Journal of Pharmacology and Experimental Therapeutics - Title …jpet.aspetjournals.org › content › jpet › early › 2008 › 09 › 18 › ... · JPET #140335 2 Running Title

JPET #140335

1

Title Page

Gene expression profiles in livers from diclofenac-treated rats reveal intestinal

bacteria-dependent and -independent pathways associated with liver injury

Xiaomin Deng, Michael J. Liguori, Erica Sparkenbaugh, Jeffrey F. Waring, Eric A.G.

Blomme, Patricia E. Ganey and Robert A. Roth

Department of Biochemistry and Molecular Biology，Michigan State University, East

Lansing, MI (XD)

Department of Pharmacology and Toxicology, Michigan State University, East

Lansing, MI (ES, PG, RR)

Department of Cellular and Molecular Toxicology, Abbott Laboratories, Abbott Park,

IL (ML, JW, EB)

JPET Fast Forward. Published on September 18, 2008 as DOI:10.1124/jpet.108.140335

Copyright 2008 by the American Society for Pharmacology and Experimental Therapeutics.

This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on September 18, 2008 as DOI: 10.1124/jpet.108.140335

at ASPE

T Journals on July 8, 2020

jpet.aspetjournals.orgD

ownloaded from

http://jpet.aspetjournals.org/

JPET #140335

2

Running Title Page

Gene expression after diclofenac treatment

Corresponding Author:

Robert A. Roth

Department of Pharmacology and Toxicology

B347, Life Sciences Building

Michigan State University

East Lansing, MI 48824

Tel: (517)-353-9841

Fax: (517)-432-2310

e-mail: [email protected]

Text Page: 48

Number of Tables: 4

Number of Figures: 8

Number of References: 40

Abstract Words: 241

Introduction Words: 418

Discussion Words: 1778

Abbreviations:


at ASPE



ownloaded from


JPET #140335

3

IADR- idiosyncratic adverse drug reactions

LPS – lipopolysaccharide

PPAR – peroxisome proliferator-activated receptor

PMN - neutrophil

ALT - alanine aminotransferase

DCLF - diclofenac

PIM - pimonidazole

ROS-reactive oxygen species

NSAID-nonsteroidal anti-inflammatory drug

Recommended Section Assignment: Toxicology


at ASPE



ownloaded from


JPET #140335

4

Abstract

Diclofenac (DCLF) is a nonsteroidal anti-inflammatory drug (NSAID) that is

associated with idiosyncratic adverse drug reactions (IADRs) in humans. Previous

studies revealed a crucial role for intestine-derived bacteria and/or lipopolysaccharide

(LPS) in DCLF-induced hepatotoxicity. We further explored this mechanism by

conducting gene expression analysis of livers from rats treated with a hepatotoxic

dose of DCLF (100mg/kg) with or without oral antibiotic pretreatment. Genes for

which expression was altered by DCLF were divided into two groups: genes with

expression altered by antibiotic treatment and those unaffected by antibiotics. The

former group of genes represented the ones for which DCLF-induced alterations in

expression depended on intestinal bacteria. The expression of the latter group of genes

was likely changed by direct effect of DCLF rather than by intestinal bacteria.

Functional analysis of genes in the former group revealed LPS-related signaling,

further suggesting a role for bacterial endotoxin in the liver injury. Functional analysis

of genes in the latter group revealed changes in signaling pathways related to

inflammation, hypoxia, oxidative stress, the aryl hydrocarbon receptor and

peroxisome proliferator-activated receptor alpha (PPARα). Neutrophil depletion failed

to protect from DCLF-induced hepatotoxicity, suggesting that intestinal bacteria

contribute to liver injury in a neutrophil-independent manner. Hypoxia occurred in the

livers of rats treated with DCLF, and hypoxia in vitro rendered hepatocytes sensitive

to DCLF-induced cytotoxicity. These results support the hypothesis that intestinal

bacteria are required for DCLF-induced hepatotoxicity and suggest that hypoxia plays


at ASPE



ownloaded from


JPET #140335

5

an important role in the pathogenesis.


at ASPE



ownloaded from


JPET #140335

6

Introduction

Diclofenac (DCLF) induces idiosyncratic hepatotoxicity in human patients with a

low incidence but high severity (Boelsterli, 2003; Banks et al., 1995). Cases of severe

hepatic injury leading to liver transplantation comprise a large portion of the reported

cases of DCLF-induced hepatotoxicity (Lewis, 2003). Due to the lack of apparent

dose dependency, the variable temporal relationship with drug exposure and the lack

of animal models, the mechanisms of DCLF-induced hepatic idiosyncratic adverse

drug reactions (IADRs) remain largely unknown (Boelsterli, 2003). Metabolic and

kinetic factors (Seitz et al., 1998;Daly et al., 2007), oxidative stress (Cantoni et al.,

2003) and mitochondrial injury (Masubuchi et al., 2002) have been suggested to be

important to the pathogenesis, but these require further evaluation, especially in vivo.

For instance, hepatocellular cytotoxicity from DCLF or its metabolites is only

observed in vitro with large concentrations of DCLF that are not achieved in vivo

(Gomez-Lechon et al., 2003a;Masubuchi et al., 2002). Similarly, polymorphisms in

enzymes that metabolize DCLF, such as UDP-glucuronosyltransferase 2B7 (UGT2B7)

and CYP2C8, and in the DCLF glucuronide transporter ABCC2, have been found in

human patients who developed DCLF hepatotoxicity (Daly et al., 2007). However, no

direct evidence has emerged to support a causal relationship between DCLF

metabolites and hepatotoxicity in vivo.

DCLF is known to cause intestinal ulceration that allows bacteria within the

intestinal tract to translocate into the circulation (Kim et al., 2005;Deng et al., 2006).

Previous studies showed that lipopolysaccharide (LPS) exposure interacted with a


at ASPE



ownloaded from


JPET #140335

7

small, nontoxic dose of DCLF (20mg/kg) to result in liver injury in rats (Deng et al.,

2006). Furthermore, antibiotics that eliminated gut-derived, Gram-negative bacteria

attenuated hepatotoxicity induced by a large dose of DCLF (100mg/kg) (Deng et al.,

2006). These results suggested that bacteria or LPS exposure during DCLF treatment

could be a susceptibility factor for DCLF-induced IADRs. Since such exposure during

drug treatment could be episodic and occur irregularly in human patients (Roth et al.,

2003), this could explain the variable dose and temporal relationships that

characterize DCLF IADRs. LPS exposure also interacts with other IADR producing

drugs, such as trovofloxacin and ranitidine, to cause hepatocellular injury in animals,

(Luyendyk et al., 2003; Waring et al., 2005).

The exact mechanisms by which bacteria or LPS contributes to DCLF-induced

hepatotoxicity remain unknown. Accordingly, the further exploration of factors

contributing to toxicity that are evoked directly by DCLF and independent of

bacteria/LPS is required. Here we examined gene expression profiles in livers of

DCLF-treated rats with or without antibiotic pretreatment to elucidate bacteria/LPS

dependent-and -independent pathways that are associated with DCLF hepatotoxicity.


at ASPE



ownloaded from


JPET #140335

8

Methods

Experimental Design. Rats received humane care according to the criteria outlined in

the “Guide for the Care and Use of Laboratory Animals” prepared by the National

Academy of Sciences, and the procedures were approved by the Michigan State

University Committee on Animal Use and Care. Male, Sprague-Dawley rats (Crl:CD

(SD)IGS BR; Charles River, Portage, MI) weighing 250 to 350 grams were used for

these studies. Animals were fed standard chow (Rodent chow/Tek 8640, Harlan

Teklad, Madison, WI) and allowed access to water ad libitum. They were allowed to

acclimate for 1 week in a 12-h light/dark cycle before use.

Rats were fasted for 16 h and then given a hepatotoxic dose of DCLF (100

mg/kg, i.p.) or its vehicle saline. They remained fasted and were sacrificed 6 h after

DCLF treatment for evaluation of liver injury, histopathology and gene expression.

The rats were anesthetized with sodium pentobarbital (50 mg/kg, i.p.), blood was

collected from the dorsal aorta, and a portion of the blood was placed into a tube

containing sodium citrate (final concentration, 0.38%) for collection of plasma.

Another portion was allowed to clot at room temperature, and serum was collected

and stored at -80°C until use. Representative (3-4-mm) slices of the ventral portion of

the left lateral liver lobe were collected and fixed in 10% neutral-buffered formalin

and then later processed for histological evaluation. A portion of the right medial

lobe of the liver was flash-frozen in liquid nitrogen for gene expression analysis.

Gut sterilization was achieved by treating rats with polymyxin B (150 mg/kg)

and neomycin (450 mg/kg) orally for 4 days before treatment with DCLF as described


at ASPE



ownloaded from


JPET #140335

9

(Deng et al., 2006). This treatment has been shown to abolish completely the

Gram-negative bacterial growth in rat fecal culture and to reduce plasma endotoxin

concentration after chronic ethanol treatment (Adachi et al., 1995). For Figure 3, rats

were treated with a nonhepatotoxic dose of LPS (2.9x107 EU/kg, i.v.), a

nonhepatotoxic (20 mg/kg, i.p.) or hepatotoxic dose (100 mg/kg, i.p.) of DCLF. The

rats were sacrificed 6 h after treatment, and RNA was prepared for microarray

analysis.

Alanine Aminotransferase (ALT) Activity and Histopathology Assessment.

Hepatic parenchymal cell injury was estimated by quantifying serum ALT activity,

which was determined spectrophotometrically using Infinity-ALT from Thermo

Electron Corp. (Louisville, CO). Formalin-fixed liver samples were routinely

processed and stained with hematoxylin and eosin (H&E). Slides were read by a

pathologist (EB) blinded to the treatment.

RNA Preparation. Each frozen liver sample (approximately 100 mg of tissue) was

immediately added to 2 mL of TRIzol reagent (Invitrogen Life Technologies,

Carlsbad, California) and homogenized using a Polytron 300D tissue grinder

(Brinkman Instruments, Westbury, NY). One mL of the tissue homogenate was

transferred to a microfuge tube, and total RNA was extracted with chloroform

followed by nucleic acid precipitation with isopropanol. The pellet was washed with

80% ethanol and resuspended in molecular biology grade water. Nucleic acid


at ASPE



ownloaded from


JPET #140335

10

concentration was determined spectrophotometrically at 260 nm (Smart-Spec,

Bio-Rad Laboratories, Hercules, CA), and RNA integrity was evaluated using an

Agilent bioanalyzer (Agilent Technologies, Model 2100, Foster City, CA).

Gene Array Analysis. Microarray analysis was performed using the standard

protocol provided by Affymetrix, Inc. (Santa Clara, CA). Approximately 5 μg of

total RNA were reversed transcribed into cDNA using a Superscript II Double-Strand

cDNA synthesis kit (Invitrogen Life Technologies, Carlsbad, California) according to

the manufacturer’s instructions with the exception that the primer used for the reverse

transcription reaction was a modified T7 primer with 24 thymidines at the 5’ end

(Enzo Life Science). The sequence was 5’GGCCAGTGAATTGTAATACGACTC

-ACTATAGGGAGGCGG-(dT)24-3’. cDNA was purified via phenol/chloroform/

isoamylalcohol (Invitrogen Life Technologies) extraction and ethanol precipitation.

The purified cDNA was resuspended in molecular biology grade water.

Biotin-labeled cRNA from the cDNA was synthesized according to the

manufacturer’s instructions using the Enzo RNA Transcript Labeling Kit (Affymetrix).

The labeled cRNA was then purified using RNeasy kits (Qiagen, Valencia, CA).

Subsequently, cRNA concentration and integrity were evaluated. Approximately 20

μg of cRNA were then fragmented in a solution of 40 mM Tris-acetate, pH 8.1, 100

mM potassium acetate, and 30 mM magnesium acetate at 94oC for 35 minutes.

Fragmented, labeled cRNA was hybridized to an Affymetrix rat genome RAE230A

2.0 array, which contained sequences corresponding to roughly 30,000 transcripts, at


at ASPE



ownloaded from


JPET #140335

11

45°C overnight using an Affymetrix Hybridization Oven 640. The array was

subsequently washed and stained twice with strepavidin-phycoerythrin (Molecular

Probes, Eugene, OR) using a Gene-Chip Fluidics Workstation 400 (Affymetrix).

The array was then scanned using the Affymetrix GeneChip Scanner 3000.

The microarray scanned image and intensity files (.cel files) were imported into

Rosetta Resolver gene expression analysis software version 7.1 (Rosetta Inpharmatics,

Seattle, WA). Error models were applied, and ratios were built for each treatment

array versus its respective vehicle control (pooled in silico). A p-value was

calculated for every fold change, using the Rosetta Resolver error model (Rajagopalan,

2003).

Statistical Filtering of Genes Changed After DCLF Treatment. Genes with

expression that changed after treatment with antibiotic/Vehicle (Veh), Veh/DCLF or

antibiotic/DCLF were identified with Veh/Veh as baseline using the following criteria:

p<0.01 in at least 2 out of 3 (antibiotic/Veh group), at least 4 out of 5 (Veh/DCLF

group); p<0.01 in at least 3 out of 4 animals (group antibiotic/DCLF). The genes for

which expression changed after Veh/DCLF treatment were analyzed further. The

expression of this group of genes in rats treated with antibiotic/DCLF and Veh/DCLF

was compared using Veh/DCLF as baseline to identify the genes differentially or

similarly expressed between these two groups. Genes were considered differentially

expressed if they met the following criterion: p<0.01 in at least 3 out of 4 animals in

antibiotic/DCLF group using Veh/DCLF as baseline. This analysis rendered two


at ASPE



ownloaded from


JPET #140335

12

groups of genes: those expressed differently between Veh/DCLF and

antibiotics/DCLF (bacteria-dependent genes) and those that were expressed similarly

(bacteria-independent genes). These two groups of genes were further filtered by the

criterion of degree of correlation of their expression level with plasma alanine

aminotransferase (ALT) activity. The gene expressions were considered highly

correlated with ALT if the correlation coefficient was greater than 0.6. The function of

genes with expression level highly correlated with ALT was identified as described in

Entrez Gene site (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene).

Furthermore, these two groups of genes were imported into Ingenuity Pathway

Analysis 5.5 (Ingenuity System, Inc., Redwood City, CA). This yielded a list of

pathway terms ranked by their probability of over-representation or

under-representation in a particular gene list. Functional annotations were based on

the Ingenuity System knowledge base. “Ratio” refers to the percentage of the number

of genes identified in a particular pathway found in the imported list of genes to the

total number of genes in that particular pathway. The pathways reported by Ingenuity

Pathway Analysis were ranked by p value, which illustrates the deviation of the

observed number of genes for each pathway found in the imported list of genes from

the number expected to occur by chance.

Neutrophil (PMN) Staining and PMN Depletion. PMNs accumulated in liver were

enumerated by immunohistochemical staining and quantified as described previously

(Yee et al., 2003). PMN depletion was accomplished by pretreating rats with a rabbit


at ASPE



ownloaded from


JPET #140335

13

anti-rat PMN serum (Intercell Technologies, Jupiter, FL) 16 h before DCLF treatment

as described before (Deng et al., 2007;Luyendyk et al., 2005). This PMN antiserum

selectively reduces circulating PMNs (Deng et al., 2007;Luyendyk et al., 2005).

Evaluation of Liver Hypoxia. Liver hypoxia was evaluated by immunohistochemical

staining for pimonidazole (PIM) adducts. PIM is a 2-nitroimidazole marker of

hypoxia and has been used to identify regions of hypoxia in liver. Unless otherwise

noted, rats were given 120 mg/kg Hypoxyprobe-1 (PIM hydrochloride; Chemicon

International, Temecula, CA) i.p. 2 hr before they were killed. PIM-adduct

immunostaining was performed as described previously (Copple et al., 2004).

Quantification of immunostaining was performed using Scion Image Beta 4.0.2

software (Scion Corporation, Frederick, MD). Background was set to be the average

pixel intensity in periportal regions of Veh/Veh-treated livers (i.e., an area where no

hypoxia occurs). An increase in positive immunostaining for PIM-modified proteins

indicates hypoxia in the liver tissue.

Effects of Hypoxia on DCLF-induced Hepatocyte Death In Vitro. Primary

hepatocytes were isolated from male Sprague-Dawley rats (Charles River) weighing

150-170 g using the Invitrogen HPC Product Line (Invitrogen), including liver

perfusion medium, collagenase-containing liver digest medium, and hepatocyte wash

medium. All reagents were warmed to 37°C. Rats were anesthetized with sodium

pentobarbital (50 mg/kg ip). The liver was perfused in situ through the portal vein


at ASPE



ownloaded from


JPET #140335

14

with perfusion medium at a flow of 30 mL/min, followed immediately by collagenase

digestion with liver digest medium at a flow of 20 mL/min, for 7-10 minutes. After

digestion, the liver was removed from the rat’s abdomen and rinsed in warmed

phophate-buffered saline (PBS), then transferred to a sterile Petri dish containing 5

mL of liver digest medium and 40 mL of hepatocyte wash medium. The digested

liver was gently manipulated with sterile forceps to disperse the hepatocytes from the

capsule, and the resulting cell homogenate was filtered through sterile nylon gauze to

remove debris. The filtrate was centrifuged (100 x g, 30 s) and washed twice with

hepatocyte wash medium, then resuspended in complete Williams’ Medium E

(supplemented with 2 mM L-glutamine, and 0.1% gentamicin) with 10% fetal bovine

serum. Viability was assessed with trypan blue exclusion, and cells were plated if

viability was greater than 85%. Cells were plated at a density of 2.5 x 105 cells/mL

in 12-well cell culture plates (Costar, Cambridge, MA). Cells were allowed to

adhere to the plates for three hours before treatment. After this time medium was

refreshed to serum-free Williams’ Medium E, and cells were treated with DCLF.

Plates were immediately transferred to hypoxic glove boxes (Coy Laboratory

Products, Inc, Grass Lake, MI) set at 5% oxygen and 5% CO2 or incubators with

room air (approximately 20% oxygen) controlled at 5% CO2. Eight hours later, the

medium (including unattached cells) was collected, and attached cells were lysed with

1% Triton X-100 in PBS. Medium and attached cell lysates were centrifuged at

8000 g for 4 minutes. Medium supernatant was removed, and the resulting

unattached cell pellet was lysed with 1% Triton X-100.


at ASPE



ownloaded from


JPET #140335

15

The medium, unattached cell lysates, and attached cell lysates were assessed for

ALT activity using Infinity-ALT reagent. ALT release was expressed as a

percentage of the total ALT activity (activity in medium, unattached cells and

attached cell lysate) detected in the medium and unattached cell lysates.

Statistical Analysis. All data are expressed as mean + SEM. For Fig 8, two-way

ANOVA with Tukey's posthoc test was applied using SigmaStat 3.0. For Figures 6

and 7, one-way ANOVA was applied with Tukey's posthoc test. The criterion for

statistical significance was p< 0.05.

For microarray analysis, error models were applied and ratios were built for each

treatment array versus its averaged respective vehicle control (pooled in silico) using

the Rosetta Resolver system. Gene expression was considered significantly changed if

the p-value was less than or equal to 0.01. For Fig 1, agglomerative cluster analysis

was performed using the average link heuristic criteria and the Euclidean distance

metric for similarity measure. For Fig 2, K-means clustering was performed using

cosine correlation as the metric type.


at ASPE



ownloaded from


JPET #140335

16

Results

Liver Histopathology. Our previous study showed that antibiotic pretreatment

reduced the increase in serum ALT activity induced by DCLF treatment (100mg/kg)

(Deng et al., 2006). Accordingly, histopathology was examined 6 h after DCLF

treatment. There were no apparent histopathological changes in Veh/Veh-treated or

antibiotic/Veh-treated livers (data not shown). Histopathology revealed subcapsular

hemorrhagic coagulative necrosis in Veh/DCLF-treated livers, and this was absent in

livers from antibiotic/DCLF-treated rats (Fig. 1).

Hierarchical Clustering of Hepatic Gene Expression Profiles. Hepatic gene

expression profiles were examined 6 h after DCLF treatment. Hierarchical clustering

was performed using Euclidian distance with Veh/Veh-treated rats as baseline. There

were two major clusters: animals that were treated with DCLF and those that were not

(Fig. 2). In contrast, the antibiotic/DCLF–treated rats and Veh/DCLF-treated rats did

not separate from each other.

K-Means Clustering of Hepatic Gene Expression Profiles. NSAIDs such as DCLF

can cause intestinal damage, and thereby potentially expose the liver to bacteria or

LPS. This coupled with the observation that pretreatment with antibiotics decreased

DCLF-induced liver injury suggested that LPS might be involved in DCLF-mediated

hepatotoxicity. To explore whether a hepatotoxic dose of DCLF induced gene

expression changes similar to those induced by LPS, K-Means clustering was


at ASPE



ownloaded from


JPET #140335

17

performed on gene expression profiles 6 h after treatment with LPS (2.9x107 EU/kg,

i.v.), nontoxic (20 mg/kg) or toxic doses (100 mg/kg) of DCLF. K-Means clustering

inputting three distinct clusters corresponding to the three treatments (Fig. 3) revealed

greater similarity between the gene expression profiles of the LPS group and the toxic

DCLF dose group than between the nontoxic DCLF dose group and either of the other

two groups.

RT-PCR Comparison with Gene Array Results. Recent technological

improvements have increased the reproducibility and reliability of microarray results

(Raymond et al., 2006). Most microarray results are now accurate, especially for

highly regulated genes, and differences between microarray- and PCR-generated data

occur mostly in the amplitude of the detected expression change (Rajeevan et al.,

2001; Dallas et al., 2005; Bosotti et al., 2007). Nevertheless, we conducted real-time

PCR validation of some of the gene expression changes mentioned in the results

section (Supplemental Data). The results showed strong agreement between the

RT-PCR and microarray data especially regarding the direction of change in

expression.

Functional Analysis of Genes Altered by DCLF Treatment. Genes with expression

altered by DCLF treatment relative to Veh/Veh controls were classified into two

groups, those expressed differently after Veh/DCLF treatment compared to

antibiotic/DCLF treatment and those expressed similarly after Veh/DCLF treatment


at ASPE



ownloaded from


JPET #140335

18

and antibiotic/DCLF treatment. The former group consisted of gene expression

changes associated with DCLF-induced liver injury and dependent on intestinal

bacteria (bacteria-dependent genes), whereas the second group consisted of gene

expression changes that were independent of intestinal bacteria (bacteria-independent

genes).

The bacteria-dependent genes were further filtered by the criterion of degree of

correlation with ALT. The genes highly correlated with ALT are shown in Table 1. The

function of genes with potential importance in liver injury was also noted. These

genes include those inducible by LPS such as fibrinogen (FGA) and signal transducer

and activator of transcription 3 (STAT3). Genes also emerged that are involved in

fatty acid metabolism (e.g., aldehyde dehydrogenase 3a2 [ALDH3a2] and acyl-CoA

synthetase long-chain family member 1 [ACSl]), cell cycle regulation (e.g., NIMA

[never in mitosis gene a]-related expressed kinase 6 [NEK6] and cyclin G1) and

protein transporting/trafficking (e.g., vesicle docking protein [VDP], sec1 family

domain containing 1 [SCFD1]).

Analysis of all the bacteria-dependent genes using the Ingenuity System revealed

impacted pathways ranked by p value (Table 2). Highly impacted pathways included

LPS/interleukin1(IL1)-induced inhibition of retinoid X receptor (RXR) function, fatty

acid metabolism, farnesoid X receptor (FXR)/RXR activation and gene regulation via

proliferator-activated receptor alpha (PPARα).

The bacteria-independent genes were also filtered by the criterion of degree of

correlation with ALT. The genes highly correlated with ALT are shown in Table 3.


at ASPE



ownloaded from


JPET #140335

19

Many of these genes are related to inflammatory responses (e.g., intercellular

adhesion molecule 1 [ICAM1], interleukin 1 beta [IL1β], tumor necrosis factor

receptor superfamily member 1a [TNFRSF1a], prostaglandin E receptor 3 [PTGER3])

and to leukocyte transmigration and activation (e.g., ICAM-1, IL1β).

Another interesting group comprised genes involved in oxidative stress,

including superoxide dismutase 2 (SOD2) and heme oxygenase 1 (HMOX1). Genes

involved in cell death and cell cycle regulation were also in the list of genes for which

expression is independent of bacteria. These genes include TNFRSF1a, tumor protein

p53 (TP53) and signal transducer and activator of transcription 1 (STAT1). Several of

these genes are known to be hypoxia-inducible. These include SOD2 (Scortegagna et

al., 2003), B-cell translocation gene 2 (BTG2) (Pacary et al., 2006), STAT1 (West et

al., 2004), ICAM-1 and TP53 (Staib et al., 2005;Zhang et al., 2007).

Analysis of all the bacteria-independent genes using Ingenuity System also

revealed impacted pathways ranked by p value (Table 4). The results further suggest

the involvement of oxidative stress and hypoxia signaling. Highly impacted pathways

also included FXR/LXR activation, PPARα signaling and aryl hydrocarbon receptor

signaling.

Lack of Role for PMNs in DCLF Hepatotoxicity. Because some of the genes for

which expression was increased after DCLF treatment are involved in PMN

trafficking and activation, liver PMN accumulation was evaluated 6 h after DCLF

treatment. In livers of DCLF-treated rats, accumulation of large numbers of PMNs in


at ASPE



ownloaded from


JPET #140335

20

the subcapsular region was evident (Fig 4). It is in these areas where the necrosis

occurs. The PMN accumulation was markedly reduced by antibiotic treatment (Fig 4).

To investigate the role of PMNs in hepatotoxicity, rats were pretreated with PMN

antiserum. This antiserum abolished the subcapsular PMN accumulation in livers of

DCLF-treated rats (Fig 5), but it did not significantly alter the serum ALT activity

(Fig 6) or the histopathology (data not shown).

Hypoxia after DCLF Treatment in Vivo. Since several genes altered by DCLF

treatment are regulated by hypoxia, tissue hypoxia was evaluated 6 h after DCLF

treatment using PIM adduct staining. DCLF induced a large increase in PIM-adduct

staining, indicating the presence of hypoxia (Fig 7).

Effect of Hypoxia on DCLF-induced Hepatocyte Death in Vitro. In vitro,

hepatocytes incubated in an oxygen-replete atmosphere were not injured by DCLF up

to 500 μM (Fig 8). However, hypoxia (5% O2) rendered hepatocytes more sensitive to

DCLF-induced cytotoxicity.


at ASPE



ownloaded from


JPET #140335

21

Discussion

Although DCLF is known to cause intestinal injury and to allow bacterial

translocation to liver both in animal models and in human patients (Deng et al., 2006;

Kim et al., 2005), the contribution of intestinal bacteria to DCLF-mediated

hepatotoxicity has not been well characterized. A previous study showed that

bacteria/LPS interacted with a nontoxic dose of DCLF to induce liver injury in rats

(Deng et al., 2006). Thus, a goal of this study was to examine the role of

intestine-derived endotoxin on DCLF-induced hepatotoxicity. In this model, liver

injury as reflected by serum ALT activity did not develop until 4hrs after treatment

with an hepatotoxic dose of DCLF and was maximal by 6hrs (unpublished results).

Accordingly, we chose to examine a time shortly after the beginning of liver injury (ie,

6 hr), since we expected gene expression changes to be pronounced at that time. At

this time, there was substantial similarity in hepatic gene expression profiles between

LPS treatment and treatment with an hepatotoxic DCLF dose (Fig. 3). We did not

examine earlier times in this study, but since gut sterilization protected from the liver

injury at 6 hr, we would anticipate fewer differences between sterilized and

nonsterilized DCLF-treated rats at earlier times before injury onset.

To explore further the role of gut-derived bacteria in DCLF hepatotoxicity, gene

expression profiles in livers from rats given a hepatotoxic dose of DCLF with or

without antibiotic pretreatment were examined. Interestingly, hierarchical clustering

could not distinguish antibiotic/DCLF-treated rats from those treated with Veh/DCLF.

This suggested that gut sterilization with antibiotics altered the expression of a small


at ASPE



ownloaded from


JPET #140335

22

number of genes in DCLF-treated rats. However, the antibiotics markedly reduced the

hepatocellular injury resulting from DCLF, reflected by either serum ALT activity

(Deng et al., 2006) or histopathology (Fig. 1). This suggested that intestinal bacteria

might cause injury by altering the expression of relatively few genes. Alternatively,

bacteria might contribute to liver injury after DCLF treatment by a mechanism

independent of changes in gene expression.

Clustering of gene expression profiles revealed high similarity between

LPS-treated rats and rats given an hepatotoxic dose of DCLF (100mg/kg), but little

similarity to those given a nontoxic DCLF dose. In light of the previous result that

LPS interacts with a nonhepatotoxic dose of DCLF (20mg/kg) to cause liver damage

(Deng et al., 2006), this finding suggested that endotoxin contributes to the liver

injury from a hepatotoxic dose of DCLF. However, the mechanism of this

contribution remains unknown.

The genes with expression altered by DCLF treatment (100mg/kg) are of

obvious potential mechanistic interest since liver injury occurred in these animals.

Those genes can be classified into two groups: genes differentially expressed after

DCLF treatment compared to antibiotic/DCLF treatment and those similarly

expressed after DCLF treatment and after antibiotic/DCLF treatment. The former

group consists of genes that might contribute to liver injury through involvement of

intestinal bacteria. The latter group represents genes for which either the expression

was not changed due to intestinal bacteria, or the gene expression was intestinal

bacteria-dependent but the reduction of bacteria by antibiotics was not sufficient to


at ASPE



ownloaded from


JPET #140335

23

exert effects on their expression. However, since the antibiotics almost abolished

(97% reduction) hepatic Gram-negative bacteria after DCLF treatment (Deng et al.,

2006), the latter possibility seems less likely. Thus, the genes similarly expressed after

DCLF treatment and after antibiotic/DCLF treatment more likely represent transcripts

for which the expression is not due to intestinal bacteria, i.e., possibly resulting from a

direct effect of DCLF or its metabolites.

In the group of genes for which expression was dependent on bacteria, those

highly correlated with ALT were further categorized by their gene function. Some are

known to be LPS-inducible, including fibrinogen (FGA) and STAT3 (Lunz, III et al.,

2007). Genes encoding enzymes involved in fatty acid metabolism were reduced in

expression after DCLF treatment. This change was not due to difference in food

consumption since all rats remained fasted after the treatment until sacrifice. LPS is

known to cause inhibition of fatty acid metabolism through nuclear transcription

factors such as RXR, FXR and PPARα (Ghose et al., 2004;Kim et al., 2007). Other

than LPS-inducible genes, there were also genes involved in cell cycle regulation and

protein transporting/trafficking.

In the pathways identified by Ingenuity for bacteria-dependent genes, most of the

genes are known to be LPS inducible, such as those in groups involved with

LPS/IL-1-induced inhibition of RXR function, fatty acid metabolism, FXR/RXR

activation and gene regulation via PPARα. These altered pathways could lead to

decreased fatty acid β-oxidation metabolism and increased fatty acid accumulation in

liver. In other models of liver injury, fatty acid accumulation has been shown to be


at ASPE



ownloaded from


JPET #140335

24

critical in the pathogenesis, possibly through increased oxidative stress (Purohit et al.,

2004;Carmiel-Haggai et al., 2005). However, whether or not the fatty acid

accumulation contributes to hepatocellular injury in DCLF-treated rats remains to be

explored.

In the group of transcripts similarly expressed after DCLF treatment and

antibiotic/DCLF treatment, those highly correlated with ALT were further categorized

by gene function. As mentioned above, these genes represent those for which the

expression was likely changed due to a direct DCLF effect rather than from

involvement of intestinal bacteria. Many of these genes encode proteins that regulate

inflammatory responses and leukocyte transmigration and activation. Thus, it seemed

possible that bacteria or LPS induced the accumulation of leukocytes in the liver, and

that DCLF acted synergistically with bacteria or LPS to activate the leukocytes to

contribute to the killing of hepatocytes. However, PMN depletion in DCLF-treated

rats failed to reduce the liver injury. This suggests that bacteria/LPS contribute to liver

injury in this model through a PMN-independent mechanism, perhaps through

LPS-activated macrophages or other inflammatory mediators.

Other upregulated genes of interest include those involved in oxidative stress

such as SOD2 and HMOX1. SOD2 is a mitochondrial antioxidant enzyme (Hu et al.,

2005), and HMOX1 is an acute phase response gene induced by oxidative stress

(Takahashi et al., 2007). The induction of these two genes suggested oxidative stress

in the liver. This was further supported by the high ranking of oxidative stress

pathways by the Ingenuity System after importation of all bacteria-independent genes.


at ASPE



ownloaded from


JPET #140335

25

Interestingly, the results of Cantoni and colleages (Cantoni et al., 2003) suggest that

oxidative stress might contribute to DCLF-induced hepatotoxicity in mice. In that

study, hepatic damage was enhanced by the glutathione-lowering agent buthionine

sulfoximine but was not attenuated by the antioxidant N-acetylcysteine. This finding

suggested that oxidative stress induced by DCLF might act with other deleterious

signals to promote hepatotoxicity. These signals could be from bacteria or LPS

translocated from the intestinal tract into the liver.

Genes involved in cell death and cell cycle regulation are also in the list of genes

regulated independently of bacterial influence. These genes include TNFRSF1a, TP53

and STAT1. TNFRSF1a is responsible for TNF-induced apoptosis (Shen and Pervaiz,

2006). TP53 is a tumor suppressor gene which not only regulates several apoptotic

genes but also has a direct, pro-apoptotic role by interacting with B-cell

leukemia/lymphoma 2 (BCL2) family members in mitochondria (Hussain and Harris,

2006). STAT1 is involved in inflammatory cytokine- and reactive oxygen

species-mediated apoptosis (Gorina et al., 2005;West et al., 2004). Consistent with

this is the observation that DCLF can induce hepatotycte apoptosis in vitro

(Gomez-Lechon et al., 2003b). It is possible that these DCLF-induced, pro-apoptotic

stresses superimpose on the inflammatory stresses induced by bacteria/LPS to

manifest hepatocellular injury.

Several other interesting pathways were highlighted that could contribute to liver

injury. These include FXR/LXR activation, PPARα signaling and aryl hydrocarbon

receptor signaling. Interestingly, FXR activation and PPARα signaling are also


at ASPE



ownloaded from


JPET #140335

26

identified in the group of genes for which expression was dependent on bacteria.

These might be potential points of interaction between DCLF induced-bacteria/LPS

exposure and a direct toxic effect of DCLF on liver.

Numerous genes regulated by DCLF in a bacteria-independent manner are

hypoxia inducible. These include SOD2 (Scortegagna et al., 2003), BTG2 (Pacary et

al., 2006), STAT1 (West et al., 2004), ICAM-1 and TP53 (Staib et al., 2005;Zhang et

al., 2007). Furthermore, Ingenuity System analysis revealed a high probability of

involvement of hypoxia-inducible factor signaling. Hypoxia can directly kill

hepatocytes in vitro (Lluis et al., 2005;Nagatomi et al., 1997). In addition, hypoxia

potentiates the damaging effects of inflammatory mediators induced by LPS in vitro,

such as macrophage- and neutrophil-derived cytotoxic factors (ie. proteases, reactive

oxygen species[ROS]) (Luyendyk et al., 2005). In vivo, hypoxia enhances the liver

lesions caused by a large, hepatotoxic dose of LPS (Shibayama, 1987). It is possible

that hypoxia interacts with these inflammatory mediators induced by LPS to cause

hepatocelluar injury in vivo after treatment with DCLF.

DCLF can kill hepatocytes directly after 24 hours of exposure in vitro

(Masubuchi et al., 2002). However, the cytotoxicity was only observed at a large

concentration (500 μM) that might not be achieved in vivo. Furthermore, the time

frame of the cell death was considerably longer than required in vivo (i.e., 6 h). This

suggests that DCLF might need a second deleterious signal to manifest the killing of

hepatocytes in vivo. Additional studies in vitro were pursued to explore this in light of

the gene array findings. DCLF did not cause hepatocyte death after 8 h of exposure


at ASPE



ownloaded from


JPET #140335

27

even at the concentration (500 μM) reported to kill hepatocytes at 24 h (Masubuchi et

al., 2002). However, hypoxia rendered hepatocytes sensitive to DCLF-induced

cytotoxicity. For example, in a hypoxic environment, DCLF caused hepatocyte death

even at a smaller concentration (250 μM) and in a time frame similar to that required

for hepatotoxicity in vivo. Since hypoxia occurred in livers of DCLF-treated rats (Fig.

7), it might provide a second signal in vivo that acts synergistically with DCLF to kill

hepatocytes. The mechanism by which hypoxia potentiates DCLF killing of

hepatocytes is unknown, but both hypoxia and DCLF can induce mitochondrial injury

and generation of ROS (Lluis et al., 2005;Gomez-Lechon et al., 2003b;Masubuchi et

al., 2002). Either of these might be a potential interaction point between hypoxia and

DCLF.

A large fraction of diclofenac glucuronide in humans is excreted by the kidney,

whereas in rodents the biliary route is more important. Although it is not clear that this

difference in disposition influences hepatotoxicity, it is a factor that should be

considered in extrapolating our findings to humans.

In summary, both bacteria-dependent and bacteria-independent changes in gene

expression occurred after DCLF treatment in rats. Microarray analysis and additional

studies revealed that bacteria/LPS contribute to DCLF hepatotoxicity in a

PMN-independent manner. DCLF may interact with bacteria or LPS through inducing

oxidative stress, apoptotic signaling or changing fatty acid metabolism. Results in

vitro suggest that hypoxia might provide a secondary signal that interacts with DCLF


at ASPE



ownloaded from


JPET #140335

28

to kill hepatocytes, which is further supported by the observation that hypoxia

occurred in vivo after DCLF treatment.


at ASPE



ownloaded from


JPET #140335

29

References

Adachi Y, Moore LE, Bradford BU, Gao W, Thurman RG (1995) Antibiotics prevent

liver injury in rats following long-term exposure to ethanol. Gastroenterology

108:218-224

Banks AT, Zimmerman HJ, Ishak KG, Harter JG (1995) Diclofenac-associated

hepatotoxicity: Analysis of 180 cases reported to the food and drug administration as

adverse reactions. Hepatology 22:820-827

Boelsterli UA (2003) Diclofenac-induced liver injury: a paradigm of idiosyncratic

drug toxicity. Toxicology and Applied Pharmacology 192:307-322

Bosotti R, Locatelli G, Healy S, Scacheri E, Sartori L, Mercurio C, Calogero R and

Isacchi A (2007) Cross platform microarray analysis for robust identification of

differentially expressed genes. BMC Bioinformatics 8 Suppl 1:S5

Cantoni L, Valaperta R, Ponsoda X, Castell JV, Barelli D, Rizzardini M, Mangolini A,

Hauri L, Villa P (2003) Induction of hepatic heme oxygenase-1 by diclofenac in

rodents: role of oxidative stress and cytochrome P-450 activity. Journal of Hepatology

38:776-783

Carmiel-Haggai M, Cederbaum AI, Nieto N (2005) A high-fat diet leads to the

progression of non-alcoholic fatty liver disease in obese rats. FASEB J 19: 136-138


at ASPE



ownloaded from


JPET #140335

30

Copple BL, Rondelli CM, Maddox JF, Hoglen NC, Ganey PE, Roth RA (2004)

Modes of cell death in rat liver after monocrotaline exposure. Toxicol Sci 77:172-182

Dallas PB, Gottardo NG, Firth MJ, Beesley AH, Hoffmann K, Terry PA, Freitas JR,

Boag JM, Cummings AJ and Kees UR (2005) Gene expression levels assessed by

oligonucleotide microarray analysis and quantitative real-time RT-PCR -- how well do

they correlate? BMC Genomics 6:59

Daly AK, Aithal GP, Leathart JBS, Swainsbury RA, Dang TS, Day CP (2007) Genetic

Susceptibility to Diclofenac-Induced Hepatotoxicity: Contribution of UGT2B7,

CYP2C8, and ABCC2 Genotypes. Gastroenterology 132:272-281

Deng X, Stachlewitz RF, Liguori MJ, Blomme EA, Waring JF, Luyendyk JP, Maddox

JF, Ganey PE, Roth RA (2006) Modest inflammation enhances diclofenac

hepatotoxicity in rats: role of neutrophils and bacterial translocation. J Pharmacol Exp

Ther 319:1191-1199

Deng X, Luyendyk JP, Zou W, Lu J, Malle E, Ganey PE, Roth RA (2007) Neutrophil

Interaction with the Hemostatic System Contributes to Liver Injury in Rats Cotreated

with Lipopolysaccharide and Ranitidine. J Pharmacol Exp Ther 322:852-861

Ghose R, Zimmerman TL, Thevananther S, Karpen SJ (2004) Endotoxin leads to

rapid subcellular re-localization of hepatic RXRalpha: A novel mechanism for

reduced hepatic gene expression in inflammation. Nucl Recept 2:4

Gomez-Lechon M, Ponsoda X, O'Connor E, Donato T, Jover R, Castell JV (2003a)


at ASPE



ownloaded from


JPET #140335

31

Diclofenac induces apoptosis in hepatocytes. Toxicology in Vitro 17:675-680

Gomez-Lechon MJ, Ponsoda X, Connor E, Donato T, Castell JV, Jover R (2003b)

Diclofenac induces apoptosis in hepatocytes by alteration of mitochondrial function

and generation of ROS. Biochemical Pharmacology 66:2155-2167

Gorina R, Petegnief V, Chamorro A, Planas AM (2005) AG490 prevents cell death

after exposure of rat astrocytes to hydrogen peroxide or proinflammatory cytokines:

involvement of the Jak2/STAT pathway. Journal of Neurochemistry 92:505-518

Hu Y, Rosen DG, Zhou Y, Feng L, Yang G, Liu J, Huang P (2005) Mitochondrial

manganese-superoxide dismutase expression in ovarian cancer: role in cell

proliferation and response to oxidative stress. J Biol Chem 280:39485-39492

Hussain SP, Harris CC (2006) p53 biological network: at the crossroads of the

cellular-stress response pathway and molecular carcinogenesis. J Nippon Med Sch

73:54-64

Kim JW, Jeon WK, Kim EJ (2005) Combined effects of bovine colostrum and

glutamine in diclofenac-induced bacterial translocation in rat. Clinical Nutrition

24:785-793

Kim MS, Sweeney TR, Shigenaga JK, Chui LG, Moser A, Grunfeld C, Feingold KR

(2007) Tumor necrosis factor and interleukin 1 decrease RXRalpha, PPARalpha,

PPARgamma, LXRalpha, and the coactivators SRC-1, PGC-1alpha, and PGC-1beta in

liver cells. Metabolism 56:267-279


at ASPE



ownloaded from


JPET #140335

32

Lluis JM, Morales A, Blasco C, Colell A, Mari M, Garcia-Ruiz C, Fernandez-Checa

JC (2005) Critical role of mitochondrial glutathione in the survival of hepatocytes

during hypoxia. J Biol Chem 280:3224-3232

Lunz JG, III, Specht SM, Murase N, Isse K, Demetris AJ (2007) Gut-derived

commensal bacterial products inhibit liver dendritic cell maturation by stimulating

hepatic interleukin-6/signal transducer and activator of transcription 3 activity.

Hepatology 46:1946-1959

Luyendyk JP, Shaw PJ, Green CD, Maddox JF, Ganey PE, Roth RA (2005)

Coagulation-mediated hypoxia and neutrophil-dependent hepatic injury in rats given

lipopolysaccharide and ranitidine. J Pharmacol Exp Ther 314:1023-1031

Luyendyk JP, Maddox JF, Cosma GN, Ganey PE, Cockerell GL, Roth RA (2003)

Ranitidine treatment during a modest inflammatory response precipitates

idiosyncrasy-like liver injury in rats. J Pharmacol Exp Ther 307:9-16

Masubuchi Y, Nakayama S, Horie T (2002) Role of mitochondrial permeability

transition in diclofenac-induced hepatocyte injury in rats. Hepatology 35:544-551

Nagatomi A, Sakaida I, Matsumura Y, Okita K (1997) Cytoprotection by glycine

against hypoxia-induced injury in cultured hepatocytes. Liver 17:57-62

Pacary E, Legros H, Valable S, Duchatelle P, Lecocq M, Petit E, Nicole O, Bernaudin

M (2006) Synergistic effects of CoCl2 and ROCK inhibition on mesenchymal stem

cell differentiation into neuron-like cells. J Cell Sci 119:2667-2678


at ASPE



ownloaded from


JPET #140335

33

Purohit V, Russo D, Coates PM (2004) Role of fatty liver, dietary fatty acid

supplements, and obesity in the progression of alcoholic liver disease: introduction

and summary of the symposium. Alcohol 34:3-8

Rajeevan MS, Vernon SD, Taysavang N and Unger ER (2001) Validation of

array-based gene expression profiles by real-time (kinetic) RT-PCR. J Mol Diagn

3:26-31

Raymond F, Metairon S, Borner R, Hofmann M and Kussmann M (2006) Automated

target preparation for microarray-based gene expression analysis. Anal Chem

78:6299-6305

Roth RA, Luyendyk JP, Maddox JF, Ganey PE (2003) Inflammation and drug

idiosyncrasy--Is there a connection? J Pharmacol Exp Ther 307:1-8

Scortegagna M, Ding K, Oktay Y, Gaur A, Thurmond F, Yan LJ, Marck BT,

Matsumoto AM, Shelton JM, Richardson JA, Bennett MJ, Garcia JA (2003) Multiple

organ pathology, metabolic abnormalities and impaired homeostasis of reactive

oxygen species in Epas1-/- mice. Nat Genet 35:331-340

Seitz S, Kretz-Rommel A, Oude Elferink RP, Boelsterli UA (1998) Selective protein

adduct formation of diclofenac glucuronide is critically dependent on the rat

canalicular conjugate export pump (Mrp2). Chem Res Toxicol 11:513-519

Shen HM, Pervaiz S (2006) TNF receptor superfamily-induced cell death:

redox-dependent execution. FASEB J 20:1589-1598


at ASPE



ownloaded from


JPET #140335

34

Shibayama Y (1987) Enhanced hepatotoxicity of endotoxin by hypoxia. Pathol Res

Pract 182:390-395

Staib F, Robles AI, Varticovski L, Wang XW, Zeeberg BR, Sirotin M, Zhurkin VB,

Hofseth LJ, Hussain SP, Weinstein JN, Galle PR, Harris CC (2005) The p53 Tumor

suppressor network is a key responder to microenvironmental components of chronic

inflammatory stress. Cancer Res 65:10255-10264

Takahashi T, Shimizu H, Morimatsu H, Inoue K, Akagi R, Morita K, Sassa S (2007)

Heme oxygenase-1: a fundamental guardian against oxidative tissue injuries in acute

inflammation. Mini Rev Med Chem 7:745-753

Waring JF, Liguori MJ, Luyendyk JP, Maddox JF, Ganey PE, Stachlewitz RF, North C,

Blomme EAG, Roth RA (2005) Microarray analysis of LPS potentiation of

trovafloxacin-induced liver injury in rats suggests a role for proinflammatory

chemokines and neutrophils. J Pharmacol Exp Ther 316: 1080-1087

West DA, Valentim LM, Lythgoe MF, Stephanou A, Proctor E, van Der Weerd L,

Ordidge RJ, Latchman DS, Gadian DG (2004) MR image-guided investigation of

regional signal transducers and activators of transcription-1 activation in a rat model

of focal cerebral ischemia. Neuroscience 127:333-339

Yee SB, Hanumegowda UM, Hotchkiss JA, Ganey PE, Roth RA (2003) Role of

neutrophils in the synergistic liver injury from monocrotaline and bacterial

lipopolysaccharide exposure. Toxicol Sci 72:43-56


at ASPE



ownloaded from


JPET #140335

35

Zhang L, Subarsky P, Hill RP (2007) Hypoxia-regulated p53 and its effect on

radiosensitivity in cancer cells. Internat J Rad Biol 83:443-456


at ASPE



ownloaded from


JPET #140335

36

Footnotes

This work was supported by NIH grants ES04139 and GM 075865.


at ASPE



ownloaded from


JPET #140335

37

Legends For Figures

Fig. 1. Liver histopathology after DCLF treatment. Rats pretreated with antibiotics

or vehicle (saline) were treated with DCLF (100mg/kg), and liver histopathology was

examined 6 h later. Subcapsular hemorrhagic coagulative necrosis (arrows) was noted

in Veh/DCLF-treated livers, and this was absent in livers from

antibiotic/DCLF-treated rats.

Fig. 2. Hierarchical clustering of hepatic gene expression profiles. Hepatic gene

expression profiles were examined 6 h after DCLF treatment in rats pretreated with

antibiotics or vehicle. Hierarchical clustering was performed using Euclidian distance

with expression data from Veh/Veh-treated rats as baseline.

Fig. 3. K-means clustering of hepatic gene expression profiles. K-Means clustering

was performed on gene expression profiles 6 h after treatment with LPS (2.9x107

EU/kg, i.v.), or nontoxic (20 mg/kg) or toxic doses (100 mg/kg) of DCLF (mpk =

mg/kg). Cosine correlation was used as the metric type.

Fig. 4. Hepatic PMN staining after DCLF treatment. PMN accumulation was

evaluated using immunohistochemistry 6 h after DCLF treatment in rats pretreated

with antibiotics or vehicle. In livers of DCLF-treated rats, accumulation of large

numbers of PMNs (red staining) was evident in the subcapusular region. The PMN


at ASPE



ownloaded from


JPET #140335

38

accumulation was markedly reduced by the antibiotic treatment.

Fig. 5. Hepatic PMN staining after treatment with PMN antiserum. PMN

antiserum (NAS) or control serum (CS) was administered 16 h before DCLF

treatment. PMN accumulation was evaluated using immunohistochemistry 6 h after

DCLF treatment. This antiserum abolished the subcapuslar PMN accumulation in

livers of DCLF-treated rats.

Fig. 6. Serum ALT activity after treatment with PMN antiserum. Rats were

treated as described in Fig. 5 and serum ALT activity was evaluated 6 h after DCLF

treatment. n=5-6. Values are not significantly different.

Fig. 7. PIM adduct staining after DCLF treatment. Rats were treated with DCLF

(100 mg/kg), and PIM adduct staining was evaluated 6 h later. n=5-6; *significantly

different from Veh treatment group.

Fig. 8. Effect of hypoxia on DCLF-induced hepatocyte death in vitro. Primary rat

hepatocytes were isolated and incubated at 20% or 5% O2 atmosphere. At the same

time, they were treated with DCLF at the indicated concentrations. n= three separate

hepatocyte isolations; *significantly different from the respective group without

DCLF treatment. #significantly different from the respective group at 20% O2

atmosphere.


at ASPE



ownloaded from


JPET #140335

39

Table 1. DCLF-induced Gene Expression Changes Correlated with Serum ALT

Activity and Altered by Antibiotic Treatment

Primary Sequence Name

Veh/DCLF Fold Change

Antibiotic/DCLF Fold Change

Gene function

Fabp5 7.61 2.34 LPS inducible Adh4 -5.74 -2.26 Fatty acid metabolism Nek6 4.52 2.71 Cell cycle and proliferation Srm 4.26 2.25

Alas1 -3.71 -2.69 LPS inducible Stat3 3.58 2.67 LPS inducible Fga 3.30 2.48 LPS inducible

Sh3bp5 -3.23 -1.90 Amigo3 2.84 0.80 Ccng1 2.70 0.79 Cell cycle and proliferation

Ssr3 2.49 1.44 Protein transport and

trafficking Stch 2.42 1.58

Rraga 2.41 1.62

Stch 2.41 1.65 Protein transport and

trafficking

Scfd1 2.34 1.58 Protein transport and

trafficking Cyp4f4 -2.18 -1.24 Fatty acid metabolism

Vdp 2.07 1.50 Protein transport and

trafficking

Ssr3 2.03 1.37 Protein transport and

trafficking Sec61a1 2.00 1.57 Selenbp1 -1.96 -1.25

Aldh3a2 -1.94 -0.72 LPS inducible, fatty acid

metabolism Sord -1.94 -0.73 Litaf 1.90 0.82

Ndrg2 -1.89 -1.29 Prkaa2 -1.89 -1.23 Galm -1.83 -0.62 Preb 1.77 0.62

Sec61a1 1.76 0.81 Sord -1.71 -0.74

Acsl1 -1.62 -1.17 LPS inducible, fatty acid

metabolism


at ASPE



ownloaded from


JPET #140335

40

Genes for which expression changed after Veh/DCLF treatment and that were

expressed differently after antibiotic/DCLF treatment and Veh/DCLF treatment were

further filtered by the degree of correlation of their expression value with ALT. Genes

with high correlation along with their respective expression ratio after Veh/DCLF and

antibiotic/DCLF treatment are listed in the table. The function of genes (as described

in Entrez Gene site http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene) with

potential importance in liver injury is also noted.


at ASPE



ownloaded from


JPET #140335

41

Table 2. Pathways Associated with DCLF-induced Gene Expression Changes

Altered by Antibiotic Treatment

Pathway -log(p) Ratio (%) Genes

LPS/IL-1 Mediated Inhibition of RXR

Function 3.80 4.8

SULT2B1, ALDH3A2, SULT1C3, ALAS1, SLCO1B3, ACSL1,

SLC10A1, FABP5, RXRA

Fatty Acid Metabolism 3.37 5.4 ADH4, ALDH3A2,

CYP4F8, EHHADH, ACAA1, HADH, ACSL1

FXR/RXR Activation 2.82 6.3 IL1A, G6PC, SLCO1B3,

SLC10A1, RXRA Positive Acute Phase

Response Proteins 2.27 8.8 ORM2, SERPINA3, FGA

Mechanism of Gene Regulation by Peroxisome Proliferators via PPARα

1.75 4.2 IL1A, EHHADH, APOA2,

RXRA

LXR/RXR Activation 1.45 4.4 IL1A, HADH, RXRA TR/RXR Activation 1.41 6.7 FGA, RXRA

PXR/RXR Activation 1.35 6.3 ALAS1, RXRA

The genes differentially expressed between antibiotic/DCLF and Veh/DCLF

groups were imported into Ingenuity Pathway Analysis 5.5. Functional annotations

were based on the Ingenuity System knowledge base. “Ratio” refers to the percentage

of the total number of genes in a particular pathway found in the imported list of

genes. The pathways reported by Ingenuity Pathway Analysis were ranked by p value

which illustrates the deviation of the observed number of genes for each pathway

found in the imported list from the number expected to occur by chance.


at ASPE



ownloaded from


JPET #140335

42

Table 3. DCLF-induced Gene Expressions Changes Correlated with Serum ALT

Activity but Not Altered by Antibiotic Treatment

Primary Sequence Name

Veh/DCLF Fold Change

Antibiotic/DCLF Fold Change

Gene function

Usp2 -16.18 -14.08 S100a9 14.60 12.20

Icam1 10.77 10.47 Inflammation, hypoxia

inducible Slc9a3r1 10.04 6.77 Hsd17b2 -7.60 -1.80 Serpinb5 -5.77 -3.18

Ak3l1 -4.90 -3.07 Ptger3 -4.73 -2.88 Inflammation Ptpns1 4.69 2.97

Il1b 4.55 3.62 Inflammation

Sod2 4.46 3.25 Oxidative stress, hypoxia

inducible Nr1i3 -4.31 -2.25 Acacb -4.19 -2.09 Nol5 3.90 1.94 Tns -3.88 -3.98

Frag1 -3.85 -2.70 Hmox1 3.84 2.46 Oxidative stress Pdk2 -3.82 -1.65 Gas6 3.63 2.85 Cell cycle and cell death Tns -3.26 -2.54

Pbef1 3.25 2.28 Cell cycle and cell death Lbp 3.20 2.81 Inflammation

Slco2a1 -3.19 -1.54

Btg2 3.13 1.40 Cell cycle and cell death,

hypoxia inducible Sult1c2 -3.12 -1.70 Mir16 -3.04 -1.40 Il13ra1 3.01 3.02 Inflammation Pdp2 -3.00 -2.38 Nr1i2 -2.97 -1.98 Galm -2.95 -2.03 Pspla1 2.94 2.08 Inflammation Plrg1 2.92 1.73


at ASPE



ownloaded from


JPET #140335

43

Cth -2.89 -2.07

Tnfrsf1a 2.89 2.61 Inflammation, cell cycle

and cell death Lkap -2.81 -1.91

Enpp2 -2.81 -2.25 Ptpn2 2.81 2.05 Inflammation

Mybbp1a 2.75 1.71 Inflammation Slc9a3r1 2.73 1.94

Abat -2.72 -2.18 Sgk 2.68 0.79 Cell cycle and cell death Tars 2.67 2.19

Nolc1 2.66 1.61 Smoc1 -2.66 -1.82 Pfkfb1 -2.64 -1.74 Klf15 -2.62 -1.57 Fmo1 -2.54 -1.94

Slc16a7 -2.50 -1.55 Foxa3 2.49 1.51 Ssr3 2.47 1.70

Ddx39 2.41 1.37 Slco2a1 -2.38 -0.84 Prkar2a 2.36 1.88 Timp1 2.35 1.41 Mcl1 2.35 1.65 Pbef1 2.29 1.75 Cell cycle and cell death Lgals3 2.26 1.60 Inflammation Faah -2.25 -1.59

Slc37a4 -2.23 -1.41 Akr7a2 -2.12 -1.64

Stat1 2.11 2.00 Inflammation, cell cycle and cell death, hypoxia

inducible Arfip2 2.07 1.51 Inflammation Gclm -2.04 -1.34

Ptpns1 2.03 1.67

Tp53 2.01 1.66 Cell cycle and cell death,

hypoxia inducible Sfpq 2.00 1.42

Slc16a1 1.99 0.98 Galnt11 -1.96 -0.78 Mtac2d1 -1.94 -1.40 Il13ra1 1.91 1.77 Inflammation Mic2l1 -1.91 -1.43


at ASPE



ownloaded from


JPET #140335

44

Acsl1 -1.91 -1.36 Gpr48 -1.87 -1.41 Eif4a1 1.86 1.43 Gpr48 -1.82 -1.26 Rdx -1.81 -1.41 Khk -1.75 -1.37

Stat1 1.67 1.82 Inflammation, cell cycle and cell death, hypoxia

inducible Hnrpa3 1.54 1.35

Fga 1.53 1.43 Nedd4a -1.52 -1.38

Genes for which expression changed after Veh/DCLF treatment and that were

expressed similarly after antibiotic/DCLF treatment and after Veh/DCLF treatment

were further filtered by the degree of correlation of their expression value with plasma

ALT activity. The genes with high correlation along with their respective expression

ratio are listed in the table. The function of genes (as described in Entrez Gene site

http://www.ncbi.nlm.nih.gov/entrez/ query.fcgi?db=gene) with potential importance in

liver injury is also noted.


at ASPE



ownloaded from


JPET #140335

45

Table 4. Pathways Associated with DCLF-induced Gene Expressions but Not

Altered by Antibiotic Treatment

Pathway list -log(p) Ratio(%) Genes

Positive Acute Phase Response Proteins

9.48 32.4 C9, FGB, CP, A2M, SOD2, FGG, CRP, FGA, HMOX1,

LBP, HPX

Oxidative Stress 9.00 22.8

S100A9, ICAM1, TP53, GSTM3, DUSP1, FOS,

SOD2, MAPK14, PRDX4, GCLM, XDH, NQO1, GSS

LPS/IL-1 Mediated Inhibition of RXR

Function 4.73 8.5

MAOB, TNFRSF1A, NR1I3, NR1I2, SULT1C2, NR0B2,

HMGCS2, IL1R1, LIPC, FMO1, GSTM3, ALDH9A1, ACSL1, LBP, MAOA, IL1B

FXR/RXR Activation 4.55 12.5

IL1A, MLXIPL, BAAT, NR1I2, FOXO1, NR0B2, CYP8B1, PON1, LIPC,

IL1B

Oxidative Stress Response Mediated by Nrf2

3.21 6.8

JUNB, FMO1, HMOX1, GSTM3, MAF, NQO2, TXNRD1, FOS, SOD2,

MAPK14, AKR7A2, GCLM, NQO1, PPIB

Aryl Hydrocarbon Receptor Signaling

2.81 7.2 ALDH9A1-, IL1A, NQO2, NFIC, FOS, NR0B2, TP53,

NQO1, NFIB, GSTM3, IL1B

Hypoxia-Inducible Factor Signaling

2.76 10.0 LDHA, CSNK1D, EIF2S2,

EIF2S1, TP53, NQO1, UBE2G1

Mechanism of Gene Regulation by Peroxisome

Proliferators via PPARα 2.60 8.4

IL1A, DUSP1, TNFRSF1A, FOS, PRKAR2A, NR0B2,

IL1R1, IL1B

Hepatic Fibrosis 2.28 8.2 IL1A, TIMP1, COL1A2, ICAM1, A2M, IGFBP3,

IL1B

Hepatic Cholestasis 2.18 6.7 IL1A, NR1I2, TNFRSF1A, PRKAR2A, NR0B2, IL1R1,

CYP8B1, LBP, IL1B


at ASPE



ownloaded from


JPET #140335

46

LXR/RXR Activation 2.13 8.7 IL1A, TNFRSF1A, IL1R1,

APOA4, LBP, IL1B CAR/RXR Activation 1.46 10.3 NR1I3, MCL1, CES1

The genes similarly expressed between antibiotic/DCLF and Veh/DCLF groups were

imported into Ingenuity Pathway Analysis 5.5. Functional annotations were based on

the Ingenuity System knowledge base. “Ratio” refers to the percentage of the total

number of genes in a particular pathway found in the imported list of genes. The

pathways reported by Ingenuity Pathway Analysis were ranked by p value, which

illustrates the deviation of the observed number of genes in one pathway of the

Ingenuity System database found in the imported list from the number expected to

occur by chance.


at ASPE



ownloaded from



at ASPE



ownloaded from



at ASPE



ownloaded from



at ASPE



ownloaded from



at ASPE



ownloaded from



at ASPE



ownloaded from



at ASPE



ownloaded from



at ASPE



ownloaded from



at ASPE



ownloaded from


Documents

Journal of Pharmacology and Experimental Therapeutics - Title …jpet.aspetjournals.org › content › jpet › early › 2008 › 09 › 18 › ... · JPET #140335 2 Running Title