Science Park Journals

Full Length Research Paper

Proximate Composition of Date Fruits and Sensory Evaluation of Date Fruit Wine

Clarified Using Aspergillus Strains Immobilized on Biomatrix

1Emecheta, R. O., 2Ahaotu, I., 3Maduka, N., 4Odu, N. N.,

Corresponding author: maduks.mn@gmail.com

1Department of Biology/Microbiology, School of Science and Industrial Technology, Abia State Polytechnic, Aba, Nigeria.

2Department of Microbiology, Faculty of Science, University of Port Harcourt, Choba, Rivers State Nigeria.

3Department of Biological Sciences, Faculty of Natural and Applied Sciences, Wellspring University, Benin City, Edo State, Nigeria

4Department of Microbiology, Faculty of Science, Rivers State University, Nkpolu-Oroworukwo Port Harcourt, Rivers State, Nigeria

ABSTARCT: Globally, there has been increase in utilization of fruits of Phoenix dactylifera for

production of various products such as date wine which has great economic benefits. However,

this product is naturally cloudy and faces reduced acceptability unless it is clarified. In this study,

date wine prepared from date must by means of Saccharomyces cerevisae fermentation was

clarified using immobilized microbial cells on papaya trunk (biomatrix). Aspergillus tamarii

TN275 and Aspergillus tamarii strain DTO:129-ES used as the immobilized cells was isolated

and characterized using standard microbiological and molecular methods. Also determined was

proximate composition and energy value of date fruit using standard methods. Nine point

Hedonic scale was used to carry out sensory evaluation of date wine, date must and white wine

(control). Our results showed that protein, carbohydrate, crude fibre, ash and moisture content

of date fruit was 20.14, 52.66, 10.50, 1.80 and 8.40 %, respectively while the energy content

was 1463.84 kj/100 g. Sensory results from this study revealed that date wine clarified using

immobilized Aspergillus strains were preferable than white wine (control) except in colour and

appearance. Therefore, clarification of date wine has the potential of increasing customer

acceptability which could lead to economic gains comparable with that of white wine.

Keywords: Sensory, Immobilized, Clarified, Aspergillus strains, Proximate composition, Date

fruit wine

Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution http://creativecommons.org/licenses/by/4.0/

Vol. 4(2), pp. 067-079, August 2019 ISSN 2315-6260 DOI: 10.14412/ SPJAMR2019.79 Copyright© 2019 Author(s) retain the copyright of this article Available online at http://www.scienceparkjournals.org/ SPJAMR

Science Park Journal of Applied

Microbiology Research

2. S. P. J. App Micro Res

INTRODUCTION

Date palm (Phoenix dactylifera) is a fruit tree reasonably distributed across Israel, African and

Arabic countries. In Middle East Arab region, it is regarded as one of the oldest fruit trees [1, 2].

Egypt, Saudi Arabia, UAE, Iran and Algeria are major producers of date palm. Being a tropical

and subtropical tree, Date palm also grows in Nigeria especially in the northern states [3]. With

minimal or no processing, date fruits could be directly consumed at Rutab (semi-ripe) and

Tamur (fully-ripe) stages. Globally, there has been significant increase in production, utilization

and industrialization of date fruit [4]. It is estimated that from 1994 - 2010, world output of date

fruits increased from 4.6 -7.68 million tons [3].

Popularity of date palm is because it produces sweet berries that have high sugary taste

suitable for confectionery. Also, date fruit has pleasant odour, flavor and biting texture [5]. On

dry weight basis, its sugar content range from 65 - 80 % [4]. Digestible sugars up to 70 %

mostly glucose, fructose and sucrose are abundant in date pulp [6]. According to Shaba et al.

[3], date palm contains crude protein (1.21 %), crude fat (1.73 %), crude fibre (2.26 %), ash

(1.88 %), moisture content (1.16 %), carbohydrate (91.76 %), and calorific values (1621.50

Kg/100 g) [2]. Date fruit has wide range of uses. It can be used to produce date syrup, date-

vinegar and date-jam whereas the by-products are used for production of concentrated

beverages, candies, confectionaries etc. [4].

Sweet and sugary taste as well as production of surplus and over-ripen date fruit makes it

attractive for wine production. Wine is generally defined as fermented beverage produced from

grape. So far, varieties of fruits have been used for wine production and the product name

becomes prefixed with the fruit used. Winemaking of today involves biotechnological processes

which has great commercial value. It is one of the oldest technologies practiced by man.

Moderate consumption of wine reduces cardiovascular morbidity and mortality. This health

benefit is attributed to antioxidant known as polyphenolics predominantly in red grape wine [7].

Fruit juices or wines are naturally cloudy due to the presences of polysaccharides (pectins). In wine tasting, a wine is considered “clear” when there are no visible particles suspended in the liquid [8]. Other factors such as guaranteed origin, ecological production, taste, colour, aroma, quality and sensory perceptions influence consumer preferences for a particular wine [7]. The process of removing insoluble matter in wine before bottling is known as wine clarification. Various clarifying agents used for this process include gelatin, casein, albumin, kaolin etc [8, 9]. Depectinisation of fruit juice through the use of pectinases is a proven method to reduce wine turbidity [10, 11]. Pectinase production by different organisms in submerged state fermentation has low production cost. Bacillus spp, Clostridiuim spp, Pseudomonas spp, Aspergillus spp, Fusaruim spp, Penicillium spp, etc. are capable of producing pectinolytic enzymes [11, 12, 13]. Immobilization of cells describes the process of physically fixing microbial cells in a defined region in order to catalyze a specific reaction without suffering loss of catalytic activity. Immobilized microbial cell responsible for biocatalyst reactions is advantageous than immobilized purified enzyme system [14]. Therefore, this study is aimed at determining the proximate composition of date fruit and compares the effect of using different clarifying agents including Aspergillus strains immobilized on a biomatrix on its sensory characteristics.

Maduka et al 3.

MATERIALS AND METHODS

Dried date fruits used in this study were purchased from Ariaria International Market, Aba, Abia State. The samples were put inside sterile plastic bags and aseptically transferred to Food Microbiology Laboratory, Abia State Polytechnic, Aba for analysis. Yam peel was obtained from a roadside roasted yam seller and fresh palm wine was purchased from a palm wine tapper in Ekeakpara village, Osisioma L.G.A in Abia State, Nigeria. Proximate composition of date fruit

Crude protein content, moisture content, crude fibre, fat, crude fibre and ash content of date fruit

was determined using AOAC methods [15]. The carbohydrate content was calculated by

difference.

Energy content determination

The energy content of date fruit was determined using the equation below:

Energy (Kj/100 mg) = 4.18.6 (% protein x 4) + (% fat x 4) + (% carbohydrate x 4)

Molecular characterization of fungal isolates used for wine clarification

The following stages were involved in molecular characterization of the fungal isolates used for wine clarification. DNA extraction DNA extraction was done using ZR fungal/bacterial DNA mini prep extraction kit supplied by Inqaba South Africa. Approximately 50-100 mg of pure culture of fungal cells was suspended in 200 µL of isotonic buffer into a ZR Bashing Bead Lysis tubes and 750 µL of lysis solution was added to the tube. The tubes were secured in a bead beater fitted with a 2 ml tube holder assembly and processed at maximum speed for 5 min. The ZR bashing bead lysis tubes were centrifuged at 10, 000xg for 1 minute. Four hundred microlitre (400 µL) of supernatant was transferred to Zymo-spin IV spin filter (orange top) in a collection tube and centrifuged at 700xg for 1 min. One thousand two hundred microlitres (1200 µL) of fungal/bacterial DNA binding buffer was added to the filtrate in the collection tubes making the final volume to 1600 µL. Eight hundred (800 µL) was then transferred to a Zymo-spin IIC column in a collection tube and centrifuged at 10, 000xg for 1 min. The flow through was discarded from the collection tube. The remaining volume was transferred to the same Zymo-spin IIC in a new collection tube and spun at 10, 000xg for 1 min followed by the addition of 500 µL of fungal/bacterial DNA Wash Buffer and centrifuged at 10, 000xg for 1 min. The Zymo-spin IIC column was transferred to a clean 1.5 µL centrifuge tube. One hundred microlitre (100 µL) of DNA elution buffer was added to the column matrix and centrifuged at 10, 000xg for 30 sec to elute the DNA. The ultra pure DNA was then stored at -20 degree for other downstream reaction.

4. S. P. J. App Micro Res

DNA quantification

The extracted genomic DNA was quantified using the Nanodrop 1000 spectrophotometer.

Internal Transcribed Space (ITS) Amplification

The ITS region of the rRNA genes of the isolates were amplified using the ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers on a ABI 9700 Applied Biosystems thermal cycler at a final volume of 50 µL for 35 cycles. The PCR mix include: the X2 Dream taq Maxter mix supplied by Inqaba, South Africa (taq polymerase, DNTPs, MgCl2), the primers at a concentration of 0.4 M and the extracted DNA as template. The PCR conditions were as follows: Initial denaturation, 95 oC for 5 min., denaturation, 95 oC for 30 secs; annealing, 53 oC for 30 sec.; extension, 72 oC for 30 sec. and final extension, 72 oC for 5 min. The product was resolved on a 1.5 % agarose gel at 120V for 15 minute and visualized on a UV transilluminator. Sequencing

This was done using the BigDye Terminator kit on a 3510 AB, sequencer by Inqaba Biotechnological, Pretoria South Africa. Phylogenetic analysis

The sequences obtained were edited using bioinformatics algorithm trace edit after which similar sequences were downloaded from the National Center for Biotechnology Information (NCBI) data base using BLASTIN. These sequences were aligned using ClustaIX. The evolutionary history was inferred using the Neighbor-Joining method in MEGA 6.0 [16]. The bootstrap consensus tree inferred from 500 replicates as described by Felsenstein [17] was taken to represent the evolutionary history of the taxa analyzed. The evolutionary distances were computed using the Jukes-Canter method [18]. Isolation of yeast from palm wine

Using the method described by Nwachukwu et al. [19] with slight modification, yeast (Saccharomyces cerevisiae) was isolated from fresh palm wine. The fresh palm wine was allowed to sediment and ferment naturally for 24 h at room temperature (28±2 oC). Ten fold serial dilution up to 10-6 was done using 1 ml fermented palm wine and 0.1 ml from 104 dilution was inoculated onto freshly prepared malt extract agar in duplicate. The culture plates were incubated at 28±2 oC for 72 h followed by morphology identification of fungal isolates on the plates. To obtain pure culture, the fungal isolates were subcultured. Biochemical identification using lactophenol cotton blue stain was carried out on each fungal isolate. Isolation of Aspergillus species from yam peel

The method described by Kwatia et al. [20] with slight modification was adopted in isolation of Aspergillus sp. Yam peel was manually ground. One gram (1 g) of ground peel was homogenized in 9 ml distilled water. Ten fold serial dilution was done using 1 ml of the homogenized sample. Using spread plate technique, 0.1 ml solution from10-3and 10-5 dilution was inoculated onto solidified potato dextrose agar (PDA) and Sabouraud dextrose agar (SDA)

Maduka et al 5.

in duplicates. At room temperature (28±2 oC), the culture plates were incubated for 5 – 7 days. Morphology of fungal isolates on the culture plates was noted. To obtain pure culture, fungal isolates were subculture on freshly prepared SDA and PDA plates and incubated as appropriate. The fungal isolates were subjected to cotton blue lactophenol staining technique for easy identification. The morphology of the fungal isolates was compared with a chart described by Cheesbrough [21]. For further study, pure fungal isolates were subcultured in PDA slants. Inoculum development

Slightly modified method described by Okeke et al. [22] was adopted for inoculum development.

Two hundred gram (200 g) of date fruit was sorted, washed using potable water and then

soaked inside 500 ml potable water for 45 min. Date must was filtered using muslin cloth after

the soaked sample was macerated and destoned using sterilized palms. Two hundred milliliter

(200 ml) of the juice obtained was sterilized by autoclaving (121 oC for 15 min.; 15 psi) and

allowed to cool. The sterilized juice was inoculated with three loopful of yeast culture isolated

from palm wine and then incubated for 48 h at room temperature (28±2 oC).

Preparation and fermentation of must for date palm wine production

Three kilograms (3 Kg) of date fruit was sorted and washed using potable water and then soaked using 7.5 litres of potable water for 45 min. Date must obtained after the soaked sample was macerated and destoned was filtered using muslin cloth. Two hundred milliliter (200 ml) of the juice was sterilized by autoclaving (121 oC for 15 min.; 15 psi) and allowed to cool. The sterilized date must was inoculated with inoculum and the setup was allowed to ferment for 28 Days at room temperature (28±2 oC) which becomes date wine. Clarification of date wine using commercial pectinase Commercial pectinase maintained at 45 - 55 oC and optimum pH of 4 – 5 was purchased from Federal Institute of Industrial Research Oshodi (FIIRO) Lagos Nigeria. The freshly prepared date wine was pasteurized (45 - 55 oC for 2 h) in order to deactivate all enzymes that could be present in the wine. For date wine clarification, 5 ml of commercial pectinase was pipette into 500 ml of date wine maintained at 50 oC inside water bath and allowed to stand for 10 h. The clarified date wine was filtered, bottled and allowed to age. Clarification of date palm wine using two immobilized strains of Aspergillus tamarii on biomatrix

Clarification of date palm wine by separately using immobilized Aspergillus tamarii TN-275 and A. tamarii strain DTO:129-ES involved the processes below:

Preparation of immobilizing material Trunk of structural fibrous network (SFN) of papaya was debarked, cut into small pieces (2 cm by 4 cm) and thoroughly washed. The pieces of papaya trunk were soaked for 2-3 h inside distilled water changed 3-4 times. Thereafter, soaked pieces of papaya were removed from the solution and dried inside oven set at 80 oC until constant weight was achieved and then allowed to cool inside a dessicator.

6. S. P. J. App Micro Res Inoculum development

Fifty gram (50 g) date fruit was sorted, washed using potable water and then soaked inside 50 ml potable water for 45 min. Date must was filtered using muslin cloth after the soaked sample was macerated and destoned using sterilized palms. It was poured into two separate conical flasks and autoclaved at 121 oC at 15 psi for 15 min. and then allowed to cool. Aspergillus tamarii isolate TN-275 and Aspergillus tamarii STRAIN DTO:129-ES identified using molecular methods were separately inoculated into the conical flasks and incubated at room temperature (28±2 oC) for 48 h. To standardize the inoculum inside the conical flasks, 0.5 McFarland Standard prepared using the procedure described by Chapin and Lauderdale [23] and ASM Manual [24] was involved.

Immobilization of Aspergillus tamarii TN-275 and A. tamarii strain DTO:129-ES on

biomatrix

Four pieces of structural fibrous network (SPN) of papaya wood were weighed and then put inside 200 ml date palm wine must inside two Erlenmeyer flasks (500 ml). The content of the flasks was sterilized at 121 oC at 15 psi for 15 min and allowed to cool before they were separately inoculated with Aspergillus tamarii isolate TN – 275 (RF10) and Aspergillus tamarii strain DTO: 129 – ES (RF11) inoculums followed by incubation that lasted for 48 h at room temperature (28±2 oC). The control was the flask containing 200 ml date must without biomatrix (SFN) added. Structural fibrous network (SFN) that had entrapped fungal hyphae was aseptically removed from the flasks and thoroughly washed using date palm must in order to remove free hyphae. The presence of hyphae in the date palm must was verified using compound microscope. Clarification of date palm wine using immobilized Aspergillus tamarii TN-275 and A. tamarii strain DTO:129-ES on a biomatrix One hundred millilitre (100 ml) of freshly prepared date wine was poured into two Erlenmeyer flasks (500 ml). Structural fibrous network (SFN) separately entrapped with hyphae of Aspergillus tamarii isolate TN-275 and Aspergillus tamarii strain DTO:129-ES were transferred separately into 100 ml fresh date wine must and incubated at room temperature (28±2 oC) for 7 Days. Both free and SFN – immobilized biomass of the two strains of Aspergillus were harvested from the medium contained in the flasks, washed twice with distilled water and oven dried at 70 oC to constant weight. The SFN immobilized biomass was separated from date palm wine by decantation and clarification. Similarly, free-grown fungal biomass was separated from date palm wine by filtration using pre-weighed filter paper (Whatman № 1). Sensory evaluation

Nine-point Hedonic rating using twenty man panelist familiar with alcoholic beverages was adopted following the procedure described by Okafor et al. [25]. Each of the sensory panelist independently evaluated date wine, date must and white wine (control) based on taste, colour, aroma, mouthfeel, appearance and overall acceptability and assigned a score which range from 1 - 9 representing dislike extremely and like extremely, respectively.

Maduka et al 7.

Statistical analysis One-way ANOVA was used to analyze duplicate results obtained from each analysis with the aid of Statistical Package for the Social Sciences (SPSS) software version 21. The mean (M) and Standard Deviation of the duplicate results were calculated at 95 % confidence interval. As for sensory evaluation results, mean and Standard deviation for each sensory parameter was calculated using sensory scores of twenty member sensory panelist. RESULTS The proximate composition and energy value of date fruit is depicted in Table 1. Figure 1 shows

the result of the polymerase chain reaction (PCR) agarose gel electrophoresis. All the isolate

showed 500bp indicate that they are fungal isolates. Shown in Figure 2 is the phylogenetic tree

showing the evolutionary relatedness of the fungal isolates intended for use as immobilized

microbial cells for date wine clarification. The internal transcribed space (ITS) sequence RF10

and RF11 produced an exact match during the megablast search for highly similar sequences

from the NCBI non-reductant nucleotide (nr/nt) database. The ITS of the isolates showed

percentage similarity to other species at 99 %. The evolutionary distances computed using

Jukes-Canter method were in agreement with phylogenetic placement of ITS of the Aspergillus

sp. which revealed that it was closely related to Aspergillus tamarii (gb: KP329611.1) than other

Aspergillus sp. The RF9 and RF12 obtained produced an exact match during the megablast

search for highly similar sequences from the NCBI non-redundant nucleotide (nr/nt) database.

The ITS of the isolates showed a percentage similarity to other species at 99 %. The

evolutionary distances computed using the Jukes-Canter method were in agreement with the

phyhlogenetic placement of the ITS of the isolate Dekkera sp. which revealed that it was closely

related to Dekkera bruxellensis (gb: JX094777.1). This isolate was not used for wine clarification

because it is implicate in wine spoilage. Sensory evaluation of date must, date wine and white

wine is shown in Table 2.

Table 1: Proximate composition and Energy value of date fruit

Parameters Values Moisture content (%) 8.40 Ash content (%) 1.80 Protein content (%) 20.14 Fat content (%) 6.50 Carbohydrate content (%) 52.66 Crude fibre (%) 10.50 Energy (kj/100 g) 1463.84 All the values inside the table are means of three determinations

8. S. P. J. App Micro Res

Table 2. Mean response rating of parameters associated with date must, date palm wine clarified using

Aspergillus tamari strains immobilized on biomatrix and white wine

Sensory properties

Date wine clarified with

Aspergillus tamari strains

immobilized on biomatrix

Date must

White wine (control)

Taste 7.2±1.30ab

8.2±0.84b

6.4±0.89a

Aroma 7.4±0.55a

7.2±0.84a

7.4±0.89a

Mouth feel 6.4±1.14a

8.3±0.84b

5.6±0.89a

Appearance 6.8±0.84a

6.8±0.84a

7.4±0.55a

Colour 6.8±0.45a

7.4±0.55a

7.4±0.55a

Overall acceptability 7.4±1.14a

7.8±0.84a

6.8±0.84a

Mean scores with same superscripts across the row are not significant at p<0.05, while others with different

superscripts are significant.

Maduka et al 9.

DISCUSSION

This study revealed that date fruit is a rich source of carbohydrate and also contain reasonable quantity of fat and protein that supplies humans with energy when consumed. This result could explain the feeling of satiety people usually experience after eating date fruit [26]. Its relatively high fibre content in addition to carbohydrate, fat and protein content makes it suitable for those that are obese and overweight who desire healthier balanced foods. Its low moisture content makes it have a longer shelf life. To crown it all, date fruit does not require processing or cooking before its nutritional benefits can be enjoyed because it is popularly eaten raw [27]. Carbohydrate content and calorific value are indicators of energy value that could be derived from foods. Shaba et al. [3] reported that calorific value of date fruit was 1621.50 kj/100 g. A study carried out by Alghamdi et al. [27] reported that carbohydrate content of date fruit range from 66.39 - 78.69 %. Meanwhile, our study revealed that calorific value (1463.84 kj/100 g) and carbohydrate content (52.66 %) was present in date fruit. The differences in calorific value and carbohydrate content could be as a result of varieties of date fruit used for the analysis. The fat content of date fruit obtained from this study corroborates the results reported by Hamza et al. [6] which range between 3.70 - 6.3 %. The importance of fat content in food is to supply calories and help in proper functioning of the body. Those essential fatty acids which the body cannot manufacture can only be obtained from fat content in food. Fat also help in the production of hormones required to initiate and regulate body activities. Structure of the brain requires fat which is obtained from foods [26]. On average, protein content of date pulp from this study is 20.14 %. It is interesting to note that this result is equivalent to protein content of Parkia biblobosa (20.9 %) which is a known protein rich food. Although protein content of date fruit revealed in this study is not in agreement with 32.5 – 42.5 % protein content reported by Jamil et al. [26] from a similar study, our result for protein content of date fruit compares favourably with other known protein rich foods such as green pea (24.9 %), cowpea seeds (24.7 %), lentil (26.1 %) and Mucuna flagellipes (24.9 %) [26]. Our result for ash content of date fruit (1.80 %) is in agreement with Shaba et al. [3] that reported 1.88 % ash content of date fruit. Generally, ash content in foods is an indication of level of minerals present in the material. The result for ash content of date palm fruit is an indication that inorganic mineral is low [26]. Crude fibre in diets plays useful role in reducing high blood pressure, constipation and also lowers the risk of developing cardiovascular disease, hypertension, diabetes, colon and breast cancer [26, 28]. From our result, crude fibre content of date fruit was 10.50 %. This result corroborates the findings reported by Agboola and Adejumo [5] from a similar study which showed that date fruit contained 12.55 % crude fibre. According to Nwaokobia et al. [29], date palm is a good source of dietary fibre. Moisture content of some varieties of date fruits reported by Jamil et al. [26] to be within the range 0.84 - 9.8 % is in agreement with the result obtained from this study. Result obtained from this study shows that moisture content of date fruits was 8.40 %. Variations in results for moisture content of date fruits could be attributed to location, longitivity, environments and maturity of date fruits used for analysis [3]. Generally, food products with extremely low moisture content does not favour growth of spoilage microorganism and therefore have long shelf life. Aspergillus tamarii TN275 and A. tamarii strain DTO:129-ES isolated from yam peel and immobilized on papaya trunk was used separately for clarification of date wine fermented by Saccharomyces cerevisiae. During fermentation of date must, molecular characterization of fungal isolates present in the product revealed the presence of Dekkera bruxellensis. This yeast is implicated in wine spoilage as a result of acetic acid and volatile phenols it releases into the wine. Sulfation, adequate cellar hygiene, aging at low temperature and using low electric current

10. S. P. J. App Micro Res treatment are some approaches that could be adopted during winemaking to prevent wine spoilage as a result of metabolic products released by Dekkera bruxellensis [30]. Our sensory result showed that there was no significant difference in aroma, appearance, clour and overall acceptability of white wine, date must and date wine clarified using Aspergillus tamarii TN275 and A. tamarii strain DTO:129-ES immobilized on a biomatrix. This was a strong indication that Dekkera bruxellensis present in date must did not significantly affect sensory characteristics of date wine probably because of low microbial population. A striking observation from our sensory report was that taste of date wine clarified using Aspergillus tamarii TN275 and Aspergillus tamarii strain DTO:129-ES immobilized on a biomatrix had a close relationship with that of white wine (control) and date wine clarified using commercial pectinase though they were significantly different. That notwithstanding, the taste of date must was assigned the highest score by the sensory panelist. This could be as a result of sugary taste of date must prior to fermentation by Saccharomyces cerevisiae which we reported to be 22 % in a related study. Average sensory score assigned to date must based on mouthfeel was the highest and significantly different from that of date wine clarified using Aspergillus tamarii TN275 and A. tamarii strain DTO:129-ES immobilized on a biomatrix and also white wine (control). Highest sensory score for mouthfeel of date must could be as a result of soluble particles in date must that have sugary taste. Our sensory panelist reported that taste of date palm subjected to wine clarification using Aspergillus tamarii TN275 and A. tamarii strain DTO:129-ES immobilized on a biomatrix was less preferable than that of date must. This result could be attributed to combined effect of wine clarification and fermentation which resulted in sugar content reduction of the product. Interestingly, our sensory panelist showed least preference in taste, mouthfeel and overall acceptability of white wine compared with that of date must and date wine. This could be as a result of the substrate used for production of white wine. Therefore, utilizing date fruits for wine production and the resulting product clarified using Aspergillus tamarii TN275 and A. tamarii strain DTO:129-ES immobilized on papaya trunk has great prospects of reducing patronage of imported white wines into Nigeria. According to Bhusari et al. [31], date wine fermented using Saccharomyces cerevisae had good sensory acceptability. CONCLUSION

Proximate composition of date fruit revealed that it is rich in carbohydrate and contains

reasonable quantity of protein, fat and crude fibre. This goes a long way in justifying its direct

consumption as a popular snack. Taste, mouthfeel and overall acceptability of date must was

preferable than clarified date wine and white wine (control). However, date wine clarified using

Aspergillus tamarii TN275 and A. tamarii strain DTO:129-ES immobilized on papaya trunk

(biomatrix) was comparable with white wine (control).

REFERENCES

1. Shah JJ. Date palm cultivation in India: An overview of activities. Emirate Journal of Food and

Agriculture. 2014; 26 (11): 987-999.

2. Hamed KA, Darwesh Rasmia SS, Zayed EMM. Evaluation physical and chemical characteristic of

some seedlings date palm fruits (Maghal) in the North Delta Egypt. International Journal of

Advances in Agricultural Science and Technology. 2017; 4 (7): 13-32.

Maduka et al 11.

3. Shaba EY, Ndamitso MM, Mathew JT, Etsunyakpa MB, Tsado AN, Muhammad SS. Nutritional

and anti-nutritional composition of date palm (Phoenix dactylifera L.) fruits sold in major markets

of Minna Niger State, Nigeria. African Journal of Pure and Applied Chemistry. 2015; 9(8): 167-

174.

4. Sani MN, Abdulkadir F, Salim FB, Abubakar MM, Kutama AS. Date palm (Phoenix dactylifera) as

food supplement and antimicrobial agent in the 21st century-A review. IOSR Journal of Pharmacy

and Biological Sciences. 2016; 11 (4) 3: 46-51.

5. Agboola OS, Adejumo AL. Nutritional composition of the fruit of the Nigerian wild date palm,

Phoneix dactylifera. World Journal of Dairy and Food Sciences. 2013; 8 (2): 196-200.

6. Hamza AM, Collins A, Ado SG, Ikuenobe CE, Ataga CD, Odewale JO. Proximate compositions

evaluation and variability among cultivars of date palm (Phoenix dactylifera L.) in Nigeria.

International Journal of Plant and Soil Science. 2014; 3 (3): 248-259.

7. Jagtap UB, Bapat VA. Wines from fruits other than grapes: Current status and future prospects.

Food Bioscience. 2015; 9: 80-96.

8. Robinson J. The Oxford Companion of Wine (Third edition). Oxford University Press. 2006; p.

661-62.

9. Awe S. Effect of clarifying agents (gelatin and kaolin) on fruit wine production. International

Journal of Agriculture Innovation and Research. 2018; 6 (4): 130-132.

10. Kashyap DR, Vohra PK, Chopra S, Tewari R. Application of pectinases in the commercial sector:

A Review. Bioresources Technology. 2001; 77: 215-227.

11. Landbo AK, Kaack K,. Meyer AS. Statistically designed two step response surface optimization of enzymatic prepress treatment to increase Juice yield and lower turbidity of elderberry Juice. Innovative Food Science and Engineering Technology. 2007; 8: 135-142.

12. Beg QK, Bhshan B, Kapoor M, Handal GS. Production and characterization of thermostable

xylanase and pectinase from Streptomyces sp. QG – 11-3. Journal of Industrial Microbiology and

Biotechnology. 2000; 24, 396-402.

13. Hoondal GS, Tiwari RP, Tiwari R, Dahiya N, Beg QK. Microbial alkaline pectinase and their

industrial applications. A Review. Applied Microbiology and Biotechnology. 2002; 59:409-418.

14. Rouf A, Kanojia V, Naik, HR. Cell immobilization: An overview on techniques and its applications

in food industry. International Journal of Chemical Studies. 2017; 5 (6): 1817-1824.

15. Association of Official Analytical Chemists (2014). Official Methods of Analysis. International

Association of Analytical Chemists, Gaithersburg, Maryland.

16. Saitou N, Nei M. The neighbor-joining method: A new method for reconstructing phylogenetic

trees. Molecular Biology and Evolution. 1987; 39: 783-791.

17. Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution,

1985; 39:783-791.

12. S. P. J. App Micro Res

18. Jukes TH, Cantor CR. Evolution of protein molecules (ed. Munro HN). Mammalian Protein

Metabolism. Academic Network Press, New York. pp. 21-132. 1969.

19. Nwachukwu I. Ejike EN. Industrial Microbiology: An Introductory Approach. Chimera Publishers,

Aba, Abia State, Nigeria. pp. 101-102.

20. Kwatia S, Dzogbefia VP, Ofosu IW. Optimisation of amylase production by Aspergillus niger

cultivated on yam peels in solid state fermentation using response surface methodology. African

Journal of Biochemistry Research. 2017; 11 (7): 34-42.

21. Cheesbrough M. District Laboratory Practice in Tropical Countries, Part 2. Cambridge University

Press. pp. 143-180; 2000.

22. Okeke BC, Agu KC, Uba PO, Awah NS, Anaukwu CG, Archibong EJ, Uwanta LL, Ezenache JN,

Ezenwa CU, Orji MU. Wine production from mixed fruits (pineapple and watermelon) using high

alcohol tolerant yeast isolated from palm wine. University Journal of Microbiology Research.

2015; 3: 41-45.

23. Chapin KC, Lauderdale T. Reagents, stains, and media: bacteriology, p.358. In Murray PR, Baron

EJ, Jorgensen JH. Pfaller MA, Yolken RH. (ed.), Manual of Clinical Microbiology, 8th ed. ASM

Press, Washington D.C.

24. ASM Manual of Clinical Microbiology (2007).

25. Okafor DC, Ihediohanma NC, Abolude DS, Onuegbu NC, Osuji CM, Ofoedu CE. Physico-

chemical and sensory acceptability of soursop (Annonamuricata) wine. International Journal of

Life Sciences. 2014; 3 (4): 163-169.

26. Jamil MS, Nadeem R, Hanif MA, Ali MA, Akhtar K. Proximate composition and mineral profile of

eight different unstudied date (Phoenix dactylifera L.) varieties from Pakistan. African Journal of

Biotechnology. 2010; 9 (22): 3252-3259.

27. Alghamdi AA, Awadelkarem AM, Hossain ABMS, Ibrahim NA, Fawzi M, Ashraf SA. Nutritional

assessment of different date fruits (Phoenix dactylifera L.) varieties cultivated in Hail province,

Saudi Arabia. Bioscience Biotechnology Research Communications. 2018; 11 (2): 263-269.

28. Effiong BN, Udofia US, Maduka N. Studies on nutritional composition and efficacy of selected

spices in southern Nigeria against some food spoilage fungi. Journal of Advances in

Microbiology. 2018; 12(2):1-12.

29. Nwaokobia K, Ogboru RO, Idibie CA. Investigating the proximate, ultimate and chemical

composition of four cultivars of date seed, Phoenix daactylifera L.World News of Natural

Sciences. 2018; 18 (2): 52-61.

30. Lustrato G, Vigentini I, De Leonardis A, Alfano G, Tirelli A, Foschino R, Ranalli G. Inactivation of

wine spoilage yeasts Dekkera bruxellensis using low electric current treatment (LEC). Journal of

Applied Microbiology. 2010; 109:594-604.

Maduka et al 13.

31. Bhusari SI, Desai VD, Nalavade ML, Wadkar SS, Ghosh JS. Fermentation and characterization

of wine from fruits of Phoenix dactylifera using Saccharomyces cerevisae NCIM 3495.

International Food Research Journal. 2013; 20(6): 3411-3415.

Cite this article as:

Maduka et al (2019). Proximate Composition of Date Fruits and Sensory Evaluation of Date

Fruit Wine Clarified Using Aspergillus Strains Immobilized on Biomatrix

SPJAMR 4(2)067-079

https://scholar.google.com/ Submit your manuscript at: http://www.scienceparkjournals.org/spjamr/submit