J. Gen. Appl. Microbiol., 58 Full Paper Improved

Introduction

　The fi lamentous fungus Aspergillus oryzae has been used in the Japanese food fermentation industry for more than 1,000 years (Kitamoto, 2002). It possesses the exceptional advantage of an unbeatable secretion capacity and it is a “generally regarded as safe” (GRAS) microorganism (Fleißner and Dersch, 2010). In addi-tion, proper eukaryotic posttranslational modifi cations, including glycosylation and protein folding, are ex-

pected to occur in A. oryzae when compared to prokaryotic production/secretion systems such as Es-

cherichia coli. Thus, A. oryzae has been used in heter-ologous protein production for various biotechnologi-cal applications (Fleißner and Dersch, 2010).　In general, the production level of heterologous pro-teins by A. oryzae is much lower than the homologous (fungal) proteins due to their proteolytic degradation by proteases secreted into the culture medium (Archer and Peberdy, 1997; Gouka et al., 1997; van den Hombergh et al., 1997). Hence, the construction of protease-defi cient mutants to avoid the proteolytic degradation is an important strategy to improve the productivity. However, the genome sequencing proj-ect revealed that A. oryzae has 134 protease genes (Machida et al., 2005), and thus it was diffi cult to select disruption targets.　Previously, we reported that the single disruption of the fi ve single protease genes (pepA, pepE, alpA, tppA,

J. Gen. Appl. Microbiol., 58, 199‒209 (2012)

Proteolytic degradation is one of the serious bottlenecks limiting the yields of heterologous pro-tein production by Aspergillus oryzae. In this study, we selected a tripeptidyl peptidase gene AosedD (AO090166000084) as a candidate potentially degrading the heterologous protein, and performed localization analysis of the fusion protein AoSedD-EGFP in A. oryzae. As a result, the AoSedD-EGFP was observed in the septa and cell walls as well as in the culture medium, sug-gesting that AoSedD is a secretory enzyme. An AosedD disruptant was constructed to investi-gate an effect of AoSedD on the production level of heterologous proteins and protease activity. Both of the total protease and tripeptidyl peptidase activities in the culture medium of the AosedD disruptant were decreased as compared to those of the control strain. The maximum yields of recombinant bovine chymosin (CHY) and human lysozyme (HLY) produced by the AosedD dis-ruptants showed approximately 2.9- and 1.7-fold increases, respectively, as compared to their control strains. These results suggest that AoSedD is one of the major proteases involved in the proteolytic degradation of recombinant proteins in A. oryzae.

Key Words—AosedD; Aspergillus oryzae; heterologous protein production; tripeptidyl peptidase

　* Address reprint requests to: Dr. Katsuhiko Kitamoto, Depart-ment of Biotechnology, The University of Tokyo, 1‒1‒1 Yayoi, Bunkyo-ku, Tokyo 113‒8657, Japan.　Tel: 81‒3‒5841‒5161　　Fax: 81‒3‒5841‒8033　E-mail: [email protected]　† Present address: College of Pharmacy, Keimyung Universi-ty, 1095 Dalgubeoldaero, Dalseo-Gu, Daegu 704‒701, Republic of Korea.

Full Paper

Improved heterologous protein production by a tripeptidyl peptidase gene (AosedD) disruptant of the fi lamentous fungus Aspergillus oryzae

Lin Zhu, Takashi Nemoto, Jaewoo Yoon,† Jun-ichi Maruyama, and Katsuhiko Kitamoto*

Department of Biotechnology, The University of Tokyo, Bunkyo-ku, Tokyo 113‒8657, Japan

(Received November 12, 2011; Accepted February 15, 2012)

200 Vol. 58ZHU et al.

and palB) enhanced human lysozyme (HLY) produc-tion. In particular, disruption of the tppA gene encod-ing a tripeptidyl peptidase is the most effective for im-proving production of HLY by A. oryzae (Jin et al., 2007), which suggests that tripeptidyl peptidases might play a signifi cant role in degradation of the het-erologous protein. The A. oryzae TppA shares a 68.8% identity with the tripeptidyl peptidase SedB from Asper-

gillus fumigatus. SedB belongs to the sedolisin family (MEROPS S53), and A. fumigatus has four proteases of the sedolisin family, namely SedA, SedB, SedC, and SedD. SedA as endoproteases, together with SedB, SedC, and SedD as tripeptidyl peptidase, constitutes a set of proteases that can be used for nitrogen as-similation in A. fumigatus to degrade proteins at acidic pHs (Reichard et al., 2006; Sriranganadane et al., 2010).　Three tripeptidyl peptidase genes tppA/AosedB, AosedC, and AosedD were found in the A. oryzae ge-nome database DOGAN (http://www.bio.nite.go.jp/ do gan/project/view/AO). Our DNA microarray analysis (unpublished results) indicates that AosedD is ex-pressed at the highest level among the three tripepti-dyl peptidase genes in A. oryzae. Therefore, we hy-pothesized that the AosedD gene might be a gene negatively affecting the heterologous protein produc-tion. Here, we report the localization of AoSedD, dis-ruption of the AosedD gene and its remarkable effect on improvement of the heterologous protein produc-tion in A. oryzae.

Materials and Methods

　Strains, media, and transformation.　 The strains generated in this study are listed in Table 1. A. oryzae wild-type strain RIB40 (Machida et al., 2005) was used as a DNA donor. Strains niaD300 (niaD-; Minetoki et al., 1996) and NSPlD1, which has a highly effi cient gene-targeting background (niaD- sC- ΔpyrG ΔligD; Maruyama and Kitamoto, 2008), were used for trans-formation. DPY medium (2% dextrin, 1% polypeptone, 0.5% yeast extract, 0.5% KH2PO4, and 0.05% MgSO4·7H2O, pH 5.5) were used to grow the A. oryzae strain. M+Met medium (0.2% NH4Cl, 0.1% (NH4)2SO4, 0.05% KCl, 0.05% NaCl, 0.1% KH2PO4, 0.05% MgSO4·7H2O, 0.002% FeSO4·7H2O, 2% glucose, 0.15% methionine, pH 5.5) with required supplements (20 mM uridine and 0.2% uracil) was used for transfor-mation and growth of A. oryzae strains. 5× DPY me-

Tabl

e 1.　

Str

ains

use

d in

this

stu

dy.

Nam

eP

aren

tal

stra

inG

enot

ype

Ref

eren

ce

RIB4

0W

ild-ty

peM

achi

da e

t al.,

200

5ni

aD30

0RI

B40

nia

D-

Min

etok

i et a

l., 1

996

NSP

lD1

NSR

-ΔlD

2n

iaD-

sC-

ade

A-

Δarg

B::a

de

A-

Δlig

D::a

rgB

Δp

yrG

::ad

eA

Mar

uyam

a et

al.,

200

8N

SlD

1-sD

2N

SPlD

1n

iaD-

sC-

ade

A-

Δarg

B::a

de

A-

Δlig

D::a

rgB

Δp

yrG

::ad

eA

ΔA

ose

dD

::pyr

GTh

is s

tudy

NSl

D1

NSP

lD1

nia

D-

sC-

ade

A-

Δarg

B::a

de

A-

Δlig

D::a

rgB

Δp

yrG

::ad

eA

pgE

pG [p

yrG

]Yo

on e

t al.,

201

0aSl

D-A

KC1

NSl

D1

nia

D- :

:pgA

KCN

[Pam

yB::a

myB

-ke

x2-C

HY:

:Tam

yB::n

iaD

] sC-

ade

A-

Δarg

B::a

de

A-

Δlig

D::a

rgB

Δp

yrG

::ad

eA

pgE

pG [p

yrG

]Yo

on e

t al.,

201

0aSl

D1-

sD2-

AKC

1/8/

9N

SlD

1-sD

2n

iaD- :

:pgA

KCN

[Pam

yB::a

myB

-ke

x2-C

HY:

:Tam

yB::n

iaD

] sC-

ade

A-

Δarg

B::a

de

A-

Δlig

D::a

rgB

Δp

yrG

::ad

eA

ΔA

ose

dD

::pyr

GTh

is s

tudy

SlD

-HLY

1N

SlD

1n

iaD- :

:pgA

FLN

[Pam

yB::a

myB

-ke

x2-H

LY::T

amyB

::nia

D] s

C-

ade

A-

Δarg

B::a

de

A-

Δlig

D::a

rgB

Δp

yrG

::ad

eA

pgE

pG [p

yrG

]Yo

on e

t al.,

201

0aSl

D1-

sD2-

HLY

1/2/

6N

SlD

1- s

D2

nia

D- :

:pgA

FLN

[Pam

yB::a

myB

-ke

x2-H

LY::T

amyB

::nia

D] s

C-

ade

A-

Δarg

B::a

de

A-

Δlig

D::a

rgB

Δp

yrG

::ad

eA

ΔA

ose

dD

::pyr

GTh

is s

tudy

2012 201Protein production by Aspergillus oryzae ΔAosedD

dium (pH 5.5) (10% dextrin, 5% polypeptone, 2.5% yeast extract, 0.5% KH2PO4, and 0.05% MgSO4·7H2O, pH 5.5) (Jin et al., 2007) was used as a medium for production of CHY. 5× DPY medium (pH 8.0) (10% dextrin, 5% polypeptone, 2.5% yeast extract, 0.5% K2HPO4, and 0.05% MgSO4·7H2O, pH 8.0) (Jin et al., 2007) was used as a medium for production of HLY. The Czapek‒Dox medium (0.3% NaNO3, 0.2% KCl, 0.1% KH2PO4 0.05% MgSO4·7H2O, 0.002% FeSO4· 7H2O, 2% glucose, pH 5.5) supplemented with 0.0015% methionine was used for niaD-based plasmid integration and for microscopic observations. E. coli

DH5α was used for DNA manipulation. A. oryzae was transformed according to a method described in Mar-uyama and Kitamoto (2011).　Molecular techniques.　 The BP and LR recombina-tion reactions with the MultiSite Gateway system (Invit-rogen, Carlsbad, CA, USA) were performed for all plas-mid construction as instructed by the manufacturer. DNA fragments were amplifi ed with PrimeSTAR HS DNA Polymerase (TaKaRa, Otsu, Japan). All of the primers used in this study are listed in Table 2.　Expression plasmid construction.　 The plasmid en-coding AoSedD-EGFP was constructed as follows. The ORF of the AosedD gene was amplifi ed by using primers (AosedD-ORF-F and AosedD-ORF-R) and the genomic DNA as template, and then inserted into a pDONRTM221 vector (Invitrogen) by the BP recombi-

nation reaction. The generated center entry clone (pgCsD), 5′entry clone (pg5′PaB) (Mabashi et al., 2006), and 3′entry clone (pg3′E) (Mabashi et al., 2006) were mixed with the destination vector (pgDN) (Mabashi et al., 2006) for the LR recombination reac-tion. The resulting plasmid pgASDGN contains the AosedD-egfp fusion gene under the control of the amyB promoter along with the niaD marker. The plas-mid pgASDGN was introduced into the strain niaD300.　The expression plasmids pgAKCN and pgAFLN for bovine chymosin (CHY) and human lysozyme (HLY), respectively, were used (Nemoto et al., 2009).　Construction of the AosedD disruptant.　 The 1.5-kb upstream fl anking region of the AosedD ORF was am-plifi ed with the primer (aB4-5sD_F and aB1r-5sD_R) and the genomic DNA as template and inserted into pDONRTMP4-P1R (Invitrogen) by the BP recombina-tion reaction, generating the 5′entry clone, pg5sD. The 0.3 kb upstream and 1.5 kb downstream fl anking re-gions of the gene were amplifi ed with primers (aB2r-sD_F and f-sD+p_R for the upstream, f-sD+p_F and aB3-sD_R for the downstream). The two fragments were fused with primers (aB2r-sD_F and aB3-sD_R) and inserted into pDONRTMP2R-P3 (Invitrogen) by the BP recombination reaction, generating the 3′entry clone, pg3′sD+p. The obtained 5′ and 3′entry clones together with the center entry clone plasmid, pgEpG

Table 2.　Primers used in this study.

Primer Sequence (5′-3′)

(Amplifi cation of AosedD gene for expression of plasmid construction)AosedD-ORF-F ATGCGTTCATCATTTCTCCTCGCAAosedD-ORF-R CAAAGACAGGACCAAATCCTTCAA

(Disruption of AosedD gene)aB4-5sD_F GGGGACAACTTTGTATAGAAAAGTTG CTTCACCCCACATCGAATTCTGTaB1r-5sD_R GGGGACTGCTTTTTTGTACAAACTTG TAGAGACGATCGAAAGGAGAGGTaB2r-sD_F GGGGACAGCTTTCTTGTACAAAGTGG ACAATAGCAGAAGTCGGAGTACCf-sD+p_R TAGAGACGATCGAAAGGAGAGGTf-sD+p_F GGATCTGCCGTAAAGAGACAATACaB3-sD_R GGGGACAACTTTGTATAATAAAGTTG CTTACGAGTGCAGAGACAGACA

(Verifi cation of AosedD gene disruption/genomic PCR)AosedDup-1529 bp-F GAATACTGTACCTTCACCCCACAAosedDdown-2082 bp-R GCCGTAAAGAGACAATACGAAGATG

(Southern blot probe)AosedDup-1518 bp-F CTTCACCCCACATCGAATTCTGTAosedDup-390 bp-R ACGAGGCTTGACCTTGCTTATCT


(Maruyama and Kitamoto, 2008), were mixed for the LR recombination reaction with the destination vector, pDESTTMR4-R3 (Invitrogen), generating pgΔsDpG. The gene disruption fragment for AosedD was ampli-fi ed by primers (aB4-5sD_F and aB3-sD_R) using pgΔsDpG as template and introduced in strain NS-PlD1. M+Met medium was used for selection of trans-formants. Genomic DNAs were used as template for PCR analysis using the primers (AosedDup-1529 bp-F and AosedDdown-2082 bp-R) for verifi cation of the AosedD gene disruption.　Southern blot analysis.　 The AosedD disruptants and strains expressing heterologous proteins were analyzed by Southern blot analysis. The process was according to a previously reported method (Nemoto et al., 2009): after electrophoresis, the genomic DNAs were transferred onto the Hybond N+ membrane (GE Healthcare, Buckinghamshire, UK). The enhanced chemiluminescence direct nucleic acid labeling and detection system (GE Healthcare) and LAS-4000mi-niEPUV luminescent image analyzer (Fuji Photo Film, Tokyo, Japan) were used for detection.　Western blot analysis.　 The transformants express-ing CHY were cultured in 20 ml of 5× DPY (pH 5.5) medium at 30°C for 4 days. The culture media (4 μl) were subjected to sodium dodecyl sulfate-polyacryl-amide gel electrophoresis, followed by transfer of the proteins onto a cellulose nitrate membrane Immobi-lon-NC (Millipore, Bedford, MA, USA) by using a semi-dry blotting system (Nihon Eido, Tokyo, Japan). The membrane was immunostained using a polyclonal rabbit serum against CHY (Nordic Immunological Lab-oratories, Tilburg, Netherlands) and anti-rabbit immu-noglobulin G labeled with horseradish peroxidase (Vector Laboratories, Peterborough, UK), and then the bands on the membrane were visualized with a ECL Advance Western blotting detection kit (GE Health-care).　Detection of AoSedD-EGFP.　 The AoSedD-EGFP in the culture media or mycelial protein extracts was ana-lyzed by Western blot analysis. For the detection in mycelia protein extracts, 0.25 g mycelia after growth in 100 ml DPY medium at 30°C for 20 h were washed, frozen with liquid nitrogen, and then thoroughly ground into a powder using a Multi-beads shocker (Yasui Kikai, Osaka, Japan). Mycelial powder was suspended in 1 ml extraction buffer (50 mM Tris–HCl (pH 7.5), Protease inhibitor cocktail) and centrifuged at 1.5 krpm at 4°C for 10 min. Then, the supernatant (mycelial pro-

tein extracts) and the culture media were subjected to Western blot analysis using the anti-GFP mouse mono-clonal antibody (1：5,000 dilution, Clontech) and per-oxidase-labeled mouse anti-immunoglobulin G anti-body (1：500 dilution, Vector Laboratories) as primary and secondary antibodies, respectively.　Fluorescence microscopy.　Approximately 105 conidia were inoculated in 150 μl of liquid medium, and then incubated in glass-based dishes (Asahi Tech-no Glass, Chiba, Japan) for fl uorescence microscopy. For fl uorescence microscopy, an Olympus system mi-croscope model BX52 (Olympus, Tokyo, Japan) equipped with a UPlanApo 100× objective lens (1.35 numerical aperture) (Olympus) was used for fl uores-cence observation of the fusion protein AoSedD-EGFP. A GFP fi lter Chroma Technologies, Brattleboro, VT, USA) was used to observe EGFP fl uorescence. The Andor iQ software (Andor Technology PLC, Belfast, UK) was used to analyze the images.　Protease activity assay.　Conidia (2×105) of the AosedD disruptant were inoculated into 20 ml of 5× DPY (pH 5.5). Total protease activities in the culture medium were measured after the growth at 30°C for 3 to 6 days. A Calbiochem protease assay kit (EMD Bio-science, San Diego, CA, USA), in which a fl uorescein thiocarbamoyl-labeled casein (FTC-casein) was used as the protease substrate, was used to analyze the to-tal protease activity in the culture medium of each A.

oryzae strain, and the pH of the assay solution was 6.5‒7.0. The total protease activity of each sample was then calculated by the obtained absorbance at 492 nm of the proteolytically cleaved small FTC peptides in the reaction supernatant, which were collected by precipi-tating the uncleaved FTC-casein with trichloroacetic acid (3.6% [wt/vol]) treatment.　Tripeptidyl peptidase activity.　Conidia (2×105) of the AosedD disruptant were inoculated into 20 ml of 5× DPY (pH 5.5). Tripeptidyl peptidase activity in the culture medium was measured after the growth at 30°C for 3 to 6 days. The enzyme assay of tripeptidyl peptidase activity was performed as previously de-scribed in Jin et al. (2007).　Measurement of CHY production yield.　 Approxi-mately 2×105 conidia of the CHY-expressing transfor-mants were inoculated in 20 ml 5× DPY (pH 5.5) me-dium and then cultured at 30°C for 3 to 6 days. The CHY activity was measured by a modifi cation of the method described by Foltmann (1970). The culture medium (100 μl) obtained every 24 h was added to 1


ml of 12% skim milk solution containing 10 mM CaCl2. During the reaction, the mixture was shaken (60 strokes per minute) at room temperature. The time point at which the thin fi lm of milk breaks into visible particles is recorded as the clotting time. The CHY pro-duction level was calculated by a standard curve gen-erated using an authentic CHY (Sigma, St. Louis, MO, USA).　HLY activity assay.　 Approximately 106 conidia of the HLY-expressing transformant were inoculated and cultured in 100 ml of 5× DPY (pH 8.0) medium at 30°C. Lysozyme activity was measured as described by Morsky and Aine (1983). The culture medium (20 μl) was mixed with 80 μl of 150 μg/ml suspension of Micrococcus lysodeikticus ATCC 4698 lyophilized cells (Sigma) in 50 mM phosphate buffer (pH 6.2). The decrease in absorbance at 450 nm of the mixture, which was due to lysis of the bacterial cells, was mon-

itored at room temperature. One unit was defi ned as the activity that reduced the absorbance value by 0.001 per min.

Results

Cloning of AosedD and localization analysis of AoSedD-

EGFP

　The A. oryzae genome database DOGAN was searched for a gene homologous to sedD in A. fumiga-

tus and the gene (AO090166000084) found was named AosedD. The predicted amino acid sequence of AoSedD was aligned and compared with that of SedD

in A. fumigatus using the CLUSTALW (http://www. genome.jp/tools/clustalw/) program. AoSedD has 594 amino acids containing N-terminal signal peptide, and shares 76.9% identity with A. fumigatus SedD (Fig. 1).　To determine the localization of AoSedD in A. oryz-

Fig. 1.　Alignment of AoSedD with A. fumigatus SedD.Predicted signal sequences are represented by the box.


ae, the plasmid (pgASDGN) containing an AosedD-

egfp fusion construct under the control of amyB pro-moter was constructed and introduced into the A.

oryzae strain niaD300. Before fl uorescence microsco-py for the transformants, AoSedD-EGFP in mycelial protein extracts and culture medium was analyzed by Western blotting using anti-EGFP antibodies. In myce-lial protein extracts, a major band for the fusion frag-ment AoSedD-EGFP (approximately 89 kDa) was de-tected, together with a protein EGFP fragment (approximately 27 kDa) (Fig. 2A and C). In the culture medium, a high level of the EGFP fragment was de-tected in addition to a little amount of the fusion frag-ment AoSedD-EGFP (Fig. 2B).　In fl uorescence microscopic analysis of the AoSedD-EGFP expressing strain, EGFP fl uorescence was pres-ent in the septa and cell walls, while vacuoles identi-fi ed by DIC microscopy showed no EGFP fl uorescence (Fig. 3). However, the Spitzenkörper where the secre-tory proteins accumulate (Gordon et al., 2000; Harris et al., 2005; Hayakawa et al., 2011; Kimura et al., 2010;

Masai et al., 2003) could not be observed at the hyphal tips.

Disruption of the AosedD gene

　The DNA fragment for disruption of the AosedD gene was introduced into the A. oryzae strain NSPlD1, and the homologous recombination was confi rmed by Southern blot analysis (Fig. 4). All the disruptants grew normally in all the culture conditions examined, and the strain NSlD1-sD2 was used in the following experi-ments.

Decrease of total protease and tripeptidyl peptidase

activities in the culture medium of AosedD disruptant

　For functional analysis of AoSedD, the time-course analysis of the extracellular protease and tripeptidyl peptidase activities in the AosedD disruptant was per-formed. The total protease activity in the culture medi-um of AosedD disruptant (NSlD1-sD2) was lower than that of the control strain (NSlD1) (Fig. 5A). Further-more, the tripeptidyl peptidase activity in the culture

Fig. 2.　Western blot analysis of AoSedD-EGFP in A. oryzae.　(A) Western blot analysis of AoSedD-EGFP in mycelial protein extracts. (B) Western blot analysis of AoSedD-EGFP in culture media. The transformants were cultured in 100 ml DPY medium at 30°C for 24 h, and their mycelial protein extracts and culture media were analyzed using anti-GFP antibody. ASDGN1, ASDGN2 and ASDGN3 represent the AoSedD-EGFP ex-pressing strains under the control of the amyB promoter. (C) Schematic model for the entire polypeptide chain of AoSedD-EGFP. Western blot analysis demonstrated the theoretical mo-lecular weight for each possible fragment.


Fig. 3.　Localization analysis of AoSedD-EGFP in A. oryzae.　The strains expressing AoSedD-EGFP were cultivated in CD medium (pH 5.5) at 30°C for 20 h on a cover glass and ob-served with both differential interference contrast (DIC) and fl uorescence microscopy (EGFP). The arrows and arrowheads indicate septa and vacuolar structures, respectively. Bars, 5 μm.

Fig. 4.　Disruption of the AosedD gene.　(A) Schematic model of the AosedD gene disruption with the pyrG marker. The 1.5 kb fl anking regions (boxed) were used for the AosedD gene disruption. The 0.3-kb upstream fl anking region of the AosedD gene (spotted box) was attached at 5′-end of the downstream fl anking region, introducing direct repeats. (B) South-ern blot analysis of the AosedD gene disruptant. The genomic DNAs were digested with PvuII and XbaI, and subjected to Southern blot analysis. Strains analyzed in the panel revealed the expected band patterns for disruption of the AosedD gene. “WT” and “Δ” represent the parental strain (NSPlD1) and the gene disruptant (NSlD1-sD2), respectively.


medium of the AosedD gene disruptant was obviously lower than the control strain (Fig. 5B), suggesting that AoSedD is a tripeptidyl peptidase.

Effect of the AosedD gene disruption on heterologous

protein production in A. oryzae

　In order to investigate whether the production level of heterologous proteins was improved in the AosedD disruptant NSlD1-sD2, we employed CHY as a model

protein. A. oryzae α-amylase (AmyB) was used as the carrier protein for fusion with CHY to aid successful production of heterologous proteins (Fig. 6A, left). The plasmid for CHY expression was introduced into the AosedD disruptant (NSlD1-sD2) with the niaD gene as the selectable marker. The transformants containing a single copy of the plasmid integrated at the niaD locus were selected by Southern blot analysis (data not shown).　The amount of CHY produced by each strain was determined by the milk clotting activity of the culture medium. Time-course analysis revealed that the maxi-mum production yields (4 days) by the CHY-express-ing AosedD disruptants SlD1-sD2-AKC 1, 8 and 9 were 78.0, 75.5 and 77.5 mg/L, respectively, which were 2.9, 2.8 and 2.8-fold higher than that of the control strain SlD-AKC1 (27.3 mg/L; Fig. 6B). Furthermore, the culture media of the transformants were also exam-ined by Western blot analysis with the anti-CHY anti-body to further confi rm the presence of CHY. Mature CHY (approximately 35 kDa) and proCHY (approxi-mately 40 kDa) were detected in the culture medium (Fig. 6C). Western blot analysis also indicated that the amounts of CHY produced by the AosedD disruptants were obviously higher than that of the control strain.　To determine whether the production levels of other heterologous proteins could be improved by the AosedD disruptant, we next constructed the HLY-pro-ducing strains (Fig. 6A, right) from the AosedD disrup-tants (NSlD1-sD2). Southern blot analysis verifi ed that the obtained transformants possessed a single copy of the plasmid, which was integrated at the niaD locus (data not shown). Time-course analysis revealed that disruption of the AosedD gene increased the HLY pro-duction. The maximum yields (4 days) by the HLY-ex-pressing AosedD disruptants SlD1-sD2-HLY1, 2 and 6 were 22.0, 20.3 and 19.7 mg/L, respectively, which were 1.7, 1.6 and 1.6-fold higher than that of the con-trol strain SlD-HLY1 (12.7 mg/L; Fig. 6D).

Discussion

　In the present study, we selected the tripeptidyl pep-tidase gene AosedD as a candidate potentially de-grading heterologous protein. Fluorescence micro-scopic and Western blot analyses of the AoSedD-EGFP (Figs. 2 and 3) suggest that AoSedD is a secretory protease as judged by the detection in septa and cell walls as well as in the culture medium. The tripeptidyl

Fig. 5.　Time-course analysis of the total protease and tri-peptidyl peptidase activities in culture media of the AosedD gene disruptant.　(A) The relative total protease activities in the culture media of the control strain (NSPlD1) and the AosedD disruptant (NSlD1-sD2). (B) The relative tripeptidyl peptidase activity in the culture media of the control strain (NSPlD1) and the AosedD disruptant (NSlD1-sD2). The value of total protease or tripeptidyl pepti-dase activities of the control strain (NSPlD1) in the growth phase (3 days) are set to 1.0. Three replicate experiments were per-formed, and the values of the average and standard deviations are represented (*, p ＜ 0.05; **, p ＜ 0.01 [Student t test]).

(A)

(B)


peptidase activities in the culture medium of the AosedD disruptant were decreased by ～40% (Fig. 5B). These results suggest that AoSedD is probably a secretory protein and governs a major part of the tri-peptidyl peptidase activity in the culture medium.

　Moreover, we investigated the effect of the AosedD gene disruption on heterologous protein production in

A. oryzae. As expected, production levels of recombi-nant CHY and HLY in the AosedD disruptant were en-hanced by 2.9 and 1.7-fold above those of the control strain, respectively (Fig. 6). This is in agreement with results of the total protease and tripeptidyl peptidase activity assay (Fig. 5). The level of recombinant HLY production (started from pH 8.0, after 4 days pH was

Fig. 6.　Effects of the AosedD gene disruption on production of heterologous proteins.　(A) Schematic model of the CHY- and HLY-expressing cassettes. A. oryzae α-amylase (AmyB) was used as the carrier protein for fusion with proCHY, and the Kex2 cleavage sites (-Lys-Arg-) were included at the upstream of prochymosin (left). The HLY gene was fused with the α-amylase gene amyB (right). The Kex2 cleavage site (-Lys-Arg-) was included at the boundary of two genes. (B) Time-course analysis of CHY production by the AosedD gene disruptant. Approximately 2×105 conidia of each strain were inoculated into 20 ml of 5× DPY (pH 5.5) medium and the CHY activities in the culture media were measured after 3‒6 days of growth at 30°C. The pro-duction yields of CHY by each strain were calculated by comparing the activity values with the standard curve generated by authentic bovine chymosin (Sigma). (C) Western blot analysis of the culture medium of the CHY-expressing strains. The control (SlD-AKC1) and the AosedD disruptants expressing CHY (SlD1-sD2-AKC1, SlD1-sD2-AKC8 and SlD1-sD2-AKC9) were cultivated in 20 ml of 5× DPY (pH 5.5) medium at 30°C for 4 days. Culture media (4 μl) were subjected to Western blot analysis. Bands of approximately 35 and 40 kDa were detected us-ing the anti-CHY antibody. (D) Time-course analysis of HLY production by the AosedD disruptant. The HLY-ex-pressing strains: the control (SlD-HLY1) and the AosedD disruptants expressing HLY (SlD1-sD2-HLY1, SlD1-sD2-HLY2 and SlD1-sD2-HLY6) were cultivated in 100 ml of 5× DPY (pH 8.0) medium at 30°C for 3 to 6 days. The production yields of HLY were calculated based on lysozyme activities.

(A)

(B) (C)

(D)


approximately 6.5) in the AosedD disruptant is not so remarkable compared to the recombinant CHY pro-duction (started from pH 5.5, after 4 days pH was ap-proximately 5.3). It is probably due to the presumed abundant existence of AoSedD in acidic culture medium, since A. fumigatus SedD was detected in the culture medium only at acidic pH (Sriranganadane et al., 2010). In A. oryzae a single gene disruption (pepA, pepE, alpA, tppA, or palB) has positive effects on the HLY production, and the tppA gene disruption leads to the highest increase (1.4-fold) among the fi ve (Jin et al., 2007). In this study, we showed a much higher in-crease (1.7-fold) by a single gene disruption of AosedD. Furthermore, the CHY production level by the AosedD disruptant is almost equal to that of the quintuple pro-tease gene disruptants (tppA, pepE, nptB, dppIV, and

dppV; Yoon et al., 2009). Taken together, the AosedD gene disruption is highly effective in improving the production of heterologous proteins in A. oryzae.　It was suggested that in A. fumigatus tripeptidyl pep-tidases can remove a number of different tripeptides from a free N-terminus of the protein (Reichard et al., 2006; Sriranganadane et al., 2010). Several studies have demonstrated that the release of tripeptides is important for the effi ciency of protein degradation (Tomkinson et al., 1999). So far, we focused on two tripeptidyl peptidases, TppA and AoSedD in A. oryzae, and our analyses show that disruption of either tppA or AosedD has strong effects on heterologous protein production. It can probably be attributed to the phe-nomenon that tripeptidyl peptidase activities of AoSedD and TppA destabilizes the heterologous protein con-formation together with other exopeptidases, and con-sequently triggers the complete proteolytic degrada-tion.　We previously reported that the multiple gene dis-ruption of protease genes signifi cantly reduces the oc-currence of degradation of heterologous proteins pro-duced by A. oryzae. The decouple (tppA, pepE, nptB, dppIV, dppV, alpA, pepA, AopepAa, AopepAd, and cpI) protease gene disruptants signifi cantly enhances the production levels of CHY and HLY (Yoon et al., 2010b). The AosedD gene disruption from the decouple pro-tease gene disruptants will be carried out for much more improved heterologous protein production in A. oryzae as an intriguing future project.

Acknowledgments

　This study was supported by a Grant-in-Aid for Scientifi c Re-search from the Ministry of Education. Culture, Sports, Science, and Technology of Japan and by the Program for the Promotion of Basic Research Activities for Innovative Biosciences of Ja-pan. We are grateful to Dr. Yujiro Higuchi (University of Exeter) for his expert technical assistance and valuable discussion.

References

Archer, D. B. and Peberdy, J. F. (1997) The molecular biology of secreted enzyme production by fungi. Crit. Rev. Biotech-

nol., 17, 273‒ 306.Fleißner, A. and Dersch, P. (2010) Expression and export: Re-

combinant protein production systems for Aspergillus. Appl. Microbiol. Biotechnol., 87, 1255‒ 1270.

Foltmann, B. (1970) Prochymosin and chymosin (prorennin and rennin). Methods Enzymol., 19, 421‒ 436.

Gordon, C. L., Khalaj, V., Ram, A. F., Archer, D. B., Brookman, J. L., Trinci, A. P., Jeenes, D. J., Doonan, J. H., Wells, B., Punt, P. J., van den Hondel, C. A., and Robson, G. D. (2000) Glucoamylase::green fl uorescent protein fusions to moni-tor protein secretion in Aspergillus niger. Microbiology, 146, 415‒ 426.

Gouka, R. J., Punt, P. J., and Van den Hondel C. A. M. J. J. (1997) Effi cient production of secreted proteins by Asper-

gillus: Progress, limitations and prospects. Appl. Microbiol.

Biotechnol., 47, 1‒ 11.Harris, S. D., Read, N. D., Roberson, R. W., Shaw, B., Seiler, S.,

Plamann, M., and Momany, M. (2005) Polarisome meets Spitzenkörper : Microscopy, genetics, and genomics con-verge. Eukaryot. Cell, 4, 225‒ 229.

Hayakawa, Y., Ishikawa, E., Shoji, J., Nakano, H., and Kitamoto, K. (2011) Septum-directed secretion in the fi lamentous fun-gus Aspergillus oryzae. Mol. Microbiol., 81, 40‒ 55.

Jin, F. J., Watanabe, T., Juvvadi, P. R., Maruyama, J., Arioka, M., and Kitamoto, K. (2007) Double disruption of the protei-nase genes, tppA and pepE, increases the production level of human lysozyme by Aspergillus oryzae. Appl. Microbiol.

Biotechnol., 76, 1059‒ 1068.Kimura, S., Maruyama, J., Watanabe, T., Ito, Y., Arioka, M., and

Kitamoto, K. (2010) In vivo imaging of endoplasmic reticu-lum and distribution of mutant α-amylase in Aspergillus

oryzae. Fungal Genet. Biol., 47, 1044‒ 1054.Kitamoto, K. (2002) Molecular biology of the Koji molds. Adv.

Appl. Microbiol., 51, 129‒ 153.Mabashi, Y., Kikuma, T., Maruyama, J., Arioka, M., and Kita-

moto, K. (2006) Development of a versatile expression plasmid construction system for Aspergillus oryzae and its application to visualization of mitochondria. Biosci. Bio-

technol. Biochem., 70, 1882‒ 1889.Machida, M., Asai, K., Sano, M., Tanaka, T., Kumagai, T., Terai,

G., Kusumoto, K., Arima, T., Akita, O., Kashiwagi, Y., Abe,


K., Gomi, K., Horiuchi, H., Kitamoto, K., Kobayashi, T., Takeuchi, M., Denning, D. W., Galagan, J. E., Nierman, W. C., Yu, J., Archer, D. B., Bennett, J. W., Bhatnagar, D., Cleve-land, T. E., Fedorova, N. D., Gotoh, O., Horikawa, H., Hoso-yama, A., Ichinomiya, M., Igarashi, R., Iwashita, K., Juvvadi, P. R., Kato, M., Kato, Y., Kin, T., Kokubun, A., Maeda, H., Maeyama, N., Maruyama, J., Nagasaki, H., Nakajima, T., Oda, K., Okada, K., Paulsen, I., Sakamoto, K., Sawano, T., Takahashi, M., Takase, K., Terabayashi, Y., Wortman, J. R., Yamada, O., Yamagata, Y., Anazawa, H., Hata, Y., Koide, Y., Komori, T., Koyama, Y., Minetoki, T., Suharnan, S., Tanaka, A., Isono, K., Kuhara, S., Ogasawara, N., and Kikuchi, H. (2005) Genome sequencing and analysis of Aspergillus

oryzae. Nature, 438, 1157‒ 1161.Maruyama, J. and Kitamoto, K. (2008) Multiple gene disruptions

by marker recycling with highly effi cient gene-targeting background (ΔligD) in Aspergillus oryzae. Biotechnol. Lett., 30, 1811‒ 1817.

Maruyama, J. and Kitamoto, K. (2011) Targeted gene disruption in koji mold Aspergillus oryzae. Strain Engineering, Meth-ods and Protocols, ed. by Williams, J. A., Humana Press, Methods Mol. Biol., 765, 447‒ 456.

Masai, K., Maruyama, J., Nakajima, H., and Kitamoto, K. (2003) In vivo visualization of the distribution of a secretory protein in Aspergillus oryzae hyphae using the RntA-EGFP fusion protein. Biosci. Biotechnol. Biochem., 67, 455‒ 459.

Minetoki, T., Nunokawa, Y., Gomi, K., Kitamoto, K., Kumagai, C., and Tamura, G. (1996) Deletion analysis of promoter ele-ments of the Aspergillus oryzae agdA gene encoding al-pha-glucosidase. Curr. Genet., 30, 432‒ 438.

Morsky, P. and Aine, E. (1983) Determination of lysozyme in tears by immunoturbidimetric and optimised kinetic bacte-riolytic methods. Clin. Chim. Acta, 129, 201‒ 209.

Nemoto, T., Watanabe, T., Mizogami, Y., Maruyama, J., and Kita-

moto, K. (2009) Isolation of Aspergillus oryzae mutants for heterologous protein production from a double proteinase gene disruptant. Appl. Microbiol. Biotechnol., 82, 1105‒ 1114.

Reichard, U., Lechenne, B., Asif, A. R., Streit, F., Grouzmann, E., Jousson, O., and Monod, M. (2006) Sedolisins, a new class of secreted proteases from Aspergillus fumigatus with en-doprotease or tripeptidylpeptidase activity at acidic pHs. Appl. Environ. Microbiol., 72, 1739‒ 1748.

Sriranganadane, D., Waridel, P., Salamin, K., Reichard, U., Grouzmann, E., Neuhaus, J. M., Quadroni, M., and Monod, M. (2010) Aspergillus protein degradation pathways with different secreted protease sets at neutral and acidic pH. J.

Proteome Res., 9, 3511‒ 3519.Tomkinson, B. (1999) Tripeptidyl peptidases: Enzymes that

count. Trends Biochem. Sci., 24, 355‒ 359.van den Hombergh, J. P., van de Vondervoort, P. J., Fraissinet-

Tachet, L., and Visser, J. (1997) Aspergillus as a host for heterologous protein production: The problem of proteas-es. Trends Biotechnol., 15, 256‒ 263.

Yoon, J., Aishan, T., Maruyama, J., and Kitamoto, K. (2010a) Enhanced production and secretion of heterologous pro-teins by the fi lamentous fungus Aspergillus oryzae via dis-ruption of vacuolar protein sorting receptor gene Aovps10. Appl. Environ. Microbiol., 76, 5718‒ 5727.

Yoon, J., Kimura, S., Maruyama, J., and Kitamoto, K. (2009) Construction of quintuple protease gene disruptant for het-erologous protein production in Aspergillus oryzae. Appl.

Microbiol. Biotechnol., 82, 691‒ 701.Yoon, J., Maruyama, J., and Kitamoto, K. (2010b) Disruption of

ten protease genes in the fi lamentous fungus Aspergillus

oryzae highly improves production of heterologous pro-teins. Appl. Microbiol. Biotechnol., 89, 747‒ 759.

Documents

J. Gen. Appl. Microbiol., 58 Full Paper Improved