←確認用doi （左上Y座標：－17.647 pt）

1172 Vol. 43, No. 8Biol. Pharm. Bull. 43, 1172–1178 (2020)

© 2020 The Pharmaceutical Society of Japan

Regular Article

Isosteviol Sodium Attenuates High Fat/High Cholesterol-Induced Kidney Dysfunction by Inhibiting Inflammation, Oxidative Stress and ApoptosisYing Mei, Yihe Kuai, Hui Hu, Fei Liu, Bo Liu, Xiaoou Sun,* and Wen Tan*Institute of Biomedical and Pharmaceutical Sciences, Guangdong University of Technology; Guangzhou 510006, China.Received November 20, 2019; accepted May 11, 2020

The sodium salt of isosteviol (STVNa) is a beyerane diterpene synthesized through acid hydrolysis of stevioside. STVNa improves multiple types of tissue injuries. However, it is not known how isosteviol sodium affects high-fat and high cholesterol diet (HFD)-induced kidney. Therefore, in this study we examined the po-tential molecular mechanism underlying STVNa mediated protective effect against high fat/high cholesterol-induced kidney dysfunction in HFD-induced kidney injury. Sprague-Dawley (SD) rats were allocated into six groups: the normal group, HFD group and HFD treated with three doses of STVNa, fenofibrate treatment group. The results indicated that HFD induced kidney injury evident by a 60% increase in serum creatinine (CRE) leves. In addition, there was a significant accumulation of triglycerides (approx. 60%), fatty acids (approx. 50%) and total cholesterol (approx. 2.5 fold) in the kidneys. STVNa inhibited HFD-induced kidney injury evident by reducing the increased levels of serum CRE. Specifically, STVNa attenuated HFD-induced kidney injury by inhibiting inflammation, oxidative stress, and apoptosis. These findings indicate that STVNa has a therapeutic potential for HFD-induced kidney dysfunction. The mechanisms of this pharmaco-logical effect are through the inhibition of inflammation, oxidative stress and apoptosis.

Key words  isosteviol sodium; high-fat diet; inflammatory; antioxidative; anti-apoptotic

INTRODUCTION

Obesity is an independent risk factor for kidney disease concern now.1,2) The obesity may be linked to risks of hyper-tension, type 2 diabetes and cardiovascular diseases.3) Obesity has  been  associated  with  lipid  accumulation,  inflammation and  oxidative  stress  in  kidney  tissues.4) Western countries’ dietary patterns are characterized by high-fat foods which are trigger for the development of metabolic disease, such as obesity, hyperlipemia, chronic kidney disease (CKD) and so on.5) High-fat diets lead to a positive fat balance and lipid ac-cumulation which can be harmful to normal body functions.6) However,  to  the  best  of  our  knowledge,  there  are  no  effective therapeutic strategies currently.

Isosteviol is a widely known sweetener which was isolated from the herb Stevia rebaudiana. STVNa is the sodium salt of isosteviol which has been reported to inhibit the production of reactive oxygen species (ROS) as well as mitochondrial mem-brane potential (MMP) in post-ischemic reperfusion injury.7) Our previous studies also demonstrated that STVNa suppress-es nuclear factor-kappaB (NF-κB)-mediated  inflammation and apoptosis in other disease models.8) However, the therapeutic effect of STVNa on kidney injure has not been reported.Inflammation,  oxidative  stress  and  apoptosis  are  important 

pathogenic processes in kidney dysfunction. Here, we aimed to  examine  the  protective  influence  of  STVNa  against  high fat high cholesterol diet (HFD)-induced kidney injury as well as its underlying molecular mechanisms. Further, the study investigated whether STVNa could alleviate renal damage in rats  induced  by  HFD  through  the  suppression  of  inflamma-tion, oxidative stress and apoptosis.

MATERIALS AND METHODS

Animals   Five  to  six-weeks of  age  rats weighing old adult male Sprague-Dawley (SD) rats, (weighing 80–100 g) were purchased from the Animal Research Centre of Guangzhou University of Chinese Medicine (Guangzhou, China). The rats were reared in separate cages (3–4 rats per cage) under 12/12-h light/darkness cycles and kept a stable temperature en-vironment (22 ± 2°C). At the same time, food and water were provided normally. Subsequently, the animals were randomly divided  into  six  groups:  normal  group  (Normal;  n = 12), a high-fat/high-cholesterol group (HFD; n = 12), a HF diet sup-plemented with STVNa at 1/10/20 mg/kg/d/(HF-NR, n = 12), and  a  fenofibrate  treatment  group  (positive  control;  n = 12). Animal  experiments  were  approved  by  the  Institutional  Ani-mal Care and Use Committee of Sun Yat-sen University.

STVNa Administration The Chemical Development Laboratories of Key Biological Pharmaceutical Company (Dongguan, China) supplied STVNa for this work. The high-fat and high-cholesterol diet were purchased from the Mao Si Bei Ke biotechnology company (Beijing. China). For the dose–response experiment, the rats were assigned to 6 groups: Normal (n = 12), HFD (n = 12), and STVNa (1, 10, 20 mg/kg, n = 12 per group) dissolved in the same volume of vehicle. Fenofibrate  (Sigma,  St.  Louis, MO,  U.S.A.),  100 mg/kg/d  dis-solved  in  1%  sodium  carboxymethyl  cellulose, was  used  as  a positive drug to ensure the sensitivity of this model.

Study Design   The  specific  process  of  establishing  the model and administration schedule is presented in Fig. 1.

Hemoxylin and Eosin Staining and Periodic Acid-Schiff Staining The kidney tissues were isolated from euthanized rats  and  fixed  in  4%  formaldehyde  for  24 h.  The  tissues were cut into 5 µm thick sections after embedding in paraffin. Next, they  were  stained  with  hematoxylin  and  eosin  (H&E)  for 

* To whom correspondence should be addressed.  e-mail: xiaoousun@gdut.edu.cn; went@gdut.edu.cn

Vol. 43, No. 8 (2020) 1173Biol. Pharm. Bull.

evaluation  of  general  morphology  and  periodic  acid-Schiff staining deposition of glycogen. The morphology of the tis-sue blocks was visualized under the Ziess microscope (Zeiss, Oberkochen, Germany).9)

Total  sera  cholesterol  (TC),  non-esterified  fatty  acids (NEFA) and total triglycerides (TG) were measured using the  corresponding  assay  kits.  Approximately  50 mg  of  the kidney tissues were harvested from each rat, placed in 1.5 mL micro centrifuge tubes and homogenized in 500 µL of PBS. The homogenates were incubated at room temperature (r.t.) for 5 min. Thereafter, they were separated by centrifugation at  12000 rpm  for  5 min  at  4°C.  Approximately  300 µL of the supernatant was transferred into micro centrifuge tubes and quantification of TG, TC, and NEFA levels performed.

Assessment of Kidney Function By measuring serum levels of creatinine (CRE), and uric acid (UA) to evaluate the kidney function. Briefly, blood was collected using a 20-gauge needle and centrifuged at 3000 rpm for ten minutes at 4°C. Serum levels of CRE and UA were measured using commer-cial kits (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China).

Measurements of Malondialdehyde (MDA)/Glutathione (GSH) and Superoxide Dismutase (SOD) Activities in Kidney To determine kidney levels of GSH, SOD, and MDA, the supernatant of the homogenized kidney tissues for analysis was collected by centrifugation at 4000 rpm for 10 min  at  4°C.  The  concentration  of  proteins  was  quantified with the bicinchoninic acid (BCA) kit (Ding Guo, Beijing, China). MDA, GSH and SOD activities were detected using MDA, GSH Assay Kit-WST and SOD Assay Kit-WST (Nan-jing Jiancheng Bioengineering Institute) according to the manufacturer’s protocols.10)

Real-Time PCR Frozen kidney (−80°C) samples were homogenized, Total RNA samples were prepared by using trizol reagent (Songshu, Guangzhou, China), and quantita-tively measured using nano drop2000 (Thermo, U.S.A.). Prim-

ers for tumor necrosis factor-α (TNF-α), interleukin-1 beta (IL-1β),  interleukin-6 (IL-6), Bcl2-associated X protein (Bax), B-cell CLL/lymphoma 2 (Bcl-2) were composed by Generay company (as shown in Table 1). Quantitative (q) PCR reactions were run for 40 cycles and the target genes amplified by qPCR using RT-PCR kit (Vazyme, NanJing, China) according to the manufacturer’s protocol and the paper.10)

Western Blot Analyses Kidney tissues were lysed with cold  RIPA  Lysis  buffer  (Ding  Guo)  containing  1 mM  pro-tease and phosphatase inhibitor cocktail (Ding Guo). The concentration  of  the  proteins  was  quantified  using  the  Bicin-choninic acid (BCA) assay (Ding Guo) after centrifugation at 12000 rpm for 5 min. Proteins separated by sodium dodecyl sulfate (SDS)-polyacrylamide gels were transferred to poly-vinylidene  difluoride  (PVDF) membranes  (Millipore, U.S.A.). Then, the membranes were incubated overnight at 4°C with the following primary antibodies: rabbit monoclonal anti-glyc-eraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (diluted 1 : 5000, Abcam, Cambridge, U.K.), rabbit monoclonal anti-NFκB  antibody  (diluted  1 : 1500,  Genetex,  Zeeland,  MI, U.S.A.), rabbit monoclonal anti-P-NFκB antibody (diluted 1 : 1000, Genetex),  rabbit monoclonal anti-Bax antibody (dilut-ed 1 : 1000, Abcam), rabbit monoclonal anti-Bcl2 antibody (di-luted 1 : 1000, Affinity, Tokyo, Japan). Further  incubation with secondary HRP-goat anti-rabbit antibody (diluted 1 : 5000, Af-finity) was  done  for  45 min  at  r.t.  Then,  the membranes were washed  thrice with TBST buffer  (Ding Guo) at  r.t.  for 10 min. The ECL chemiluminescence kit (ASPEN, U.S.A.) was used to examine  the binding affinity and  the bands were visualized using Image Lab Software (Bio-Rad, Hercules, CA, U.S.A.).11)

Statistical Analyses Data was processed using GraphPad Prism5.0 Software (GraphPad Software, Inc., U.S.A.). One-way ANOVA with Tukey’s multiple comparison test was used to  analyze  the  means  of  different  groups.  A  p-value of less than 0.05 was considered as statistically significant.

Fig.  1.  Experimental Protocol for the Induction of Kidney Injure and STVNa Administration in SD RatsFirstly, the rats were separated into 2 groups. One group (n = 60) received high fat/high cholesterol diet while the control group (n = 12) was fed the standard diet

for 5 weeks. Then, the high cholesterol/high fat diet-fed rats were further separated into 5 groups (n = 12 per group). The rats from the HFD, HFD + STVNa and HFD + Fenofibrate groups were  fed high  fat. Different doses of STVNa,  fenofibrate or normal  saline was performed by gavage  for 5 weeks. Normal  rats were  sensitized and challenged with the equivalent of normal saline. STVNa: isosteviol sodium.

Table 1. List of Primers Used for Real-Time PCR

Gene Forward primer (5′→3′) Reverse primer (5′→3′)

BCL2 CCAGCGTGTGTGTGCAAGTGTAAAT ATGTCAATCCGTAGGAATCCCAACCBAX GCTGATGGCAACTTCAACTG GATCAGCTCGGGCACTTTAGIL1β CTTCCCCAGGGCATGTTAAG ACCCTGAGCGACCTGTCTTGIL6 TTCCATCCAGTTGCCTTCTTG TTGGGAGTGGTATCCTCTGTGATNFα ATGGCCTCCCTCTCATCAGT CTTGGTGGTTTGCTACGACGGADPH AGCCAAAAGGGTCATCATCT GGGGCCATCCACAGTCTTCT

1174 Vol. 43, No. 8 (2020)Biol. Pharm. Bull.

RESULTS

Kidney Morphology and Lipid Content Changes The morphological changes after the HFD diet were administered for 5 weeks as shown in Fig. 2a. Nuclear pyknosis and inflam-matory cell  infiltration  in  the HFD group at 5weeks  indicated that the kidney injury model was successfully established.HFD animals exhibited higher plasma levels of triglycerides 

(F = 38.17, p < 0.05), cholesterol (F = 29.23, p < 0.05) (Fig. 2b) and  non-esterified  fatty  acids  (NEFA)  (F = 35.76, p < 0.05) (Fig. 2c).

Effects of STVNa on Body Weight (BW) and Kidney Function   Animals fed normally exhibited lower weight than the one of HFD group. The bodyweight of rats in STVNa group was smaller relative to that of rats in the HFD group and  fenofibrate  treatment  group  (Fig.  3b).  However,  there was  no  significant  change  after  treatment  with  STVNa  and fenofibrate.H&E  staining was  used  to  examine morphological  changes 

in the 10th week after high-fat/high cholesterol diet (Fig. 3a). Clear  structures  were  exhibited  in  the  normal  group,  whereas 

the  high-fat  diet  treated  group  exhibited  shrinkage,  nuclear pyknosis, and enlargement of the intercellular space. Rats showed less extensive damage with multiple STVNa treatments and fenofibrate treatment group. In particular, rats  treated with the 10 mg/kg STVNa showed significantly improvement.

The UA and CRE levels were elevated in HFD-fed rats relative to the normal group. However, UA and CRE levels (F = 14.91, p < 0.05)  were  significantly  lower  in  the  STVNa group  relative  to  HFD  group.  Fenofibrate  also  decreased serum UA and CRE levels in HFD-fed rats. However, there were  no  significant  change  between  HFD  group  and  feno-fibrate group on serum UA level (Figs. 3c, d).

Effect of STVNa on Oxidative Stress in Kidney Total MDA level (F = 107.3, p < 0.05) and SOD inhibition ratio (F = 265.8, p < 0.05) of kidney tissues were increased in HFD group as compared with those in the normal group, however, those in the group treated with STVNa or fenofibrate were sig-nificantly  decreased  (Figs.  4a,  b).  Animals  fed  with  HFD  ex-

Fig. 2. The Impact of HFD Treatment on Morphological Changes and Serum Parameters at Five Weeks(a)  Hematoxylin  and  eosin  (H&E)  staining  images  of  the  kidney  (magnifica-

tion: ×400, scale bar = 50 µm); (b) TC and TG content; (c) NEFA content (n = 6, # p < 0.05, ## p < 0.01 vs.  the  normal  group).  HFD:  high-fat  high  cholesterol diet;  H&E  staining:  hemoxylin  and  eosin  staining;  TC:  Triglycerides;  TG:  total cholesterol; NEFA:  non-esterified  fatty  acids.  (Color  figure  can  be  accessed  in  the online version.)

Fig.  3.  Effects of STVNa Treatment on Weight and Kidney Function(a)  H&E  staining  images  of  kidney  (magnification: ×200, scale bar = 100 µm);

(b) KW/BW at age of 10th week; (c) The level of UA; (d) The level of CRE. All data  are  expressed  as  mean ± standard error of the mean (S.E.M.) (n = 6 for each group). ## p < 0.01 vs. the normal group; * p < 0.05, ** p < 0.01 vs. the HFD group. HFD: high fat diet; H&E staining: hemoxylin and eosin staining, BW: body weight, KW: kidney weight, UA: uric acid; CRE: creatinine; Fen: fenofibrate. (Color figure can be accessed in the online version.)

Fig.  4.  Effects of STVNa on Oxidative Stress in Kidney(a) The level of MDA (mmol/mgprot); (b) SOD inhibition ratio; (c) The level of GSH (µmol/mgprot). All data are represented as mean ± S.E.M. (n = 6 for each group).

## p < 0.01, ### p < 0.001, vs. the normal group; * p < 0.05, ** p < 0.01, *** p < 0.001, vs.  the  HFD  group.  HFD:  high  fat  diet;  MDA:  malondialdehyde;  SOD:  superoxide dismutase; GSH: glutathione; Fen: fenofibrate.

Vol. 43, No. 8 (2020) 1175Biol. Pharm. Bull.

hibited a marked reduction in GSH levels while STVNa treat-ment  led  to  a  significant  elevation  in  GSH  levels  (F = 37.89, p < 0.05). All  these molecular markers of oxidative stress were significantly inhibited by STVNa treatment (Fig. 4c). However, there were  no  significant  differences  between HFD  group  and fenofibrate treatment groups on the level of GSH.

Effects of STVNa on Lipid Accumulation in Kidney To illustrate  the effect of STVNa  treatment on glycogen and glo-

merular  expansion,  morphological  analysis  revealed  that  rats fed with HFD developed a remarkable increase in glomerular area and glycogen content (Figs. 5a, b). However, quantitative analysis  of  the  PAS-positive  matrix  revealed  that  treatment with STVNa reduced the increase in glomerular area and glycogen content (F = 13.145, p < 0.05),  and  the  fenofibrate showed the same trend drawn from results.To  determine  the  effect  of  STVNa  treatment  on  lipid  stor-

age, we measured the content of TG, TC and NEFA in kidney tissue. As illustrated in Figs. 5c and d, the results showed that  the  plasma  levels  of  non-esterified  fatty  acids  (NEFA) (F = 86.71, p < 0.0001) (Fig. 5d), triglycerides and cholesterol were higher in rats fed on HFD diet (Fig. 5c) relative to rats fed on normal diet at 10 weeks. These were attributed to the  effects  of  STVNa  treatment.  The  content  of  TG,  TC  and NEFA  were  also  significantly  decreased  by  treatment  with fenofibrate.

Effect of STVNa on Cell Apoptosis in Kidey RT-PCR assays  revealed  increased  expression  of  Bax  (F = 16.12, p < 0.05)  and  a  reduced  expression  of  Bcl-2  level  (F = 20.65, p < 0.05) in the HFD group relative to the normal group, and the STVNa treatment restored these alterations (Figs. 6a, b).  To  further  confirm  the  anti-apoptotic  effects  of  STVNa, Western bolt was performed, and the data were illustrated in Figs. 6c, e. Compared with the rats in normal group, increased protein  expression  of  Bax  and  a  reduced  expression  of  Bcl-2 were observed in the HFD-induced rats. However, STVNa treatment  played  a  major  role  in  suppressing  Bax  expression (F = 19.83, p < 0.05) and inducing Bcl-2 expression (F = 25.85, p < 0.05).

Effect of STVNa on Kidney Inflammation IL-1β, IL-6, and TNF-α  are  essential  inflammatory  mediators  involved  in inflammatory  response.  Therefore, we  evaluated  the  quantita-tive  expressions  of  IL-1β, IL-6, and TNF-α genes controlling inflammation  by  real-time  PCR  array.  The  results  showed the  expression  of  genes  involved  in  inflammation  signaling were up regulated in the HFD group, while STVNa treat-

Fig.  5.  Effects  of  STVNa  on  Renal  Morphology  and  Metabolic Parameters(a)  PAS  staining  images  of  kidney  (magnification: ×400, scale bar = 100 µm);

(b)  Semi-quantification  of  PAS;  (c)  The  level  of  TG  and  TC  (mmol/gprot);  (d) The  level  of  NEFA  (mmol/gprot).  Data  are  expressed  as mean ± S.E.M. (n = 6 for each group). * p < 0.05, ** p < 0.01, *** p < 0.001, vs. the HFD group; # p < 0.05, ### p < 0.001, vs.  the  normal  group.  HFD:  high  fat  diet;  PAS:  periodic  acid-Schiff staining;  TC:  Triglycerides;  TG:  total  cholesterol;  NEFA:  nonesterified  fatty  acid; Fen: fenofibrate. (Color figure can be accessed in the online version.)

Fig.  6.  Effects of STVNa on the Cell Apoptosis Expression and Gene Expression(a) Bax mRNA  levels  in  the kidney.  (b) Bcl-2 mRNA  levels  in  the kidney.  (c) The protein  level  of Bax, Bcl2,  and GADPH assessed by Western blotting.  (d) Bax  and 

(e) Bcl2 expression was measured and presented in bar graph. All data are expressed as mean ± S.E.M. (n = 6 for each group). * p < 0.05, ** p < 0.01, *** p < 0.001, vs. the HFD group; # p < 0.05, ### p < 0.001, vs. the normal group. HFD: high fat diet.

1176 Vol. 43, No. 8 (2020)Biol. Pharm. Bull.

ment  reduced  the  expression of  these  inflammatory mediators (F = 11.08, F = 18.50, F = 35.75, p < 0.05) (Figs. 7a–c).

Furthermore, the protein levels of NFκB and p-NFκB were determined by Western blot. The results indicated that the protein level of p-NFκB and the p-NFκB/NFκB  expression ratio  were  significantly  increased  in  the  HFD  group  while the  expression of p-NFκB and p-NFκB/NFκB expression  ratio (F = 21.45, p < 0.05) were down regulated in the kidney tis-sues of the rats treated with STVNa (Figs. 7d, e).

DISCUSSION

Isosteviol, a common natural sweetener, has antitumor and anti-inflammatory  activities.12,13) HFD feeding induces the metabolic syndrome such as hyperinsulinemia, hyperlipid-emia,  impaired  renin  angiotensin-aldosterone  activity,  oxida-tive stress, and insulin resistance. Reduced insulin sensitivity is more likely to lead to chronic kidney disease than other metabolic complications in the kidney. This study used the model of HFD fed rat to investigate whether STVNa could alleviate  insulin  resistance  and  explored  the  mechanism  by which STVNa prevents apoptosis, inflammation, and oxidative stress in high-fat/high cholesterol diet-induced kidney injury and whether the NF-κB pathway is involved.Based  on  the  findings,  a  high-fat/high  cholesterol  diet  rats 

anomalies  in  a  significant  rise  in  high  fat  and  kidney  tissue pathological  changes.  In  the  present  study,  hemoxylin  and eosin staining results indicate that STVNa or fenofibrate treat-ment  can  improve  kidney  function  and  reduce  infiltrative  in-flammatory cells. Numerous studies have identified MDA as a reliable biomarker of oxidative balance since it directly reflects the levels of ROS. GSH and SOD are essential antioxidant en-zymes capable of scavenging free radicals and maintaining biosynthesis, cellular immunity among other functions.14,15) Both enzymes possess a number of important physiological functions.16,17) Therefore, in this study, MDA and GSH content were  measured.  The  findings  report  that  GSH  content  in  the kidney  tissue  increased  significantly  with  STVNa  treatment, while SOD and MDA enzyme activity decreased obviously.

SOD  and  MDA  enzyme  activity  were  also  significantly  in-hibited  by  fenofibrate  treatment.  These  results  indicate  that STVNa and fenofibrate can effectively improve the kidney an-tioxidant  capacity.  However,  STVNa  has  a  better  antioxidant effect compared to fenofibrate. Previous studies have similarly demonstrated  the  cardiomyopathy  (DCM)  effects  of  STVNa, focusing on the suppression of pathological processes DCM and  inhibiting extracellular signal-regulated kinase (ERK) 1/2 phosphorylation to reduce the cardiac tissue oxidative stress.10) Our  findings  are  consistent  with  previous  findings  and  the mechanism  underlying  improved  antioxidant  ability  may  in-hibit ROS production and ERK signaling pathways.Oxidative  stress  is  an  important  pathogenic  mechanism  of 

metabolic  syndrome  which  induces  inflammation.18,19) In the present study, there was a marked increase in glomerular sur-face area and inflammatory cells infiltration in the HFD which indicated the presence of severe pathology. Moreover, glomer-ular  expand  and glomerular mesangial matrix  increased HFD model group rats. The obvious increment of the mesangial cell number was not detected. However, the pathological damage degree  was  improved with  STVNa  and  fenofibrate  treatment. Though  the  metabolism  of  uric  acid  in  rodents  is  different from mammals, various studies have shown that increased serum levels of uric acid have been associated with the onset and development of chronic kidney disease.20–22) STVNa can reduce the level of serum creatinine and uric acid obviously in  this  study.  However,  fenofibrate  also  can  reduce  the  levels of  uric  acid  and  serum creatinine  to  some  extent. Our  results indicate  that both STVNa and fenofibrate can exhibit an obvi-ous protective effect against kidney injury and improve kidney function,  but  the  effect  of  fenofibrate  is  significantly  weaker than STVNa.

Previous studies have reported that the accumulation of ROS can damage the cell structure and activate the mito-chondrial apoptotic pathway. Elevated pro-apoptotic protein Bax  and  decreased  anti-apoptotic  protein  Bcl-2  induces  apo-ptotic cascades.23)  Excessive  apoptosis  has  been  observed  in metabolic syndrome and also demonstrated in kidney injury animal models.24,25) Therefore, inhibition of apoptosis attenu-

Fig.  7.  Effects of STVNa on the Expression of Inflammatory Cytokines(a) IL1β mRNA level in the kidney tissue. (b) The mRNA level of IL6 in the kidney tissue. (c) TNFα mRNA level in the kidney tissue. (d) The NFκB, P-NFκB, and

GADPH protein expression evaluated by Western blotting. (e) Bar graph showing P-NFκB/NFκB expression ratio. All data are expressed as mean ± S.E.M. (n = 6 for each group). * p < 0.05, ** p < 0.01, *** p < 0.001, vs. the HFD group; # p < 0.05, ## p < 0.01, ### p < 0.001, vs. the Normal group. HFD: high fat diet.

Vol. 43, No. 8 (2020) 1177Biol. Pharm. Bull.

ates the symptoms of kidney injury. Consistently, our results showed that  the expression of Bax (pro-apoptotic protein) was remarkably upregulated while Bcl-2 (anti-apoptotic protein) was decreased in the HFD group in comparison to the normal group implying activation of apoptosis. Following, the admin-istration of STVNa, Bax expression was  inhibited while Bcl-2 expression  was  enhanced.  Therefore,  STVNa may  exert  anti-apoptotic effects.

Many previous studies show that metabolic disease is associated  with  CKD  which  induces  an  inflammatory  re-sponse.26,27) Moreover, other studies demonstrate that HFD leads to metabolic syndrome which is the major factor to cause kidney failure.28) Rat KW/BW in the HFD group was significantly higher  in comparison to that  in  the normal group in this study. Conversely, the weight of rats fed on STVNa was lower than those fed on HFD, and there is no change in  weigh  between  the  fenofibrate  treatment  group  and  HFD group. The present results suggest that STVNa could prevent weight gain depending on the dose. Moreover, the periodic acid-schiff  staining  data  reveals  that  the  glycogen  content  of kidney  is  significantly  increased  after  consumption of  a high-fat diet, but reduced with the STVNa or fenofibrate  treatment. Additionally,  the PAS score  in  the HFD group  is  significantly higher than that in the normal group. By contrast, rats in the STVNa and fenofibrate groups exhibit a considerable decrease in the pathological score in comparison to the HFD group. In  a  word,  kidney  injury  significantly  decreases  following STVNa administration. In addition, content of TG, TC, and NEFA is markedly elevated in rats fed on HFD diet relative to those fed on normal diet. Notably, STVNa treatment is able to significantly  reverse  this phenomenon and fenofibrate has a similar  effect.  The  results  indicates  that  STVNa may  amelio-rate metabolic syndrome and it’s renal protective function may be the consequences of whole body effects and be used to treat kidney injury induced by HFD.

IL-1β, IL-6 and TNF-α are  important pro-inflammatory cy-tokines which play an important role in various diseases.29,30) Therefore, this study investigated whether STVNa could improve  inflammatory  response  induced  by  HFD  by  deter-mining  the  relative  expression  levels  of  key  factors  (IL-1β, IL-6 and TNF-α). The mRNA levels of TNF-α and IL-1β, and IL-6 were significantly downregulated  in  the normal group as compared with those in the HFD group and STVNa treatment significantly  decreased  the  expression  levels  of  these  factors. Furthermore, IL-1β、IL-6, and TNF-α have been reported to be associated with the NF-κB signaling pathway which is one of the classic inflammatory signaling pathways.31,32) Therefore, analysis of the NF-κB and p-NF-κB  expression  reveal  strong evidence that they were elevated in rats fed on HFD diet relative to those of the normal group and markedly reduced following STVNa administration. The present results suggest that kidney injury caused by HFD activates the NF-κB signal-ing  pathway  and  STVNa  treatment  suppresses  the  expression of NF-κB.  It demonstrates  that STVNa effectively  inhibits  the inflammatory response.

In conclusion, STVNa can regulate lipid metabolism and attenuate  kidney  injury  by  decreasing  inflammation  and  apo-ptosis through the NF-κB  and  Bax/Bcl2  signaling  pathways, respectively. The current study suggests that STVNa may have therapeutic potential for metabolic syndrome associated kid-ney  dysfunction  by  inhibiting  inflammation,  oxidative  stress 

and  apoptosis.  However,  the  exact  molecular  mechanisms  re-quire further investigation.

Acknowledgments This study was supported in part by the National Natural Science Foundation of China (31601089), the Science and Technology Planning Project of Guangzhou (No. 201904010232). The authors are grateful to Key Biophar-maceutical Co. Ltd. for supplying STV-Na. The authors thank Professor Jiming Ye (Director for Postgraduate Research Group Leader, Lipid biology and Metabolic Disease School of Health and Biomedical Sciences RMIT University, Melbourne, Victoria, Australia) for providing linguistic assistance.

Author Contributions Ying Mei conducted the study and wrote the manuscript. Wen Tan and Xiaoou Sun designed the project. Yihe Kuai participated in histological procedure. All authors  have  approved  the  final  manuscript.  Therefore,  all authors have full access to all the data in the study and take responsibility for the integrity and security of the data.

Conflict of Interest  The  authors  declare  no  conflict  of interest.

REFERENCES

1) Amann K, Benz K. Structural renal changes in obesity and diabe-tes. Semin. Nephrol., 33, 23–33 (2013).

2) Maric-Bilkan C. Obesity and diabetic kidney disease. Med. Clin. North Am., 97, 59–74 (2013).

3) Caramori ML, Mauer M. Diabetes and nephropathy. Curr. Opin. Nephrol. Hypertens., 12, 273–282 (2003).

4) Solini A, Ferrannini E. Pathophysiology, prevention and manage-ment of chronic kidney disease in the hypertensive patient with diabetes mellitus. J. Clin. Hypertens., 13, 252–257 (2011).

5) Schieppati A, Remuzzi G. Chronic renal diseases as a public health problem:  epidemiology,  social,  and  economic  implications. Kidney Int. Suppl., 68, S7–S10 (2005).

  6)  Fioretto P, Steffes MW, Sutherland DE, Goetz FC, Mauer M. Rever-sal of lesions of diabetic nephropathy after pancreas transplantation. N. Engl. J. Med., 339, 69–75 (1998).

7) Sun X, Yang Y, Xie Y, Shi X, Huang L, Tan W. Protective role of STVNa in myocardial ischemia reperfusion injury by inhibiting mi-tochondrial fission. Oncotarget, 9, 1898–1905 (2018).

8) Zhang H, Sun X, Xie Y, Zan J, Tan W. Isosteviol sodium protects against permanent cerebral ischemia injury in mice via inhibition of NF-κB–mediated  inflflammatory  and apoptotic  responses. J. Stroke Cerebrovasc. Dis., 26, 2603–2614 (2017).

9) Xu S, Luo W, Xu X, Qian Y, Xu Z, Yu W, Shan X, Guan X, Lum H, Zhou H, Wang Y. MD2 blockade prevents oxLDL-induced renal epithelial cell injury and protects against high-fat-diet-induced kid-ney dysfunction. J. Nutr. Biochem., 70, 47–55 (2019).

10) Tang S, Liu X, Ye J, Hu T, Yang Y, Han T, Tan W. Isosteviol ame-liorates diabetic cardiomyopathy in rats by inhibiting ERK and NF-κB signaling pathways. J. Endocrinol., 238, 47–60 (2018).

11) Shi X, Li D, Wang Y, Liu S, Qin J, Wang J, Ran J, Zhang Y, Huang Q, Liu X, Zhou J, Liu M. Discovery of centrosomal protein 70 as an important player in the development and progression of breast cancer. Am. J. Pathol., 187, 679–688 (2017).

12) Chan P, Xu DY, Liu JC, Chen Y, Tomlinson B, Huang W, Cheng J.  The  effect  of  stevioside  on  blood  pressure  and  plasma  catechol-amines in spontaneously hypertensive rats. Life Sci., 63, 1679–1684 (1998).

13) Gregersen S, Jeppesen PB, Holst JJ, Hermansen K. Antihyperglyce-mic effects of stevioside in type 2 diabetic subjects. Metabolism, 53,

1178 Vol. 43, No. 8 (2020)Biol. Pharm. Bull.

73–76 (2004).14)  Yang  RL,  Shi  YH,  Hao  GW,  Li  W,  Le  GW.  Increasing  oxidative 

stress  with  progressive  hyperlipidemia  in  human:  relation  between malondialdehyde and atherogenic index. J. Clin. Biochem. Nutr., 43, 154–158 (2008).

15) Ponce-Canchihuamán JC, Pérez-Méndez O, Hernández-Muñoz R, Torres-Durán PV, Juárez-Oropeza MA. Protective effffects of Spiru-lina maxima on hyperlipidemia and oxidative-stress induced by lead acetate in the liver and kidney. Lipids Health Dis., 9, 35 (2010).

16)  Singh U, Kumar S, Dhakal S. Study of oxidative stress in hypercho-lesterolemia. Int. J. Con-temp. Med. Res., 4, 1204–1207 (2017).

17) Smathers RL, Galligan JJ, Stewart BJ, Petersen DR. Overview of lipid  peroxidation  products  and  hepatic  protein  modifification  in alcoholic liver disease. Chem. Biol. Interact., 192, 107–112 (2011).

18) Terevinto A, Ramos A, Castroman G, Cabrera MC, Saadoun A. Oxidative  status,  in vitro  iron-induced  lipid  oxidation  and  superox-ide dismutase, catalase and glutathione peroxidase activities  in rhea meat. Meat Sci., 84, 706–710 (2010).

19) Vasant RA, Narasimhacharya A. Antidotal activity of Averrhoa car-ambola  (Star  fruit)  on  fluoride  induced  toxicity  in  rats.  Interdiscip. Toxicol., 7, 103–110 (2014).

20) Kanbay M, Jensen T, Solak Y, Le M, Roncal-Jimenez C, Rivard C, Lanaspa MA, Nakagawa T, Johnson RJ. Uric acid in metabolic syndrome:  From  an  innocent  bystander  to  a  central  player. Eur. J. Intern. Med., 29, 3–8 (2016).

21) Roumeliotis S, Roumeliotis A, Dounousi E, Eleftheriadis T, Liako-poulos V. Dietary  antioxidant  supplements  and uric  acid  in  chronic kidney disease: a review. Nutrients., 11, 1911 (2019).

22) Borghi C, Rosei EA, Bardin T, Dawson J, Dominiczak A, Kielstein JT, Manolis AJ, Perez-Ruiz F, Mancia G. Serum uric acid and the risk of cardiovascular and renal disease. J. Hypertens., 33, 1729–1741, discussion, 1741 (2015).

23) Liu T, Han Y, Zhou T, Zhang R, Chen H, Chen S, Zhao H. Mecha-nisms of ROS-induced mitochondria-dependent apoptosis under-

lying liquid storage of goat spermatozoa. Aging, 11, 7880–7898 (2019).

24)  Maes  ME,  Schlamp  CL,  Nickells  RW.  BAX  to  basics:  How the BCL2 gene family controls the death of retinal ganglion cells. Prog. Retin. Eye Res., 57, 1–25 (2017).

25)  Pfeffer CM, Singh ATK. Apoptosis:  a  target  for  anticancer  therapy. Int. J. Mol. Sci., 19, 448 (2018).

26) Aladaileh SH, Abukhalil MH, Saghir SA, Hanieh H, Alfwuaires MA, Almaiman AA, Bin-Jumah M, Mahmoud AM. Galangin activates Nrf2  signaling  and  attenuates  oxidative damage,  inflflam-mation, and apoptosis in a rat model of cyclophosphamide-induced hepatotoxicity. Biomolecules, 9, 346 (2019).

27)  Schwingshackl  L,  Hoffmann  G.  Comparison  of  effects  of  long-term low-fat vs. high-fat diets on blood lipid levels in overweight or  obese  patients:  a  systematic  review  and  meta-analysis.  J. Acad. Nutr. Diet., 113, 1640–1661 (2013).

28) Chen H, Fu Y, Jiang X, Li D, Qin W, Zhang Q, Lin D, Liu Y, Tan C,  Huang  Z,  Liu  Y,  Chen  D.  Arabinoxylan  activates  lipid  catabo-lism and alleviates liver damage in rats induced by high-fat diet. J. Sci. Food Agric., 98, 253–260 (2018).

29)  Opal  SM,  DePalo  VA.  Anti-inflammatory  cytokines.  Chest, 117, 1162–1172 (2000).

30) Singh S, Facciorusso A, Singh AG, Vande Casteele N, Zarrinpar A, Prokop LJ, Grunvald EL, Curtis JR, Sandborn WJ. Singh AG4. Obesity and response to anti-tumor necrosis factor-α agents in patients with select immune-mediated inflammatory diseases: a sys-tematic review and meta-analysis. PLOS ONE, 13, e0195123 (2018).

31)  Nennig  SE,  Schank  JR.  The  role  of  NFkB  in  drug  addiction:  be-yond inflammation. Alcohol Alcohol., 52, 172–179 (2017).

32) Rosette C, Agan FJ, Rosette N, Moro L, Mazzetti A, Hassan C, Ger-loni  M.  Rifamycin  SV  exhibits  strong  anti-inflammatory  in vitro activity through pregnane X receptor stimulation and NFκB inhibi-tion. Drug Metab. Pharmacokinet., 34, 172–180 (2019).