about and crickets chirp. Walk through the 42-foot-high north entrance and hear native Coqui frogs whistling as you gaze at a vegetation-laden cliff.

The Arecibo Observatory lies a 20-minute drive from the caves. It’s the world’s largest single-dish radio telescope. Fans of James Bond will remember the spine-tingling duel filmed here between Pierce Brosnan and Sean Bean in 1995’s GoldenEye. With three support towers, it weighs close to 10,000 pounds. Snap photos and chat with scientists about the telescope’s tracking of asteroids and pulsars.

More adventures await at the northwest coast’s Villa

Montana Beach Resort. It offers spacious suites filled with fine art and beautifully landscaped gardens. There’s lively cuisine at the open-air Eclipse restaurant, ranging from root vegetable chips served with hummus to grilled loin of kangaroo.

Go stand-up paddleboarding on the Guajataca River, caressed by soothing breezes, and then take a guided hike through the woods to an abandoned railway tunnel. En route, you might see tiny brown crabs scuttling across the path, and maybe even a worm-sized Puerto Rican boa (non-venomous).

You can also book a horseback outing with Tropical Trail Rides, right by Villa Montana. Spot huge iguanas trailside, and clip-clop across what was a US missile launch pad during the Cuban Missile Crisis. Riding on the beach at dusk, bathed in warm tropical rain, is just one more of those unforgettable moments that are commonplace in Puerto Rico. —Lucas AykroydFor more info on Puerto Rico, go to seepuertorico.com.

Hermoso Puerto Rico. From fortresses and caves to ziplines and horseback riding, this Caribbean island abounds with excitement. (CE events in Puerto Rico are highlighted in blue.)

COu

RTES

y Pu

ERTO

RIC

O T

Ou

RISm

CO

mPA

ny

clockwise from top left Old San Juan; mofongo, Puerto Rico’s signature

fried-plantain dish; Isla Palominito; Toro Verde zipline; waterfall in El

Yunque National Forest.

Puerto Rico


c e c e

new CE to be placed

ce when where topic sponsor contact websitea

nest

hesi

aoct19-20

Patchoguenew York

local anesthesia in dental Hygiene Practice Missouri college 314-596-8665sblearninglink.com

nov20

detroitMichigan

a Hands-on review of local anesthesiauniversity of detroit Mercy

313-494-6694 udmercy.edu

Jan 17-Feb 162014

sacramentocalifornia

iV sedation training For dentistsconscious sedation consulting

888-581-4448sedationcon-sulting.com

cos

met

ics/

aes

thet

ics

through 2013

Westerncanada

Focus dental education series: Part ii F.o.c.u.s. 604-922-3465 drracich.ca

dec07

MontrealQuebec

Modern concepts in restorative dentistry (special guest: dr. elliot Mechanic)

international dental institute

877-463-1281 idi.org

dec 21-Jan 052014

Hong Kong to singapore cruise

building blocks of aesthetic restorationMindware educational seminars

888-574-8288mindwaresemi-nars.com

Jan102014

lincolnnebraska

Weeth lecture 2014university of nebraska Medical center

402-472-7993 unmc.edu

Jan 23-Feb 022014

east africa safari

current concepts in ProsthodonticsAddiction, Methadone And The Dental OfficeHow to survive Your next Medical emergencycombining art & science

Kennedy seminars877-536-6736see ad Page 4

kennedysemi-nars.com

Feb07-222014

southern caribbean cruise

an overview of restorative dentistry Kennedy seminars877-536-6736see ad Page 4


Mar 08-152014

turks and caicos

Problem solvers For restorative dentistry Kennedy seminars877-536-6736see ad Page 4


den

tal M

ater

ials nov

15-17Minneapolis Minnesota

new Materials, technologies & laser training Postgraduate Program in contemporary restorative dentistry: level iii

university of Minnesota 800-685-1418dentalce.umn.edu

Jan23-262014

san Franciscocalifornia

Predictable aesthetics and longevity With bonded Porcelain restorations

interdisciplinary dental education academy

650-578-9495 ideausa.net

endo

dont

ics

nov01

MontrealQuebec Foundations For endodontically-treated teeth Mcgill university 514-398-4314 mcgill.ca/

dentistry

nov14-16

las Vegasnevada

2013 Fall conference - contemporary concepts in Periradicular surgery: diagnosis and treatment

american association of endodontists

800-872-3636 aae.org

Jan 20-Feb 032014

australia & new Zealandcruise

endodontics & Medicine sea courses cruises 800-647-7327see ad Page 22 seacourses.com

apr 30-May 032014

Washingtond.c. 2014 annual session american association

of endodontists800-872-3636 aae.org

c a l e n d a r

new CE to be placed

www.aocruise2013.com • 301-738-6400

ms EurodamDecember 29, 2013 through January 5, 2014

U L T I M A T E ALPHA OMEGA CR U ISE

DentalCE Credits9

ce when where topic sponsor contact website

gen

eral

den

tist

ry

sep27

MontrealQuebec

clinical applications of cone beam computed tomography in general dental Practice Mcgill university 514-398-4314 mcgill.ca/

dentistry

oct4

MontrealQuebec

tooth Preparation: a new twist to an old story Mcgill university 514-398-4314 mcgill.ca/

dentistry

oct26

WinnipegManitoba Winnipeg rhapsody ce solutions 604-575-4570 conedgroup.

com

oct 31-nov 03

new orleanslouisiana annual Meeting american dental

association312-440-2665 ada.org/session

nov09-12

Victoriabritishcolumbia

current concepts in dentistryProsthodontic success: From concept to deliveryMedical emergencies in dental PracticeOffice Oral & Maxillofacial Surgerya critical look at dental adhesives, composites & light curing

university of Victoria 250-472-4747 uvcs.uvic.ca

dec09-21

south east asia cruise oral Pathology and dermatology sea courses cruises 800-647-7327

see ad Page 22 seacourses.com

Jan05-212014

antarcticacruise dental challenges in isolated communities Professional education

society877-737-7005 pestravel.com

Jan10-222014

Vancouverbritishcolumbia

science & treatment Planning Pacific Implant Institute 604-868-9700 pacificimplan-tinstitute.com

Jan17-262014

Multiple citiesspain

alpha omega dental Fraternity toronto chapter european ski seminar

alpha omega dental society

301-738-6400see ad Page 23 aotoronto.org

Feb01-082014

MauiHawaii 34th annual Hawaiian dental Forum dental seminars &

symposia, llc952-922-1707see ad Page 26 dentsem.com

Feb072014

MontrealQuebec

Making “real World” dentistry Productive and enjoyable (special guest: dr. gordon J. christensen From the usa)

international dental institute 877-463-1281 idi.org

Feb08-152014

KauaiHawaii 34th annual Hawaiian dental Forum dental seminars &

symposia, llc952-922-1707see ad Page 26 dentsem.com

Feb15-202014

big skyMontana

alpha omega dental Fraternity toronto chapter Western ski seminar

alpha omega dental society

301-738-6400see ad Page 23 aotoronto.org

Feb22-242014

chicagoillinois Midwinter Meeting chicago dental society

contact via websitesee ad Page 13

cds.org

Mar15-222014

caribbeancruise comprehensive dentistry sea courses cruises 800-647-7327


apr03-052014

calgaryalberta rocky Mountain rhapsody ce solutions 604-575-4570 conedgroup.

com

oct 24-nov 012014

greece and turkeycruise

contemporary topics in dentistry university of californiasan Francisco

415-476-1323see ad Page 25 ucsf.edu

c a l e n d a r

For: Just For Canadian Dentists Issue: Sep / Oct 2013 Fax: 604 - 681 - 0456 Attn: Advertising in Print Email: Copy sent to [email protected] Feature the following 4 departures in the ad in the dental list Dec 9 - 21/13 South East Asia Jan 20 - Feb 3/14 Australia & New Zealand Mar 15 - 22 Caribbean Apr 29 - May 11 Grand Europe

DENTAL CE CRUISES

for current pricing & promotions 1-888-647-7327 www.seacourses.com

Canadian owned and operated providing dental CE

since 1995

companion cruises FREE

SOUTHEAST ASIA Dec 9 - 21, 2013 Oral Pathology & Dermatology

NEW ZEALAND Jan 20-Feb 3 Endodontics & Medicine

ALASKA GLACIERS Jul 5 - 12

Treatment Planning

CARIBBEAN Mar 15 - 22

Comprehensive Dentistry

GRAND EUROPE Apr 29 - May 11

Pediatric Dentistry


Introducing a new systematic way to use and sterilize all your handpieces equally reducing consistent handpiece repair costs.

1-866-591-7770info@thehandpiececloset.cawww.thehandpiececloset.com

The Handpiece Closet will save your practice thousands of dollars.

Order yours today!

new CE to be placed

ce when where topic sponsor contact websiteim

plan

tolo

gy

sep 2013-May 2014


8 sessions to implant therapy (introduction: Mondays; intermediate: thursdays; oradvanced: Fridays)

renaissance dental implant institute (rdii) and dentsply implants

877-879-9660 rdiinstitute.com

sep26-28


21st Annual Scientific Meetingcanadian academy of restorative dentistry & Prosthodontics

902-435-1723 cardp.ca

nov15-16

MontrealQuebec all-on-4 continuum (Modules i & ii of iV) Mcgill university 514-398-4314 mcgill.ca/

dentistry

nov29

MontrealQuebec

implant-retained overdentures: Hands-on course Mcgill university 514-398-4314 mcgill.ca/

dentistry

impl

anto

logy

oct04-06


the complete advanced cadaver grafting Program i.d.e.a.s. 888-554-3327 dentalideas.ca

oct13-24

Wine tour of israel

trilogy of implants, bone & soft tissue; orthodontics in a comprehensive treatment Plan; and bone reconstruction For dental implants

Mindware educational seminars

888-574-8288 mindwaresemi-nars.com

nov09

MontrealQuebec

technologies that improve our implant Practices

international dental institute

877-463-1281 idi.org

nov14-17

san diegocalifornia

advanced Hard and soft tissue grafting Program With cadavers Hands-on

california implant institute

858-496-0574 implanteduca-tion.net

nov20-23

rosaritoMexico 2013 liVe externship Program california implant

institute858-496-0574 implanteduca-

tion.net

Jul11-132014


surgical operations & Wound Healing Pacific Implant Institute 604-868-9700 pacificimplan-tinstitute.com

Med

ical

issu

es

ongoing Podcast and online based Medical emergencies dentaledu 239-593-2178 dentaledu.tv

oct17

san JuanPuerto rico basic life support For Healthcare Provider university of Puerto

rico 787-756-7145 dental.rcm.upr.edu

oct17

san JuanPuerto rico basic life support For Healthcare Provider university of Puerto

rico 787-756-7145 dental.rcm.upr.edu

nov22

torontoontario

Medical Emergencies In The Dental Office And CPR Certification sleep for dentistry 416-498-8484 sleepfordentist-

ry.com

Feb 18-Mar 052014

Vietnam & cambodia river cruise

dental Healthcare delivery Professional education society 877-737-7005 pestravel.com

occ

lusi

on

through 2013

Westerncanada Focus dental education series: Part i F.o.c.u.s. 604-922-3465 drracich.ca

nov15-16

tempearizona ultimate occlusion - level 1 gold dust clinical

Mastery 480-968-6131 clinicalmastery.com

Feb19-202014

chicagoillinois

AES 59th Scientific Meeting - Occlusion: The bigger Picture and beyond

american equilibration society 847-965-2888 aes-tmj.org

c a l e n d a rc e

new CE to be placed

c ece when where topic sponsor contact website

Offi

ce /

Team

M

anag

emen

t

ongoingPodcast and online based

understanding and assessing risk in the treatment of Periodontal disease dentaledu 239-593-2178 dentaledu.tv

Mar15-222014

Western caribbean cruise

comprehensive dentistry and the dental team: the Pursuit of excellence

continuing education,inc./university at sea

800-422-0711see ad Page 20

continuingedu-cation.net

May02-042014

saskatoonsaskatchewan sdta annual Professional development saskatchewan dental

therapists association306-672-3699 sdta.ca

ora

l sur

gery

nov14-16

las Vegasnevada

2013 Fall conference - contemporary concepts in Periradicular surgery: diagnosis and treatment

american association of endodontists 800-872-3636 aae.org

Feb10-142014

HawaiiHawaii

21st international symposium in oral and Maxillofacial surgery contemporary concepts in oral and Maxillofacial surgery

university of californiasan Francisco

415-476-1323see ad Page 25 ucsf.edu

nov21-232014

Vancouver british columbia

advanced soft tissue surgery Pacific Implant Institute 604-868-9700 pacificimplan-tinstitute.com

ort

hodo

ntic

s

oct04-05

las Vegasnevada orthodontic case Finishing conference rondeau seminars 877-372-7625

rondeausemi-nars.com

oct25-26


level i introduction to orthodontics 1 of 4 session series rondeau seminars 877-372-7625


nov09-10

torontoontario dentist’s role in snoring and sleep apnea rondeau seminars 877-372-7625


Jan19-302014

indiatour

gummy smiles & lingual orthodontics; and esthetic implant Placement

Mindware educational seminars 888-574-8288 mindwaresemi-

nars.com

Pedi

atri

c d

enti

stry

apr 29-May 112014

grand europecruise Pediatric dentistry sea courses cruises 800-647-7327


apr 29-May 112014

italy to denmarkcruise

d-day 70th anniversary cruise conference continuing education,inc./university at sea

800-422-0711see ad Page 20


Peri

odon

tics nov

08-09MontrealQuebec

Periodontal symposium: optimizing teamwork and enhancing Patient care Mcgill university 514-398-4314 mcgill.ca/

dentistry

dec05

Minneapolis Minnesota

clinical grand rounds For the dental team: lasers in Periodontal therapy

university of Minnesota 800-685-1418 dentalce.umn.edu

Phar

mac

olog

y ongoing online based Florida Board Of Pharmacy Misfills Course nova southeastern university

800-356-0026 nova.edu

ongoing online based advances in Xylitol dentaledu.tv 239-593-2178 dentaledu.tv

oct08

seattleWashington

ce1312: the art of dental therapeutics – Modern dental Pharmacology

university of Washington

206-543-5448 uwcde.com

c a l e n d a r


c e

new CE to be placed

ce when where topic sponsor contact websitePr

acti

ce M

anag

emen

t, t

echn

olog

y an

d Pl

anni

ng

sep25 & 26

calgary & edmontonalberta

What Your Practice is Worth today and Why sep 25: calgarysep 26: edmonton

roi [email protected] ad Page 47

roicorp.com

sep27-29

collingwoodontario

the ultimate opportunity to optimize Your Practice roi corporation

[email protected] ad Page 47

roicorp.com

oct04-05

MontrealQuebec

Hit the ground running – getting Your Patients to get it!

international dental institute 877-463-1281 idi.org

oct18

saskatoonsaskatchewan

Meet the Masters series - achieving optimal esthetic results through digital dentistry

straumann canada limited 905-335-7407 straumann.com

Jan23-262014

cabo san lucasMexico

complete dental Practice rejuvenationBring Your Entire Staff For A Complete Office rejuvenation experience

dental Management secrets 403-984-0115

dentalmanage-mentsecrets.com

Feb15-222014

sandalsWhitehouseJamaica



roicorp.com

Mar28-292014

MontrealQuebec transition Planning in dentistry international dental

institute 877-463-1281 idi.org

May 28-Jun 042014

alaskancruise



roicorp.com

Jul05-122014

alaskancruise dental treatment Planning and sequencing continuing education,

inc./university at sea800-422-0711see ad Page 20


Pros

thod

onti

cs

sep25-27


annual Meetingcanadian academy of restorative dentistry and Prosthodontics

902-435-1723 cardp.ca

dec22-29

easterncaribbean cruise

cruise and learn: american academy of dental education road Map to Planning, grafting, and restoring complex implant cases

continuing education,inc./university at sea

800-422-0711see ad Page 20


Jan172014

st. PetersburgFlorida all-ceramic restorations in 2014: clinical steps West coast district

dental association 813-654-2500 wcdental.org

oct01-242014

Multiple citiesindia contemporary Fixed Prosthodontics Kennedy seminars

877-536-6736see ad Page 4


den

tal a

ssis

tant

s &

H

ygie

nist

s

oct03-04

columbusohio Front Office Academy

Paragon Management associates inc

614-433-0790theparagonpro-gram.com

nov16

st. PaulMinnesota Winter dental assistants’ seminar university of Minnesota 800-685-1418 dentalce.umn.

edu

nov23

stoney creekontario

Laser Certification Course For DentalHow to integrate the laser into dental Hygiene Practice

rdhu 855-295-7348 rdhu.ca

For feedback, requests or to have your course featured please email [email protected]

c a l e n d a r

Dental Forum in hawaii!

For details & registration, visitwww.dentsem.comor call 952.922.1707

For travel information, call Linda800.826.6644or email [email protected]

don’t miss the 34th annual

Dental Seminars & Symposia, LLC

maui february 1-8 &/OR kauai february 8-15

A fter five years of associateship, Dr. Al Dente realized his dream of buying a practice. with a huge demand for

practices in the city, he paid top dollar for the three-operatory practice that produces an annual gross revenue of $750,000 with a net cash flow before taxes, debt servicing and owner compensation of $250, 000.

In addition to the $800,000 purchase price, Dr. Dente will inject $200,000 in new equipment and upgrades. The annual debt servicing cost on a $1 million loan is $90,000 amortized over 15 years. The $160,000 projected practice income is less than his as-sociate pay of $230,000. To make ends meet, Dr. Dente is working two days a week in his old associate job, and to ensure a smooth transition of patients, the vendor will work a

couple of days a week. Dr. Dente’s ownership dream comes with

significant challenges. with only 10 new patients a month, it’s difficult to increase the patient volume. young families, the biggest source of new patients, have long left the neighbourhood for more affordable homes in the suburbs, leaving behind mostly single and retired condo dwellers. Eighty percent of existing patients are over the age of 55, and most of the complex and profitable dental treatments have already been done.

A second growth-limiting factor is the restricted capacity of a three-operatory practice. Accommodating a patient increase means expanding hours and incurring the cost of associate dentists and additional staff. The easier route to increase the bottom line is

to reduce expenses; a 10% reduction in over-head from the current 62% of gross means a 30% increase in net income from $250,000 to $330,000. This, however, is easier said than done and is Dr. Dente’s biggest challenge.

His idea to bring in a practice manage-ment consultant to make the office more ef-ficient is met with open resistance. likewise, reducing salary costs is difficult. How do you tell the $50-per-hour hygienist, who’s friends with every patient, that you want to drop her pay to the going rate of $35 per hour? Knowing that existing staff is critical in the retention of patients, Dr. Dente must wait to make any staff changes.

He now often longs for worry-free associ-ate days, without the headache of managing an office and the pressure of meeting

make it your ownwhy you should start rather than buy a practice

Manfred Purtzki is the principal of Purtzki & Associates Chartered Accountants. You can reach him at [email protected].

t h e w e a lt h y d e n t i S t m a n f r e d p u r t z k i

>>


payroll and loan payment deadlines.In contrast to Dr. Dente, Dr. Susie

Zahnarzt is celebrating the first anniver-sary of starting a practice. A year ago she took the plunge of setting up a practice in a rapidly growing area of the city. with a gross monthly practice income of $60,000 and 90 new patients each month, her three treatment rooms have produced $600,000 in the first year. Dr. Zahnarzt invested in professional help to set up efficient business systems, resulting in an overhead of less than 50%. The premises are designed for six operatories with enough capacity to hire an associate for the evenings and weekends. The bank provided her with a $500,000 loan for the leaseholds and equipment, plus $200,000 of working capital to draw on before she was able to break even after six months. By being available to patients most evenings and weekends, Dr. Zahnarzt has found it easy to grow her practice.

It’s a risky business venture to spend $700,000 on a practice start-up without any patients. This uncertainty is why young dentists often choose to buy practices, even overpriced ones. yet, to invest $1,000,000

for an existing practice with a cash flow of $250,000 that barely pays the bills is just as risky. By inheriting the patients and staff of an existing practice, the risk is a lack of con-trol to manage the practice and maximize its profitability.

From an investment point of view, it’s worthwhile to consider the start-from-scratch versus existing-practice option. Practice values have peaked and the best Dr. Dente can hope for when he sells his practice is to get his investment back. Dr Zahnarzt, on the other hand, is creating wealth with every new patient. with a goodwill value of about 70% of her revenues of $600,000, she has increased her invest-ment by $420,000 in the first year. The overhead expense for dentists who start a new practice is as much as 15 – 20% lower than dentists who buy an existing practice. A scratch-start dentist may also have more fun, designing the office space, selecting like-minded staff, and retaining some control over the practice’s mix of patients. Both the enjoyment and profitability of being a scratch-start dentist is hard to beat.

t h e w e a lt h y d e n t i S t [ c o n t i n u e d ]

>> 185274369

923681547

476395821

752936184

694128753

318457692

267519438

531842976

849763215

Puzzle by websudoku.com

sudoku 2 harder solution

solu

tion

from

Ju

ly/a

ugus

t 201

3 co

ntes

t

598642317

234517896

617389542

781264935

952138674

463795281

325971468

146823759

879456123

Puzzle by websudoku.com

sudoku 1 easier solution

solu

tion

from

pag

e 45

Special Advertising Feature

Strategically SpeakingValue-added Solutions

for Your Practice

Leasing works: to lease or pay cashtune up your practice

payroll service simplifiedtransitioning: you need a plan

accounting strategies to retire sooner

Sandie Baillargeon is a leading authority on how to increase the effectiveness of medical and dental business systems. Ms. Baillargeon is author of two text books, Dental Office Administration and The Canadian Dental Office Administrator, published by Nelson Canada. Sandie is the owner and operator of Dental Office Consulting Services, which specializes in dental business planning, staff development, consulting and continuing education seminars. Visit her website at www.dentalofficeconsulting.com or contact her directly at (905) 336-7624.

Tune Up Your Practice Management Systems SANDIE BAILLARGEON

Erosion of practice management systems may occur silently and go

unnoticed. Dental management systems must be responsive to the changing mar-ket place and proactively direct the ac-tions of the people within your office. Recognize the hidden signals, identify the causes, and correct the breakdown of your systems quickly to protect your practice from long term effects of eco-nomic downturns. Uncover inefficien-cies that may exist, discover opportuni-ties for improvement and take action now!

means that someone needs to focus on this process and be accountable for the results. If there are accounts that have been outstanding for over 90 days, make those accounts a priority. The key to col-lections is everyone on the team needs to believe in the services and the fees and collect the fees at the time of service.

Elevate Your Hygiene DepartmentMost cancellations and no shows occur in the hygiene schedule because your patients don’t see the value in dental hygiene appointments. When you tell

to increase revenue is to have patients booked in the schedule, who keep their appointments, value your services and who are on active recall. When you in-crease the revenue and collections of your practice, all of the benchmarks for success will align.

Human Resources ManagementA good human resource performance management system with clear goals and measurable objectives will increase accountability and help your employees feel connected and committed to your success. Striking a balance between being involved with your team members enough so they feel your direction and support isn’t easy. Employees want to be treated as people first and workers sec-ond. Happy employees affect the bottom line.

To make sure that your management systems are running at maximum ef-ficiency and effectiveness, check them often and look for the hidden signs of erosion. Make any necessary adjust-ments quickly and your practice will run like a well-oiled and well-maintained machine that will reward you with many years of sustainable growth and profit-ability. If you are interested in receiv-ing a copy of Powerful Communication skills, send an email to [email protected] with the subject line Just for Canadian Dentists.

“...increase the revenue and collections of your practice, all of the benchmarks for success will align.”The Appointment ScheduleThe appointment schedule is the beat-ing heart of your practice. When the schedule falls apart, everything else fol-lows. Having warm bodies in the chairs receiving treatment is the only source of revenue generating activity in your prac-tice - everything else generates expense.

If you have just two cancellations per day in your hygiene columns, your prac-tice could be losing between $72,000 – $96,000.00 per year. Maintaining the appointment schedule is challenging, but it is the job of the team to focus and work on the schedule to get it filled. The alternative is much worse.

Practice Collections—Turn Your Accounts Receivable into Accounts ReceivedIt doesn’t matter how much you are charging if you don’t collect the fees for your services at the time of service. Accounts that are over 90 days outstand-ing are considered uncollectable. After all, the patients who still owe you money 3 months after they have received your services, have no intention of paying you. That doesn’t mean that you should write off all of your 90 day accounts, it simply

patients that they need a “cleaning” ap-pointment, there is no sense of urgency and patients think that it can wait—“it’s just a cleaning!”

Dental hygienists are not teeth clean-ers!! They are highly trained, registered, regulated dental therapists, who prevent disease, promote healing, improve the overall health of the patient, etc. You must believe in your own value before your patients will.

Hygiene coordinators must change their semantics to reflect the value of the hygiene appointment. Never say to a patient, “I’m just calling to remind you that you are overdue for a cleaning”—saying the word “just” it minimizes the value of anything else that you have to say so the patient has stopped listening.

Overhead Expense ControlA well run dental practice should oper-ate at between 50 – 60% overhead ex-penses (based on gross production be-fore taxes). Monthly dental sundry costs (consumables) should not exceed 5% of monthly production and staff costs should range between 20 – 25%.

The best way to decrease expenses is to increase revenue. The best way

Cheryl Anderson is the Territory Manager for National Leasing’s Healthcare Financing sector. She has 12 years of experience dealing with financing dental equipment and leaseholds helping dentists all across Canada. You can reach her at 604-948-3000 or by email [email protected]. Backed by professional service and an outstanding reputation, National Leasing is fast to respond, easy to work with, and ever-changing to meet our client’s needs. For more information, visit www.nationalleasing.com or call 1-877-646-0023. As a wholly owned af-filiate of Canadian Western Bank (TSX:CWB), National Leasing is a proud member of the CWB Group of Companies.

far more effective than paying cash for equipment before it works for you.

Up-to-Date Technology — To be on the cutting edge, remain competitive, and maximize revenue dental practices need access to new technology. Certain lease

Equipment Finance Expertise — The finance expertise of leasing consultants makes them a valued advisor to your practice. Many will provide services that range from recommending lease structures and payment schedules cus-tomized for your practice to helping you manage equipment replacement and implementing equipment lifecycle solutions. Many financing companies provide asset management services that track the status of equipment, know when to upgrade or update it, equip-ment management by a third party, such as an equipment financing company, can enhance the ability of a business to focus on its core operations—like dentistry.

At National Leasing we work hard to make sure our customers are informed and that our process is smooth. We un-derstand the dental industry and we can accommodate both standard and com-plex situations ranging anywhere from acquiring one new piece of equipment to setting up a new practice.

“Equipment Financing — Lease What Depreciates; Own What Appreciates.”

Leasing Works for Dental PracticesTo lease or to pay cash, that is the question.

CHERYL ANDERSON

Many times a dental practice will have available cash and access to

lines of credit. The key question to ask is “what is the most effective use of cash?” The best answer is: “Use it for areas of the business, such as expansion, inven-tory, and staffing for peak periods.

“The finance expertise of leasing consultants makes them a valued advisor to your practice.”

Using leasing as a finance tool for equipment acquisition allows you to hold onto cash so that it is available when needed. This is just one of the many reasons why equipment leasing works for the dental industry.

There are many benefits to businesses realized through using equipment leas-ing as a finance option. Some of them are more applicable to a dental practice than others. Here are a few:

Flexible Payment Structures and Terms — Working with your lease consultant will allow you to structure lease payments and terms that suit your practice.

100 Percent Financing — Unlike traditional financing there is usually no down payment with a lease. This is another way to ensure access to cash remains unaffected.

Get the Equipment Needed NOW! — Leasing enables businesses to acquire more equipment with more functionality than could have been acquired through paying cash. When you pay cash you may be limited to the equipment and features you buy because of available capital restrictions. Making monthly payments makes getting the equipment you need now more manageable.

Match Revenue with Expenses — Paying for the equipment while it gen-erates revenues (or protects profits) is

finance programs allow for technology upgrades and/or replacements within the term of the lease contract.

Avoid Owning Obsolete Equipment — Since the lessor owns the equipment, the risk of obsolescence remains with the lessor. That means you never have to hang onto old technology because “you own it”.

Eliminate Other Risks Associated with Owning Equipment — Generally speaking equipment is used to either: a) Increase revenue and efficiency, or b) re-duce or eliminate expenses. Equipment financing can help mitigate the uncer-tainty of investing in a capital asset until it achieves the desired impact on the business.

Budget Planning — Financing equip-ment helps maintain cash flow and creates greater certainty in budgeting by setting regular payments to match cash flow and even seasonal cash flows. Knowing the equipment payment allows you to budget into the future.

Potential Tax Savings — With an appro-priate lease structure, you may be able to write off 100% of your lease payments.

Hedge Against Inflation — Instead of paying cash up front in today’s dollars using lease financing means the stream of payments delays the outlay of funds.

Transition Planning—“If you fail to plan, you plan to fail”AL HEAPS & HENRY DOYLE

A dental practice is one of your big-gest retirement investment assets.

A practice’s evaluation or appraisal pro-vides the practice worth through an ob-jective observer. The valuation provides an in-depth analysis and thorough doc-umentation of your practice establishing the fair market value.

Al Heaps & Henry Doyle are licensed brokers with Al Heaps & Associates, dealing exclusively with dental practices. They are active members of the Real Estate Council of BC and the Pacific Dental Trade Association. Al Heaps & Associates has over 25 years of experience in the dental field. They have offices in BC, Alberta and Ontario. They can be reached at Toll Free: 1-866-638-6194 or [email protected].

fair market value: dental equipment and furniture, leasehold improvements, goodwill and supplies. A comprehen-sive valuation package is best done by someone who understands and is skilled in the area of dental practice appraisals. It will include a practice description, a review of the facility and charts, de-

Ask dental colleagues. Local dental con-ferences are great locations to scout out and talk with qualified professionals. Someone actively involved in dentistry will be exhibiting, and/or speaking at re-gional meetings, participating in dental fundraising events and supporting the community. They will make themselves available to talk with you privately, at your convenience. Confidentiality is key in these situations and a professional will go out of their way to see that it is maintained.

With a completed valuation you can rest more comfortably knowing that if the need arises, the necessary paper-work is in order and any necessary action can be undertaken on short notice. A copy of the confidential docu-ment can be stored with your important papers. An annual review is recom-mended to record any changes within the practice and can generally be com-pleted for minimal cost utilizing your new financial statements. It should be acting as a road map for your success—if you don’t know where you are, or where you’re going, you won’t know when you get there. Have a plan!

“A valuation report provides direction to main-tain and increase the value of your practice.”

Not thinking of retiring or selling your practice in the near future? A valu-ation is still a vital document to your economic wellbeing. A valuation report provides direction to maintain and in-crease the value of your practice. It’s es-sential for financing (loans or leases), for incorporation and insurance issues (office interruption as well as personal disability and life insurance), finan-cial planning, ownership restructuring, transition planning, associate buy-ins, tax allocations and classifications of as-sets and preparation of legal documents (matrimonial and prenuptial agree-ments, estate planning, sales).

Not having a current valuation avail-able can result in financial loss and delay at a critical time. For example, in the event of injury or death, the value of a practice can deteriorate rapidly if the principal is unable to keep the practice running at 100%. The estate, in the event of death, needs direction with respect to selling a practice and it may be a difficult task to access the information needed.

By maintaining a current practice val-uation you’ll be ready for the unexpect-ed, and you’ll understand the financial consequences of any triggering event. Sometimes even slight adjustments in day-to-day operations or simple cos-metic upgrades can alter the value and subsequently your future income.

A practice valuation looks at four principal components to determine

mographics and community profile. It outlines the types of service and treat-ments, the premise lease or ownership, an analysis of patient flow, appointment and recall systems. Employee agree-ments, associate agreements, conditions of lease, an analysis of financials, fees, payments and collections are included in the valuation.

A practice appraisal/valuation is an extremely detailed process that should be undertaken objectively to identify, document and value the goodwill and assets of an office. Cost varies depend-ing on the scope of the assignment, the size and complexity of the practice to be appraised. Your appraiser should review the document with you to iden-tify any errors or oversights and recom-mend any areas where improvements could improve your financial position. Should you take any action to do so, ad-justments can be made in the valuation (recommended annually).

Select an appraiser who is experi-enced. Engage an appraiser who is doing the work him or herself, not directing you to do it, or hiring a third party. Will they visit your practice evenings and after hours to help maintain your con-fidentiality and avoid interference with your practice work schedule? Are they well respected by the financial institu-tions you are dealing with?

Look for referrals from your financial team—banker, accountant and lawyer.

Sam Vassa heads PaymentEvolution—Canada’s largest and most loved cloud payroll and payments service. Sam founded the company with a team of technology and subject matter specialists and devised an award-winning solution that empowers organizations and their accountants to manage their own payroll process. Find out more PaymentEvolution.com/Dentists

Previously, Sam led business development for the capital markets industry at Microsoft Corporation. His team worked with leading Microsoft partners to build compelling solu-tions for the financial services industry. Sam was responsible for alliance relationships with Microsoft’s largest global partners, as well as sales and marketing execution with the community. He has worked with Microsoft’s US and Canadian subsidiaries and is known for his passion for forming strong partnerships.Sam was a channel manager at Digital Equipment Canada and served with the Canadian Department of Foreign Affairs and International Trade at their foreign missions worldwide. He is a board member of Telecompute—a leading software development firm pioneering the use of portable database technology for vertical markets. Sam is active in the emerging business market as an advisor and mentor to firms seeking management and technol-ogy expertise.Sam is a graduate of McMaster University where he studied biochemistry. Contact Sam at [email protected] or directly at (647) 776-7600.

research but the time spent will ensure that your staff are happy with easy to use tools, accurate pay and convenient online access to their pay history.

Here are some tips on how to find the right payroll service for you:• Employeesshouldhaveeasy online

access to their full pay history, all pay slips and important year-end

Paying Your StaffSAM VASSA

Not long ago, payroll was consid-ered a dark art requiring magical

calculators and inside knowledge to get it done. In fact, industries popped up supporting the notion that paying your staff was “difficult” and they spread fear, uncertainty and doubt regarding penal-ties from tax authorities like the Canada Revenue Agency.

“Payroll can be easy, convenient and accessible from any device.”

Nothing can be farther from today’s reality—payroll can by easy, convenient and accessible from any device. Just like online banking, payroll in Canada has evolved to use the latest cloud technolo-gies making it simple to get your staff paid. Online electronic payments have eliminated the need for paper cheques while employees enjoy convenient 24/7 access to their pay history without wor-rying about printed stubs and reports.

The hallmark of any modern dental practice is automation and simplifica-tion. Just as your patient records become electronic, so should your business operations. The convenience and safety of electronic records helps streamline your operations giving you more time to focus on running your business.

If you haven’t reconsidered how your staff get paid—you’ll be surprised at the changes in the last year. Modern cloud-based accounting and payroll has revo-lutionized how Canadian businesses operate. Gone are the days of the “dark arts”—financial information about your business and staff is available immedi-ately on the mobile device you are carry-ing now. Security and privacy has also evolved to keep pace to ensure that these systems are, in fact, safer than the old desktop you might have been using.

Fees for paying your staff have also come down to realistic levels—in fact, some cloud-based payroll services offer their tools for free. Knowing which ones are right for you requires just a bit of

By adopting these tips you’ll ensure that paying your dental staff is compli-ant with local regulations, and impor-tantly, convenient to do.

tax documents like T4 and RL-1 (Québec) forms.

• Eliminate cheques, which not only cost you more to issue, but can become a tracking and reconcilia-tion nightmare for your bookkeep-ing. Safer and more secure elec-tronic payments are preferred by your employees—choose direct deposit and save.

• Keep detailed records. Most prov-inces require you to retain employee pay records to facilitate tax and other social service benefits. Use an online service that maintains these electronic records for you in a secure location safe from theft, fire and other threats.

• Consider employee benefits and incentives as a way to retain and attract staff. While direct compen-sation is a key factor for employees, most put a high value on benefits and rewards as part of their overall pay. Look for a payroll service that accurately calculates and tracks the tax burden for these programs.

• Ensure your payroll service canintegrate with your bookkeeping and accounting system. Cloud based accounting services like Kashoo, Xero and FreshBooks are convenient and rival the capabilities of old desktop software—make them, and integrated cloud payroll part of your modern practice.

Planning for the FutureAccounting strategies to help dentistsreduce debt and retire soonerANDREA CHAN

Savvy clients and a surplus of dental professionals have helped create an

ultra-competitive marketplace through-out Canada—making it challenging for mature practices to stay profitable and service outstanding debt at the same time.

As dentists reach retirement age, many are still carrying hefty loans and don’t have sufficient savings. From new equipment purchases to training for cosmetic procedures, dentists are incur-ring more debt as they explore alternate revenue streams and technologies in an effort to regain their competitive edge. Before taking on additional credit in an effort to compete, it’s important to con-sider the long-term impact more debt will have on your practice and future.

In Canada, the average education debt upon graduation from dental school is $170,0001. The average loan to buy a dental practice is $450,000.2 The average home mortgage is $301,000.3 These three common loans tally almost $1 million – without factoring in other types of per-sonal and business loans.

Debt overload puts the financial se-curity of your business, personal assets and loved ones at risk. To avoid getting into more debt, take control of your fi-nances by evaluating decisions against the following criteria:

Your Current Financial SituationIt’s critical to know what your spending habits are. Track both your personal and business expenses for a few months. This will give you insight to determine wheth-er you can increase your line of credit or not without overextending yourself.

Your Retirement GoalsSetting goals will allow you to maintain focus on what you want to achieve in the future and help you estimate how much fulfilling those goals will cost. Think about your personal, professional and financial goals for yourself and for your family, then establish a timeframe

to complete each goal in terms of sav-ing, investing and paying down debt. Consult your accountant to prioritize your goals and effectively estimate your retirement needs.

Your Risk Tolerance Determine what risks you’re comfort-able with. Be sure to consider your age, income, cash flow, timelines and per-sonality before making the decision to acquire more credit.

Your Credit Rating Essentially, the better your credit score, the less you will pay for a loan. The im-portance of maintaining a good credit rating, in part by making bill and loan payments on time, cannot be stressed enough. Making a payment even one day later can weaken your credit profile.

Your Debt Elimination Plan Ask your accountant to help you de-velop a loan repayment schedule to pay down debts in the most timely, cost-effective way. Balances, interest rates and tax consequences are all important considerations.

Your Tax Plan Optimizing your tax plan is critical in helping dentists manage debt effectively. For example, if you set up and structure a professional corporation to allow fam-ily members to be shareholders, you can pay down personal debts by paying out income to those who are taxed at a lower rate than you.

If you are in a position to take on ad-ditional credit, then it’s important to consider the following before you sign on the dotted line:

Determine Potential Impact of Debt Choices When selecting a financing option, it’s important to consider your entire finan-cial picture before taking on new credit in terms of payments, cash flow, time-

lines and your financial security.

Investigate Loan Options Generally, dentists can secure personal or practice loans or lines of credit quite easily, but the associated costs can vary widely. Some financial institutions offer special rates and packages to health care professionals. Ask your accountant for referrals to ensure you receive the best rate and the right form of financing.

Secure Appropriate Insurance Ensuring you have sufficient insurance coverage is important in order to protect yourself, your loved ones and your den-tal practice from financial challenges. Insurance can serve a variety of pur-poses, from collateral for a practice loan to protecting your family’s well-being if you were unable to work.

If you still find yourself overextend-ed, don’t fall behind on payments. This could negatively impact your credit rat-ing for years or, in the case of late gov-ernment remittances or payroll, could trigger major penalties. Instead, meet with your accountant to discuss pos-sible solutions to ensure your retirement turns out the way you imagined it.

1 TheNewDentist.net, summer 20102 TheNewDentist.net, summer 20103 Mortgage Pulse, RateSupermarket.ca

Andrea Chan, CA, ([email protected]/ 1.877.251.2922) is a partner of MNP LLP (www.MNP.ca) who works with dentistsand other professionals to enhance the profitability of their practices and to achieve personal financial wellbeing for themselves and their families.


t r a v e l t h e w o r l d

Rioon therise


T here’s something about Rio. This iconic city has all the things you might expect: out-of-this-world scenery, quintessential beaches, gorgeous locals, tasty

caipirinhas (Brazil’s classic cachaça cocktail), football frenzy, flip-flops (that is, Havaianas, made right here) on every foot…and plenty of buzz. There’s a chaotic thrum to Rio. The vibe is both supremely laid-back and always ready to party.

It’s the carioca spirit. Rio locals are dubbed carioca, and they fit the stereotype of beach-loving, surf-riding, sun-bathing, party-going… This is the home of bossa nova, the inspiration for “The Girl from Ipanema,” the vibe that begot the Copacabana. Think Carmen miranda. It’s about being simpático or carismático. The cariocas of Rio are proud to be friendly, fun and free-spirited. To be a “very carioca guy,” explains my rather charming guide (carioca himself), is to be “not so serious, cool,” like one of Brazil’s most famous actors, Rodrigo Santoro. “He would go in Havaianas to the shopping mall.”

That simpático nature bodes well for Rio’s upcoming spotlight on the world stage: first, the FIFA world Cup in the summer of 2014, then the Olympics in 2016. Rio needs no preparation in hosting a party—after all, it puts on Carnaval every year—yet, with the entire globe focused on the city soon, Rio is pulling out all the stops. Some major cleaning up is going on, from educating its vast populace (over six million) on recycling and sustainability to the pacification of its favelas, the Portuguese term for the shanty towns that creep up Rio’s hillsides.

Dona marta favela is home to over 6,000 people in Rio’s Botafogo neighbourhood. Residents and guides Veronica and Salete take me on a walking tour that’s part of a government initiative to redefine what a favela is—from a drug- and gang-riddled vacuum of lawlessness to a thriving community in its own right. This Rio Top Tour is an insider look at Rio’s model favela.

It’s the first favela to open to the public and cooperate with police. In 2008, just a few short years ago, a special-ops mission came in to clean up a neighbourhood held hostage by gangs. now there’s a water treatment facility and u.P.P. (unidade de

The summer season is just starting in Rio de Janeiro, Brazil, an always happening city now gearing up for the World Cup + Olympics

Local boys hit Ipanema Beach at sunset. above, clockwise from top left Christ the redeemer overlooks all of rio; Speedo-clad carioca strolling the tiled sidewalk of Ipanema; downtown skyscrapers; Coconut-water break, rio style.

clockwise from top left Kids in Dona Marta favela; Ipanema surf at sunset; the view from Sugar Loaf; Vendor in the heart of Dona Marta favela; carioca guide, João; Dona Marta residents and rio Top Tour guides, Veronica and Salete.

story + photography BARB SLIGL




WEB BRANDING PRINT MARKETING Website Design Custom Programming E-Commerce Mobile Websites Corporate Portals Social Media

Full Company Branding Image Consultation Logo Design Business Card Design Stationery Design

Creative Services Flyers & Brochures Print Ads Greeting Cards Postcards

Online Marketing SEO Services Direct Mail Promo Products

NO MATTER HOW GOOD YOU ARE, THERE ARE MANY PEOPLE IN YOUR AREA THAT DON’T KNOW ABOUT YOU!This is where direct mail comes in. is We will design, print and mail your marketing material. We specialize in direct mail campaigns that provide an ongoing consistent message to your target audience, delivered by Canada Post.

DIRECT MAIL one of the most powerful marketing methods.

Households Households Households Households5,000 10,000 15,000 20,000

PRICES INCLUDE DESIGN, PRINTING AND DELIVERY BY CANADA POST

$1300 $2170 $3100 $3975

WEB BRANDING PRINT MARKETING

HOW’S YOUR INTERNET PRESENCE?

DO PEOPLE IN THE NEIGHBOURHOOD KNOW ABOUT YOU?

When we design your , we ensuring that your mission and

values are reflected online.

Our Websites are functional, user-friendly and search engine friendly. Let us build your website and enjoy... QUALITY, FUNCTIONALITY & AFFORDABILITY.

WEBSITE aim to give your practice the best possible representation on the web,

Web Design & Development Services:

www.i uestMedia.netQ

Target Target Target Target

Email: [email protected] Call Toll Free: 1-888-502-2526

Web Presence StrategyCustom Website DesignWeb HostingCustom ProgrammingE-CommerceMobile WebsitesCorporate PortalsSocial MediaEmail us [email protected] us Toll Free 1-888-502-2526Visit us online www.iQuestMedia.net

Polícia Pacificadora) or Police Pacification unit on site. It’s the first favela to have electricity (legally, that is), water on tap and internet—a dramatic turnaround from once being considered one of the most dangerous favelas in Rio.

But there’s no dwelling on the past here. It’s about the future, not the past. Dogs are yapping, kids screeching and chasing each other, teens playing soccer (on a pitch with astro turf!). This favela is full of life. There’s even a funicular (it’s one of Rio’s steepest favelas), but we walk the zig-zag of narrow corridors amidst the jumble of cracker-jack-stacked homes. It’s like making one’s way through a maze.

we pass a group of young men playing truco (a lively card game), an old man sweeping his threshold, a woman sitting on her stoop. A man sells candy from his tiny stall perched at the top of crooked stairs. Another man hawks fresh-baked sonho or “dream,” a donut oozing with a caramel cream filling. we come upon one courtyard where people are setting up for some forró, a Brazilian music and dance style with a partner “for everyone,” says one local. Another stand sells brigadeiros, a beloved sweet treat made from condensed

milk (Brazilians have a sweet tooth) that’s inspired a common saying, “we have a brigadeiro sky today,” meaning clear, blue skies.

That picture-perfect sky might best be seen from across the city atop another of Rio’s seemingly endless peaks, where it’s been said “God comes down every morning and has his breakfast on Sugar loaf.” looking back at Sugar loaf with a beatific expression—and Dona marta as well—is Rio’s main hallmark, Christ the Redeemer, himself visible from just about anywhere in the city. The outstretched arms (a 28-metre span) of the stylized, stark-white Christ figure (38 metres tall) atop Corcovado mountain seem to welcome visitors and embrace locals at the same time, whether those lounging on hip-and-high-fashion Copacabana or trekking up the steep steps of Dona marta’s upper reaches.

A funicular takes us to the seemingly unreachable peak, followed by stairs or an escalator up the side of the mountain (really!) to the base of the statue. Gathered around the stylized folds of Christ the Redeemer’s robe are the masses. This is what everyone who comes to Rio wants to check off the list. And it’s worth it, if only

Oral Health Classified Ads PRACTICES & OFFICES SECTION

00601 MAY 13 TOP RIGHT HAND PAGE

Al Heaps & Associates Inc.LOCAL KNOWLEDGE — INTERNATIONAL EXPOSURE

Al Heaps604-644-6297

[email protected]

Ruth Chatel604-220-4830

[email protected]

Henry Doyle604-724-1964

[email protected]

Practice Sales and Valuation Specialists

Toll Free: 1-866-638-6194 Fax: 1-866-545-6759BC: 300-1055 West Hastings Street, Vancouver, BC V6E 2E9 | Alberta: 2nd Floor 11210 107th Avenue, Edmonton, Alberta T5H 0Y1

Ontario: 200-1920 Yonge Street, Toronto, Ontario M4S 3E2

We have over 55 dental practice opportunities across Canada

Please visit our website:www.HEAPSandDOYLE.com

Practices are selling for the highest value in 25 years!

Contact us for a complimentary consultation.

George Osterbauer416-312-6166

[email protected]

Palm Springs Transition Seminar and Golf TournamentTransition seminar with panel and

one-on-one discussions with transition expertsRancho Las Palmas Resort and Spa — February 2014

Dental Practice Transition SeminarsToronto, ON — September 20, 2013 – 9am – 12pm

contact [email protected] for details and registration.Saskatchewan Oral Health Professionals Annual Conference — Regina, SK – September 19-21, 2013

Northwest Dental Exposition — Edmonton, AB – September 27, 2013


The masses gather in the mist high above the city at Christ the redeemer’s feet, mimicking his

outstretched arms. a rite of passage in rio…


Gurunath E. Pujari CA, CPA, CMA, CFM, LLB (G)G.E. PUJARI CHARTERED ACCOUNTANT165 Dundas Street West, Suite 902Mississauga, ON L5B 2N6

www.gepujari.com

G.E. PujariChartered Accountant

TRUST APROFESSIONAL

TO DO IT RIGHT!

Guru is a Chartered Accountant from the Canadian Institute of Chartered Accountants and a Certified Public Accountant from the State of Illinois, USA. He is also a Certified Management Accountant & Certified Financial Manager from the Institute of Management Accountants, USA.

Guru has Healthcare Professionals in his family, who also own Dental Offices in Canada. He is conversant with tax strategies and financial planning for Healthcare Professionals and Dentists having their own practice or working as an Associate. Dentists need an Advisor who understands their business.

The right advisor can mean the difference between success and failure in your practice. We believe in being a partner in your growth. Please contact us for an initial consultation.

Off: (905) 232-9393 / (647) 800-4345Cell: (416) 876-7489Fax: (905) 232-9456e-mail: [email protected]

ACCOUNTING, TAXATION & BUSINESS SOLUTIONSFor Dentists, Doctors and Healthcare Professionals

TURNING VISION INTO VALUE

4Buying & Selling Dental Practices4Setting Up Professional Corporations4Corporate Tax Returns & Personal Tax Returns4Tax Strategies For Dentists4Assistance With CRA Audits4Business Plans & Bank Financing4Financial Statements


Capital Dental Equipment1/2-pg ad

“As a returning customer I can attest to their unbeatable product quality and a top-notch customer experience.” Dr. Jeannotte (Terrace, BC)

Capital Dental Equipment offers high-quality,certified pre-owned dental x-ray systems.

888-759-4287 capitaldentalequipment.com

The “new” way to buy dental x-ray systems.

for the view of Rio spread out far below. The mishmash of favelas and pockets of highrises are tucked between those characteristic peaks, up hillsides, skirting lagoons and bays. Ribbons of beach, far-off surf, and the vast Atlantic play peek-a-boo with shifting clouds and mist. It feels, rather appropriately, as if I’m standing atop the clouds, getting a glimpse of earth from a heavenly perch.

Guide João says, “we call it the curve of oh,” as in “Oh, ohhh…” The exclamation is repeated again and again around me. It’s one of those places that, despite all its hype and oft-seen and over-referenced imagery, doesn’t disappoint. João can’t count how many times he’s been up here. “Everyday is different,” he says. The view fluctuates between flitting clouds, mercurial sea, incessantly spreading favelas and the cranes and construction that are the harbingers of the world Cup and Olympics.

To one side is Estádio do maracanã, the football stadium built in 1950 that was once the world’s biggest, hosting some 200,000 spectators in its stands during the 1950 world Cup between Brazil and mexico. It’s since been modernized and revamped for safety as an all-seater with a capacity

of 80,000 and will be the main venue for the upcoming world Cup. It’s also the base of the Flamengo and Fluminense teams, two of Rio’s four home teams. As I’m told again and again, you haven’t experienced futebol until you’ve attended a game here with carioca fans…

After an acerola juice from one of the juice stalls found on every corner (offering fresh tropical juices like açaí and graviola that seem exotic but are everyday fare here), João demonstrates some capoiera and Brazilian jiu-jitsu while we wait for the funicular down. He nimbly flips backward off a bench, lands in a crouch before twirling in a flurry of arms and legs. The national sport (and way of life), which João describes as “human chess,” is performed on street corners, squares and in gymnasiums throughout Brazil. Besides soccer, the meld of dance and martial arts is one of Brazil’s best-known exports. That, and the rhythms of bossa nova. And, as if on cue, our descent on the funicular includes a bossa nova serenade by local musicians, hawking their trade of tunes.

After seeing the curvaceous shape of

Rio from above, we want to explore her bombshell curves up close…by bike. Rio, like most cosmopolitan cities these days, has rental-bike kiosks scattered throughout its tourist-friendly “south zone,” Zona Sul. The “BikeRio” orange bicycles are available at 60 stations

(with 600 bikes) in the neighborhoods of Copacabana, Ipanema, leblon, lagoa, Botanical Garden, Gavia, Botafogo, urca, Flamengo and Centro. And there are an astounding 250km of official cycle paths.

we weave along a small portion of that, around the lagoa or lagoon (stopping at the Flamengo football team’s store for souvenirs) and by Ipanema Beach, past surf shops and kiosks with heaps of coconuts. Post-ride, we sip from one of those freshly cracked-open coconuts, Rio-style, as locals gather in the fading light for impromptu samba dancing. A Speedo-clad carioca walks by in Havaianas on the Portuguese-tile-patterned sidewalk. This is Rio. Another local, standing at a crowded corner café, drink in hand, says, “Congratulations!” what for, we ask. His matter-of-fact answer: “you are here!” Indeed.

roCK IT In rIo Now’s the time to discover Rio de Janeiro’s carioca spirit—summer’s starting and the pre-World-Cup-and-Olympics party prep is underway. rioguiaoficial.com.br/en/home

if you go +


t h e t h i r S t y d e n t i S t J a n e t g y e n e S

essential bar toolsOutfit your home bar with tools of the bartender trade

Janet Gyenes is a magazine writer and editor who likes to dally in spirits, especially when discov-ering something like corenwyn jenever (a gin-like Dutch spirit)—straight or in cocktails like the “bramble.” Have a boozy idea or question? Send it to [email protected]

There’s something of an art to making a cocktail well at home, whether a Hemingway-inspired Death in the

Afternoon or a Sazerac that’s reminiscent of a night spent in new Orleans. Of course, the all-important first step is to have quality ingredients at the ready (liquor, juices, sodas and garnishes), but making drinks quickly, consistently and with minimal fumbling

through cupboards and drawers, requires a few tools of the bar-

tender trade. Crack open a copy of

The PDT Cocktail Book, the celebrated bartender guide penned by resident mixolo-

gist Jim meehan, and 30 bar tools—from absinthe spoons to

swizzle sticks—are listed within its pages in medical precision. There are tools for measuring, muddling and misting and tools for stirring, shaking and straining, each accompanied by an artful illustration. It’s one part Gray’s Anatomy and one part Cabinet of Natural Curiosities.

Thorough? yes. Overwhelming? A little. I turned to Halifax-based bartender, Jenner Cormier, who was recently named Diageo world-Class Canada Bartender of the year, to pare the pro-tools list down to a handful of home bar essentials.

Cormier’s top two tools are the Boston shaker and mixing glass. The Boston shaker is essentially two parts—a shaking tin and a mixing glass. (A pint glass will work for the latter). “If you have this tool,” says Cormier, “you are able to not only shake cocktails us-ing both components, but you are also able to stir cocktails using just the mixing glass.”

Sure, a Boston shaker looks and operates like the utilitarian “everyman” shaker, com-pared to handsome sleek three-part cobbler shakers, which come with a cap (often used as a measure) and built-in strainer. There’s a downside to all that style, though. The parts can be tough to wrest apart and the small strainer makes for a slow pour.

when to shake? As general rule, shake cocktails that include juice, eggs or cream. Ice is a key player here, not just for chilling in-gredients but for diluting the mix, so skip the monster cubes for this step. Fill the metal por-

tion of the shaker halfway with ice and shake vigorously for at least eight to 10 seconds to get ingredients amply chilled and diluted.

Stirring is preferred when a cocktail is composed only of spirits, such as a classic manhattan. Again, ice is essential (your stirring glass should already be chilled). Add the ingredients to the glass and let your mind wander for 10 seconds or so while stirring with a long-handled bar spoon. Have two to three spoons on hand, suggests Cormier.

“There are dozens of beautifully designed and extremely handy bar spoons on the mar-ket right now. These can be used for stirring cocktails and also as a measurement tool.” Some spoons come with trident tips, ideal for fishing cocktail onions and cherries from jars; others feature flat bottoms that can double as muddlers for mashing mint.

what’s shaken or stirred must be strained into a glass before being garnished (if appro-priate). Cormier recommends the tried-and-true hawthorne strainer, which is “crucial for straining shaken cocktails; [it does] a really good job straining out debris and/or ice shards, keeping your drink smooth and clean.” A julep strainer, which looks like a big metal spoon shot with holes, is the go-to for stirred drinks.

when it comes to measuring, forget about free pouring, unless you can eye an ounce with laser-like precision. And put down that shot glass: use a jigger. A great-tasting beverage is about balance after all. A jigger is often made of stainless steel and looks a little two funnels stuck together, with a different measure on each side.. Again, Cormier suggests having a few different volumes (measured in ounces) on hand.

There’s no reason why you can’t raid your kitchen for paring and chef’s knives. The for-mer will help you cut garnishes (think classic lime wedge or orange twist), while the latter will let you cut citrus safely and efficiently for juicing, says Cormier. The same goes for juicers, whether a low-tech hand press or an electric one. Don’t have either? Consider how much citrus you’re going through and purchase accordingly.

you’ve got the home bar essentials handy—what next? Cormier extols the vir-tues of PDT as a great cocktail-oriented book

for beginners. But if you’re lready beyond

basics, he recommends Amy Stewart’s The Drunken Botanist, which focuses on indi-vidual ingredients.

Above all, avoid making up your mind that there is only one way to make a cocktail, says Cormier. “Depending on where you are in the world ... everyone will make drinks dif-ferently. I believe that that is where the beauty is; you create your cocktail around your needs. you can never learn too much.”

Part 1: the tools

(Part 2: the booze; stocking your bar)

[1] PRESS > Chef’n citrus juicer. $19.99, amazon.ca [2] MEASURE > Cocktail measure in 18/10 stainless steel. $50, Alessi; alessi.com [3] SHAkE + STIR > 18/10 stainless steel Boston shaker with glass tumbler. $173, Alessi; alessi.com [4] STRAIN > Brass/horn hawthorne strainer. $20, Williams-Sonoma [5] SlICE > Eight-inch forged chef’s knife and three-inch forged paring knife. $110 and $80, Victorinox Swiss Army; 1-800-665-4095 [6] DISCOVER > The Drunken Botanist: The Plants that Create the World’s Best Drinks. $24.95, amazon.ca [7] lEARN > The PDT Cocktail Book: The Complete Bartender’s Guide from the Celebrated Speakeasy. $29.95, chapters.indigo.ca [8] STIR > Brown bone stirrer spoon. $10, Williams-Sonoma; williams-sonoma.ca

Splurge or Steal? > Buy quality tools, but it’s not necessary to spend a small fortune.

Next-level bar toolS > Oak barrels: fun for aging cocktails, bitters or certain ingredients. Available from a few different cocktail suppliers online.

Secret weapoN > Books. Cookbooks and cocktail books (old or new) can be very helpful for discovering new flavour combinations.

6

2 5

1

3

jenner cormier’s tools + tips

4 7

t h e h u n g r y d e n t i S t

FOO

D P

HO

TO: D

R. H

Oll

y FO

nG

For those of us with school-age chil-dren, September seems like the start of a new year. It’s the return to bag

lunches and sandwiches. my eldest used to like leftovers for lunch, but last year she succumbed to peer pressure and asked for sandwiches. However, she wasn’t too keen when given plain deli-meat-and-lettuce sandwiches. If you think about it, a sand-wich is nothing more than filling between slices of bread. why does it have to be deli meat? If you’re too rushed to grill or roast something yourself, there are supermarket takeaways like rotisserie birds. And if you go to a Chinese roast-meat shop or grocery with a hot-food counter, you’ll find BBQ pork, soya chicken or roast duck.

my eldest’s favourite is the Peking-duck sandwich. Roast duck from Chinese shops has the same flavour as Peking duck in a restaurant, only without the crispy skin. Pick up a whole roast duck and ask for it to be split in half lengthwise or quarters (other-wise it’ll be chopped into bite-sized pieces not suited for sandwiches). At home, use the breasts for sandwiches and reserve the thighs and legs for another meal (they’re great with vegetables and noodles). Give the sandwich some crunch with sliced rad-ishes or daikon “noodles” (using a Japanese

Benriner or mandoline slicer). Add hoisin-flavoured mayonnaise, tomato, avocado, greens and pecan-and-dried-fruit bread to make a delicious “out of the box” fusion sandwich. make your own hoisin mayon-naise (recipe upon request; email [email protected]), or simply add hoisin sauce to mayo.

The traditional wine pairing with duck is an old-world Pinot noir, but a Côte du Rhône with mostly Grenache rather than Syrah also works well. I paired this Peking-duck sandwich with the Chateâu de Bord 2010 laudun Villages la Croix de Frégère, which has a deep, dark fruit-forward nose with tastes of cherry and raspberry, soft tannins and a long peppery finish. The wine wasn’t overwhelmed by the sweetness of the hoisin sauce, and brought out the anise and chili flavours in the sandwich.

2 roasted duck breasts1 large ripe tomato, cored

and sliced crosswise into 6 rounds

1 large firm but ripe avocado1 tablespoon lemon juice4 radishes washed, stem

ends removed and thinly sliced (or optional 1 small daikon radish, peeled and turned into thin strands)

2 stems green onions, rinsed, ends trimmed and thinly sliced on a diagonal

box of baby kale or arugula, rinsed and dried

12 slices of pecan-and-dried-fruit bread (fig-and-anise or cranberry pistachio also work well)

hoisin mayonnaise

peKInG DuCK SanDWICH (SerVeS 6)

Halve avocado. Pit, peel and cut thin slices lengthwise. Drizzle with lemon juice. Set aside.

Remove skin from the duck breasts (delicious on its own if you scrape off the adhering layer of fat with the back of a knife) and any fat on the meat. Remove meat from the breast bone by slicing down close to the bone. Lay a breast, cut side down on a cutting board. Using a sharp knife, make thin cuts parallel to the board (approximately ¼-inch thick).

Toast bread and thinly spread with hoisin mayonnaise. Sprinkle on sliced green onions. Reserve some mayonnaise to spread on the duck, if

desired. Divide the duck, avocado, tomato and radish or daikon amongst 6 toast slices. Add a handful of baby kale. Cover with the remaining bread. Secure each sandwich with 2 toothpicks, if desired and halve to serve. Enjoy with some sliced raw peppers and carrots.

This Peking-duck

sandwich calls for a Château de Bord

2010 Laudun Villages La Croix de Frégère that can stand up to

the sweetness of hoisin.

fusion sandwichThis school year, serve up this “out of the box” lunch

Dr. Holly Fong is a practising speech-language pathologist with three young children who’s always trying, adapting and creating dishes.

“Everyone’s First Choice for Rewards”

Canadian Owned & Operated since 1981

www.noveltoy.ca

Ask for a new catalogue:

1-800-663-8966

•Low Prices•No order too small•Small package sizes

Our best sellers:

Dr. John’s Sugarless Lollies 50@ $14.99

Oralabs’ Scope Outlast Mini Brush 60@ $54.99

Dental Duckies12@ $10.99

1” Rubber Smile Tooth Ring 36@ $16.99

3.5” Bendable Tooth Man24@ $19.99

8


Use this space to deliver your message to

15,500 dentists across Canada.

Call 604-681-1811 now.*your ad here!

d i v e r S i o n

Enter for a chance to win one of four prizes: 1 one of three $1,000

gift certificates to a Profitable Practice Destination CE seminar in Jamaica or alaska, and 2 a VISA gift card.

sudokuSolve Sudoku puzzle #2 to win a $100 Visa gift card, compliments of ROI Corporation and to be entered into a draw to win one of three $1,000 CE gift Certificates to be used towards Profitable Practice’s Destination CE—in Jamaica or Alaska!

Each Sudoku puzzle has a unique solution that can be reached logically without guessing. Fill in the grid so that every row, column and 3x3 square contains the digits 1 through 9. gOOD lUCK!

LAST ISSUE’S WINNER: Dr. Luc Leboeuf of St. Zotique, PQ (VISa gift card, value $100)

5

8

4

1

3

9

6

89

42

12

4935

3

4637

52

32

97

8

4

5

7

5

1

3Puzzle by websudoku.com

sudo

ku1 ea

sier

sol

utio

n on

pag

e 28

2

39

6

78

9

4

35

52

5

312

6

24

31

4

4

56

7

19

4Puzzle by websudoku.com

sudo

ku2 ha

rder

sol

utio

n in

nex

t iss

ue Sudoku conteSt entry form (solve + send in sudoku!)

name: __________________________________________________________addreSS: ________________________________________________________city, province, poStal code: _________________________________________e-mail: _________________________________________________________tel: ____________________________ fax: ____________________________

Sudoku conteSt ruleS: 1. entry form must be accompanied with solved puzzle. only correctly solved puzzles entered into random draw. 2. Send puzzle + entry form to Just For Canadian Dentists, 200 – 896 Cambie St., Vancouver, BC, V6B 2P6 or fax 604-681-0456. entries must be received by october 17, 2013. 3. prize: $100 visa gift card compliments of roi corporation pluS a chance to win 1 of 3 $1,000 ce gift certificates to be applied to dentist’s choice of profitable practice’s destination ce in Jamaica (valued at $2,312) or alaska (valued at $4,699). contest closes dec. 15, 2013; winner contacted by dec. 31, 2013. 4. contest can be changed and/or cancelled without prior notice. 5. all entries become property of in print publications and roi corporation.

at your service�e Top 1% of Canadian Dentists Reveal �eir Secrets

Download your FREE copy of Dr. Bill Blatchford’s new e-book

now at: www.blatchford.com/canada

“For the past 20 years, Dr. Bill Blatchford’s highly efficient systems have helped me do more implant dentistry and

more full mouth reconstruction cases…while enjoying more time off.”

-- Dr. Ron Zokol, Vancouver, B.C.Free Recorded Message & Free Analysis:

512-703-8095

feeling lucky?

2 contests to enter!

2

1ce gift certificate conteSt entry form (no sudoku necessary!)

name: __________________________________________________________addreSS: ________________________________________________________city, province, poStal code: _________________________________________________________________________________________________________e-mail: _________________________________________________________tel: ____________________________ fax: ____________________________

ce gift certificate conteSt ruleS: 1. contest entries will be entered into a random draw. 2. Send entry form to Just For Canadian Dentists, 200 – 896 Cambie Street, Vancouver, BC, V6B 2P6 or by fax to 604-681-0456. entries must be received by december 15, 2013. 3. prize 1 of 3 $1,000 ce gift certificates to be applied to the dentist’s choice of profitable practice’s destination ce seminar in Jamaica (valued at $2,312) or alaska (valued at $4,699). winner will be contacted by december 31, 2013. 4. contest can be changed and/or cancelled without prior notice. 5. all entries become property of in print publications and roi corporation.

Practice Valuations - Practice Sales

CURRENT OPPORTUNITIES

Alan Rustom Broker

[email protected]

For up-to-date listings, please visit www.Practice4Sale.ca

Toll Free 1-855-310-SOLD

TORONTO - ORTHODONTIC OFFICE

TORONTO – Leaside Area

ETOBICOKE

Well established.

Nicely set-up with high end finishes. Doctor working 2-3 days a week. Ideal for a full time Orthodontist. Current Production $1.1M with potential growth to $2M. Email Alan for details.

Very nicely designed practice

consisting of 2 fully equipped and 2 plumbed operatories. Live-work set-up with a gorgeous 2 floor home above the practice. Price includes practice and property. Same owner for 13 years. Seller retiring and will transition for a short time. Excellent location and high exposure with lots of growth potential. Co-listed with Hill Kindy Group. $1.795 Million.

Recently renovated. 3 fully equipped

operatories. Pan X-ray. Annual production around $650K. Very low overhead and highly profitable.

Very nice office

with high end finishes. 3 fully equipped ops and 3 plumbed. Very busy plaza. Excellent exposure. Ceph/pan. All digital. $300K annual billing with working 2 days only. Email Alan for details.

30 MINUTES NORTH OF TORONTO

SCARBOROUGH, ON

2 operatories. Digital pan. All digital

x-rays. Annual billings of $500K. Ideal for an owner/operator. Fully computerized. Email Alan for details.

MAPLE, ON

KEELE & LAWRENCE

2 Hours NW of Toronto

WEST CENTRAL TORONTO

TORONTO - Rosedale

3 Operatories Hygiene clinic. Completely set-up

to be dental. 1 fully equipped operatory and 2 plumbed. X-ray wall bracing throughout. Very nice modern set-up. Email Alan for details.

4 operatories. This is an office set-

up only with approximately 150 patients. Great potential. Priced to sell. Asking $79,000. Good rent. Long term lease. Owner moving to a practice up north. Contact Alan for details.

Annual billings of $1.2M.

5 operatories. No weekends. Property also for sale. Highly profitable.

Two fully equipped

operatories. Annual production around $425K. Property is also for sale. Excellent opportunity next to TTC station.

Well established under the same

owner for over 22 years. Annual production of $425K. Fully computerized. Amazing area with high end neighborhoods.

SCARBOROUGH, ON 3 operatories. Analog pan. All

digitial x-rays. Recently renovated office. Annual billings over $400K. Computerized. Busy medical building. Short hours.

(7653)

S S A L L A E S S I A A R P P&

An accurate valuation of your practice is an indispensable tool that will help you make the best decisions regarding your practice and career. Meridian Sales & Appraisals not only provides exceptionally accurate valuations, but also provides invaluable advice, often increasing a practice's worth prior to a sale. Sometimes, even slight adjustments in the day-to-day operations of a practice or simple cosmetic upgrades will dramatically increase your practice's value.

Even if you're not contemplating selling your practice in the near future, having a current valuation on hand proves very useful should any unforeseen events happen. If you are thinking of selling your practice and cashing in on your life's work, it is advisable to have a valuation done three to five years before you actually plan to sell. After going through the process of a full evaluation, we can often suggest simple steps to make a practice more valuable prior to a sale.

SOLD

SOLD

SOLD

SOLD

SOLD

SOLD

SOLD

Conditionally SOLD

q LOOKING TO KNOW THE FAIR MARKET VALUE OF YOUR PRACTICE?

q READY TO SELL YOUR PRACTICE FAST FOR TOP DOLLAR?

WE ARE LOW ON INVENTORY... AND WE HAVE BUYERS EAGERLY WAITING.CONTACT ALAN IF YOU ARE THINKING OF SELLING YOUR PRACTICE.


ROI Corp.IBC full-pg

ad

My name: Kevin Aminzadeh

I live and practise in: Vancouver, BC

My training: BSC (Pharmacy), DDS, mS (Prosthodontics)

why I was drawn to dentistry: I loved the tools as a child, I loved working with my hands

My last trip: mexico

the most exotic place I’ve travelled: Tie between Vietnam and Togiak fishing village in Alaska

the best souvenir I’ve brought back from a trip: memories of children playing soccer with a soccer ball I purchased for them

a favourite place that I keep returning to: Gambier Island

Ultimate dream vacation: A farm house in a sun-drenched valley, my wife beside me, good wine, bunch of old books to read, no digital distractions

If I could travel to any time, I’d go to: Present

favourite book: Around the World in 80 Days

favourite film: Sleepless in Seattle

Must-see tV show: Suits

favourite music: Adele

My first job: Delivering Pennysavers

the gadget or gear I could not do without: Dog leash

My favourite room at home: The study

My car: Bmw

My last purchase: Gelato

My last splurge: Don’t remember

My most-frequented store: whole Foods

My closet has too many:

Shoes

My fridge is always stocked

with: Salad stuff

My medicine cabinet is always stocked with: Advil

My guilty pleasure is: A massage from a Chinese guy

favourite exercise/sports activity: Soccer

favourite sport to watch: Soccer

celebrity crush: Charlize Theron

I’d want this with me if stranded on a desert island: Rope

My secret to relaxing and relieving tension: living in day-tight compartments as advocated by Ostler. yesterday is an eternity that I cannot change, tomorrow is the beginning of an eternity that in my life I cannot

accomplish. I therefore, try to live for today.

a talent I wish I had: Playing the piano

My scariest moment: House fire, may 17, 2012, 7 pm

My fondest memory: A beach in southern Iran

a big challenge I’ve faced: lived through a war

one thing I’d change about myself: I am happy with who I am

the word that best describes me: Kind

I’m inspired by: A sunrise

My biggest ego boost: I am a self-made man

My biggest ego blow: Errors I made as a pharmacist that could have killed or harmed human beings

I’m happiest when: walking with my dog

My greatest fear: Dying alone

My motto is: Today!

a cause close to my heart: Prishan Foundation

something I haven’t done yet that’s on my must-do list: Climb the Seven Summits

If I wasn’t a dentist I’d be: Sad

Sm

al

l t

al

k d e n t i s t s s h a r e t h e i r p i c k s , p a n s , p l e a s u r e s a n d f e a r s

dr. keVIn aMInzadeh apprecIates lIfe. After surviving a house fire and living through a war, his motto is “today!” he’s an advocate of ostler’s concept of shaking off yesterday’s baggage, not getting bogged down with tomor-row’s eternity and simply embracing the now. Deep stuff. it’s likely why this dentist relishes escaping to a farmhouse in a sun-drenched valley, hanging out on bucolic Gambier island in the Pacific Northwest and walking his dog. he also has bigger travel plans: climbing the seven summits, no less. We hope to share that journey in our pages one day…

TOP

PHO

TO: C

Ou

RTES

y O

F D

R. K

EVIn

Am

InZ

AD

EH

Dr. Aminzadeh in his office, and a few

of his favourite things…including the original

travelogue. No wonder climbing the Seven Summits is on this

dentist’s list.

Advise your Patients today!

The John Robinson Group Inc.June Borlé: 604.874.4429 Fax: 604.873.5600

Toll Free: 1.888.880.2266 Email: [email protected]

www.trustedadvisor.ca

Canada Revenue Agency (CRA) Federal Legislation allows business owners tofully tax deduct 100% of their healthcare costs as a business expense using a Private Health Services Plan.

Who qualifies?Anyone who owns a business of any size, employees and dependents. No health questions or age limits. This is not insurance.

What’s covered?100% of virtually all dental and medical expenses. Visit our websitewww.trustedadvisor.ca for a complete list.

What’s the cost?There is a one-time set-up fee plus applicable taxes. The additional cost is 10%administration fee plus applicable taxes, depending on which province you live in.

Who uses a Private Health Services Plan?Business owners who:

> do not qualify for group insurance or find it too expensive> find group insurance coverage too restrictive; i.e.; orthodontics> have sick child or spouse> want front of line treatment> want to write-off child support relating to healthcare expenses> large groups who have been struggling with significant cost

increases each year.

Healthcare Costs $1600 Healthcare Costs $1600

(3% of net income) Deduct $1500 Admin Fee (10%) $ 160

Available for credit $100 Tax-deductible total $1760

Tax Credit* $25 Tax Deduction$1760EXAMPLE:Net income of $50,000 per year with family medical expenses of $1600

*Based on a combined Federal and Provincial rate of 25%.

AcupunctureAlcoholism TreatmentAmbulance

AnesthetistAttendant CareBirth Control PillsBlood tests

CatscanChinese medicineChiropractor

CrownsDentalTreatmentDentalImplantsDental X-raysDenturesDermatologistDetoxification Clinic

Diagnostic FeesDietitianEyeglassesFertility TreatmentsGuide DogHearing Aid andBatteriesHospital BillsInsulin TreatmentsLaser Eye Surgery

Lodging (away fromhome for outpatientcare)MRINaturopathOptician

Oral SurgeryOrthodontistOrthopedistOsteopathOut-of-Country Medical ExpensesPhysicianPhysiotherapistPrescription MedicinePsychiatristPsychologistPsychotherapyRegistered MassageTherapyRenovations &Alterations to Dwelling (for severe & prolongedimpairments)Special School Costs forthe HandicappedSurgeonTransportationExpenses (relative tohealth care)Vitamins (if prescribed)WheelchairX rays

A partial list of qualified expenses:

Note: This is a partial list. All allowableexpenses must qualify as outlined in theIncome Tax Act

FACT...did you know Patients can 100% tax-deductall dental expenses, fees, healthcare, vision costs...and so can you?

Why are your patients doingthis with dental expenses?

When they could be doing this!

100% TAX DEDUCTIBLE DENTISTRY

CdnDentists-fullpg-Aug13_RobinsonGroup 13-08-22 6:49 PM Page 1

JFCDentists-mayjun2013(48p)-FINAL.indd 48 8/23/13 11:46:25 AM

Documents

Just For Canadian Dentists 2013-09 September October