jurnal_y

7/28/2019 jurnal_y

1/14

Inhalation Toxicology, 21:119132, 2009

Copyright c Informa UK Ltd.

ISSN: 0895-8378 print / 1091-7691 online

DOI: 10.1080/08958370802419145

Increase of Matrix Metalloproteinases inWoodsmoke-Induced Lung Emphysema in Guinea Pigs

Carlos Ramos, Jose Cisneros, Georgina Gonzalez-Avila, Carina Becerril,Vctor Ruiz, and Martha MontanoDepartamento de Investigacion en Fibrosis Pulmonar, Instituto Nacional de Enfermedades

Respiratorias, Mexico City, Mexico

Elastolysis, collagenolysis and gelatinolysis are essential in the pathogenesis of tobacco smoke-induced emphysema; however, these activities have been scantily studied in emphysema sec-ondary to woodsmoke. The aim of this study was to analyze elastolysis, collagenolysis andgelatinolysis, MMP-1, MMP-2, and MMP-9 expression, and apoptosis in guinea pigs exposed tosmoke produced by 60 g/day of pine wood, 5 days/week, from 1 to 7 months. Histological anal-

ysis after 4 to 7 months in smoke exposed guinea pigs showed alveolar mononuclear phagocyteand lymphocytic peribronchiolar inflammation, epithelial and smooth muscle hyperplasia, andpulmonary arterial hypertension. Mild to moderate emphysematous lesions were observed inwoodsmoke-exposed animals at 4 to 7 months by increase of mean linear intercepts. A higherpercentage of whole blood carboxyhemoglobin (COHb) and elastolytic activity in bronchoalve-olar lavage macrophages and lung tissue homogenates was observed at all times. Collagenolysiswas increased after 4 to 7 months in woodsmoke-exposed animals, although collagen concen-tration did not change. Zymography revealed increase in lysis bands of the active MMP-2 andMMP-9 at 4 and 7 months in bronchoalveolar lavage fluid and lung tissue homogenate. Posi-tive immunostaining for MMP-1 and MMP-9 was observed in epithelial cells and macrophagesin wood exposed animals at 4 to 7 months. Real-time PCR showed MMP-2 and MMP-9 ex-pression at 3 to 7 months in exposed animals. Furthermore, apoptosis was increased at alltimes in bronchoalveolar lavage macrophages and lung tissue from exposed animals. Resultssupport a role of metalloproteinases and apoptosis in emphysema secondary to woodsmokeexposure.

INTRODUCTION

Chronic obstructive pulmonary diseases (COPD) are charac-

terized by irreversible airflow limitation and airway inflamma-

tion, accompanied by decreased health status. The air flow lim-

itation is usually progressive and associated with an abnormal

inflammatory response of the lungs to several noxious particles,

gases, and cigarette smoking. COPD includes chronic bronchi-

tis, emphysema, and small airway disease (Barnes, 2004; Celli

Received 28 March 2008; accepted 19 August 2008.Declaration of interest: The authors report no conflicts of interest.

The authors alone are responsible for the content and writing of thepaper.

This work was supported by a grant from the Consejo Nacional deCiencia y Tecnologa (CONACYT) Mexico, project number III-53083.

Address correspondence to Carlos Ramos, PhD, Departamentode Investigacion en Fibrosis Pulmonar, Instituto Nacional de Enfer-medades Respiratorias, Calzada de Tlalpan 4502, Tlalpan DF, Mexico,14080, Mexico. E-mail: [email protected]

& MacNee, 2004). Several cells participate in emphysema in-

flammation,inflammatorymediators, chemotacticfactors, extra-

cellular matrix (ECM) molecules, ECM degradative enzymes,

and proteinase inhibitors (Barnes et al., 2003; March et al.,

2006; Yoshida & Tuder, 2007). Macrophages are the predom-

inant cell population identified in emphysema and play an im-

portant role in strengthening the inflammatory response with

secretion of chemotactic factors, growth factors, and inflamma-

tory mediators. Macrophages also participate in ECM turnover

and degradation by secreting differentmatrix metalloproteinases

(MMPs), although neutrophils also increase and participate, se-creting a serine-elastase (Ofulue et al., 1998; Shapiro et al.,

2003).

The human MMP family consists of at least 23 enzymes that

collectively degrade all ECM components and exert selective

proteolysis of cell surface receptors, adhesion molecules,

chemokines, cytokines, and growth factors (Pardo & Selman,

2006). MMPs have been classified into six different subgroups

of closely related members with rather distinctive but often

119

7/28/2019 jurnal_y

2/14

120 C. RAMOS ET AL.

overlapping substrate specificities: collagenases, gelatinases,

stromelysins, matrilysins, membrane-type MMPs, and other

MMPs (Pardo & Selman, 2005). ECM metabolism is main-

tained in a balance between the synthesis and activity of MMPs

and that of their inhibitors such as antitrypsin and tissue in-

hibitors of metalloproteinases (Pardo & Selman, 2006). MMPs

have been strongly associated with emphysema in human andanimal models, induced by tobacco smoke exposure, oxidants,

gene-targeting of enzymes and growth factors, instillation of en-

zymes, apoptosis induction, and specific chronic inflammation

(Groneberg & Chung, 2004; Shapiro, 2007). Results of these

models have shown that even when COPD is caused by differ-

ent agents, cigarette smoke exposure remains the main factor,

especially producing emphysema and acting by means of air-

way inflammation in combination with increase in expression

and activity of MMPs, producing lung parenchyma destruction

(Yoshida & Tuder, 2007; Selman et al., 2003; Shapiro, 2007).

Conversely, recent epidemiological studies have established an-

other important cause of COPD, especially emphysema, char-

acteristically in developing countries. This cause is domesticexposure to woodsmoke and other biomass solid fuels used as

domestic heating and cooking fuels, increasing the prevalence

of chronic bronchitis and emphysema (Montano et al., 2004;

Ramirez-Venegas et al., 2006). Furthermore, World Health Or-

ganization statistics shows that 3 billion people worldwide

(45% of the worlds population) use solid fuel biomass such

as wood, crop residues, charcoal and dung, but predominantly

wood (Desai et al., 2004). Hence, indoor air pollution has been

a problem since the Stone Age. In addition, in rural areas of

Mexico, biomass, mostly wood, is used as the primary cook-

ing fuel in 69% of households as a result of poverty (Regalado

et al., 2006). Nevertheless, the effects of woodsmoke go be-

yond emphysema and induction of COPD. A recent study from

Mexico reported that 38.7% of female patients with lung cancer

(non-smokers) who were exposed to continuous woodsmoke

for >10 years lived under poverty conditions in rural areas.

The findings suggested a connection between lung cancer and

woodsmoke exposure, which may cause similar gene mutations

to p53, phospho-p53, and MDM2 protein expression, similar to

tobacco use (Delgado et al., 2005). Alternatively, the molecu-

lar mechanisms involved in the onset and progress of COPD

associated with woodsmoke exposure are only partially known

because patients are diagnosed in advanced stages of disease

(Desai et al., 2004; Perez-Padilla et al., 1996; Ramirez-Venegas

et al., 2006). Using this approach, animal models may contribute

to understanding theonset and pathological processesof emphy-

sema and other forms of COPD as occurs with animals exposed

to tobacco smoke, mimicking the onset and progression of em-

physema. Among the most important woodsmoke components

associated with health damage are CO and CO2, as wellas PM10and PM2.5 particles. PM10 are small particles with a diameter of

10 m or less, and PM2.5 are fine particles with a diameter of

2.5 m or less and can be deposited throughout the respiratory

tract (Naeher et al., 2007).

Several studies performed on human and animal models ex-

posed to different kinds of woodsmokehave shown that a variety

of pathophysiological and cellular effects in lungs and airways

can be induced (Diaz et al., 2006; Fehrenbach, 2006; Fujita &

Nakanishi, 2007; Groneberg & Chung, 2004; Matthew et al.,

2001; Naeher et al., 2007). In this manner, there are no models

of COPD and, especially, of emphysemainduced by woodsmokeexposure analyzing the participation of MMPs on lung destruc-

tion (Montano et al., 2004; Shapiro, 2007). Consequently, the

aim of the present study was to develop a sequential model of

subchronic exposure to woodsmoke in guinea pigs and analyze

histological features, elastolysis, collagenolysis, gelatinolysis,

expression of MMP-1, -2, and -9, and apoptosis with the objec-

tive of developing lesions and activities that imitate the histo-

logical and biochemical characteristics of emphysema observed

in human and experimental models induced by tobacco smoke

and other agents.

METHODSWoodsmoke Exposure and Woodsmoke Analysis

Groupsof six guineapigs weighing 330370g were exposed

for 3 h to the whole smoke produced by 60 g of pine wood/day,

5 days/week, for 1, 2, 3, 4, 6 and 7 months. The smoke cham-

ber was similar to the one described elsewhere (Matthew et al.,

2001). Briefly, the system for smoke exposure was integrated

with an electric incinerator for combustion of wood and con-

nected by a rubber tube to a whole-body inhalation chamber. At

the same time, the inhalation chamber was coupled through an-

other rubbertube to a vacuum pump. In this manner, woodsmoke

flows from the incinerator to the inhalation chamber and then

to the outside. Wood was cut into small pieces (30 10

5 mm) and placed between the heating coils in the incinera-

tor. The wood burned gradually without producing a flame. CO

concentration in the inhalation chamber was monitored with a

CO-detector (MiniCO responder Kit Dosimeter, Mine Safety

Appliances Co., Pittsburgh, PA) and maintained at

7/28/2019 jurnal_y

3/14

INCREASE OF MMP IN WOODSMOKE-INDUCED EMPHYSEMA 121

Care Committee of the National Institute of Respiratory Dis-

eases (INER), Mexico City.

Experimental and control animals were anesthetized in-

traperitoneally with sodium pentobarbital (50 mg/kg body

weight). Lungs were subjected to bronchoalveolar lavage

(BAL). Right lungs were used for morphological analysis, im-

munostaining, and real-time PCR. Left lungs were used to as-say gelatin zymography, collagenolytic activity, elastolysis and

collagen concentration. Alveolar macrophages from BAL were

used for elastolytic activity, whereas BAL fluid was used for

gelatin zymography.

Total and Differential Cell Count in BAL

Lungs were lavaged by flushing twice with 8-mL aliquots of

sterile phosphate-buffered saline(PBS) solution at 37C through

a tracheal cannula. BAL was centrifuged at 300 g for 10 min

at 4C. The pellet was resuspended in PBS and used for total cell

count with a hemocytometer. One aliquot of 100L ofcells was

fixed in 50% ethyl alcohol and 2% carbowax (50% polyethylene

glycol) and used for differential cell counting in slides stained

with hematoxylin and eosin (Selman et al., 1996; Sansores et al.,

1997). Remaining cells were frozen and maintained at 80C

until used for elastolytic activity and apoptosis.

HISTOLOGICAL ANALYSIS

Lungs were fixed in situ using a tracheal cannula with 4%

phosphate-buffered formaldehyde (pH 7.4) at 25 cm H2O pres-

sure. Lung tissues were embedded in paraffin and processed

for conventional light microscopy and immunohistochemistry.

Six-m sections were stained with hematoxylin-eosin (Selman

et al., 1996), andlungs were analyzed. Enlargement of air spaces

was analyzed by mean linear intercept (MLI), which representsthe average size of alveoli. MLI were evaluated according to the

procedure by Robbesom et al. (2003).

To measure the intercepts, a transparent sheet with 10 hori-

zontal and 11 vertical lines was laid over the images. The inter-

cepts of alveolar walls with these lines were counted. Intercepts

of bronchiole, blood vessels or septae were counted as one half

because they represent part of the structure of surrounding alve-

olar spaces. Images with bronchi, large bronchioles or blood

vessels were excluded from the measurements. Images showing

compression of alveolar space observed as meandering walls

were also excluded.

Elastolytic Activity

Elastolytic activity was performed in BAL macrophages and

lung tissue homogenates as described elsewhere (Montanoet al.,

2004). Sixteen g of 3H-elastin (specific activity = 259,000

cpm/g elastin) per well were applied to cover the bottom of 24-

well tissue culture plates, and1106 macrophages or aliquots of

lung homogenates in PBS containing 5 g of total protein were

plated on each well. Cells were maintained in RPMI medium

supplemented with 10% fetal bovine serum (FBS) at 37C, 5%

CO2/95% air for 48 h. Blanks were incubated with RPMI+ 10%

FBS or PBS alone. Positive controls for3H-elastin-coated plates

were made by incubating 10 g of bovine pancreatic elastase.

Duplicates were assayed with 50 mM EDTA or 100 mM PMSF

to inhibit MMPs or serine-elastase, respectively. Results were

calculated as follows: cpm macrophage cpm blank/specificactivity of 3H-elastin where cpm is counts per minute. Results

were reported as g of elastin degraded/106 macrophages in

48 h or as g of elastin degraded/mg protein in 48 h.

Collagenolytic Activity Assay

In order to determine the influence of collagen degrada-

tion in this model of woodsmoke exposure, endogenous col-

lagenolytic activity was measured as described previously (Sel-

manet al., 1996).Lungswere homogenized at 4Cin50mMTris

[tris(hydroxymethyl-aminomethane)] buffer, pH 7.4, 10 mM

CaCl2, usinga homogenizer (BrinkmannInstruments, Westbury,

NY), and 1-mL aliquots were incubated at 37C for 24 h. Colla-

gen degradation was stopped by adding 0.4 M EDTA at the endof the incubation period. As controls, replicate tissue samples

wereincubated underidenticalconditions except for the addition

of 0.4 M EDTA for the entire incubation period. Homogenates

were centrifuged at 4C and collagen digestion was detected by

the release of soluble hydroxyproline-containing material into

the supernatants.

To control the ratio of enzyme activity to substrate, collagen

content wasmeasuredin all aliquots. Collagenolytic activity was

expressed as g of collagen degraded/mg of collagen incubated

in 24 h.

Measurement of Collagen

Collagen concentration was measured by means of hydrox-

yproline content as described previously (Cisneros-Lira et al.,

2003).100-mg aliquots of lung tissue were dried andhydrolyzed

in6NHClfor24hat110C, andthe hydroxyproline content was

evaluated colorimetrically. All assays were done in triplicate.

Lung Tissue and BALF Gelatin Zymography

Gelatinolytic activity was performed in left lung tissue ho-

mogenates (LTH) and BALF. Substrate gel electrophoresis was

carried out by incorporating 0.1% gelatin (Sigma Chemical

Co., St. Louis, MO) into standard 8% SDS-PAGE under non-

denaturating conditions as described elsewhere (Pardo et al.,

1996). Aliquots of 3 g of total protein from BALF or LTH su-

pernatants from control and experimental animals were added

per lane, and gels were run at a constant current of 10 mA. Af-

ter electrophoresis, gels were rinsed in 2.5% Triton X-100 and

then incubated in TNC buffer (50 mM Tris-HCl, 0.15 M NaCl,

20 mM CaCl2, and 0.02% sodium azide, pH 7.4, with or with-

out 20 mM EDTA) at 37C overnight. Each gel was stained in

0.05% Coomassie blue R-250 (Bio-Rad, Richmond, CA) and

was detained in 10% methanol/10% acetic acid. Gelatinolytic

7/28/2019 jurnal_y

4/14

122 C. RAMOS ET AL.

activity was detected as clear bands on a blue background on

the stained gel. Serum-free conditioned medium from human

lung fibroblasts was used as a gelatinase A (MMP-2) marker,

and serum-free conditioned medium from phorbol myristate ac-

etate (PMA)-stimulated U2-OS cells was used as a marker of

gelatinase B (MMP-2). Similar gels were incubated but in the

presence of 20 mM EDTA.

Immunohistochemistry

Immunohistochemical evaluation for MMP-1 and MMP-9

was performed as described elsewhere (Segura-Valdez et al.,

2000). Lung tissuesections were deparaffinized, rehydrated, and

then incubated for 30 min with H2O2 (3%) in methanol fol-

lowed by antigen retrieval with citrate buffer (10 mM, pH 6.0)

for 5 min in a microwave. Tissue sections were blocked with

a universal blocking reagent (BioGenex; San Ramon, CA) 1X

solution for 20 min and then incubated with rabbit anti-MMP-

1 (5 g/mL; Lab Vision, Fremont, CA) or rabbit anti-MMP-

9 (10 g/mL; Chemicon, Temecula, CA) at 4

C overnight. Asecondary biotinylated anti-IgG followed by streptavidin-HRP

conjugate (BioGenex) was used according to the manufacturers

instructions. 3-Amino-9-ethyl-carbazole (AEC) (BioGenex) in

acetate buffer containing 0.05% H2O2 was used as a substrate.

Tissue sections were counterstained with hematoxylin. For nega-

tive controls, the primary antibody wasreplaced by non-immune

serum.

RT-PCR and Quantitative Real-time PCR Amplification

One g of total RNA obtained from lung tissue was re-

verse transcribed using random primers and Moloney murine

leukemia virus reverse transcriptase according to the manufac-

turers protocol (Advantage RT-for-PCR Kit; Clontech, Palo

Alto, CA). Quantitative real-time PCR amplification was per-

formed using iCycler iQ Detection System (Bio-Rad, Hercules,

CA). PCR was performed with cDNA working mixture in a

25-l reaction volume containing 2 l of cDNA, 20 mm Tris

HCl, pH 8.3, 50 mM KCl, 2 mM MgCl2, 200 M dNTP, 1

M specific 5 and 3 primers (Table 1), 1.25 units of Taq DNA

polymerase (Roche, Branchburg, NJ), and 10 nM fluorescein

and SYBR green I dye 1:50,000 (Roche, Indianapolis, IN). A

dynamicrangewas built witheach PCR product on copy number

serial dilutions of 1 108, 1 107 1 106, 1 105 1 104,

1 103, 1 102, and 1 101. All PCRs were performed in

FIG. 1. Woodsmoke exposure induces body weight loss and in-

crease of carboxyhemoglobin (COHb) levels. (A) Body weight

in controls and woodsmoke-exposed guinea pigs. Bars represent

mean SD of 6 guinea pigs; *p < 0.01 compared with con-

trols using Students t-test. (B) COHb% in blood of control and

woodsmoke-exposed animals.

triplicate. Standard curves were calculated referring to the

threshold cycle (the PCR cycle at which a specific fluores-

cence becomes detectable) to the log of each cDNA dilutionstep. Results were expressed as the number of copies of the

target gene normalized to 18S rRNA. Cycling conditions for

PCR amplification to MMP-2, MMP-9 and rRNA 18s (Ta-

ble 1) were performed using the following protocol: initial

activation of AmpliTaq Gold DNA polymerase at 95C for

10 min, 40 cycles of denaturization at 95C/30 sec, annealing

at 58C/30 sec, and extension at 72C/30 sec. Specific amplifi-

cation was confirmed by the presence of one single peak in the

melting curve plots. Additionally, PCR products were analyzed

in agarose gel electrophoresis. Values are expressed as mean

SD of copy number MMP-2 or MMP-9/ 18s RNA (Pardo et al.,

2005).

TABLE 1

Primers and probes for real-time PCR

GENE Forward Primer (5 to 3) Reverse Primer (5 to 3 ) AT bp

rRNA 18s cgttgattaagtccctgccctt tcaagttcgaccgtcttctcag 60C 142

MMP-2 agggcgctctgtcct ggttcctctcgacgttgga 56C 159

MMP-9 agcactttgggaggccaagg ggtgacgtgaggtcggaccc 57C 226

7/28/2019 jurnal_y

5/14


FIG. 2. Cellular BAL profile. (A) Total cell number in control and woodsmoke-exposed animals (n = 6); *p < 0.01 compared

with controls. (B) Cellular profile in control and woodsmoke-exposed animals; *p < 0.01 and **p < 0.05. Values are expressed

as mean SD (n = 6). Significant differences from air controls are indicated.

Detection of ApoptosisApoptosis was analyzed by terminal deoxynucleotidyl

transferase-mediated dUTP nick end labeling (TUNEL) and by

measuring caspase-3 in macrophages and lung tissue sections as

described elsewhere (Ramos et al., 2006). DNA fragmentation

examined by TUNEL was done with the In Situ Cell Death De-

tection Kit (Roche, Mannheim, Germany). Macrophages from

woodsmoke exposed and control animals (1 104 cells/cm2)

TABLE 2Time course effect of woodsmoke inhalation in air space enlargement of guinea pig lungs, measured by mean linear intercepts

(MLI)

Time (months) 0 1 2 3 4 6 7

MLI (m) 85.3 24.5 86.1 18.6 89.3 28.4 118.2 39.6 167.2 34.8 231.7 57.9 248 87.7

Values are expressed as mean animals in each group.p < 0.05; p < 0.01; significantly higher than controls (Time 0).

7/28/2019 jurnal_y

6/14

124 C. RAMOS ET AL.

FIG. 3. Representative photomicrographs of hematoxylin/eosin-stained lung sections of control and guinea pigs exposed to

woodsmoke. (A) Control lung tissue showing normal thickness of alveolar septa and alveolar duct. Insert, magnification of

normal thickness in alveolar septa of only one cell layer is shown. (B) Lung section from a guinea pig exposed to woodsmoke for4 months showing alveolar mononuclear phagocyte inflammation. Insert, magnification of cell wall thickening of more than one

cell, as well as mononuclear phagocyte cells. (C) Areas of emphysematous lesions in lung of guinea pig after 7 months exposure

to woodsmoke showing air space enlargement. (D) Panoramic view from a control lung tissue. (E) Control lung tissue showing a

terminal bronchiole. (F) Lung tissue from guinea pig after 4 months exposure to woodsmoke showing lymphocytic peribronchiolar

inflammation (closed black arrow), bronchiolar epithelial and smooth muscle hyperplasia (head arrow), as well as thickening of

alveolar septae of more than one cell. (G) Lung tissue from guinea pig after 7 months of woodsmoke exposure epithelial and

smooth muscle hyperplasia (head arrow), in addition to pulmonary arterial hypertension (open arrow). (H) Panoramic view of lung

tissue from guinea pig after 7 months of woodsmoke exposure showing extensive emphysematous areas. Original magnifications:

A-C, E-G: 20; D and H:4. Inserts in A and B: 63.

7/28/2019 jurnal_y

7/14


FIG. 4. Increased elastolytic activity in BAL macrophages and

lung tissue homogenates. Elastolysis was increased in BAL

macrophages and lung tissue homogenates at all study times

in guinea pigs exposed to woodsmoke. (A) Elastolytic activity

by 1 106 BAL macrophages. (B) Elastolytic activity in lung

tissue homogenates. *p < 0.01 for all comparisons. All values

are mean SD(n= 6 per group); mean SD from groups were

compared using Students t-test. Significant differences from air

controls are indicated.

FIG. 6. Active forms of MMP-2 and MMP-9 are detected at 4

and 7 months in lung tissue homogenates and in BALF from

woodsmoke-exposed guinea pigs. (A) Representative zymo-

gram from BALF. (B). Representative zymogram from lung tis-

sue homogenate. Zymography bands corresponding to activity

of 92, 85, 72, and 62 kDa to pro-MMP9, active MMP9, pro-M

MP2, and active MMP-2, respectively.

were plated. Some macrophages were incubated with DNase

(2 U/mL) for 30 min at 37C and were used as positive controls.

After fixation, macrophages were permeabilized with 0.1% Tri-ton X-100 in 0.1% sodium citrate for 2 min on ice. TUNEL

reaction mixture was added to the slides and incubated in a

humidified chamber at 37C for 1 h. Apoptotic cells show-

ing brown nuclei were counted with an Olympus microscope

at different random fields until at least 500 cells were com-

pleted. Results were expressed as a percentage of TUNEL-

positive macrophages. Immunostaining for caspase-3 was de-

veloped with a polyclonal antibody caspase-3 (CPP32, Ab-4)

(Neomarkers, Fremont, CA) visualized with diaminobenzidine

(DAB) and hematoxylin counterstain.

FIG. 5. Endogenous collagenolytic activity. Collagenolysis was increased in lung from guinea pigs exposed to woodsmoke for 4

to 7 months; *p

7/28/2019 jurnal_y

8/14

126 C. RAMOS ET AL.

FIG. 7. Immunohistochemical detection of MMP-1 and MMP-9. Immunoassay for both MMPs was increased in macrophages

and epithelial cells and some interstitial cells in woodsmoke-exposed animals, especially from 3 to 7 months. (A) Control lung

section incubated with MMP-1 antibody showing occasional reaction product located in isolated alveolar walls. (B) Section oflung from animal exposed for 7 months to woodsmoke showing positive reaction to MMP-1 in some alveolar and interstitial cells.

(C) Section of lung from animal exposed for 7 months to woodsmoke showing positive reaction to MMP-1 in macrophages and

alveolar cells. (D) Negative control for MMP-1 showing any labeling. (E) Control lung section incubated with MMP-9 antibody

showing occasional positive reaction located in macrophages and alveolar walls. (F) Section of lung from animal exposed for 7

months to woodsmoke showing positive reaction to MMP-9 in numerous alveolar cells. (G) Section of lung from animal exposed

for 7 months to woodsmoke showing positive reaction to MMP-9 in some macrophages and epithelial cells. (F) Negative control

for MMP-9 showing any labeling (63).

7/28/2019 jurnal_y

9/14


STATISTICS

Results were expressed as mean SD. Between-group com-

parisons were made using Students unpaired t-test. Multiple

group comparisons were made using ANOVA followed by Dun-

netts multiple comparison post-hoc test; p < 0.05 was consid-

ered statistically significant.

RESULTS

Woodsmoke Composition

In order to characterize the composition of the woodsmoke,

we measured CO, CO2, O2, PM10 and PM2.5 particle concentra-

tion in an inhalation chamber during exposure. Wood-burning

quantity was adjusted to obtain a continuous exposure of CO

7/28/2019 jurnal_y

10/14

128 C. RAMOS ET AL.

FIG. 9. Apoptosis analysis in BAL macrophages and lung tissue. Increase in apoptosis was observed in BAL macrophages and

lung tissue sections in woodsmoke-exposed guinea pigs. (A) Analysis of apoptosis by TUNEL in BAL macrophages; *p

7/28/2019 jurnal_y

11/14


MMP-2 and MMP-9 at4 and 7 monthsin BALF asin lungtissue

homogenate from woodsmoke-exposed guinea pigs (Figure 6).

Immunolocalization of MMP-1 and MMP-9

To evaluate whether MMP-1 and MMP-9 were present in

woodsmoke-exposed tissues, we developed specific immunolo-

calizations. The study revealed an increase in the presence ofMMP-1 in alveolar macrophages andepithelial cells andin some

interstitial cells, especially from 3 to 7 months (Figures 7B and

7C). MMP-9 was also evident in alveolar macrophages and ep-

ithelial cells in experimental animals, mainly from 3 to 7 months

(Figures 7F and 7G).

Real-time PCR for MMP-2 and MMP-9

To evaluate whether activity of gelatinases A and B (MMP-2

and MMP-9, respectively) is accompanied by their expression,

we performed real-time PCR for mRNA obtained from lung

tissue. We found that MM9-2 transcript was increased signifi-

cantly between 3 and 7 months in woodsmoke-exposed animals(Figure 8A). mRNA for MMP-9 also was increased from 4 to 7

months in woodsmoke-exposed animals (Figure 8B).

Apoptosis

Apoptosiswas evaluated in BAL macrophages andin lung tis-

sue sections by both TUNEL staining and caspase-3 immunos-

taining. BAL macrophage apoptosis showed a progressive in-

crease during the entire study time. Controls showed 11.5

1.23% of cell positivity for apoptosis measure by TUNEL,

whereas in woodsmoke-exposed animals apoptosis showed a

progressive increase to 27 3% at 3 months and 44 6%

at 7 months; p < 0.01 (Figure 9A). Additionally, caspase-3

immunostaining was observed in BAL macrophages (data notshown). Similarresults were observed in tissuesections showing

positive immunostaining for caspase-3, chiefly in macrophages

and epithelial cells (Figures 9B and 9C).

DISCUSSION AND CONCLUSIONS

Elastolytic, collagenolytic and gelatinolytic activities have

been assumed to be clues to the pathogenesis of COPD, espe-

cially in pulmonary emphysema secondary to tobacco smoke

(Barnes et al., 2003). However, these enzymes have not been

extensively analyzed in emphysema secondary to woodsmoke

exposure (Segura-Valdez et al., 2000; Montano et al., 2004). The

use of wood and other solid biomass fuels for cooking and heat-

ing is a frequent practice worldwide, especially in developing

countries. However, respiratory alterations due to exposure to

woodsmoke have been scantily studied. Clinical respiratory al-

terations associated with long-term woodsmoke exposure are

similar to those induced by cigarette smoking. Furthermore,

chronic bronchitis and emphysema have been observed in non-

tobacco smokers exposed to woodsmoke (Ramirez-Venegas

et al., 2006; Perez-Padilla et al., 1996). The effects of tobacco

smoke on the inflammatory process and the molecular mecha-

nisms involved in lung damage have been widely studied. Simi-

larly, theincreasein expression andactivityof severalMMPs has

been strongly associated with pathogenesis of tobacco smoking-

induced disease (Yoshida & Tuder, 2007). In this context, the

MMP family collectively degrades all ECM components and

exerts selective proteolysis of cell surface receptors, adhesion

molecules, chemokines, cytokines, and growth factors, actingtherefore in tissue homeostasis. The action of MMPs is consid-

ered crucial in ECM turnover and degradation in emphysema

and other forms of COPD (Barnes et al., 2003; Pardo & Selman,

2006). In this regard, elastolysis due to neutrophil elastase and

macrophage metalloelastase (MMP-12), MMP-2 (gelatinase A)

and MMP-9 (gelatinase B) has been identified in emphysema

patients and animal models (Celli & MacNee, 2004). Addition-

ally, MMP-1 and MMP-8 activity has been evidenced (Montano

et al., 2004; Segura-Valdez et al., 2000).

In this study we focused our analysis on determining whether

exposure to woodsmoke induces increases in elastolytic, col-

lagenolytic and gelatinolytic activities and their probable as-

sociation with the development of emphysema. In addition,we assayed BAL cell profile, immunolocalization of MMP-1

and MMP-9, real-time PCR for MM-2 and MMP-9, and pro-

grammed cell death (apoptosis). We used guinea pigs because

they have proven to be extremely important in research in-

volving cigarette smoke-induced lung disease and show many

advantages and few disadvantages when used in experimental

circumstances versus other animals (Wright & Churg, 2002).

Consequently, we compared the results from this emphysema

model with the one obtained previously in our laboratory expos-

ing guinea pigs to smoke produced by 20 cigarettes/day, which

induced emphysema. On the other hand, the time points for

this study were chosen on the basis of previous experiments in

guinea pigs, which showed the onset of emphysematous lesions

at 4 months with woodsmoke exposure.

With regard to particle content during exposure in the in-

halation chamber, it is important to mention that CO concen-

tration was maintained at

7/28/2019 jurnal_y

12/14

130 C. RAMOS ET AL.

similar to what occurs in patients with end-stage emphysema

(and COPD) who have been exposed to domestic woodsmoke

(Ramirez-Venegas et al., 2006; Regalado et al., 2006 ). Alterna-

tively, a high percentage of COHb was observed at all times dur-

ing the study in comparison with controls. COHb is constituted

as an indirect measure of woodsmoke exposure, which acts as a

sensitive and specific marker of atmospheric carbon monoxideproduced from woodsmoke in both indoor and outdoor sources

(Townsend & Maynard, 2002). Elevated but variable COHb lev-

els have been seen in different animal models exposed to differ-

ent types of woodsmoke. COHb levels have been increased up

to 50% (Fujita & Nakanishi, 2007; Groneberg & Chung, 2004).

In this study, COHb levels were comparable to those found in

our emphysema model induced with 20 cigarettes/day in guinea

pigs (Selman et al., 1996; Selman et al., 2003).

BAL cell analysis showed a significant increase in total cell

recovered in woodsmoke-exposed animals (Figure 2A). Addi-

tionally, cell profile showed an increase in macrophages from

1 to 4 months, whereas neutrophils were increased from 4 to 7

months. Similar cellular changes have been described in guineapig in animal models of emphysema induced by tobacco smoke

as well as in emphysema patients (Groneberg & Chung, 2004;

Shapiro, 2007; Sethi & Rochester, 2000; Sansores et al., 1997;

Cisneros-Lira et al., 2003). This increase of macrophages and

neutrophils is crucial in emphysema and other forms of COPD

because these cells posses a secretor phenotype of MMPs and

other ECM degradative enzymes, leading to turnover and de-

struction of lung tissue (Barnes et al., 2003; Ofulue et al., 1998).

Histological analysis revealed the presence of moderate alve-

olar and phagocyte-mononuclear alveolar inflammation. This

inflammation was prominent at 3 and 4 months and was asso-

ciated with an increase in cells obtained from BAL, especially

macrophages (Figure 2B), which are from the most abundant

cells in COPD.

Airways also showed alterations such as lymphocytic peri-

bronchiolar inflammation and epithelial and smooth muscle hy-

perplasia. Pulmonary arterial hyperplasia was noted at 6 and 7

months (Figure 3G). These histological changes have been ob-

served in patients withCOPD, especially emphysema secondary

to domestic exposure to woodsmoke (Brauer et al., 1996; Perez-

Padilla et al., 1996; Diaz et al., 2006).

Mild to moderate emphysematous lesions were revealed in

lungs of woodsmoke-exposed guinea pigs from 4 to 7 months

(Figures 3C and 3H), accompanied by rupture of the alveo-

lar septa in the emphysematous lesions (Figure 3C). Emphy-

sematous lesions were analyzed by MLI. Comparison showed

MLI increased in lungs from woodsmoke-exposed4 to 7 months

(Table 2).

Lesions obtained from woodsmoke exposure were similar to

those of guinea pigs and humans exposed to tobacco smoke af-

ter 6 to 8 weeks of exposure to 20 cigarettes/day (Selman et al.,

1996; Sansores et al., 1997) but were also similar to other em-

physema models (Fehrenbach, 2006; Fujita & Nakanishi, 2007;

Groneberg & Chung, 2004). Nevertheless, in this model the on-

set of emphysematous lesions occurred at after 4 months as

we described previously. Human emphysema shows a similar

behavior because tobacco smokers develop emphysema earlier

than humans exposed to woodsmoke, although patients (espe-

ciallywomen) exposed domesticallyto woodsmoke develop em-

physema and other forms of COPD with clinical characteristics

and quality of life similarto those of tobacco smokers (Ramirez-Venegas et al., 2006; Regalado et al., 2006).

Results regarding ECM turnover revealed an increase in ac-

tivity of several MMPs with woodsmoke exposure. Elastolytic

activity was increased significantly in macrophages obtained

from BAL and lung tissue homogenates at all study times

(Figure 4) probably due to MMP-12 as shown by EDTA in-

hibition. This activity was concomitant with an increase in BAL

macrophages, and neutrophils in woodsmoke-exposed animals,

suggesting the participation of macrophages and neutrophils

in this active emphysematous process similar to experimental

and human tobacco-induced emphysema (Barnes et al., 2003;

Yoshida & Tuder, 2007). The increase in elastolytic activity

due to macrophages and neutrophils has been extensively an-alyzed in interstitial and BAL cells in cigarette smoke-induced

emphysema in rats, showing the participation of elastolysis as

an essential mechanism for emphysema (Ofulue et al., 1998;

Shapiro, 1999). Additionally, an increase of elastolysis in BAL

and interstitial macrophages derived from emphysema models

induced by tobacco smoke in guinea pigs and patients exposed

to woodsmoke has been shown (Montano et al., 2004; Sansores

et al., 1997), comparable to our results. Conversely, elastases

have the capacity to degrade gelatin, collagen IV, fibronectin,

laminin, vitronectin, proteoglycan type IV, consequently acting

in overall degradation of ECM (Shapiro et al., 2003). Further-

more, this affects basement membranes from endothelia and

epithelia, which are predominantly injured in emphysema and

COPD.

Collagenolysis, another important component of tobacco-

induced emphysema, also was increased at 4 to 7 months

(Figure 5), showing the significant role of this MMP, as oc-

curs in human and animaltobacco-induced emphysema (Selman

et al., 1996). Similarly, an increase in gelatinolysis associated

with active MMP-2 and MMP-9 was established in both BALF

and lung tissue at 4 and 7 months when the primary emphy-

sematous lesions were developed (Figure 6). This is also com-

parable to cigarette-induced emphysema (Barnes et al., 2003)

and human COPD (Segura-Valdez et al., 2000). Additionally,

gelatinolysis due to MMP-2 and MMP-9 in BAL from patients

exposed to woodsmoke has been demonstrated (Montano et al.,

2004).

Gelatinolysis due to MMP-9 and MMP-2 is significantly as-

sociated with basement membrane turnover and degradation,

determining accordingly the progression of emphysema. MMP-

9 was increased at 4 to 7 months in exposed animals, when

emphysematous lesions were observed (Segura-Valdez et al.,

2000). MMP expression analysis by real-time PCR corrobo-

rated the presence of MMPs, showing an increased expression

7/28/2019 jurnal_y

13/14


of MMP-2and MMP-9(Figure 8).Similarly, MMP-1and MMP-

9 immunostaining were increasedin exposed animals (Figure 7).

This supports their presence in macrophage, epithelial and in-

terstitial cells, which seem to participate in ECM degradation

in this emphysema model. Expression and activities of MMP-2,

MMP-9, and MMP-12 have been shown in BAL macrophages

from patients exposed to woodsmoke (Montano et al., 2004)and also in parenchyma of COPD patients (Segura-Valdez et al.,

2000).

Apoptosis, another important pathogenic mechanism re-

cently associated with emphysema, was also increased in both

macrophage and epithelial cells from woodsmoke exposed

animals (Figure 9), similar to tobacco-induced emphysema

(Fehrenbach, 2006). Recently an emphysema model induced by

apoptosis induction with caspase-3 instillation was developed,

showing that apoptosis alone is enough to induce emphysema-

tous lesions (Demedts et al., 2006).

In conclusion, this study demonstrates that subchronic expo-

sure to woodsmoke produces effects similar to tobacco smoke,

showing inflammatory lesions comparable to emphysema andaccompanied by an increase in MMP activity and expression,

as well as apoptosis. The presence of these enzymes in the res-

piratory tract seems to be responsible for degradation of the

basement membrane and interstitial ECM. This study also con-

firms the utilization of the guinea pig in lung pathology models

because it induces emphysematous lesions similar to those ob-

tained in humans and guinea pigs exposed to tobacco smoke

(Fujita & Nakanishi, 2007; Selman et al., 1996). However, the

timefor emphysematous lesions to develop with woodsmokeex-

posure is longer than tobacco smoke. Woodsmoke needs about

4 months to develop similar emphysematous lesions as opposed

to those observed after 6 to 8 weeks in a model developed in

our laboratory with 20 cigarettes/per day (Selman et al., 1996;

Selman et al., 2003).

REFERENCESBarnes, P. J., Shapiro, S. D., and Pauwels, R. A. 2003. Chronic obstruc-

tive pulmonary disease: Molecular and cellular mechanisms. Eur.

Respir. J. 22:672688.

Barnes,P.J. 2004. Mediators of chronicobstructive pulmonary disease.

Pharmacol. Rev. 56:515548.

Brauer, M., Bartlett, K., Regalado-Pineda, J., and Perez-Padilla, R.

1996. Assessment of particulate concentrations from domestic

biomass combustion in rural Mexico. Environ. Sci. Technol. 30:104

109.

Celli, B. R., and MacNee, W., with Committee Members: Standards

for the Diagnosis and Treatment of Patients with COPD. (2004). A

summary of the ATS/ERS position paper.Eur. Respir. J. 23:932946.

Cisneros-Lira,J., Gaxiola,M., Ramos, C., Selman, M.,Pardo, A. 2003.

Cigarette smoke exposure potentiates bleomycin-induced lung fibro-

sisin guinea pigs.Am. J. Physiol. Lung Cell Mol. Physiol. 285:L949

56.

Delgado, J., Martinez, L. M., Sanchez, T. T., Ramirez, A., Iturria, C.,

and Gonzalez-Avila, G. 2005. Lung cancer pathogenesis associated

with wood smoke exposure. Chest128:124131.

Demedts, I. K., Demoor, T., Bracke, K. R., Joos, G. F., and Brusselle,

G. G. 2006. Role of apoptosis in the pathogenesis of COPD and

pulmonary emphysema. Respiratory Research 7:53.

Desai,M. A.,Mehta, S.,and Smith,K. R. 2004.Indoor smoke fromsolid

fuels: Assessing the environmental burden of disease at national and

local levels (WHO Environmental Burden of Disease Series, No. 4).

Geneva: World Health Organization.

Diaz, J. V., Jonathan, K., Gotway, M. B., Nishimura, S., and Balmes,

J. R. 2006. Case report: A case of wood-smoke-related pulmonary

disease. Environ. Health Perspect. 114:759:762.

Fehrenbach, H. Animal models of pulmonary emphysema: A stereolo-

gists perspective. 2006. Eur. Respir. Rev. 15:136147.

Fujita,M.,and Nakanishi,Y. 2007.The pathogenesis ofCOPD:Lessons

learned from in vivo animal models. Med. Sci. Monit. 13(2):RA19

24.

Groneberg, D. A., and Chung, K. 2004. Models of chronic obstructive

pulmonary disease. Respiratory. Research. 5:18.

March, T. H., Wilder, J. A., Esparza, D. C., Cossey, P. Y., Blair, L.

F., Herrera, L. K., McDonald, J. D., Campen, M. J., Mauderly, J.

L., Seagrave, J. 2006. Modulators of cigarette smoke-induced pul-

monary emphysema in A/J mice. Toxicol. Sci. 92:54559.

Matthew, E., Warden, G., and Dedman, J. 2001. A murine model

of smoke inhalation. Am. J. Physiol. Lung. Cell. Mol. Physiol.

280:L716-L723.

Montano, M., Beccerril, C., Ruiz, V., Ramos, C., Sansores, R. H.,

and Gonzalez-Avila, G. 2004. Matrix metalloproteinases activity in

COPD associated with wood smoke. Chest. 125:466472.

Naeher, L. P., Brauer, M., Lipsett, M., Zelikoff, J. T., Simpson, C. D.,

Koenig, J. Q., and Smith, K. R. 2007. Woodsmoke health effects: A

review. Inhalat. Toxicol. 9:67106.

Ofulue, A. F., Ko, M., and Abboud, R. T. 1998. Time course of neu-

trophil and macrophage elastinolytic activities in cigarette smoke-

induced emphysema. Am. J. Physiol. Lung Cell Mol. Physiol.

275:11341144.

Pardo, A., Selman, M., Ridge, K., Barrios, R., and Sznajder, I. J. 1996.

Increased expression of gelatinases and collagenase in rat lungs ex-

posed to 100% oxygen. Am. J. Respir. Crit. Care Med. 154:1067

1075.

Pardo, A., Gibson, K., Cisneros, J., Richards, T. J., Yang, Y., Becerril,

C., Yousem, S., Herrera, I., Ruiz, V., Selman, M., and Kaminski, N.

2005. Up-regulation and profibrotic role of osteopontin in human

idiopathic pulmonary fibrosis. PLoS Med. 2(9):e251.

Pardo, A., and Selman, M. 2005. MMP-1: The elder of the family. Int.

J. Biochem. Cell. Biol. 37:283288.

Pardo, A., and Selman, M. 2006. Matrix metalloproteases in aberrant

fibrotic tissue remodeling. Proc. Am. Thorac. Soc. 3:383388.

Perez-Padilla, R., Regalado, J., Vedal, S., Pare, P., Chapela, R., San-

sores, R., and Selman, M. 1996. Exposure to biomass smoke and

chronic airway disease in Mexican women: A case control study.

Am. J. Respir. Crit. Care. Med. 154:701706.

Ramirez-Venegas, A., Sansores, R. H., Perez-Padilla, R., Regalado, J.,

Velazquez, A., Sanchez, C., and Mayar, M. E. 2006. Survival of

patients with chronic obstructive pulmonary disease due to biomass

smoke and tobacco. Am. J. Respir. Crit. Care. Med. 73:393397.

Ramos, C., Montano, M., Becerril, C., Cisneros-Lira, L., Barrera, L.,

Ruz, V., Pardo, A., and Selman, M. 2006. Acidic fibroblast growth

factor decreases -smooth muscle actin expression and induces

apoptosis in human normal lung fibroblasts. Am. J. Physiol. Lung

Cell. Mol. Physiol. 291:L871-L879.

7/28/2019 jurnal_y

14/14

132 C. RAMOS ET AL.

Regalado, J., Perez-Padilla, R., Sansores, R., Paramo, R. J. I., Brauer,

M., Pare, P., and Vedal, S. 2006. The effect of biomass burning on

respiratory symptoms and lung function in rural Mexican women.

Am. J. Respir. Crit. Care Med. 174:901905.

Robbesom, A. A.,Versteeg, E. M. M.,Veerkamp, J. H.,Krieken, J. H. J.

M. V., Bulten, H. J., Smits, H. T. J., Willems, L. N. A., Herwaarden,

C. L. A. V., Dekhuijzen, P. N. R., and Kuppevelt, T. H. V. 2003.

Morphological quantification of emphysema in small human lung

specimens: Comparison of methods and relation with clinical data.

Mod. Pathol. 16:17.

Sansores, R. H., Abboud, R. T., Becerril, C., Montano, M., Ramos, C.,

Vanda, B., Selman, M. L. 1997. Effect of exposure of guinea pigs to

cigarette smoke on elastolytic activity of pulmonary macrophages.

Chest112:214219.

Segura-Valdez, L.,Pardo, A.,Gaxiola,M., Uhal, B. D.,Becerril,C., and

Selman, M. 2000. Upregulation of gelatinases A and B, collagenases

1 and 2, and increased parenchymal cell death in COPD. Chest.

117:684694.

Sethi, J. M., and Rochester, C. L. 2000. Smoking and chronic obstruc-

tive pulmonary disease. Clin. Chest Med. 21:6786.

Selman, M., Montano, M., Ramos, C., Vanda, B., Becerril, C., Del-

gado, J., Sansores, R., Barrios, R., and Pardo, A. 1996. Tobacco

smoke-induced lung emphysema in guinea pigs is associated with

increased interstitial collagenase. Am. J. Physiol. 271:L734-L743.

Selman, M., Cisneros-Lira, J., Gaxiola, M., Ramirez, R., Kudlacz, E.

M., Mitchell, P. G., and Pardo, A. 2003. Matrix metalloproteinases

inhibition attenuates tobacco smoke-induced emphysema in guinea

pigs. Chest123:16331641.

Shapiro, S. D. 1999. The macrophage in chronicobstructive pulmonary

disease. Am. J. Respir. Crit. Care. Med. 160:529532.

Shapiro, S. D., Goldstein, N. M., Houghton, A. M., Kobayashi, D. K.,

Kelley, D., and Belaaouaj, A. 2003. Neutrophil elastase contributes

to cigarette smoke-induced emphysema in mice. Am. J. Pathol.

163:23292335.

Shapiro, S. D. 2007. Transgenic and gene-targeted mice as models for

chronic obstructive pulmonary disease. Eur. Respir. J. 29:375378.

Townsend, C. L., and Maynard, R. L. 2002. Effects on health of pro-

longed exposure to low concentrations of carbon monoxide. Occup.

Environ. Med. 59:708711.

Wright, J. L., and Churg, A. 2002. A model of tobacco smoke-induced

airflow obstruction in the guinea pig. Chest121:188S191S.

Yoshida, T., and Tuder, R. M. 2007. Pathobiology of cigarette

smoke-induced chronic obstructive pulmonary disease.Physiol. Rev.

87:10471082.

Documents

jurnal_y