Embed Size (px)
Citation preview
1
ISOLATION AND CHARACTERIZATION OF EQUINE UMBILICAL CORD BLOOD DERIVED STEM CELLS
By
SARAH ANN REED
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2009
2
© 2009 Sarah Ann Reed
3
To Jake, who taught me what it meant to be a true horsewoman; Aja, who relit the fire; and Jared who was there for it all
4
ACKNOWLEDGMENTS
There are so many people whom have helped me throughout this process that it would be
impossible to thank you all. First and foremost, I am thankful to my advisor, Dr. Sally Johnson.
Sally gave me the chance to work in her lab as an unproven technician and then invited me to
join her lab as a student. Over the past five years, she has coaxed, encouraged, motivated and
made me into a better scientist and a better person. She pushed me beyond what I thought were
my limits because, in the end, she knew I could do more.
My committee has been supportive throughout my tenure at UF. Dr. Moore was
instrumental in teaching me valuable ES culture techniques. Dr. Brown provided a wonderful
outside perspective of my project from a clinician’s point of view. Dr. Ealy was a great
sounding board for ideas and was extremely helpful with statistical analysis.
My lab mates have been wonderful at providing friendship and support. Sophia, Dane, Juli,
Sara, John Michael, Lulu and Dillon – Thank you. I am forever indebted to my friends who have
been there for me throughout the last five years. Sara, Beth, and Ella have all been the greatest
friends to have, whether I needed a shoulder to cry on or to just go out and have fun. John
Michael has been my lab best friend and the person that I could always gripe to when I had a
frustration with anything. I couldn’t have gotten through all of the real-time without him.
My family has provided constant support and understanding, even when attending graduate
school meant moving 1100 miles away from home, missing Christmases, birthdays and all of the
little things in family life. My Mom and Dad, Lisa and Howard Grove, have provided endless
encouragement and faith that I could do this. My grandparents have always let me know how
much I am loved and that they believe I can do anything I set my mind to do. My in-laws, Don
and Barb Reed, have also provided much support and encouragement along the way, and I thank
them for accepting me into their family.
5
Finally, I am supremely thankful to my husband, Jared, who has been there through all of
the tears, successes, late night blood collections and long work hours. He had faith that I would
succeed even when I lost mine. Even when he didn’t understand what, he understood why and
stood behind me the whole way. His unfailing support is the only reason I stand where I do
today. He is the love of my life, my partner, my other half, my husband and I am the luckiest
girl in the world to have found him.
6
TABLE OF CONTENTS
page
ACKNOWLEDGMENTS ...............................................................................................................4
LIST OF TABLES ...........................................................................................................................9
LIST OF FIGURES .......................................................................................................................10
ABSTRACT ...................................................................................................................................12
CHAPTER
1 INTRODUCTION ..................................................................................................................14
Self Renewal ...........................................................................................................................14 Stem Cell Plasticity .................................................................................................................17
Transcriptional Regulation of Plasticity ..........................................................................17 Oct4. .........................................................................................................................18 Sox2. .........................................................................................................................19 Nanog .......................................................................................................................20
Epigenetic Regulation of Plasticity .................................................................................21 Role of Fibroblast Growth Factors in Stem Cell Maintenance and Differentiation ...............23 Embryonic Stem Cells ............................................................................................................25
Characteristics .................................................................................................................25 Differentiation .................................................................................................................30
Umbilical Cord Blood Derived Stem Cells ............................................................................33 Collection and Processing ...............................................................................................33 Differentiation .................................................................................................................34
Adult Stem Cells .....................................................................................................................38 Bone Marrow Derived Mesenchymal Stem Cells ...........................................................38 Peripheral Blood Derived Progenitor Cells .....................................................................39 Umbilical Cord Vein Derived Stem Cells .......................................................................40 Adipose Derived Stem Cells ...........................................................................................41
Therapeutic Uses of Stem Cells ..............................................................................................42 Spinal Cord Injuries .........................................................................................................43 Vertebrae .........................................................................................................................44 Cardiovascular Repair .....................................................................................................45 Tendon and Ligament Injuries .........................................................................................47 Bone Injuries ...................................................................................................................49 Cartilage Injuries .............................................................................................................51 Muscular Dystrophies ......................................................................................................53
Conclusion ..............................................................................................................................54
2 CENTRAL HYPOTHESIS ....................................................................................................55
7
3 EQUINE UMBILICAL CORD BLOOD CONTAINS A POPULATION OF STEM CELLS THAT EXPRESS OCT4 AND DIFFERENTIATE INTO MESODERMAL AND ENDODERMAL CELL TYPES ..................................................................................57
Introduction .............................................................................................................................57 Materials and Methods ...........................................................................................................59
Umbilical Cord Blood (UCB) Collection and Stem Cell Isolation .................................59 Equine UCB and Adipose-Derived (AD) Stem Cell Culture ..........................................59 RNA Isolation, Reverse Transcription (RT), and Polymerase Chain Reaction (PCR) ...60 Osteogenic Differentiation ..............................................................................................60 Chondrogenic Differentiation ..........................................................................................61 Adipogenic Differentiation ..............................................................................................61 Hepatogenic Differentiation ............................................................................................61 Myogenic Differentiation ................................................................................................62 Histology .........................................................................................................................62 Immunocytochemistry .....................................................................................................62
Results.....................................................................................................................................63 Foal Umbilical Cord Blood Contains an Oct4-Expressing Cell Population ...................63 UCB Stem Cells Form Chondrocytes ..............................................................................64 Differentiation of UCB Stem Cells into Osteocytes ........................................................64 Foal UCB Stem Cells can Differentiate into Endodermal-Derived Cell Types ..............65 Inefficient Formation of Myocytes and Adipocytes by UCB Cells ................................65 AdMSC do not Express the Same Complement of Stem Cell Markers ..........................66
Discussion ...............................................................................................................................67
4 REFINEMENT OF CULTURE CONDITIONS TO PROMOTE THE MAINTENANCE OF EQUINE UMBILICAL CORD BLOOD DERIVED STEM CELLS ....................................................................................................................................78
Introduction .............................................................................................................................78 Materials and Methods ...........................................................................................................79
UCB Collection and Stem Cell Isolation .........................................................................79 Stem Cell Culture ............................................................................................................80 RNA Isolation, Reverse Transcription (RT) and Polymerase Chain Reaction (PCR) ....81 Statistical Analysis ..........................................................................................................82
Results.....................................................................................................................................83 UCB Express Markers of Pluripotent Stem Cells ...........................................................83 GM and GM+FGF Maintain UCB Proliferation .............................................................83 Protein Surface Matrixes Promote UCB Growth ............................................................84 Oct4 is Maintained Throughout UCB Culture ................................................................84 Notch Signaling in UCB Stem Cells ...............................................................................85
Discussion ...............................................................................................................................87
8
5 CULTURE OF EQUINE UMBILICAL CORD BLOOD AND ADIPOSE DERIVED STEM CELLS TO PROMOTE TENOCYTIC DIFFERENTIATION ................................101
Introduction ...........................................................................................................................101 Materials and Methods .........................................................................................................103
Stem Cell Culture ..........................................................................................................103 Plasmids and Transfections ...........................................................................................104 Confocal Microscopy ....................................................................................................104 Protein Isolation and Evaluation ...................................................................................105 Assessment of Proliferation ...........................................................................................105 RNA Isolation, Reverse Transcription, and Polymerase Chain Reaction .....................106 Quantitative PCR ...........................................................................................................106
Results...................................................................................................................................106 AdMSC and UCB Express Markers of Tenocytic Cells ...............................................106 Scleraxis Minimal Promoter Activity ............................................................................107 AdMSC and UCB Survive on Various Matrices ...........................................................108 Culture in Matrigel Increases Tenocyte Gene Expression ............................................108 Fibroblast Growth Factors Elicit Differing ERK1/2 Responses in UCB and AdMSC .109 Effect of FGF5 Supplementation on Actin Structure ....................................................110 Response of the PI3K Pathway to FGF2 and FGF5 Supplementation ..........................111
Discussion .............................................................................................................................111
6 SUMMARY AND CONCLUSIONS ...................................................................................131
APPENDIX
A SUPPLEMENTARY DATA ................................................................................................136
Mouse Embryonic Stem Cell Culture and Differentiation ...................................................136 Alternative UCB Differentiation Protocols ..........................................................................137
Myogenic Differentiation ..............................................................................................137 Neural Differentiation ...................................................................................................137 Adipogenic Differentiation ............................................................................................137
Quantification of Oct4, nanog, and Sox2 Across Time in Culture .......................................138
B TABLE OF PRIMER SEQUENCES ...................................................................................142
LIST OF REFERENCES .............................................................................................................144
BIOGRAPHICAL SKETCH .......................................................................................................171
9
LIST OF TABLES
Table page 4-1 Effect of substrata on equine UCB1 derived stem cell population doubling time .............92
4-2 Effect of substrata and media on equine UCB1 derived stem cell doubling time ..............93
4-3 Effects of horse, passage, media and substrata on mRNA expression ..............................95
4-4 Delta Ct values for hes realtime PCR. ...............................................................................99
5-1 Real-time PCR primers ....................................................................................................116
5-2 Cycle threshold ranges .....................................................................................................117
5-3 Putative transcription factor binding sites on the mouse scleraxis minimal promoter1. ..120
B-1 Primer sequences and sources. .........................................................................................142
10
LIST OF FIGURES
Figure page 3-1 Foal UCB cells express stem cell marker proteins ............................................................72
3-2 Induction of chondrogenesis in foal UCB stem cells.........................................................73
3-3 UCB stem cells form osteocytes. .......................................................................................74
3-4 Foal UCB stem cells form hepatocytes ..............................................................................75
3-5 Incomplete initiation of adipogenesis and myogenesis in foal UCB stem cells and AdMSCs .............................................................................................................................76
3-6 AdMSC fail to express embryonic stem cell markers .......................................................77
4-1 GM and GM+FGF support equine UCB stem cell propagation ........................................91
4-2 Equine UCB stem cells express markers of embryonic stem cell pluripotency ................94
4-3 UCB and AdMSC express a limited number of molecules in the Notch signaling pathway. .............................................................................................................................96
4-4 Inhibition of the Notch signaling pathway does not affect proliferation ...........................97
4-5 UCB and 23A2 myoblasts express hes. .............................................................................98
4-6 BMP6 inhibits myoblast differentiation in a Notch dependent manner ..........................100
5-1 AdMSC and UCB express markers of tenocytic cells. ....................................................118
5-2 Mouse scleraxis promoter with putative transcription factor binding sites .....................119
5-3 Scleraxis promoter activity is not increased by growth factor supplementation in UCB stem cells. ...............................................................................................................122
5-4 UCB stem cells express Erm, Pea3, and Scleraxis. .........................................................123
5-5 UCB and AdMSC attach to various culture surfaces.......................................................124
5-6 Culture in matrigel increases tenocyte gene expression ..................................................125
5-7 UCB and AdMSC respond uniquely to FGF stimulation. ...............................................126
5-8 Fibroblast growth factors stimulate proliferation of AdMSC and UCB stem cells in a MAPK dependent manner................................................................................................127
5-9 Culture conditions affect tenocyte gene expression in AdMSC and UCB. .....................128
11
5-10 FGF5 supplementation does not affect UCB actin structure ...........................................129
5-11 FGF2 and FGF5 do no activate Akt in UCB (A) or AdMSC (B). ...................................130
A-1 Stages of mES colony differentiation. .............................................................................140
A-2 mES embroid bodies differentiate into a variety of cell types.. .......................................141
12
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
ISOLATION AND CHARACTERIZATION OF EQUINE UMBILICAL CORD BLOOD
DERIVED STEM CELLS
By
Sarah Ann Reed
August 2009 Chair: Sally E Johnson Major: Animal Molecular and Cellular Biology
Musculoskeletal injuries are responsible for a large portion of wastage in sport horses.
Mesenchymal stem cells (MSCs) offer promise as therapeutic aids in the repair of tendon,
ligament, and bone damage suffered by these horses. The objective of these studies was to
identify and characterize stem-like cells from newborn foal umbilical cord blood (UCB). UCB
was collected and MSC isolated using human reagents. The cells exhibit a fibroblast-like
morphology and express the stem cell markers Oct4, SSEA-1, Tra1-60 and Tra1-81. UCB
express transcripts implicated in embryonic stem (ES) cell pluripotency, namely Oct4, nanog,
Sox2, Klf4 and c-myc. Culture of the cells in tissue-specific differentiation media leads to the
formation of cell types characteristic of mesodermal and endodermal origins including
chondrocytes, osteocytes, and hepatocytes. Limited adipogenic and myogenic differentiation
occurred. Population doubling time and the presence of Oct4, nanog and Sox2 transcripts were
used to determine culture conditions that promoted the proliferation of a stem cell population.
Culture on a protein matrix (gelatin, collagen or fibronectin) shortened population doubling time
compared to growth on uncoated plasticware. Inclusion of fibroblast growth factor 2 (FGF2) in
the growth media slowed proliferation. The persistence of Oct4, nanog and Sox2 expression was
monitored over time in culture in UCB stem cells. Oct4 was detected throughout the duration of
13
the experiment. Sox2 and nanog expression declined with time in culture. Finally, the effect of
culture conditions on expression of tendon markers was assessed. Initial stem cell populations
express scleraxis, an early marker of tenocytic differentiation. Culture on collagen coated beads
did not affect scleraxis levels; however culture in 30% Matrigel significantly increased levels of
the transcript. This change was accompanied by differences in morphology. Cells grown in
Matrigel formed tight colonies reminiscent of ES cell colonies while those on collagen coated
beads maintained a fibroblast-like morphology. In conclusion, we have isolated a population of
stem cells from equine umbilical cord blood that possess a number of stem cell markers, can be
expanded in culture, and can differentiate into a variety of potentially useful cell types.
14
CHAPTER 1 INTRODUCTION
The millions of cells that compose an organism stem from a small population of cells of
the inner cell mass (ICM) in the developing embryo. During development, these cells give rise
to more committed cells which form the three germ layers: endoderm, mesoderm, and ectoderm.
With increasing numbers of divisions, the cells become more committed until the majority of the
organism is composed of fully differentiated adult cell types. However, in most tissues a
population of cells remains that is capable of recapitulating at least some of the cell types
specific to that tissue. These stem cells maintain homeostasis throughout aging and insult. Stem
cells have several characteristic properties that define the global stem cell population – self
renewal and differentiation into a variety of more mature cell types. Self renewal is an essential
property that allows repopulation of the stem cell community. One daughter cell is destined to
become a more committed cell type, while the other remains a malleable stem cell. Plasticity, or
the ability to differentiate, is a property that is unique to the type of stem cell. Different
populations have varied amounts of plasticity – thus, while one cell type may be capable of
differentiation into two committed cell types, another such as an embryonic stem cell can
contribute to every tissue of the adult organism.
Self Renewal
The process of self renewal allows stem cells to contribute to a population of committed
cells while maintaining a stable population of stem cells. This can occur through a variety of
mechanisms including asymmetric cell division, polarization initiated by external factors, fate
determination by cell:cell contact, and stochastic regulation of intrinsic processes. It is most
likely a complex combination of all four mechanisms that creates a permissive and instructive
environment for stem cell self-renewal. During development, the axis of polarity is established
15
and coordinated with the body plan. Cell fate determinants are localized asymmetrically along
this axis. During mitosis, the mitotic spindle is oriented along the axis such that cytokinesis
creates two daughter cells containing different concentrations of these determinants. In
Drosophila germ line stem cells, differential positioning of the mother and daughter centrosomes
during mitosis determines the fate of each resulting cell. The mother centrosome is anchored to
the niche by astral microtubules. The cell containing the daughter centrosome migrates away
from the niche following cytokinesis and differentiates (Yamashita et al., 2003; Spradling and
Zheng, 2007; Yamashita et al., 2007). In neural stem cells, asymmetrical localization of cellular
proteins influences cell fate. Numb, a negative regulator of Notch signaling is localized
asymmetrically at one pole of mitotic spindle in the sensory organ precursor cell of the
Drosophila peripheral nervous system such that only one daughter cell inherits the protein (Rhyu
et al., 1994). In this system, Numb influences cell fate by repressing Notch signaling. The
primary function appears to be the creation of two daughter cells that can respond differently to
external cues rather than to specify a specific cell fate (Rhyu et al., 1994). Using
videomicroscopy, Li et al report that 30-40% of mouse neuroepithelial cells segregate Numb to
one daughter cell during division (Li et al., 2003). This is correlated with asymmetric division to
one neuroepithelial cell and one neuron. In addition, 18% of cortical precursor cells divided and
expressed Notch1 asymmetrically. Notch1 was associated with the basal cell of the dividing pair
(Chenn and McConnell, 1995).
Hematopoietic stem cells (HSC) provided the first indication that stem cells were capable
of self renewal through asymmetric division. Colony formation assays of HSC demonstrated
that approximately 20% of progenitors divide asymmetrically (Suda et al., 1984a; Suda et al.,
1984b). In a population of CD34+ HSC, one daughter remained quiescent or divided very
16
slowly while the other multiplied quickly and yielded committed progenitors (Huang et al.,
1999). Slow dividing fractions of HSC are associated with primitive function and self renewal
while the fast dividing fraction proceeds to differentiation (Huang et al., 1999; Cheng et al.,
2000; Punzel et al., 2002). Using time lapse microscopy, Wu et al showed that hematopoietic
precursor cells are capable of symmetric commitment, symmetric self renewal, and asymmetric
division (Wu et al., 2007c). Additionally, overexpression of Numb in these cells resulted in fewer
lineage negative cells. In addition, HSC self renewal is mediated at least in part by the stem cell
niche. Long term repopulating cells (LTRC; CD34+CD38-) are located in the HSC niche (the
endosteal region associated with bone lining osteoblasts or endothelial cells) in a quiescent state
(Yahata et al., 2008). Approx 75% of the most primitive long term repopulating hematopoietic
stem cells are resting in G0 (Cheshier et al., 1999). Following isolation, these cells were capable
of successful engraftment and reconstitution of hematopoiesis (Yahata et al., 2008). Clonally
distinct LTRC controlled hematopoietic homeostasis and created a stem cell pool hierarchy by
asymmetric self renewing division that produced both lineage restricted, short term repopulating
cells and LTRCs (Yahata et al., 2008). Quiescent LTRC clones can expand to reconstitute the
hematopoiesis of the secondary recipient (Yahata et al., 2008).
More restricted adult stem cells are also capable of self renewal. Muscle satellite cells that
are Pax7+/Myf5- can give rise to Myf5+ cells when dividing in the basal/apical orientation
(Kuang et al., 2007). Myf5 expressing cells lay next to fiber in a position to differentiate and fuse
while null cells remain next to basal lamina in a position to remain as a precursor cell.
Committed cells expressed Delta1, while the more naïve progenitor cells did not. Conversely,
Notch3 was highly expressed in the progenitor but not committed cells. Notch 1, 2 and Numb
levels were equal in both populations. Using videomicroscopy, Shinin et al examined the
17
segregation of Numb-GFP in dividing satellite cells (Shinin et al., 2006). Both symmetric and
asymmetric segregation was observed; approximately 34% of primary myogenic cells in culture
displayed asymmetric Numb localization following division. Numb segregated to the mother
cell. Slow dividing, label retaining satellite cells contain the template DNA strand during
division and maintain Pax7 expression. In cells in which both the DNA and Numb were
segregated asymmetrically, 90% retained the Numb and template DNA in the same (mother)
cell. Furthermore, these cells expressed Pax7 and did not differentiate.
Stem Cell Plasticity
As mentioned above, different populations of stem cells have different levels of plasticity.
Totipotent cells are those capable of recapitulating the entire organism including the
extraembryonic materials. Pluripotent cells, such as ES cells, contribute to the three germ layers.
Cells with limited abilities that can only differentiate into a few cell types (generally of the same
germ layer) are termed multipotent. Pluripotency of ES cells has only been shown conclusively
in the mouse, where ES cells completely integrated into a developing embryo and produced a
highly chimeric fetus (Evans and Kaufman, 1981). The mechanisms that regulate plasticity must
be pliable enough to allow differentiation under appropriate stimuli but rigorous enough to
override the developmental program when needed.
Transcriptional Regulation of Plasticity
In ES cells, there are several well characterized pathways of transcriptional regulation of
pluripotency. Leukemia inhibitory factor (LIF) is essential for the maintenance of mES cells in
vitro. LIF binds to the LIF receptor—gp130 heterodimer to activate STAT3 signaling in mES
cells (Niwa et al., 1998). Inhibition of STAT3 phosphorylation results in loss of DNA-binding
ability and morphological changes to ES cells resembling differentiation (Boeuf et al., 1997). In
contrast, activation of STAT3 is sufficient to maintain mES cells in an undifferentiated state in
18
the absence of LIF (Matsuda et al., 1999). These cells were capable of forming chimeric mice
when injected into blastocysts. However, LIF is not required for embryonic development – null
embryos develop to a stage beyond that of ES cell isolation. It is important to remember that the
presence of the pluripotent ICM in the developing embryo is a transient state, thus the lack of
requirement of LIF is not surprising. A notable difference between hES and mES cells is the
lack of requirement for LIF signaling in hES cells. When maintained on a feeder layer in the
presence of serum, human ES cells do not require LIF signaling to prevent differentiation. Bone
morphogenic protein 4 (BMP4) is an anti-neurogenesis factor that has been shown to contribute
to LIF cascade, enhancing self renewal and pluripotency by activating SMADs which, in turn,
promote transcription of the Id gene family (inhibitors of differentiation, (Ying et al., 2003)). In
the absence of LIF, BMP4 promotes differentiation. Like LIF, this factor is not required for the
initial “creation” of the ES cell population – null embryos develop past the stage of ES cell
derivation. However, ES cells can be derived in the absence of serum with media supplemented
with LIF and BMP4 (Ying et al., 2003). Wnt activation helps maintain the undifferentiated
phenotype in mouse and human ES cells by sustaining the expression of Oct4, Rex1, and nanog
(Sato et al., 2004).
Oct4.
Oct4 is a Pou domain transcription factor expressed by all pluripotent cells during mouse
embryogenesis as well as undifferentiated mouse ES cells and embryonic carcinoma cell lines
(Scholer et al., 1989a; Scholer et al., 1989b; Okamoto et al., 1990; Rosner et al., 1990).
Upregulated during the 4 cell stage of embryo development, Oct4 later becomes restricted to
pluripotent stem cells. Expression of Oct4 is downregulated with differentiation (Brandenberger
et al., 2004). In addition, embryos lacking Oct4 expression develop to a stage resembling a
blastocyst and have a mass of cells designated to the location of the ICM, but do not contain
19
pluripotent cells, only trophectodermal cells which cannot be used to produce ES cells (Nichols
et al., 1998). Decreased expression of Oct4 by siRNA resulted in the downregulation of
pluripotency related genes such as nanog and Sox2, markers of undifferentiated stem cells such
as Lefty1, Lefty2, and Thy1, and chromatin modifying factors such as DNMT3B (Babaie et al.,
2007). Relative amounts of Oct4 protein effects cell fate; overexpression of Oct4 results in
differentiation into primitive endoderm and mesoderm, while loss of the protein results in
spontaneous differentiation into trophectodermal cells (Yeom et al., 1996; Niwa et al., 2000;
Niwa, 2001). Thus, Pou5f1 must be strictly regulated to maintain ES cell fate. The Oct4
pathway appears to be independent from LIF/STAT3 signaling, as disruptions to either pathway
have no direct effect on the other. However, the two transcription factors may cooperate to
regulate target genes, as many target genes contain both Oct and STAT binding sites (Tanaka et
al., 2002; Ginis et al., 2004).
Sox2.
Sox2 is a high mobility group (HMG) domain DNA binding protein that regulates
transcription and chromatin architecture (Pevny and Lovell-Badge, 1997). Sox2 forms a ternary
complex with Oct4 on the FGF4 enhancer as well as other genes involved in maintaining ES cell
pluripotency (Yuan et al., 1995; Boyer et al., 2005). Expression of Sox2 in the developing
embryo is similar to that of Oct4 (Avilion et al., 2003). Null embryos are incapable of giving
rise to pluripotent cells from the ICM, instead producing trophectoderm-like cells (Avilion et al.,
2003; Masui et al., 2007). Microarray screening indicates that Sox2 null cells express greater
levels of genes that negatively regulate Oct4 and downregulate factors that positively regulate
Oct4. Introduction of exogenous Oct4 into Sox2 null cells restored their proliferation and
pluripotency, indicating that Sox2 may upregulate the positive regulators of Oct4 while
downregulating factors that negatively affect Oct4 transcription (Masui et al., 2007). In human
20
ES cells, treatment with Sox2 siRNA significantly reduced Sox2, Oct4 and nanog expression
levels (Fong et al., 2008). Decreased Sox2 expression also resulted in significantly reduced
populations of SSEA3, SSEA4, Tra1-60 and Tra1-81 expressing cells. Expression levels of
chromatin remodeling factors and transcription factors known to regulate pluripotency were also
downregulated in Sox2 knockdown cells.
Nanog
The homeobox domain containing transcription factor Nanog is expressed by
undifferentiated ES cells, however it is not capable of preventing differentiation after the
withdrawal of LIF (Chambers et al., 2003; Mitsui et al., 2003). Additionally, Oct4 is required for
Nanog mediated self renewal in ES cells (Chambers et al., 2003). Null embryos lack a primitive
ectoderm and consist almost entirely of disorganized extraembryonic tissues (Mitsui et al., 2003;
Hyslop et al., 2005). ES cells lacking nanog differentiate slowly into extra-embryonic lineages
(Mitsui et al., 2003). Nanog transcriptionally represses genes involved in differentiation.
Overexpression of nanog in ES cells allows the cells to remain pluripotent in the absence of LIF,
although the ability to self renew is reduced (Chambers et al., 2003; Mitsui et al., 2003). This
ability is abrogated if nanog is mutated to be dimerization incompetent (Wang et al., 2008). In
cooperation with Sall4, a spalt-like zinc finger protein, nanog occupies target genes important for
pluripotency, including Pou5f1, Sox2, and nanog (Wu et al., 2006; Zhang et al., 2006).
Transcription of Nanog itself is suppressed by p53 binding of the nanog promoter (Lin et al.,
2005). Oct4, Sox2 and Nanog map to promoters of a large population of genes that are both
active in defining ES cell identity (the undifferentiated phenotype) and repressing
developmental/differentiation genes. These factors also participate in autoregulatory and feed-
forward loops (Boyer et al., 2005; Loh et al., 2006). Nanog contains a 15 base pair Oct-Sox
composite element in the proximal promoter (Rodda et al., 2005). Sox2 and Oct4 bind this
21
module both in vitro and in viable mouse and human ES cells. Expression of constitutively active
nanog maintains mES cells in the undifferentiated state in the absence of LIF (Mitsui et al.,
2003).
Recent work has suggested that Oct4, nanog and Sox2 cooperate in regulating self renewal
and plasticity. Numerous target genes have been identified to be bound by the three factors.
Target genes of Oct4 have a Sox binding element 0 or 3 base pairs from the octamer binding
element (Rodda et al., 2005). Significantly, a complex containing both Oct4 and Sox2 regulates
the expression of nanog (Kuroda et al., 2005; Rodda et al., 2005). Oct4 and Sox2 recognize and
bind elements in the regulatory regions of their own genes (Chew et al., 2005). Large numbers
of target genes of Oct4 are also bound by nanog in ES cells, suggesting that these pathways work
in cooperation rather than independently of one another (Boyer et al., 2005; Loh et al., 2006).
The gene targets identified represent a variety of products required for pluripotency but also
those required for differentiation, suggesting that these transcription factors not only promote the
maintenance of the naïve state but also block the progression of differentiation. Klf4 binds the
regulatory regions of Pou5f1 and nanog and is also found in many complexes of these proteins at
transcriptional regulatory sites on other genes. Nanog and Oct4 may interact directly with each
other and chromatin remodeling proteins (Liang et al., 2008). A transient reduction in Pou5f1
and nanog induced differentiation in mES cells (Hough et al., 2006).
Epigenetic Regulation of Plasticity
Another mechanism by which plasticity is maintained is the epigenetic regulation of
chromatin structure. Epigenetic marks (including methylated DNA and possibly modified
histones) are propagated at S phase, thus epigenetic information can be transmitted through
sequential rounds of cell division (Jaenisch and Bird, 2003; Henikoff et al., 2004). Chromatin is
subjected to various forms of epigenetic regulation that modulate the transcriptional activity of
22
specific genomic regions including chromatin remodeling, histone modifications, histone
variants, and DNA methylation. For example, trimethylation of lysine 9 and lysine 27 on histone
3 (H3K9 and H2K27, respectively) correlate with inactive regions of chromatin. However,
trimethylation of H3K4 and acetylation of histones three and four are associated with active
areas of transcription (Jenuwein and Allis, 2001). Generally, methylation is considered a
repressive mark (Santos and Dean, 2004). Polycomb group proteins (PcG) also silence
developmental regulators, aiding in the maintenance of a plastic state (Boyer et al., 2006; Lee et
al., 2006). PcG proteins form two repressor complexes, PRC1 and PRC2. PRC2 inhibits
initiation of transcription, while PRC1 maintains the repressed state (Boyer et al., 2006). Genes
that are co-occupied by PRC1 and PRC2 also exhibit H3K27 trimethylation which is catalyzed
by PcG proteins (Cao et al., 2002; Ringrose et al., 2004). Recently, a configuration of epigenetic
modification has been described on target genes poised for transcription but not yet active.
These bivalent histones contain both repressive and active histone markers, with large regions of
H3K27 trimethylation interrupted by a smaller region of H3K4 trimethylation. This
configuration is frequently associated with developmentally regulated factors that may be
expressed at low levels in stem cells. Upon differentiation, most bivalent domains become H3K4
or H3K27 methylated (Azuara et al., 2006; Bernstein et al., 2006).
BAF, a member of the SWI/SNF family of ATP dependent chromatin remodeling
complexes, is expressed abundantly in ES cells. BAF250a is a member of the BAF complex
which can target and antagonize PcG proteins. Absence of BAF250a results in embryos that fail
to undergo gastrulation and proper germ layer development (Gao et al., 2008). Null ES cells
differentiate into cells with endoderm-like morphology. These cells express a marked reduction
23
in Oct4 and Sox2. Loss of BAF250a resulted in the inability to specify some lineage-specific
differentiation.
Overall, the stem cell must maintain a highly dynamic and transcriptionally permissive
state to be poised to respond to appropriate stimuli. These cells exhibit fewer heterochromatin
foci that are more diffuse than in differentiated cells. Using fluorescent recovery after
photobleaching, Meshorer et al demonstrated the presence of an increased fraction of loosely
bound or soluble architectural chromatin proteins (Meshorer et al., 2006). With this method,
higher recovery rates reflect loose binding of these proteins to chromatin, rendering it more
accessible to transcription factors and chromatin modifiers. Overall, the chromatin of stem cells
exists in a more permissive transcriptional state than that of differentiated cells.
Role of Fibroblast Growth Factors in Stem Cell Maintenance and Differentiation
The fibroblast growth factors (FGF) were first discovered as a family of growth factors
that promoted proliferation. There are now over twenty FGFs identified in the human with
different temporal and spatial expression patterns. FGFs function in proliferation, differentiation
and migration during development and adult life. Most FGFs share a conserved internal region
of residues responsible for receptor binding (Baird et al., 1988; Plotnikov et al., 1999). Two of
the twelve B-strands in the core region of the protein are thought to contain the heparin binding
domain which is separate from the domain which binds the receptor. Most FGFs have amino-
terminal signal peptides and are readily secreted. However, FGF1 and FGF2 lack this sequence
and may be released via exocytosis (Mignatti et al., 1992). Extracellular FGFs bind four high
affinity transmembrane receptor tyrosine kinases which propagate signal transduction
intracellularly. Stable interaction between the FGF and FGF receptor (FGFR) requires the
presence of heparin sulfate proteoglycans which protect the complex from proteolysis and
thermal degradation. Heparin sulfate may also limit the amount of FGF diffusion into the
24
interstitial spaces. FGFs bind FGFR in a 2:2:2 fashion where each fully active complex consists
of two each of FGF, FGFR, and heparin sulfate. FGF receptors contain two or three
immunoglobulin-like domains, a short, conserved area of acidic residues which contains separate
ligand and heparin binding domains, a transmembrane region and two intracellular tyrosine
kinase domains. To achieve downstream signaling, binding of the ligand to the FGFR and
heparin sulfate must occur. The resulting tyrosine phosphorylation of FRS2, a docking protein,
allows the recruitment of Grb2 molecules which, in turn, recruit the nucleotide exchange factor
SOS. The formation of the FRS2-Grb2-SOS complex activates the Ras-Raf-MAPK pathway,
resulting in changes in gene transcription. Phosphorylation of the FGFRs can also activate the
PLCγ-PKC pathway. Alternatively, Grb2 can recruit Gab1 to activate PI3K/Akt signaling. This
diversity allows a single set of receptors to influence a wide variety of cellular events.
Receptor diversity is controlled by alternative splicing and results in differential ligand
binding characteristics as well as varying temporal and spatial expression patterns (Lee et al.,
1989; Johnson et al., 1990). Alternative splicing specifies the sequence of the immunoglobulin
domain III determining the receptor isoform (i.e. IIIb, IIIc). Splicing occurs in a tissue specific
manner and dramatically affects ligand specificity (Miki et al., 1992; Orr-Urtreger et al., 1993;
Scotet and Houssaint, 1995).
Identified as potent mitogens, FGFs play a major role in stem cell biology that ranges from
self-renewal to differentiation to cell attachment and migration. Importantly, FGF2 is required
by human ES cells to sustain self-renewal and plasticity (Amit et al., 2000; Xu et al., 2001).
Inhibition of FGFRs in hES cells suppressed activation of downstream signaling, led to the
downregulation of Oct4 and stimulated rapid differentiation (Dvorak et al., 2005).
Supplementation of FGF2 at levels greater than 5 ng/ml decreased the outgrowth of hES colonies
25
while not affecting proliferation suggesting a role in cell attachment and spreading. Exogenous
FGF2 enhances growth of bone marrow mesenchymal stem cells (Solchaga et al., 2005). It
prolongs the life span of bone marrow stromal cells by stimulating telomere elongation (Bianchi
et al., 2003). Murine bone marrow derived Sca1-positive stem cells proliferated in response to
FGF4 and FGF2 under low serum conditions and exhibited a simultaneous phosphorylation of
ERK1/2 and Akt. Changes in proliferation were abrogated by the inclusion of MEK and PI3K
inhibitors. The up-regulation of the immediate early gene c-jun was also apparent following
ERK1/2 activity (Choi et al., 2008).
FGF4 is secreted from undifferentiated hES cells and promoted self-renewal. Not only did
expression of FGF4 decline with differentiation, but knockdown of the growth factor with
siRNA resulted in differentiation, indicating a role for FGF4 in the maintenance of the
undifferentiated state in human ES cells (Mayshar et al., 2008). Accordingly, Sox2 and Oct4 can
transactivate the FGF4 enhancer in F9 embryonal carcinoma cells suggesting a circular feedback
mechanism (Yuan et al., 1995). Alternatively, Fgf4-/- mES cells do not undergo differentiation
upon removal of LIF, but will differentiate along the neural lineage if further supplemented with
exogenous FGF4. Cells null for FGF4 exhibit a reduced ability to enter neuronal and
mesodermal lineages which does not stem from a lack of proliferation or death of precursor cells.
Null cells do not select alternative commitment programs, rather they remain in an
undifferentiated state (Kunath et al., 2007).
Embryonic Stem Cells
Characteristics
Embryonic stem cells were first derived from the inner cell mass of a mouse blastocyst in
1981 (Evans and Kaufman, 1981). Established human lines followed in the late 1990’s
(Thomson et al., 1998). The immortal cells derived from the inner cell mass are an in vitro
26
phenomenon, existing only transiently in vivo. Much work has been done to characterize these
cells in hopes of obtaining a population of stem cells useful for regeneration and repair of human
tissue. The chromatin of ES cells exists in an open state, allowing transcription of genes for
maintenance and eventual differentiation. Epigenetic modifications of chromatin structure or
DNA methylation may lead to more restricted lineage-specific gene transcription (Arney and
Fisher, 2004). High levels of telomerase activity are associated with ES cells and their ability to
be cultured indefinitely (Zeng and Rao, 2007). While murine and human ES cells exhibit similar
morphologies, there are several distinct characteristics of each species. Embryonic stem cells
derived from the mouse can be cultured in feeder-free culture systems in the presence of
leukemia inhibitory factor (LIF). Conversely, human ES cells do not require LIF and can be
cultured off of feeder layers if supplemented with fibroblast growth factor 2 (Xu et al., 2005).
Cells from both species grow in tightly packed colonies and appear to be inherently
heterogeneous, as a portion of the outer layer of cells will differentiate. Whether this is truly a
heterogeneous population or an artifact of inefficient culture is unknown at this point in time.
The deletion of both copies of lif in mES did not completely abolish the ability of these cells to
self renew. Instead, these cells produced a soluble factor that allowed the propagation of a small
number of colonies despite the presence of a differentiation permissive environment. This
factor, termed ES cell renewal factor (ESRF), works independently of the STAT3 signaling
pathway and can sustain the undifferentiated phenotype of ES cells in vitro (Dani et al., 1998).
In culture, ES cells possess a very short cell cycle (11-16 hr) mainly due to a reduction in G1
phase. Early G1 is omitted by the constitutive presence of cyclin E – CDK2 activity (Savatier et
al., 1994; White et al., 2005). LIF withdrawal from the culture media brings cyclin E expression
under control of pocket proteins, requiring cyclin D complexes and the obtainment of the early
27
phase of G1 (White et al., 2005). By eliminating the requirement for cyclin D expression
(MAPK induced), ES cells uncouple cell cycle traverse from differentiation, allowing for self
renewal.
ES cells isolated from cynomolgus monkey require a feeder layer to maintain pluripotency
and cannot rely on LIF supplementation as do murine ES cells. LIF treatment induces
phosphorylation of tyrosine 705 but does not affect the phosphorylation status of serine 727 of
STAT3 (Sumi et al., 2004). Serine phosphorylation of STAT3 is required for full transcriptional
activity (Wen et al., 1995).
Interestingly, down-regulation of connexin 43, a protein responsible for formation of gap
junctions, results in the rapid differentiation of mES cells (Todorova et al., 2008). This included
loss of Oct4 expression, morphological changes, and up regulation of differentiation markers
such as glial fibrillar associate protein (GFAP). Formation of embroid bodies was hindered by
treatment with gap junction intercellular communication (GJIC) blockers. Recovery of GJIC
allowed the restoration of the differentiation program.
Research with ES cells is not limited to humans and mice. ES cells were successfully
isolated from the ICM of bovine embryos (created by IVF or nuclear transfer) and cultured on
mitomycin-c treated MEFs (Wang et al., 2005b). They assumed the typical morphology of ES
cells: multicellular colonies with a smooth surface and distinct colony boundary. Bovine ES
cells react positively with SSEA4 and Oct4 but not SSEA1 antibodies. No Tra1 expression was
found. In the absence of a feeder layer and LIF, bES cells spontaneously differentiated into EBs
and gave rise to cells from three germ layers. Ectodermal cells expressed the neurofilament
marker TUBB3, mesodermal cells expressed smooth muscle ACTA2, and cuboidal and net-like
epithelial structures expressed creatine kinase.
28
Likewise, equine embryos have also yielded ES-like cells. Several groups have isolated
ES-like cells from frozen and freshly collected equine blastocysts (Saito et al., 2002; Li et al.,
2006; Guest and Allen, 2007). Equine ES-like cells exhibit morphology similar to mES cells
with underrun cell borders, a small cytoplasmic to nuclear ratio, and prominent nucleoli (Li et
al., 2006). These cells express Oct4, alkaline phosphatase, SSEA1, SSEA4, Tra1-60 and Tra1-81
(Saito et al., 2002; Li et al., 2006; Guest and Allen, 2007). No SSEA3 was apparent in ES-like
cells, although it was detected in equine blastocysts (Guest and Allen, 2007). Equine ES-like
cells were capable of differentiation into all three germ layers in vitro but did not form teratomas
when injected subcutaneously into SCID/beige immunoincompetent mice (Li et al., 2006).
Despite the similarities in marker expression, reports of the culture conditions required differ
among reports. In the absence of LIF, eES-like cells lost expression of all markers of
pluripotency and exhibited morphological properties identical to differentiated cells (Li et al.,
2006; Guest and Allen, 2007). However, other reports indicate that a feeder layer, but not LIF, is
necessary for the maintenance of eES-like cells (Saito et al., 2002). The difference between the
reports is unclear but may result from differences in isolation protocols or source of the equine
embryos.
Embryos from rats and dogs have also yielded ES-like cells. Rat ES-like cells cultured on
a feeder layer in the presence of LIF express Oct4, SSEA1, and alkaline phosphatase (Vassilieva
et al., 2000). Canine ES-like cells were isolated from inner cell masses collected from
blastocysts (Hatoya et al., 2006). Unlike mouse and human ES cells, this population is limited in
life span, entering replicative senescence after nine passages. Domed colonies with tightly
packed cells and an apparent border were present during early passages when cultured on a
feeder layer. Cells expressed alkaline phosphatase, SSEA1, and Oct4, but no SSEA4.
29
Aggregation into EBs produced cells with morphologies that represented cells from all three
germ layers.
In an effort to avoid the ethical controversies surrounding embryonic stem cells and to
make pluripotent stem cells that matched the unique identity of each individual, Takahashi and
Yamanaka sought to find a set of factors that would induce a pluripotent state in a somatic cell
(Takahashi and Yamanaka, 2006). They identified four factors which, when transduced into
mouse embryonic fibroblasts, elicited a naïve state with ES cell morphology and the ability to
produce teratomas in nude mice that contained cell types from all three germ layers. Oct4, Sox2,
Klf4, and c-Myc induced the expression of nanog and other pluripotency factors. The induced
pluripotent stem cells (iPS) showed increased acetylation of histone H3 of the Pou5f1 and nanog
promoters as well as decreased methylation of lysine 9 of histone H3, indicating a permissive
state for Pou5f1 and nanog transcription. However, the CpG dinucleotides remained partially
methylated. Additionally, iPS cells exhibited higher telomerase activity at levels similar to ES
cells. Human embryonic fibroblasts respond similarly to induction with Oct4, Sox2, Klf4 and c-
Myc, expressing ES cell markers at both the protein and mRNA level (Park et al., 2008).
However, recovery of iPS from postnatal human cells was successful only when hTERT and
SV40 large T were included in the retroviral cocktail. The authors speculate that these factors
are required to act on supportive cells in the culture to enhance the efficiency with which the
reprogrammed colonies can be selected (Park et al., 2008). Further work has indicated that only
two factors, Oct4 and Sox2 may be necessary for induction of iPS cells from human fibroblasts
when coupled with valproic acid (Huangfu et al., 2008). These cells are morphologically similar
to hES cells and express nanog, Oct4, Sox2, SSEA4, Tra1-60 and Tra1-81. iPS cells have been
postulated to be functionally equivalent to mouse ES cells in that they express the same markers,
30
possess similar gene expression profiles, form teratomas, and contribute to cells of chimeric
animals, including the germ line (Takahashi and Yamanaka, 2006; Maherali et al., 2007; Okita et
al., 2007; Wernig et al., 2007).
Differentiation
Differentiation of ES cells can be obtained by removing LIF from the culture media and
allowing the formation of embroid bodies (EBs). These masses of cells will differentiate and,
upon dispersal onto a culture plate, produce cells of the three germ layers. Differentiating EBs
mimic the genetic changes of early development – the downregulation of pluripotency and self
renewal genes coupled with the upregulation of genes responsible for the development of the
three germ layers – making this system useful for studying the mechanisms of early development
(Gerecht-Nir et al., 2005).
Directed differentiation of ES cells is much more difficult than the spontaneous
differentiation found in EBs. Zheng et al were successful in creating a pre-myoblast line from
hES cells but the differentiated cells did not fully differentiate in vitro (Zheng et al., 2006).
However, placing these preconditioned cells into an injured muscle resulted in moderate
incorporation into host fibers (approximately 7%). Irradiation following cardiotoxin treatment
resulted in a higher degree of incorporation (approximately 29%).
Transducing CGR8 ES cells with Ptf1a and Mist1 prior to differentiation resulted in
increased pancreatic differentiation (Rovira et al., 2008). Acinar genes including CPA and Ela1
were upregulated in a manner similar to early exocrine cells. Pancreatic signaling mediators and
gap junction protein mRNAs were expressed in transduced cells. Additionally, differentiated
cells contained zymogen granule-like vesicles filled with Amyl which was released in response
to carbachol, indicating functional properties similar to exocrine cells. Phillips et al cultured hES
cells in a three dimensional environment followed by stimulation by a series of growth factors to
31
induce pancreatic differentiation (Phillips et al., 2007). Embroid bodies were cultured with
activin A and BMP4 to induce endodermal cell types. Pancreatic progenitor cells were formed
following supplementation with HGF, exendin-4, and β-cellulin. These cells expressed Pdx-1 as
well as the early pancreatic epithelial marker Ptf1a and endocrine progenitor marker Ngn3.
Following further differentiation, cells expressed insulin and released c-peptide when stimulated
with forskolin and glucose. When transplanted into the intraperitoneal cavity of SCID mice,
differentiated cells maintain the endocrine identity and show modest glucose responsiveness.
Multiple ES cells lines were tested for their ability to differentiate into mature cartilage
(Kramer et al., 2005). Embroid bodies contained regions deeply stained with Alcian blue
representing cartilage nodules. Nodules consisted of dense groups of rounded cells surrounded
by a rigid membranous structure of extracellular matrix proteins containing type II collagen. In
particular, the BLC6 line of ES cells had markedly high numbers of cartilage nodules (60 fold
that of other lines tested) and a distinct increase in the expression of the adult splice variant B of
type II collagen, a marker of mature chondrocytes.
Osteogenic differentiation was achieved in hES cells when cultured as embroid bodies in
media supplemented with the dexamethasone, ascorbic acid and β-glycerophosphate (Sottile et
al., 2003). Culture in osteogenic induction media generated mineralized cultures that stained
positive for calcium deposits with Alizarin Red and von Kossa. Expression of osteogenic genes
such as osteocalcin, type I collagen, Cbfa1, and osteopontin were increased while Pou5f1
expression decreased during differentiation. The x-ray diffraction pattern of mineralized nodules
was characteristic of hydroxyapatite, the primary component of mineralized bone. Osteogenesis
was also achieved without the use of dexamethasone, ascorbic acid or β-glycerophosphate by
transiently suppressing PPARγ with small interfering RNA (siRNA) (Yamashita et al., 2006).
32
PPARγ induces adipogenesis and when suppressed increases the proportion of ES cells that
differentiate into osteogenic cells. Osteogenic transcripts Cbfa1, type I collagen, and osteocalcin
were increased throughout culture with PPARγ siRNA, however osteocalcin and type II collagen
were expressed later in siRNA treated cells than those treated with osteogenic induction medium.
After twenty days of culture, cells induced with PPARγ siRNA contained matrix that stained
positively with Alizarin Red and produced an equivalent amount of calcium as cells induced with
osteogenic medium.
Neural inductive signals provided by co-culture of mES cells on the PA6 stromal cell line
generated Sox1/TuJ1 expressing neurons (Wichterle et al., 2002). Retinoic acid was also
capable of generating post mitotic neurons expressing Sox1, NeuN and TuJ1. Combination of
retinoic acid and an agonist of the Sonic hedge hog signaling pathway generated spinal motor
neurons. Similar to the gradient produced during embryogenesis, a small variation in the level of
sonic hedge hog signaling led to the generation of ventral interneurons rather than spinal motor
neurons. Pre-differentiated cells introduced into the embryonic chick spinal cord engrafted and
differentiated into motor neurons in vivo. Post mitotic neurons also survived engraftment.
ES cells are capable of undergoing hematopoiesis when cultured in serum free media and
activated sequentially with a number of growth factors (Pearson et al., 2008). Addition of bone
morphogenic protein 4 (BMP4) promoted efficient formation of mesodermal cells. Subsequent
stimulation with activin A and fibroblast growth factor 2 (FGF2) induced the formation of
hemangioblast precursors. Finally, supplementing the media with VEGF was required for the
progression to a committed hematopoietic precursor. Sequential addition of these factors to mES
cells resulted in a significant increase of CD41 expressing hematopoietic precursor cells.
33
Umbilical Cord Blood Derived Stem Cells
Identified as a population of cells from blood that are adherent in plastic cultureware,
umbilical cord blood derived stem cells (UCB) are further purified by centrifugation through a
density gradient such as Ficoll. These cells exhibit a fibroblast like appearance and proliferate,
though they are contact inhibited. UCB have been successfully isolated from humans, sheep,
pigs, dogs, and horses and appear to maintain the same basic characteristics across species
(Bieback et al., 2004; Lee et al., 2004b; Fuchs et al., 2005; Zhao et al., 2006; Koch et al., 2007;
Kumar et al., 2007).
While the explicit protein markers of UCB remain elusive, most reports agree that this
population is CD34, CD45 and major histocompatibility complex (MHC) class II negative and
only weakly positive for MHC class I (Lee et al., 2004a). The minor expression of MHC classes
I and II indicate the lack of immunogenicity of this cell type. Additionally, a mixed lymphocyte
reaction indicated that human UCB did not stimulate lymphocyte proliferation, consistent with
low levels of immunogenicity (Zhao et al., 2006). The absence of CD34 and CD45 suggests a
non-hematopoietic lineage. Additionally, cell surface markers commonly found on MSC, CD29,
CD44, CD73, and CD90 (Thy-1) are found in the majority of UCB (Bieback et al., 2004; Lee et
al., 2004b; Fuchs et al., 2005; Zhao et al., 2006; Kumar et al., 2007). The presence of Oct4,
nanog, SSEA3 and SSEA4 by some researchers suggests a naïve phenotype for UCB (Baal et al.,
2004).
Collection and Processing
Aspiration of blood via syringe or through a canula into a sterile container containing anti-
coagulant (EDTA, citrate phosphate dextrose, or other citrate based anticoagulant) at the time of
parturition or caesarean section yields the highest number of UCB (Sparrow et al., 2002;
McGuckin et al., 2003; Bieback et al., 2004; Chang et al., 2006; Kern et al., 2006). Processing
34
is performed as soon as possible after collection, generally within 15 hours (Bieback et al.,
2004). Prolonged time from collection to processing may decrease the number of cells obtained.
Blood is diluted in a buffered saline solution prior to separation of the mononuclear layer by
density gradient centrifugation (Sparrow et al., 2002; McGuckin et al., 2003; Romanov et al.,
2003; Bieback et al., 2004; Gang et al., 2004a; Lee et al., 2004a; Chang et al., 2006; Kern et al.,
2006). The buffy coat, containing the mononuclear cells, is collected and subjected to at least
two further washes in saline solution or medium. Lysing of the red blood cells may be
performed at this time. Cells are then plated in expansion medium which is typically composed
of Dulbecco’s modified eagle medium (DMEM), 10-20% fetal bovine serum (FBS), and
penicillin/streptomycin. Some researchers suggest the addition of various growth factors and
supplements (Sparrow et al., 2002; Romanov et al., 2003; Bieback et al., 2004; Gang et al.,
2004a; Lee et al., 2004a; Kang et al., 2005; Wagner et al., 2005; Chang et al., 2006; Kern et al.,
2006). Fibroblast like colonies can be seen two to four weeks after plating (Bieback et al., 2004;
Kern et al., 2006). Upon confluency, UCB can be detached with trypsin-EDTA and subcultured.
In contrast to stem cells derived from bone marrow, most UCB populations show an increased
(but not indefinite) potential for proliferation (Bieback et al., 2004).
Differentiation
In an effort to prove the plasticity of umbilical cord blood derived stem cells in relation to
other stem cell populations, in vitro and in vivo differentiation protocols have been performed.
UCB have been successfully differentiated into cells from all three germ layers. Mesodermal
cell types, such as osteoblasts, chondrocytes, and adipocytes, are most commonly used to
identify a stem cell’s ability to differentiate. However, differentiation into cells of the
ectodermal or endodermal layer tends to be more difficult.
35
Maturation of UCB into bone and cartilage is routinely achieved. Both human and equine
UCB have been differentiated into cells capable of producing calcium deposits stained by von
Kossa and Alizarin Red (Kogler et al., 2004; Koch et al., 2007). Transcription of osteopontin,
osteocalcin, and type I collagen has been reported in these cells (Kogler et al., 2004). Culture of
human UCB in media containing dexamethasone and bone morphogenic protein 2 (BMP2)
resulted in morphological changes from spindle shaped cells to cuboidal cells in twenty days
coupled with increased alkaline phosphatase and type I collagen expression (Hildebrandt et al.,
2009). However, it has been noted by some researchers that UCB which differentiate into
osteoblasts do not take on the cuboidal appearance typical of bone marrow derived osteoblasts
(Goodwin et al., 2001).
Chondrogenesis is commonly achieved by culture in a three-dimensional micromass
environment in the presence of transforming growth factor β (TGFβ). These masses react
positively with Alcian Blue and Safranin O, indicating the presence of glycosaminoglycans
typical of cartilage (Kogler et al., 2004; Koch et al., 2007). Further analysis of these cells
reveals transcription of cart-1, Col2a1 and chondroadherin (Kogler et al., 2004). Ovine UCB
from blood collected at 80-120 days of gestation formed tissue reminiscent of hyaline cartilage
when placed on a construct of biodegradable polyglycolic acid polymer treated with poly-L-
lactic acid solution and coated with collagen. This was placed in a bioreactor in permissive
medium for 12 weeks. Marked chondrogenic differentiation was apparent, presenting
characteristics of hyaline cartilage and staining positively for Safranin O and Toluidine Blue.
Type II collagen was primarily expressed with little type I collagen present and no type X
collagen (Fuchs et al., 2005). Inclusion of insulin-like growth factor 1 (IGF-1) after the initial
36
three week culture period with TGFβ increased hydroxyproline content in hUCB (Wang and
Detamore, 2009).
UCB treated with insulin and 3-isobutyl-1-methyl-xanthine, a phosphodiesterase inhibitor,
will obtain lipid vacuoles identified by Oil Red O (Goodwin et al., 2001; Kogler et al., 2004;
Koch et al., 2007). It has been noted that UCB present much less obvious adipogenic
differentiation than do bone marrow or adipose derived MSC (Wagner et al., 2005; Rebelatto et
al., 2008). Other researchers have struggled to form adipocytes from UCB. Biebeck et al could
not obtain adipocytes after culture of UCB in induction medium containing dexamethasone,
IBMX, insulin, indomethacin and fetal calf serum (Bieback et al., 2004). No lipid vacuoles were
formed in UCB despite the appearance of lipid vacuoles in BM MSC treated in a parallel culture.
However, continuous culture in induction medium for 5 weeks did result in some adipocytic
differentiation. Kern et al also reported a failure to induce differentiation into adipocytes, even
following 5 weeks of culture (Kern et al., 2006). Lee et al achieved adipocytic differentiation
but only after the addition of rabbit serum to the induction medium (Lee et al., 2004b).
Less frequently, UCB have been shown capable of limited myogenic conversion in vitro.
Human UCB cultured in myogenic medium resulted in an increase in MyoD and myogenin
transcription. These cells also expressed myosin, but no fusion of cells was reported (Gang et al.,
2004b). When co-cultured on murine fetal cardiomyocytes, human UCB began synchronized
beating in culture after seven days (Nishiyama et al., 2007). Immunocytochemistry indicated
expression of human cardiac troponin 1, α-actinin, and connexin 43 on these cells. Transcripts
for GATA4, cardiac actin, cardiac troponin T, cardiac troponin I, and Nkx-2.5 were also
amplified. Cells successfully engrafted into the atria, ventricles and septum when transplanted
into fetal sheep hearts (Kogler et al., 2004). No cell fusion was apparent between host and donor
37
cells. Myosin heavy chain, dystrophin, and ryanodine receptor were all identified in engrafted
UCB.
Treatment of human UCB with VEGF stimulated the expression of endothelial markers
Flt1, Flk1, von Willebrand Factor, and the transmembrane glycoprotein CD146 as well as a
change in morphology to broad endothelial like cells with spontaneous formation of chain like
structures (Zhao et al., 2006).
Elongated or branched morphologies forming neuronal-like networks were formed
following treatment of human UCB with neural growth factor. These cells expressed the
neuronal markers microtubule-associated protein 1B, synaptophysin, neuronal transmitter
gamma-aminobutyric acid (GABA), and glutamic acid decarboxylase (GAD) (Zhao et al., 2006).
Formation of neural precursors in vitro was achieved in approximately 90% of human UCB as
evidenced by the presence of neurofilament, synaptophysin and GABA protein after 4 weeks of
culture. When these cells were labeled and transplanted into the hippocampus region of adult
rat brain, three months after grafting cells were detected throughout the brain with a neuronal-
like highly differentiated morphology (Kogler et al., 2004). Additionally, Jeong et al report that
human UCB exhibit morphological changes including a narrowing and thickening of the area
around the nucleus while remainder of the cytoplasm elongated to give rise to multiple cellular
processes (Jeong et al., 2004). These cells further progressed to yield network like structures and
express glial fibrillar acidic protein (GFAP), Tuj1, TrkA and CNPase, markers of mature
neuroglia. Neural differentiation can also be obtained following cryopreservation of UCB.
Under permissive conditions, previously cryopreserved human UCB differentiated into neuronal
cell types and expressed neurofilament, GAD, acetylcholinesterase, and GFAP (Lee et al., 2007).
Neural stem cells derived from hUCB cultured on biodegradable human keratin-associated
38
protein scaffolds differentiated into more mature phenotypes connected by gap and tight
junctions (Jurga et al., 2009). Cells migrated away from aggregates and formed neural networks
that were capable of generating spontaneous electrical activity, indicating the presence of a
functional action potential.
Hepatogenic differentiation has also been shown in a number of studies. Treatment of
UCB with fibroblast growth factor (FGF) and hepatocyte growth factor (HGF) stimulated the
expression of hepatogenic markers alpha-fetoprotein and cytokeratin 18 (Kang et al., 2005; Tang
et al., 2006). These cells were capable of producing urea, storing glycogen, and LDL
endocytosis, functional measures of liver cells (Hong et al., 2005; Kang et al., 2005; Tang et al.,
2006). Additionally, to determine if these cells were capable of producing insulin in an in vivo
environment, xenograft transplantation was performed by Zhao et al. Human UCB were
transplanted into Balb/c nude mice with induced diabetes. Mice were then evaluated for their
ability to correct hyperglycemia. Mice receiving the UCB transplantation displayed significantly
lower blood glucose levels than the untransplanted controls (Zhao et al., 2006).
Adult Stem Cells
Bone Marrow Derived Mesenchymal Stem Cells
Isolation of bone marrow derived mesenchymal stem cells (or mesenchymal stromal cells;
BMSC) has been occurring in research and medical practice for a number of years. In vivo these
cells support the formation of hematopoietic cells. BMSC derived from humans, mice and
horses attach to culture plates and exhibit a fibroblast like morphology when cultured in vitro.
They represent a very small portion of the total cell population of the bone marrow; reported
numbers vary from 0.001-0.01% (Pittenger et al., 1999). BMSC are positive for cell surface
markers SH2, SH3, CD29, CD44, CD71, CD106, CD120a, and CD124 but negative for CD14,
CD34 and CD45 (Pittenger et al., 1999). Common differentiation protocols can be used to elicit
39
osteogenic, adipogenic and chondrogenic differentiation of BMSC. Adipogenic differentiation
resulted in the accumulation of lipid rich vacuoles, expression of PPARγ2, and lipoprotein lipase
(Pittenger et al., 1999; Meirelles Lda and Nardi, 2003; Tropel et al., 2004; Vidal et al., 2006).
Culture with TGFβ in a micromass resulted in initiation of the chondrogenic program and
expression of type II collagen, aggrecan, and the formation of a proteoglycan rich extracellular
matrix (Pittenger et al., 1999; Tropel et al., 2004). Furthermore, culture in osteogenic induction
medium resulted in rapid mineralization and nodule formation as well as runx2, type I collagen,
osteopontin, and osteonectin expression (Pittenger et al., 1999; Meirelles Lda and Nardi, 2003;
Tropel et al., 2004; Vidal et al., 2006). Mouse, rat, and human BMSC differentiated into
hepatocyte like cells in presence of HGF and/or FGF4, expressing markers HNF3B, Gata4,
HNF1a, albumin and CK18 by day 21. These cells produced urea and albumin at levels similar to
monolayer cultures of primary rat hepatocytes and were also capable of endocytosing LDL and
storing glycogen (Schwartz et al., 2002). Culture of hBMSC in enhanced DMEM further
supplemented with TGFβ resulted in the upregulation of smooth muscle actin and calponin
(Gong et al., 2008). TGFβ increased the expression of cardiac markers GATA-4, Nkx2.5,
troponin-T, troponin-I, and connexin43 in murine BMSC (Li et al., 2008). Cells exhibited
morphological but not functional differentiation – no spontaneous beating was observed.
Peripheral Blood Derived Progenitor Cells
In addition to cells derived from bone marrow, other sources of blood related stem cells
have been explored. Peripheral blood derived progenitor cells (PBPC) have been isolated from
human, swine, and equine with limited success. Reports range from 35-75% of collections that
give rise to an adherent cell population (Koerner et al., 2006; Giovannini et al., 2008). These
mononuclear cells exhibit fibroblast like morphology and proliferate rapidly (Chan et al., 2006;
Koerner et al., 2006; Porat et al., 2006; Giovannini et al., 2008). PBPC can give rise to a
40
number of differentiated or pre-cursor cell types. In permissive medium, human PBPC
underwent differentiation into neural precursor cells, evidenced by changes in morphology and
expression of nestin, β3 tubulin, and NeuN, a nuclear protein present in neurons (Porat et al.,
2006). These cells also underwent limited myogenic differentiation in vitro. PBPC cultured
with galectin 1 expressed desmin and subsequently formed multinucleated fibers over the
following week of culture (Chan et al., 2006). In vivo transplantation into an injury model (c-/y-
/RAG2- mouse) resulted in more muscle fibers expressing human spectrin in galectin 1
stimulated PBPCs than control PBPCs (</= 4%). Swine PBPC were capable of engrafting into
the rat striatum, where they migrated and maintained neurogenic morphology (Price et al., 2006).
Adipogenic, chondrogenic, and osteogenic conversions are also commonly completed with
PBPCs (Koerner et al., 2006; Price et al., 2006; Giovannini et al., 2008). Stem cells derived
from peripheral blood are easily obtained, but are more limited in plasticity and self-renewal than
other sources of adult stem cells.
Umbilical Cord Vein Derived Stem Cells
An alternative to umbilical cord blood, a population of stem cells has also been isolated
from the human, equine and porcine umbilical cord veins (UCV) (Kim et al., 2004; Kestendjieva
et al., 2008). The umbilicus itself is digested with collagenase; cells isolated from this procedure
form a confluent monolayer with cobblestone or spindle-shaped fibroblast like morphology
(Kestendjieva et al., 2008). These cells express oct4, sox2,and nanog as well as the cell surface
markers CD29, CD73, and CD90. However, they lacked expression of CD45, CD14, CD3,
CD19, CD16, CD34 and HLA-DR. UCV are capable of differentiation into adipogenic,
osteogenic, and endothelial cell types. Lipid droplets and Oil Red O staining were present in
UCV treated with adipogenic induction medium. Adipsin, lipoprotein lipase and PPARγ2 mRNA
are also expressed in treated cells (Kim et al., 2004; Kestendjieva et al., 2008). Osteogenic
41
differentiation is visualized by von Kossa staining of calcium deposits and osteopontin and
Runx2 expression (Kim et al., 2004; Kestendjieva et al., 2008).
Adipose Derived Stem Cells
A population of stem cells can be derived from adipose tissue by obtaining fat from
subcutaneous surgery. The tissue undergoes enzymatic digestion followed by filtration and
centrifugation. Adherence to plastic and subsequent expansion produces a relatively
homogenous population. Morphologically similar to bone marrow and umbilical cord blood
derived stem cells, adipose derived stem cells are spindle shaped. Adipose derived
mesenchymal stem cells (AdMSC) express similar cell surface markers to bone marrow derived
MSC, including CD13, CD44, CD73, CD90, CD105, CD106, CD166, CD29, CD49e, and HLA-
ABC (Gronthos et al., 2001; Katz et al., 2005; Wagner et al., 2005; Yanez et al., 2006). While
HLA-ABC surface markers are expressed on these cells, they lack expression of HLA-DR.
Additionally, AdMSC did not stimulate lymphocyte proliferation (Yanez et al., 2006). In fact,
AdMSC inhibited the proliferation of T cells stimulated with peripheral blood mononuclear cells.
When co-cultured in a transwell, soluble factors secreted by AdMSC exerted immunosuppressive
effects on responder T cells but only when AdMSC could interact with responder lymphocytes.
Furthermore, AdMSC infusion decreased the severity of graft v. host disease in mice when used
in the first two weeks.
Adipose derived stem cells have been induced to differentiate into osteogenic,
chondrogenic, adipogenic, cardiomyogenic and neurogenic cell types (Gronthos et al., 2001;
Katz et al., 2005; Wagner et al., 2005; Guilak et al., 2006; Oedayrajsingh-Varma et al., 2006;
Liu et al., 2007; Yoshimura et al., 2007; Zhu et al., 2008; Mehlhorn et al., 2009). Cells induced
to osteogenic differentiation express RunX2 and Col1a1 after 7 days of culture, with
mineralization after 3 weeks (Oedayrajsingh-Varma et al., 2006). Comparison of AdMSC and
42
BMSC indicates that AdMSC are less efficient at osteogenic differentiation, despite considerable
similarity in gene expression throughout the differentiation process (Liu et al., 2007).
Adipogenic differentiation was observed following treatment with insulin and IBMX (Gronthos
et al., 2001; Katz et al., 2005; Guilak et al., 2006; Liu et al., 2007). Cells formed lipid vacuoles
and secreted leptin. Culture in chondrogenic differentiation media containing TGFβ led to the
expression of proteoglycans and type II collagen (Guilak et al., 2006; Liu et al., 2007;
Yoshimura et al., 2007). Culture on a poly-lactide-co-glycolide scaffold in the presence of TGFβ
resulted in the expression of Col2a1 and a homogenous distribution of proteoglycans (Mehlhorn
et al., 2009). However, the AdMSC are again less efficient at chondrogenesis producing less
Col2a1, chondroitin sulfate, and hyaluronan (Yoshimura et al., 2007). Neural differentiation has
also been reported by several labs (Katz et al., 2005; Guilak et al., 2006). In instructive media,
AdMSC gain elongated cytoplasmic processes and express NeuN, GFAP, and β3-tubulin.
Injection of murine AdMSC into ischemia induced angiogenesis resulted in a greater degree of
perfusion in the implanted limbs (Kondo et al., 2009). Injection of mature adipocytes resulted in
weaker recovery of perfusion than saline injected controls. Additionally, AdMSC recruited
endothelial precursor cells and stimulated the secretion of SDF1 and VEGF in ischemic hind
limbs. Human AdMSC co-cultured with neonatal rat cardiomyocytes resulted in elongation of
AdMSC and formation of myotube-like structures (Zhu et al., 2008). After two weeks of co-
culture, AdMSC stained positively for myosin heavy chain, troponin-I and connexin 43. At this
time, the AdMSC and cardiomyocytes contracted synchronously. Rarely, binucleate AdMSC
were found in co-cultures.
Therapeutic Uses of Stem Cells
Stem cells have been widely accepted as a potential therapeutic aid in disease and injury
states in both humans and animals. Diseases ranging from metabolic inefficiencies to
43
musculoskeletal defects and neurological disorders could benefit from the use of a naïve cell type
which promotes repair or production of healthy tissue. The potential of stem cells lies in not only
their ability to contribute healthy, differentiated cells to the “unhealthy” region, but in the
production of beneficial growth promoting factors and recruitment of additional reparative cells.
The precise effects of stem cells in each disease state remain to be determined as do the
mechanisms by which they may help.
Spinal Cord Injuries
A number of stem cell populations have been used to treat spinal cord injuries in hope of
improving neural regeneration and recovery of locomotion. Embryonic stem cells differentiated
into neural precursors were transplanted into a spinal cord injury (SCI) model in the rat
(McDonald et al., 1999). Transplanted cells were found at the injury site and at distances up to 8
mm from the injury. Engrafted ES cells expressed markers of oligodendrocytes, neurons, and
astrocytes with no evidence of tumor formation. Rats receiving UCB transplants demonstrated
partial hind limb weight bearing and improved coordination compared to a complete lack thereof
in sham operated rats. Engraftment of fetal neural stem cells into immunodeficient mice after a
traumatic spinal cord injury showed locomotory recovery (Cummings et al., 2005). Cells had
migrated extensively from the injection site at 17 weeks post injury. Transplantation resulted in a
higher degree of locomotor recovery with greater coordinated forelimb-hind limb function after
16 weeks. Ablation of the stem cells after transplantation by diphtheria toxin resulted in similar
coordination to animals with no stem cell transplantation, indicating that the improvement is due
to the presence of these cells. Engrafted cells differentiated into neurons and oligodendrocytes.
Transplantation of neurospheres into a contusion model of SCI by Ogawa et al resulted in
engrafted cells differentiating into neurons, oligodendrocytes, and astrocytes (Ogawa et al.,
44
2002). Cells underwent mitotic neurogenesis. Additionally, some donor axons were myelinated
and formed pre-synaptic structures.
Infusion of UCB into a rat model of stroke ameliorated many of the physical and
behavioral deficits associated with the injury (Chen et al., 2001). hUCB engrafted into the brain
of rats that suffered a stroke with the majority of cells localized to the boundary of the ischemic
region. Engrafted cells were reactive with neuronal and astrocyte markers. Treatment within 24
hours of injury significantly improved functional recovery measured by the motor rotarod test
and neurological severity scores (NSS), however later treatment resulted only in improved NSS.
Transplantation of hUCB into either the femoral artery or the brain of induced stroke rats
resulted in higher levels of spontaneous activity compared to non-transplanted controls (Willing
et al., 2003). The recovery of motor asymmetry was shown to be dose dependent in animals
treated with varying numbers of UCB (Vendrame et al., 2004). Transplantation also decreased
the area of infarction, ischemic volume, and inflammatory cytokines TNF-α and IL-6 compared
to non-transplanted rats in a stroke model (Vendrame et al., 2004; Vendrame et al., 2005;
Vendrame et al., 2006). When hUCB were injected into rats via the saphenous vein 24 hours
after transient middle cerebral artery occlusion, an improvement in neurological severity scores
was apparent in transplanted rats by day 14 (Xiao et al., 2005). Transplanted rats showed
improvement in the stepping test measuring asymmetric movement. Smaller lesion sizes were
measured in transplanted animals, although very few cells engrafted into the brain. However,
implants of hUCB into the cortex resulted in neuronal outgrowth from the contralateral side and
improvement in NSS scores.
Vertebrae
In addition to examining the effect of stem cells on neurogenesis, stem cells have also been
used to aid the repair of the vertebrae surrounding the spinal cord which is also likely to be
45
injured in traumatic spinal cord injuries. Using a porous scaffold of βTCP, autologous bone
marrow derived MSC and autografts from the iliac crest fused the L4 and L5 vertebrae similarly
in the Cynomolgus monkey (Orii et al., 2005). However, bone formation assessed by micro
computed tomography showed greater new bone formation at 12 weeks in BMSC engrafted
vertebrae than those receiving autografts. Likewise, in an ovine model of vertebrae injury,
higher fusion was apparent in implants of BMSC on a βTCP scaffold than autografts (Gupta et
al., 2007). Newly formed woven and lamellar bone trabeculae in a cancellous organization with
evidence of remodeling was observed in BMSC/βTCP grafts. Formation of hematopoietic and
fatty marrow tissue was also apparent. Using a canine cancellous bone matrix transplanted with
BMSC, superior fusion volume and fusion area for mineralized and demineralized matrix was
observed over graft alone (Muschler et al., 2003). In a clinical trial, bone grafts saturated with
uncultured autologous BMSC were implanted into acute thoracolumbar fractures (Faundez et al.,
2006). The resorbable matrix was replaced with new bone containing several active foci of
membranous and/or endochondral ossification.
Cardiovascular Repair
In rabbits with surgical myocardial infarctions, hBMSC were injected into the border area
of myocardial ischemia (Wang et al., 2005a). Lower mortality was reported in the cell transplant
group compared to controls. Surviving patients had higher ejection fractions. Engrafted cells
differentiated into cardiac troponin I expressing cells. In a canine model of cardiovascular
disease, labeled canine BMSC were injected into a chronically infarcted myocardium due to a
permanently ligated coronary (Bartunek et al., 2007). Labeled cells expressed cardiac specific
myosin or troponin I by four and twelve weeks after injection. Newly differentiated
cardiomyocyte-like cells were observed within the fibrotic area of infarction. Transplanted
BMSC expressed connexin43, consistent with the integration into the host tissue. No
46
calcification or osteogenic formation was noted. Pre-differentiated BMSC injected into heart
resulted in increased shortening and regional wall thickening suggesting a higher degree of
functional recovery. Eight weeks after transplantation of hBMSC into rats with acute myocardial
infarcts, engrafted cells expressed connexin43 and cardiac troponin T (Chang et al., 2008b).
Functional aspects of the heart were improved, with reduced left ventricular end diastolic
diameter and end systolic dimension as well as improvement of fractional shortening. Comparing
hBMSC and hUCB in a mouse model of cryoinjury to the left ventricle, Ma et al determined that
the presence of both cell types increased capillary density (Ma et al., 2006). However, hUCB
had no effect on the shortening fraction while BMSC alleviated the decrease in contractility
caused by cryoinjury. Additionally, while both BMSC and UCB could be identified in the
myocardium, no neo-cardiomyocyte like cells were found.
Stem cells from umbilical cord blood have also been used as a therapeutic tool in the
treatment of cardiovascular diseases. hUCB implantation into Sprague-Dawley rats with acute
myocardial infarction present engrafted cells that express cardiac troponin T, von Willebrand
factor, and smooth muscle actin indicating that these cells contributed to cardiac, endothelial and
smooth muscle cell types (Wu et al., 2007b). Left ventricular ejection fraction was increased
within two weeks of transplantation. Rats transplanted with hUCB also demonstrated an
increase in arteriole vessels and capillary density. hUCB implantation into a hind limb model of
ischemia in nude mice resulted in marked improvement of perfusion as well as a time dependent
increase in blood flow following the injection of hUCB (Wu et al., 2007a). Genetically modified
hUCB were used by Chen et al to treat a murine model of acute myocardial infarction (Chen et
al., 2005). hUCB transfected with vascular endothelial growth factor (VEGF) or Angiopoietin1
were implanted into the damaged myocardium. Transplanted cells incorporated into the
47
myocardium and expressed VEGF or Ang1. Treatment with untransfected hUCB decreased the
infarct size, however cells expressing VEGF reduced infarct size further. Transplantation of cells
expressing VEGF or Ang1 also increased capillary density and improved fractional shortening
and ventricular ejection fraction.
Tendon and Ligament Injuries
Current treatments for tendon injury are inefficient at best, including immobilization or
surgery to reattach partially severed tendons. Re-injury is a common problem due to the
replacement of tendon tissue with scar tissue. These changes in the tendon’s capacity to store
energy and recoil affect the ability of the tendon to adapt and equally disperse the load,
potentially creating microdamage leading to re-injury. In some animals, bone marrow derived
stem cells (BMSC) have been used to treat tendon lesions with some success. Several reports
suggest improved results using BMSC injections compared to traditional treatment programs
(Smith et al., 2003; Crovace et al., 2007; Pacini et al., 2007; Guest et al., 2008). No negative
immune response was reported using autologous or allogeneic BMSC injections into core
superficial digital flexor tendon (SDFT) lesions (Smith et al., 2003; Guest et al., 2008). The
labeled cells integrated into tendon, assuming tenocyte-like morphology (Guest et al., 2008).
However, a low efficiency (0.001%) of engraftment was reported. Autologous BMSC
transplanted into collagenase induced SDFT lesions decreased the lesion size as a percent of total
tendon cross sectional area (Crovace et al., 2007). Racehorses with typical core SDFT lesions
receiving stem cells suffered no adverse reactions (Pacini et al., 2007). One month following
injection, greater tendon density was apparent in horses injected with BMSC compared to
uninjected control horses. Tendons appeared almost completely repaired after six months. All
returned to racing with no further reinjury more than two years after diagnosis. Control horses
showed fibrosis during the healing process and all were reinjured within twelve months after the
48
initial diagnosis. Autologous rat BMSC successfully engrafted into injured MCL (Watanabe et
al., 2002). These cells became spindle shaped with elongated nuclei and aligned with parallel
collagen bundles within 14 days of treatment. Biomechanical properties including stiffness,
maximum force, maximum stress, and modulus were all improved in tendons receiving a gel
sponge seeded with autologous BMSC (Juncosa-Melvin et al., 2006). In a patellar tendon defect,
BMSC seeded collagen composite implants strengthened tendons over natural repair (Awad et
al., 2003). However, 28% of these grafts showed formation of ectopic bone. Bone-free tendons
exhibited improved biomechanics, with increased maximum force, stiffness and strain energy
after 26 weeks of recovery. Values reported for cell seeded grafts were intermediate to naturally
repaired tissue and normal, healthy tissue indicating an improvement but not return to completely
native state. Twenty days after implantation of hBMSC into a patellar tendon defect in rats
treated tendons exhibited spindle shaped cells among collagen fibers aligned in parallel
(Hankemeier et al., 2007). The improvement in biomechanical properties was also reported by
Young et al, who implanted autologous BMSC into a gap defect model in the gastrocnemius
tendon of the rabbit (Young et al., 1998). Treated repairs were stiffer, withstood more force and
energy than control repairs but were still weaker than normal tissue. The area of the treated
repair declined at a significantly faster rate than control repairs.
An alternate source of autologous stem cells derived from adipose tissue (adipose derived
stem cells; ADSC) has recently become commercially available for use in the horse (VetStem,
CA). This putative population of cells has been used to treat tendon, ligament and joint injuries.
However, no data is available regarding the true identity of these cells or their capability for
differentiation into various types of tissue. A recent report indicates that use of adipose derived
mononuclear cell fractions for repair of collagenase induced lesions in the horse results in
49
improvements in overall tendon fiber architecture after six weeks of recovery (Nixon et al.,
2008). These cells may be more mature in nature than BMSC, as Kisiday et al report indicates
they are less efficient at chondrogenesis than BMSC, secreting and accumulating less
extracellular matrix (Kisiday et al., 2008).
Bone Injuries
Union at the host-implant interface was apparent by eight weeks in dogs implanted with
allogeneic BMSC on a hydroxyapatite-tricalcium phosphate scaffold (Arinzeh et al., 2003). A
callus was also present around the periphery of the implant and host bone at this time. Newly
formed bone and connective tissue were apparent; in some cases a marrow cavity was
reestablished. Similar results were obtained with autologous BMSC, however cell free matrices
formed little to no callus or new bone. No adverse host response to allogenic BMSC was
observed. On hydroxyapatite ceramic (HAC), culture expanded BMSC osteoprogenitor cells
were implanted into a critical sized defect in ewes and allowed to recover for sixty days (Kon et
al., 2000). Callus formation was observed between the bone and scaffold, regardless of the
presence of cells. Transplants including cells had more substantial callus formation and earlier
presence of bone than cell free transplants. In another study using sheep, Viateau et al
transplanted BMSC on coral constructs into a bone defect (Viateau et al., 2007). In ewes
implanted with scaffold only grafts, no union formed but some bone deposition was present.
Grafts with BMSC exhibited significant new bone formation and complete resorption of the
scaffold as early as one month after implant. Notably, the same amount of new bone formation
was present in the coral/BMSC grafts as autogenic corticocancellous grafts. In bone marrow
derived osteogenic progenitor cells cultured on a matrix consisting of demineralized bone and
cancellous chips and subsequently transplanted into a critical sized defect in the canine femur,
autografted and stem cell grafts resulted in 100% healing compared to 50% healing in graft only
50
transplants and 67% in bone marrow grafts (Brodke et al., 2006). Goats with tibial bone defects
that received autologous BMSC on a beta-tricalcium phosphate scaffold achieved full union by
32 weeks post surgery (Liu et al., 2008). At this point, the ceramic scaffold was almost
completely resorbed and the engrafted bone had reached similar biomechanical properties as a
normal tibia. Little callus was observed at 16 or 32 weeks in acellular grafts, which were not
resorbed and did not heal during the 32 week trial. hBMSC implanted into a rat femur defect on
hydroxyapatite/βTCP cubes exhibited more bone formation than grafts alone (Bruder et al.,
1998). By eight weeks, the BMSC seeded graft had significant bone formation within the pores
of the scaffold and were integrating into the ends of the host bone. Union was complete by
twelve weeks. New woven and lamellar bone were detected in close contact with the edges of the
defect and were directly contiguous. Defects corrected with cell seeded grafts exhibited
increased strength and stiffness in biomechanical testing compared to grafts alone. Pores of the
acellular grafts were primarily filled with fibrous tissue at twelve weeks. Following lunate
arthroplasty, autologous rabbit BMSC were seeded on a scaffold of hyaluronan and gelatin prior
to transplantation into the surgical defect (Huang et al., 2006). Removal of the entire lunate
resulted in carpal collapse. However, rabbits receiving the implant presented evidence of new
bone formation twelve weeks after surgery. Scaffold only implants showed no bone formation.
Repaired tissue contained intensely stained metachromatic matrix and islands of ossicles within
the lunate space. Endochondral ossification had occurred in central areas of the scaffold seeded
with BMSC by twelve weeks with chondrocytes being replaced by woven bone. In a clinical
trial, Marcacci et al report that patients injected with autologous BMSC into bone defects
resulting from trauma exhibit callus formation between the host bone and hydroxyapatite
cylinder implant after one to two months (Marcacci et al., 2007). Complete resorption occurred
51
five to seven months after surgery; this integration was maintained in three patients six to seven
years after surgery (the longest follow-up available).
Cartilage Injuries
Swine BMSC labeled with green fluorescent protein were seeded on polyglycolic acid
fibers (PGA) and polylactic acid (PLA) scaffolds prior to implantation into an osteochondral
defect in the femur trochlea of both knees (Zhou et al., 2006). Transplantation of scaffolds with
cells predifferentiated to cartilage resulted in relatively regular surfaces and newly formed
cartilage like tissue after three months. Non-induced BMSC on scaffolds had inferior results,
with irregular surfaces and visible tissue deficits with defects filled mostly with fibrotic tissue.
Six months post surgery, nearly normal osteochondral tissue and relatively smooth articular
surfaces were apparent in induced BMSC seeded grafts with strong metachromatic matrix
production. Green fluorescent protein positive cells remained present in the graft site up to seven
months post operation. Mrugala et al transplanted ovine BMSC with chitosan in fibrin glue in the
absence or presence of TGFβ into a partial thickness defect in the cartilaginous tissue of the
patella (Mrugala et al., 2008). BMSC implanted in the absence of chitosan (fibrin glue only)
formed poorly integrated tissue with no glycosaminoglycan, proteoglycan, or type II collagen
expression. However, when chitosan was included, tissue resembling cartilage with lacunae and
associated cells was observed but integration remained poor. The combination of chitosan,
BMSC and TGFβ resulted in the best repaired tissue in terms of integration with host cartilage,
presence of chondrocyte-like cells surrounded by a matrix that stained positive for Safranin O,
type II collagen, and aggrecan. However, some fibrous tissue remained and overlapped the
neocartilage in some areas. Autologous uncultured rabbit BMSC transplanted into a full
thickness cartilage defect on a fibrin gel carrier resulted in the regeneration of cartilage that
stained intensely with Safranin O but remained inferior to normal cartilage (Chang et al., 2008a).
52
Implants containing gel alone had much less area of regeneration coupled with the presence of
fibrous tissue and less intense staining of extracellular matrix for Safranin O. BMSC injected
directly into a full thickness defect of the articular cartilage of the left distal femur in 16 New
Zealand white rabbits showed smooth, consistent white tissue resembling articular cartilage in
the regenerating area (Im et al., 2001). In contrast, control animals exhibited red, irregular
tissue with the margin of the defect sharply differentiated from the surrounding normal cartilage.
Defects in the group receiving BMSC had relatively normal surfaces with adjacent normal
cartilage showing little degenerative change. Control animals showed degenerative changes in
adjacent cartilage, thin and undifferentiated defects, and decreased cellularity. Collagen matrices
containing type I, type II and type III collagen seeded with ovine BMSC were used to fill
surgical defects in the medial condyle of the femur (Dorotka et al., 2005). Defects treated with
cell seeded matrices appeared more filled than control defects and had the largest quantity of
hyaline cartilage. Autologous BMSC were implanted into full thickness cartilage lesions in the
femoropatellar articulation in mature horses (Wilke et al., 2007). After thirty days, defects
repaired with BMSC appeared more completely filled with more homogenous tissue.
Arthroscopic scores were significantly higher in the BMSC seeded defects. No consistent
differences between control and cell seeded scaffolds could be determined eight months after
surgery. The authors concluded that early repair was improved by the presence of BMSC but no
long term benefits were apparent. Yan and Yu compared the effects of chondrocytes, BMSC,
fibroblasts and hUCB seeded on a polylactic acid scaffold on a full thickness cartilage defect in
rabbits (Yan and Yu, 2007). While no apparent visible difference in the defects were found after
twelve weeks, the fibroblast and control scaffolds were filled with non-cartilaginous tissue while
hUCB and BMSC seeded scaffolds housed tissue indistinguishable from host hyaline cartilage.
53
Areas of union between the host and graft were indiscernible in defects implanted with hUCB
seeded PLA scaffolds. However, the junction between the repaired tissue and subchondral bone
was irregular in grafts seeded with BMSC. Fibroblast seeded scaffolds exhibited irregular
borders with some degeneration of surrounding cartilage. Poly-lactide-co-glycolide scaffolds
seeded with human adipose derived stem cells supplemented with TGFβ were implanted
subcutaneously into scid mice (Mehlhorn et al., 2009). After eight weeks, histological
examination demonstrated the presence of proteoglycans throughout the implant. Cells were
round in shape and distributed homogenously throughout the scaffold. The presence of type II
collagen was determined by immunohistochemistry, however some implants also expressed type
I collagen. Fewer explants seeded with TGFβ treated AdMSC expressed type I collagen than
control implants. In a clinical study, autologous BMSC were injected into patella-femoral
lesions (Wakitani et al., 2007). A cartilaginous matrix formed at the site of injection. Patients
reported clinical improvement in lessening pain and range of motion with no adverse reactions.
Muscular Dystrophies
The use of stem cells in muscle disease generally involves muscular dystrophies. When
human UCB were transplanted into the sjl mouse, a model of limb girdle muscular dystrophies,
the cells engrafted into host muscle (Kong et al., 2004). A small number of fibers were capable
of expressing dysferlin, the missing protein, twelve weeks after transplantation. Additionally,
when injected into the adductor muscle of an ischemic mouse limb, human UCB engrafted into
the injured muscle (Pesce et al., 2003). Some donor cells expressed desmin, a marker of
myogenic differentiation. Transplantation increased the number of regenerating controls at an
earlier time point, suggesting that the presence of UCB initiated an earlier healing process.
Transplantation of human circulating AC133+ cells into scid/mdx mouse tibialis anterior resulted
in cells engrafting into the regenerating muscle (Torrente et al., 2004). Some cells took up
54
residence in the satellite cell position while others produced human dystrophin and myosin heavy
chain. Additionally, muscle injected with ACC133+ cells possessed fewer regenerating fibers
with less central nuclei than controls. Human fetal BMSC were transplanted intraperitoneally
into mdx murine fetuses (Chan et al., 2007). Engraftment of human cells was apparent in a
number of tissues including the brain, lung, liver and spleen. Skeletal, diaphragmatic and cardiac
muscle expressed human specific myosin heavy chain transcripts. Human nuclei were present in
regenerating muscle of transplanted animals and some human dystrophin was expressed.
Conclusion
The scientific community has access to a widely varied population of stem cells with
which to investigate the biology and potential application of the stem cell. Undoubtedly, certain
cell types are more suited for use in different situations. ES cells likely recapitulate early
embryonic development; while adult bone marrow derived cells are more suited for the study of
hematopoiesis in the adult animal. Investigations focus not only the stem cells themselves, but
the environment in which they exist in the organism. The effects of the stem cell niche on not
only the stem cell but the surrounding cells and tissues provide a huge area of potential research
for therapeutic application.
55
CHAPTER 2 CENTRAL HYPOTHESIS
Stem cells exist in a wide array of plasticity and self-renewing abilities. From embryonic
stem cells which can divide indefinitely and recapitulate the entire organism to adult stem cells
which are limited to a few cell divisions and differentiation into a small number of cell types,
each stem cell has its niche both in the life of the animal and in the world of therapeutic
medicine. Umbilical cord blood is a widely available, often discarded source of stem cells. This
population of stem cells has the potential to be an intermediate population between the naïve
embryonic stem cell and the less plastic adult stem cell. Owing to its immature source, umbilical
cord blood derived stem cells may be a more malleable population of stem cells with less of the
inherent risk of tumor formation found in embryonic stem cells.
Using the horse as a model animal, we sought to identify stem cells from umbilical cord
blood that may be useful in treating tendon injuries. Horses provide a large animal model that is
easily accessible, easy to work with, and provides large volumes of umbilical cord blood at birth.
Most foalings are attended by farm hands who can collect the blood with minimal training.
Moreover, large animal models may be more appropriate to evaluate possible human therapies
owing to greater similarities in anatomy and physiology than available in rodent models.
Our hypothesis is that equine umbilical cord blood contains a population of stem cells that
can be isolated, cultured, and differentiated into a variety of cell types. Specifically, the ability
of these cells to differentiate into an early tendon precursor cell was examined. The following
objectives were designed to test the hypothesis:
56
Aim 1: Stem cells can be isolated from equine umbilical cord blood and cultured using methods
currently used in human medicine and research. Equine UCB stem cells express markers and
morphology similar to other mesenchymal stem cells.
Aim 2: Equine UCB have the potential to contribute to tendon injury and repair. Stem cells were
examined for expression of early tenocytes. Tenocytic differentiation was promoted by culture
on a variety of protein matrices and in growth factor containing media.
57
CHAPTER 3 EQUINE UMBILICAL CORD BLOOD CONTAINS A POPULATION OF STEM CELLS
THAT EXPRESS OCT4 AND DIFFERENTIATE INTO MESODERMAL AND ENDODERMAL CELL TYPES
Introduction
Bone marrow (BM) derived mesenchymal stem cells (MSCs) are the conventional model
of choice for adult stem cell based therapeutics in humans due to their multi-lineage
differentiation capabilities. Their relative ease of expansion in vitro without loss of plasticity
makes MSCs an attractive repair aid for damaged or diseased heart, bone and vascular tissues
[for review see (Giordano et al., 2007)]. However, enthusiasm for the use of MSCs as
cytotherapeutics is tempered by their age-dependent decline in absolute numbers and the
invasive nature of their harvest (Stenderup et al., 2003). To counter these problems, umbilical
cord blood (UCB) MSCs may represent a viable alternative. Several reports define a clonogenic
population of cells from the umbilicus that differentiate into both mesenchymal and non-
mesenchymal tissue derivatives (McGuckin et al., 2003; Aoki et al., 2004; Baal et al., 2004;
Bonanno et al., 2004; Peled et al., 2004; Ruzicka et al., 2004; He et al., 2005; Holm et al., 2006;
Martin-Rendon et al., 2007; Guest et al., 2008). The identity of these cells as circulating stem-
like progenitors versus endothelial progenitors detached from the umbilicus remains debatable
(Kogler et al., 2004).
A hierarchy in stem cell plasticity exists such that embryonic stem (ES) cells are
pluripotent and adult MSCs are more limited in their differentiation capacity (Feinberg, 2007).
UCB stem cells likely fall in the area between the two. The three classes of stem cells
demonstrate variable stage specific embryonic antigen (SSEA) and tumor rejection antigen (Tra)
surface marker protein expression patterns, as well as differences in transcriptional circuitry.
SSEA-3 and SSEA-4 are prevalent on the surface of human ES cells; these undifferentiated cells
58
do not express SSEA-1 (Thomson et al., 1998; Reubinoff et al., 2000; Henderson et al., 2002).
By contrast, mouse blastocyst inner cell mass cells and ES cells express SSEA-1 but not SSEA-3
or SSEA-4 (Henderson et al., 2002; Tielens et al., 2006). The keratan sulfate proteoglycan
markers, Tra1-60 and Tra1-81, are localized within the extracellular matrix of human ES cells
(Henderson et al., 2002; Stojkovic et al., 2004). Key to the establishment and maintenance of the
undifferentiated state of ES cells are the coordinated activities of Oct4, nanog, and Sox2 (Boyer
et al., 2005). This combination of surface markers and plasticity genes represent the minimal
defining components of a naïve ES cell. By comparison, human BM derived MSCs are more
limited in their expression of the central ES indicators likely owing to the heterogeneity of the
population. SSEA4 is present on the surface of BM-MSC; the cells lack Oct4 but can be induced
to form multiple lineages (Gang et al., 2007). Culture of BM-MSC in FGF2 supplemented media
results in Oct4 and nanog transcription suggesting that a premature phenotype reminiscent of ES
cells can be established (Battula et al., 2007). UCB stem cells are unique in that they possess an
intermediate phenotype that more closely resembles ES cells. SSEA-3, SSEA-4, Tra1-60, Tra1-
81, Oct4, and Nanog are present in this population (McGuckin et al., 2003; Zhao et al., 2006;
Markov et al., 2007; Sun et al., 2007).
BM-MSC isolated from adult horses differentiate along the chondrogenic and osteogenic
lineages comparable to their human counterparts (Fortier et al., 1998; Worster et al., 2001;
Koerner et al., 2006). However, a reduced level of success exists for the formation of adipocytes
from BM aspirates (Koerner et al., 2006; Vidal et al., 2006). Because human UCB stem cells
exhibit a heightened degree of plasticity, we chose to identify a comparable cell entity in
newborn foal cord blood as an alternative to BM-MSC. Using conventional human purification
methods, culture conditions and differentiation protocols, an equine UCB cell population was
59
discovered that possesses stem cell-like markers and multilineage differentiation capabilities.
The isolation and characterization of these cells represent a first-step toward their application in
cytotherapeutic repair of sport horse injuries.
Materials and Methods
Umbilical Cord Blood (UCB) Collection and Stem Cell Isolation
Cord blood (n = 25) was collected from the intact umbilicus at foaling into a sterile 50 ml
centrifuge tube containing ethylenediamine tetraacetic acid (EDTA) as an anti-coagulant. Blood
was stored at 4°C and further processed within 12 h of collection. Samples were incubated for 20
min with RosetteSep Human Cord Blood Progenitor Enrichment Cocktail (50 µl/ml blood; Stem
Cell Technologies, Seattle, WA), a commercially available product for negative selection of
human UCB stem cells. An equal volume of phosphate-buffered saline (PBS) containing 2%
fetal bovine serum (FBS, Invitrogen, Carlsbad, CA) was added. The cell suspension was layered
atop a Ficoll-Paque Plus (Stem Cell Technologies) cushion and centrifuged at 1,200g for 20 min.
The cell interface was collected and cultured.
Equine UCB and Adipose-Derived (AD) Stem Cell Culture
MSCs isolated from equine adipose tissue were purchased from Sciencell Research
Laboratories (San Diego, CA). Cells were cultured in Mesenchymal Stem Cell Medium
(Sciencell Research Laboratories) on standard tissue plasticware, according to manufacturer's
recommendations. UCB stem cells were cultured in Dulbecco's modified Eagle media (DMEM,
Invitrogen) supplemented with 10% FBS and 5 µg/ml Plasmocin (Invitrogen). Culture medium
was exchanged every three days. Cells were passaged at 70% confluency using 0.025% trypsin-
EDTA (Invitrogen).
60
RNA Isolation, Reverse Transcription (RT), and Polymerase Chain Reaction (PCR)
Total RNA was isolated by lysis in STAT60 (Iso-Tex Diagnostics, Friendswood, TX) and
ethanol precipitation. The RNA was digested with DNase (Ambion, Austin, TX) to remove
genomic DNA contaminants. One microgram of total RNA was reverse transcribed (Superscript
III, Invitrogen) in 20 µl reaction volume. Two microliters of first strand cDNA was amplified
with gene-specific primers and AccuPrime DNA polymerase (Invitrogen). Primer sequences
included glyceraldehyde 3-phosphate dehydrogenase (F-
GATTCCACCCATGGCAAGTTCCATGGCAC, R-
GCATCGAAGGTGGAAGAGTGGGTGTCACT), collagen 2a1 (F-
CAGCTATGGAGATGACAACCTGGC, R-CGTGCAGCCATCCTTCAGGACAG), Sox9 (F-
GCTCCCAGCCCCACCATGTCCG, R-CGCCTGCGCCCACACCATGAAG), osteonectin (F-
CCCATCAATGGGGTGCTGGTCC, R-GTGAAAAAGATGCACGAGAATGAG), Runx2 (F-
CGTGCTGCCATTCGAGGTGGTGG, R-CCTCAGAACTGGGCCCTTTTTCAG), albumin (F-
AACTCTTCGTGCAACCTACGGTGA, R-AATTTCTGGCTCAGGCGAGCTACT) and
cytokeratin18 (F-GGATGCCCCCAAATCTCAGGACC, R-
GGGCCAGCTCAGACTCCAGGTGC). PCR products were visualized following
electrophoresis through 2% agarose gels containing ethidium bromide. Representative images
were captured with a Kodak ImageDoc system and inverted in Adobe Photoshop CS.
Osteogenic Differentiation
Cells were plated at a density 1,300 cells/cm2 and allowed to attach overnight in normal
growth medium. The following day, cells were washed twice with PBS and placed in an
osteogenic differentiation medium composed of alpha modified Eagle medium ( -MEM), 10
mM -glycerophosphate, 0.1 µM dexamethasone, 0.1 mM ascorbic acid (Tondreau et al., 2005;
Wagner et al., 2005). Media was changed twice weekly. Cells were fixed in 4%
61
paraformaldehyde in PBS for 15 min on days 7, 14, and 21. Total RNA was isolated from
parallel plates.
Chondrogenic Differentiation
UCB stem cells were pelleted to a micromass, promoting chondrogenic differentiation in a
three-dimensional environment. Cells (4 × 105) were pelleted at 1,000g for 5 min. The medium
was removed and 0.5 ml chondrogenic medium was added (Worster et al., 2000; Tondreau et al.,
2005). Chondrogenic medium consisted of DMEM, 1.0 g/L insulin, 0.55 g/L transferrin, 0.67
mg/L sodium selenite (ITS-X, Invitrogen), 10 ng/ml transforming growth factor beta-1 (TGF 1,
R&D Systems, Minneapolis, MN), 35 µg/ml ascorbic acid and 100 nM dexamethasone (Sigma,
St. Louis, MO). Media was changed twice weekly. After 7, 14, and 21 days, the micromass was
embedded and frozen in OCT freezing compound. Alternately, micromasses were washed with
PBS and used for RNA isolation.
Adipogenic Differentiation
UCB stem cells were plated at a density of 3,000 cells/cm2 in growth medium. Adipogenic
differentiation was induced with Iscove's modified Dulbecco's media (IMDM) supplemented
with 10% FBS, 1 µM dexamethasone, 10 µg/ml recombinant human insulin, 0.25 mM 3-
isobutyl-1-methylxanthine (IBMX) and 100 µM indomethacin (Wagner et al., 2005). Medium
was replaced every three days. Cells were fixed with 4% paraformaldehyde in PBS after 7, 14,
and 21 days in culture.
Hepatogenic Differentiation
UCB stem cells were plated at a density of 5,000 cells/cm2 and allowed to attach overnight
in normal growth medium. The following day, cells were washed twice with PBS and placed in
hepatogenic medium [1% FBS, 20 ng/ml recombinant human hepatocyte growth factor (HGF,
R&D Systems), 10 ng/ml recombinant human fibroblast growth factor 4 (FGF4, R&D Systems)
62
in IMDM], as described (Kang et al., 2005). Medium was replaced twice weekly. On days 7 and
14 cells were fixed in 4% paraformaldehyde in PBS for 15 min. Total RNA was isolated from
parallel plates.
Myogenic Differentiation
UCB stem cells were plated at 3,000 cell/cm2 on gelatin-coated tissue cultureware.
Differentiation was initiated by incubation in low glucose DMEM supplemented with 200 µg/ml
galectin-1 (R&D Systems) essentially as described (Chan et al., 2006). After 14 days, cells were
fixed with 4% paraformaldehyde or lysed for RNA isolation.
Histology
Alkaline phosphatase enzymatic activity was detected colorimetrically using Nitro-Blue
Tetrazolium Chloride (NBT) and 5-Bromo-4-Chloro-3'-Indolyphosphate p-Toluidine (BCIP;
Pierce, Rockford, IL) following fixation with 4% paraformaldehyde. Oil Red O (0.1% in 60%
isopropanol) was used to visualize lipid droplets. Alcian Blue (1% in 3% acetic acid) staining
was used to detect glycosaminoglycans. Safranin O (0.1% in water) was used for the
visualization of proteoglycans and cartilage. Alizarin Red (2% in water, pH 4.2) was used for the
detection of mineral deposits. Calcium deposits were detected by the method of von Kossa using
1% silver nitrate and 5% sodium thiosulfate.
Immunocytochemistry
Cells were fixed in 4% paraformaldehyde for 10 min at room temperature and
permeabilized with 0.1% Triton X-100 in PBS. Non-specific antigen sites were blocked with 5%
horse serum. For the detection of stem cell markers, anti-Oct4 (1:50, Santa Cruz, Santa Cruz,
CA), anti-SSEA-1, anti-SSEA-3, anti-SSEA-4 (1:50, R&D Systems), anti-Tra1-60 (1:50,
Abcam, Cambridge, MA) and anti-Tra1-81 (1:50, Abcam) were used. Myogenic cells were
incubated with anti-desmin (1:200, DE-U-10, Sigma Aldrich, St. Louis, MO) and Texas Red
63
conjugated Phalloidin (Invitrogen). All antibodies were diluted in PBS containing 1% horse
serum and incubated with fixed cells for 1 h at room temperature. Immune complexes were
visualized with goat anti-mouse AlexaFluor488 (1:200), goat anti-rabbit AlexaFluor488 (1:200),
or goat anti-rabbit AlexaFluor568 (1:200) on a Nikon T200 microscope equipped with
epifluorescence. Images were captured with NIS Elements (Nikon Instruments, Melville, NY)
software and compiled with Adobe PhotoShop CS.
Results
Foal Umbilical Cord Blood Contains an Oct4-Expressing Cell Population
Multipotent stem cells are routinely isolated from fresh cord blood at birth from humans by
density gradient centrifugation. Initial Ficoll gradient separation of equine UCBs yielded a
heterogeneous population with poor recovery of adherent cells. As such, a negative selection
procedure (RosetteSep) was employed with the potential to remove extraneous natural killer
cells, macrophages, lymphocytes, and B-cells. Significantly fewer cells were present in the buffy
coat following centrifugation through Ficoll that attached readily to plastic cultureware. To
ascertain their identity, cells were fixed and evaluated by immunocytochemistry for the stem cell
markers, SSEA-1, Oct4, Tra1-60 and Tra1-81. Results demonstrated the presence of Oct4 in the
nuclei of greater than 90% of the cells (Figure 3-1). A similar percentage of the cells contained
Tra1-60 and Tra1-81, as well as SSEA-1. In data not shown, alkaline phosphatase enzymatic
activity was readily detected and minor amounts of SSEA-4 were noted by
immunocytochemistry. Thus, newborn foal cord blood contains a cell population that can be
isolated with conventional human reagents and protocols and that express characteristic ES cell
marker proteins.
64
UCB Stem Cells Form Chondrocytes
The plasticity of UCB stem cells was evaluated by differentiation into cartilage precursors.
Adherent stem cells were pelleted and cultured as a micromass in a defined media supplemented
with ascorbic acid, dexamethasone and TGF- 1. At the end of 3 weeks in chondrogenic media,
the cell pellet was cryopreserved or lysed for RNA isolation. Alcian blue histology revealed the
presence of proteoglycans, a matrix component of mature chondrocytes (Figure 3-2A). The
extracellular constituents of the micromass were rich in glycosaminoglycans, as indicated by
Safranin staining. Sox9 is a transcription factor that positively regulates the expression of
collagen and extracellular matrix genes in chondrocytes (Ng et al., 1997; Bi et al., 1999;
Lefebvre et al., 2001). Expression levels of Sox9 and collagen 2a1 were evaluated by RT-PCR
after 7 and 21 days in chondrogenic differentiation media. Gene transcripts for Sox9 are evident
after 7 days but absent by 21 days in differentiation permissive media (Figure 3-2B). Abundant
amounts of collagen 2a1 mRNA was evident at both time frames. These results demonstrate
temporal and specific activation of the chondrogenic gene program.
Differentiation of UCB Stem Cells into Osteocytes
Young thoroughbred racehorses are prone to debilitating bone fractures whose repair may
be aided by stem cell-based therapeutics. Therefore, UCB stem cells were cultured on
plasticware in a defined media capable of inducing osteocytes from human UCB stem cells
(Tondreau et al., 2005). After 3 weeks, cells were fixed with paraformaldehyde or harvested for
RNA isolation. Alizarin Red histology indicated that the putative bone cells were capable of
calcium deposition (Figure 3-3A). In a similar manner, Von Kossa staining detected calcium
aggregates. RT-PCR confirmed the osteogenic program in these cells. Primers specific for
osteonectin and Runx2 amplified products of the correct size (Figure 3-3B). These results
65
demonstrate that UCB stem cells are a source of osteocytes under appropriate in vitro cultivation
conditions.
Foal UCB Stem Cells can Differentiate into Endodermal-Derived Cell Types
A key feature of ES cells is their potential to contribute to any tissue type in the body.
Adult stem cells possess a more limited plasticity than their embryonic counterparts. The ability
of foal UCB stem cells to differentiate into hepatocytes, a cell type that originates from the
endoderm, was examined. In brief, UCB stem cells were cultured for 2 weeks in media that
supports hepatocyte formation in human UCB stem cells (Kang et al., 2005). Subsequently, cells
were fixed with paraformaldehyde or lysed for RNA isolation. As shown in Figure 3-4A, a
change from an elongated, spindle-shaped morphology to one exhibiting a larger cytoplasmic
volume with an elliptical shape occurs in response to the treatment media. These cells express
mRNA for both albumin and cytokeratin 18, definitive markers of hepatocytes (Figure 3-4B).
Equine UCBs maintained in the absence of induction media failed to express the liver marker
genes (data not shown). The ability to respond in a manner similar to ES cells and form
hepatocytes suggests that our UCB cell population may be more plastic than other adult MSC.
Inefficient Formation of Myocytes and Adipocytes by UCB Cells
Koerner et al. (Koerner et al., 2006) reported limited formation of adipocytes from adult
horse BM-derived MSCs. Thus, we compared the adipogenic differentiation capabilities of foal
UCB stem cells and adult horse adipocyte-derived MSCs (AdMSC). In brief, both cell types
were incubated for 21 days in adipocyte induction media. Cells were fixed and evaluated by Oil
Red O histology for the presence of lipid droplets. In our hands, neither UCB nor AdMSC
efficiently formed adipocytes. Sporadic fat cells containing limited amounts of lipid droplets
were evident in foal UCB cell cultures; no Oil Red O positive cells were found in the AD-MSCs.
This restricted differentiation profile by the two forms of stem cell was further exemplified
66
following their incubation in myocyte induction media. UCB stem cells and AD-MSCs were
incubated for 7 days in media supplemented with galectin-1, a glycoprotein that promotes
myogenesis in human fetal MSCs (Chan et al., 2006). Subsequently, cells were fixed and
immunostained for the skeletal muscle marker protein, desmin. UCB stem cell cultures contained
several multinucleated, spindle-shaped cells that are reminiscent of myocytes. Anti-desmin
immunofluorescent detection reveals that these structures express the intermediate filament
protein (Figure 3-5B). No desmin expressing muscle cells were present in the AD-MCSs treated
in a similar manner (data not shown). The presence of organized actin filaments was examined
using Texas Red conjugated phalloidin. Equine UCB-derived myoblasts contained organized
actin structures throughout their cytoplasm (Figure 3-5C). By contrast, AdMSC cells contained
fewer phalloidin-reactive filaments. The cytoskeletal structures pointed to distinct differences in
overall cellular morphology between the differentiated AdMSC and UCB myoblasts. UCB
myoblasts were thin, elongated and cylindrical in shape whereas the AdMSC cells were
fibroblast-like with an enlarged cytoplasmic space. Our results demonstrate differences between
the two types of stem cells and suggest that foal UCB cells are more plastic than adult horse
MSCs.
AdMSC do not Express the Same Complement of Stem Cell Markers
The inability of AdMSC to form adipocytes was surprising given that they originate from
the fat depot. To ensure that the cells were naïve and undifferentiated, subconfluent cultures of
AdMSC were immunostained for stem cell markers. Similar to UCB stem cells, AD-MSCs
express Oct4, Tra1-60 and Tra1-81 (Figure 3-6). However, SSEA-1 and SSEA-4 were
undetectable. These results indicate that AdMSC retain markers of adult stem cells but do not
express those more closely associated with ES cells.
67
Discussion
There is widespread interest in tendon, ligament and cartilage repair in horses through the
use of directed stem cell transplantation methods. To date, published reports of multipotent cells
isolated from BM, peripheral blood, and UCB exist (Fortier et al., 1998; Saito et al., 2002;
Koerner et al., 2006; Li et al., 2006). Cells from each of these sources display limited
differentiation into mesodermal cell types with predominant induction of chondrogenic and
osteogenic precursors. Beyond these two cell types, vast differences in differentiation
efficiencies and alternate cellular identities exist. The disparities may be attributed to tissue
source or suboptimal culture conditions; both possibilities necessitate further study.
Alternatively, the transcriptional regulators that govern pluripotency may be absent or inactive
thereby, limiting plasticity. Key to the ES cell-like nature is expression of Oct4, Sox2, nanog, c-
myc, and Klf4 (Takahashi and Yamanaka, 2006). Foal UCB stem cells maintained in a growth
factor rich medium expressed Oct4, SSEA-1, Tra1-60 and Tra1-81, all stem cell marker proteins.
However, repeated attempts to detect nanog and Sox2 mRNA were unsuccessful. The absence of
these transcription factors may contribute to the restricted types of cells generated and their
incomplete differentiation (myoblasts). Interestingly, the ability of UCB stem cells to express
these embryonic markers sets them apart from adult MSCs. Surface expression of SSEA-1 and
SSEA-4 were not evident in equine AD-MSCs. The lack of SSEA markers points to a hierarchy
in plasticity that may account for some of the differences in differentiation capabilities. Efforts to
define culture media that support nanog, Sox2, and Klf4 expression may lead to an increased
range of differentiated lineages from UCB stem cells.
Stem cells isolated from the umbilical cord matrix of pigs develop a morphology that
resembles that reported by others for equine UCB stem cells (Carlin et al., 2006; Koch et al.,
2007). In both examples, the majority of the cells attached to the cultureware surface and
68
possessed a flat, spindle-shaped, fibroblast-like morphology. A lesser population formed light-
refractile colonies that grew upward from the substratum surface in a manner consistent with
transformed fibroblast foci. These colonies of small cells with a high nuclear to cytoplasmic
volume were evident in our cultures of newborn foal UCB stem cells only after reaching
confluency. Our UCB stem cells were maintained as a monolayer and passaged at approximately
60% confluency thereby, selecting against the development of these cell clusters that appear to
grow independent of contact inhibition. While the identity of this cell population remains less
clear, it is possible that these colonies represent a more primitive progenitor cell. Indeed, these
cell clusters resemble those found in cultures of mouse ES cells. As such, one would predict that
confluent equine UCB cultures that contain both the fibroblast-like and light-refractile cell
colonies would express the plasticity genes, nanog and Sox2. However, expression of SSEA-1,
Tra1-60, Tra1-81 and alkaline phosphatase, in a manner consistent with equine inner cell mass-
derived ES cells, provides encouraging evidence that our monolayer cells are naive and
undifferentiated (Takahashi and Yamanaka, 2006).
Equine UCB stem cells, in our hands, are not direct equivalents to human UCB stem cells
but do possess many similarities. Human UCB stem cells can be isolated directly from the blood
and frozen without expansion (Lee et al., 2005). This aspect of enrichment and storage remains
elusive in our equine UCB cells. Partial purification by negative immunoselection and density
gradient centrifugation produces a cell population that survives immediate cryopreservation very
poorly. This may be due to the small numbers of stem cells and/or heightened sensitivity of these
cells to plasma membrane perturbation. Culture of the fresh isolates for 3-5 days allows for the
removal of contaminating lymphocytes and cellular debris and expansion of the putative stem
cell population, which can be stored in liquid nitrogen and subsequently recovered. Direct
69
enrichment of the UCB stem cell population by affinity purification with CD133 antibodies may
provide an alternative to both cell heterogeneity and cryopreservation issues.
The capacity of foal UCB stem cells to initiate hepatocyte-specific gene transcription
demonstrates an endodermal developmental potential. Reports exist demonstrating hepatocyte
formation from human UCB stem cells and MSC isolates from BM (Hong et al., 2005; Talens-
Visconti et al., 2006). However, this is the first report of hepatocyte formation using equine
multipotential cells. Putative stem cells from the inner cell mass of equine blastocysts undergo
spontaneous differentiation in vitro to yield cell derivatives of the three germ layers with
endoderm defined by RT-PCR detection of -fetoprotein (Li et al., 2006). The ability of
newborn foal UCB stem cells to form liver cells is encouraging as it provides additional evidence
for a population with plasticity characteristics that more closely resemble an ES cell than an
adult stem cell. Additional endoderm-derived cell types of clinical importance include pancreatic
and cardiogenic. Human UCB stem cells can be induced to form heart cells following a two-step
differentiation protocol that involves 5-azacytidine treatment (Kadivar et al., 2006). Culture with
the hypomethylating agent suggests that UCB stem cells are more restricted in their
differentiation capabilities than ES cells and require chemical-induced reprogramming. In our
hands, treatment of foal UCB stem cells with 5-azacytidine did not induce the expression of
myosin immunopositive cells. Because our antibody (MF20) recognizes all forms of sarcomeric
myosin, this result provides indirect evidence that a full-fledged cardiocyte is not created in
response to epigenetic modification. However, a more comprehensive analysis of growth factor,
morphogen and substratum requirements for UCB stem cell differentiation into cardiocytes is
warranted.
70
Induction of the myogenic gene program has proven difficult in MSC originating from
multiple animal and tissue sources. Exposure of rat BM-derived MSCs to 5-azacytidine caused
differentiation into elongated, multinucleated myofibers (Wakitani et al., 1995). However,
reprogramming the equine UCB transcriptome with this chemical did not induce the myogenic
gene program (data not shown). A similar result was noted by others (Chan et al., 2006). Others
reported that human UCB stem cells formed limited numbers of desmin immunopositive cells
following in vitro differentiation (Nunes et al., 2007). These cells were devoid of the myogenic
regulatory factors (MRFs) as measured by RT-PCR. Interestingly, injection of the putative stem
cells into mdx mice resulted in engraftment suggesting that components within the muscle niche
are essential for myogenic progression. One of those proteins is likely galectin-1, a glycoprotein
of the basal lamina. Chan et al. (Chan et al., 2006) demonstrated that culture of human fetal
MSC in media containing galectin-1 initiated both biochemical and morphological differentiation
into myocytes. These cells formed large, multinucleated fibers that expressed contractile proteins
and the MRFs. We used a similar approach with some degree of success. Supplementation of
foal UCB cell culture medium with purified galectin-1 caused myogenic lineage establishment as
determined by desmin immunocytochemistry. However, a large percentage of the myoblasts
were fusion-defective. In addition, we were unable to detect gene transcripts for MyoD, an early
MRF, or myogenin, an MRF required for fusion and contractile gene expression. In accordance
with our failure to amplify members of the MRFs, we did not detect myosin heavy chain or
troponin T by immunocytochemical methods. The constraints to full activation of the myogenic
program may be attributed to the absence of complementary soluble proteins. The source of
galectin-1 used by Chan was spent media from COS cells that produce and secrete the
glycoprotein. Thus, additional proteins within the galectin-1 supplement may have aided
71
induction of myogenesis. Alternatively, specie-specific differences may underlie the discrepant
results.
Given the relative ease of adipocyte formation by human and rodent MSC, the inefficiency
of adipogenesis in equine UCB stem cells was surprising. Less than 1% of cells contained Oil
Red O reactive lipid droplets following application of conventional adipogenic induction
protocols. Koerner reported a similar result using BM-derived and peripheral blood-derived
MSC isolated from adult horses (Koerner et al., 2006). A very small number of adipocytes were
found and the cytoplasmic lipid droplets within said cells were miniscule. By contrast, robust
lipid formation is evident by Oil Red O histology in equine UBCs cultured in a similar adipocyte
induction media (Koch et al., 2007). The discrepancy between these various reports may be
attributed to the heterogeneity of the starting population and/or culture conditions. Koch reported
the presence of dome-like, clusters of small cells as well as a fibroblast-like cell type (Koch et
al., 2007). While we observe the same morphologies, care was taken to maintain the adherent
monolayer exclusive of the foci-like colonies. Future efforts will concentrate on resolving the
identity of these divergent cellular phenotypes and their contribution to plasticity.
72
Figure 3-1. Foal UCB cells express stem cell marker proteins. UCB stem cells (passage 5) were fixed and incubated with antibodies directed against Oct4, SSEA-1, Tra1-60 or Tra1-81. Immunoreactivity was detected with goat anti-mouse AlexaFluor 488 or anti-rabbit AlexaFluor 568 (Oct4). Nuclei were counterstained with Hoechst 33245. Scale bar = 10 μm.
73
Figure 3-2. Induction of chondrogenesis in foal UCB stem cells. Micromass cultures were established as described. Cell pellets were embedded in OCT freezing medium and 10 um cryosections were collected. Alcian Blue and Safranin O histology indicated the presence of glycosaminoglycans and proteoglycans (A). Total RNA was isolated from cells treated in an analogous manner. RT-PCR using gene-specific primers indicated Sox9 and collagen 2A1 expression after 7 days in chondrogenic medium (B). Sox 9 mRNA was not detected at d21. RT, reverse transcriptase.
74
Figure 3-3. UCB stem cells form osteocytes. UCB stem cells were maintained for 21 days in media containing -glycerophosphate, dexamethasone, and ascorbic acid. Cells were fixed and stained for calcium and mineral deposition with Alizarin Red and von Kossa. Representative brightfield images (left part) and corresponding phase contrast fields (right part) at 200× are shown (A). Total RNA was isolated after 21 days in osteogenic induction medium. RT-PCR using gene-specific primers for osteonectin and RunX2 was performed. Products were separated through agarose gels and visualized with ethidium bromide (B). RT, reverse transcriptase.
75
Figure 3-4. Foal UCB stem cells form hepatocytes. UCB stem cells were cultured for 14 days in absence or presence of HGF and FGF4. Cells were fixed with 4% paraformaldehyde and representative phase-contrast images were captured at 200× (A). Separate cultures were analyzed by RT-PCR for cytokeratin 18 (CK18), albumin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene expression (B). RT, reverse transcriptase.
76
Figure 3-5. Incomplete initiation of adipogenesis and myogenesis in foal UCB stem cells and AdMSCs. Foal UCB and AdMSC cells were cultured in adipogenic induction media for 21 days prior to fixation. Oil Red O histology demonstrates very few adipocytes in foal UCB cells (A). UCB stem cells were cultured for 7 days in myogenic induction media prior to fixation and desmin immunostaining. Arrow indicates multinucleated cell (B). Actin filaments were detected by incubation with Texas Red-phalloidin (C). Total nuclei were visualized with Hoechst 33245. Scale bar = 25 µm.
77
Figure 3-6. AdMSC fail to express embryonic stem cell markers. AD-MSCs were fixed and incubated with antibodies directed against Oct4, SSEA-1, SSEA-4, Tra1-60 or Tra1-81. Immunoreactivity was detected with goat anti-mouse AlexaFluor 488 or anti-rabbit AlexaFluor 568 (Oct4). Nuclei were visualized with Hoechst 33245. SSEA-1 and SSEA-4 were not detected. Scale bar = 10 µm.
78
CHAPTER 4 REFINEMENT OF CULTURE CONDITIONS TO PROMOTE THE MAINTENANCE OF
EQUINE UMBILICAL CORD BLOOD DERIVED STEM CELLS
Introduction
Cytotherapeutic repair in horses is a proposed means of decreasing the prescribed stall
confinement period. Current strategies involve isolation of mesenchymal stem cells (MSCs)
from bone marrow (BM) aspirates or adipose tissue coupled with autologous engraftment into
the site of damage (Richardson et al., 2007; Taylor et al., 2007). Tendon lesions in horses
treated with BM MSC retained a portion of the cells at the lesion site, exhibited properly oriented
collagen fibrils and returned to exercise sooner (Pacini et al., 2007). Injection of BM-MSCs into
damaged superficial digital flexor tendons (SDFT) demonstrates that a portion of the cells is
retained at the lesion site indicating that the improved healing is likely a product of the engrafted
MSCs (Guest et al., 2008).
MSC from equine adipose, bone marrow and umbilical cord blood efficiently differentiate
into chondrocytes and osteocytes in vitro (Fortier et al., 1998; Arnhold et al., 2007; Koch et al.,
2007; Stewart et al., 2007; Kisiday et al., 2008; Reed and Johnson, 2008). Their ability to
transform into cell types of additional lineages is limited. Under the appropriate conditions,
UCB stem cells differentiate into adipocytes (Koch et al., 2007). A limited set of hepatogenic
and myogenic markers was reported following UCB stem cell differentiation (Reed and Johnson,
2008). The reason for the restricted plasticity is unknown, but may be associated with
suboptimal culture conditions.
Implicit to the pluripotent nature of human and rodent embryonic stem (ES) cells is
expression of Oct4 and nanog (Chambers et al., 2003; Yates and Chambers, 2005; Wang et al.,
2006; Babaie et al., 2007). Loss of either factor is associated with differentiation of the
pluripotent cell. Recent evidence demonstrates that ectopic expression of Oct4, Sox2, Klf4 and c-
79
myc is sufficient to reprogram somatic cells into ES-like cells (Takahashi and Yamanaka, 2006;
Takahashi et al., 2007; Aoi et al., 2008; Lowry et al., 2008). Oct4 mRNA is present in MSCs
isolated from multiple tissue sources suggesting that the transcription factor participates in the
global inhibition of stem cell differentiation (Tondreau et al., 2005; Ren et al., 2006; Greco et
al., 2007). Undifferentiated equine UCB stem cells express Oct4 in the nucleus, which is lost
upon introduction of lineage decisions (Reed and Johnson, 2008).
The objective of the experiment was to refine culture conditions of equine UCB stem cells
and examine the effects of continuous culture on genetic markers of ES cell identity. Results
indicate improved UCB stem cell population doubling times (PDTs) with cultivation on matrix-
associated protein surfaces. UCB stem cells express Oct4, nanog and Sox2 immediately upon
establishment in vitro. Serial passage is associated with decreased expression of both nanog and
Sox2.
Materials and Methods
UCB Collection and Stem Cell Isolation
Cord blood was collected from the intact umbilicus of Thoroughbred foals (N= 4) at
foaling into a sterile 50 ml centrifuge tube containing EDTA (1 mg/ml) as an anti-coagulant.
UCB was stored at 4° C and putative stem cells isolated within 12 hours of collection. Samples
were incubated for 20 minutes with RosetteSep Human Cord Blood Progenitor Enrichment
Cocktail (50 µl/ml blood; Stem Cell Technologies, Seattle, WA). An equal volume of
phosphate-buffered saline (PBS) containing 2% FBS was added and the mixture was layered on
a bed of Ficoll-Paque (Sigma, St. Louis, MO). Cell aggregates were sedimented through the
density gradient by centrifugation at 1,200 X G for 20 minutes. Mononuclear cells at the
gradient interface were collected, washed with PBS and placed into culture.
80
Stem Cell Culture
All media, serum and supplements were purchased from Invitrogen (Carlsbad, CA) unless
otherwise noted. Murine ES cells (E14TG2a; (Thompson et al., 1989)) were cultured using a
modified procedure of that previously described (Piedrahita et al., 1992) and served as positive
controls. Briefly, ES cells were cultured in Dulbecco’s modified Eagle medium (DMEM)
supplemented with 15% fetal bovine serum (FBS), 1000 units/ml leukemia inhibitory factor
(LIF), 2mM L-glutamine, 0.1 mM 2-mercaptoethanol on 0.1% gelatin coated plasticware. Cells
were passaged at 70% confluence using 0.025% trypsin- ethylenediamine tetraacetic acid
(EDTA). UCB stem cells were cultured on 0.1% gelatin (Fisher Scientific, Pittsburgh, PA),
0.01% fibronectin (Sigma-Aldrich, St. Louis, MO), rat tail collagen I (5 µg/cm2) or uncoated
tissue cultureware. Conventional UCB stem cell growth media (GM) is DMEM supplemented
with 10% FBS and 5 µg/ml plasmocin (InVivogen, San Diego, CA). Test media included GM
supplemented with10 ng/ml FGF2 (R&D Systems, Minneapolis, MN), 1% non-essential amino
acids, 1% insulin-transferrin-selenium (GM+FGF), Iscove’s modified Dulbecco’s media
(IMDM) supplemented with 10% FBS, 50 ng/ml Flt3, 10 ng/ml thrombopoietin and 20 ng/ml c-
kit [GM+Flt/Tpo/Kit; (McGuckin et al., 2003)] or conditioned media (CM). CM was collected
from confluent UCB stem cells cultured in growth medium and centrifuged at 1500 x g for 10
minutes. The supernatant was retained and supplemented with 3% FBS and 5 µg/ml plasmocin.
Culture medium was exchanged every three days and cells were passaged at 70% confluency
using 0.025% trypsin-EDTA. Additionally, cell number was determined daily for 4 days on
subpopulations of UCB for the calculation of PDT according to the formula N=N02(t/pdt) where N
= final cell number, N0 = initial cell number, t=time, and pdt= population doubling time. Phase
photographs were captured by a Nikon T200 microscope with NIS Elements software (Nikon
81
Instruments, Melville, NY) and converted to grayscale in Adobe Photoshop CS. Cell number was
determined by manually counting the number of attached cells in six random photographed
fields. Manual counting was employed to minimize the disruption of cell growth.
For extended passaging, UCB cells at passages three, six, and nine were plated at a density
of 2000 cells/cm2 on the appropriate substrata in either FBS or Modified FBS media. Cell
number was determined on days 0 through 4 and population doubling time was determined as
above. Cells were harvested for RNA isolation on day 4 for subsequent RT-PCR analysis. All
samples were evaluated in duplicate.
RNA Isolation, Reverse Transcription (RT) and Polymerase Chain Reaction (PCR)
Total RNA was isolated by lysis in STAT60 (Iso-Tex Diagnostics, Friendswood, TX) and
ethanol precipitation. The RNA was digested with DNase (Ambion, Austin, TX) to remove
genomic DNA contaminants. One microgram of total RNA was reverse transcribed (Superscript
III, Invitrogen, Carlsbad, CA) in 20 µl reaction volume. Two microliters of first strand cDNA
was amplified with gene-specific primers and AccuPrime DNA polymerase (Invitrogen,
Carlsbad, CA). Primer sequences are glyceraldehyde 3-phosphate dehydrogenase (F-
GAGATCCCGCCAACATC, R- CTGACAATCTTCAGGGAATTGTC), Oct4 (F-
GCTGCAGAAGTGGGTGGAGGAAGC, R- GCCTGGGGTACCAAAATGGGGCCC), Nanog
(F- GTCTCTCCTCTGCCTTCCTCCATGG, R- CCTGTTTGTAGCTAAGGTTCAGGATG),
Sox2 (F- AACGGCAGCTACAGCATGA, R- TGGAGTGGGAGGAAGAGGTA), Klf4 (F-
TGGGCAAGTTTGTGTTGAAG, R- TGACAGTCCCTGTTGCTCAG), c-myc (F-
GACGGTAGCTCGCCCAAG, R- ACCCCGATTCTGACCTTTTG), Jagged-1 (F-
GCCTGGTGACAGCCTTCTAC, R-GGGGCTTCTCCTCTCTGTCT), Jagged-2 (F-
CATGATCAACCCCGAGGAC, R-CGTACTGGTCGCAGGTGTAG), Notch-1 (F-
82
GAGGACCTGGAGACCAAGAAGGTTC, R-AGATGAAGTCGGAGATGACGGC), Notch-2
(F-GCAGGAGCAGGAGGTGATAG, R-GCGTTTCTTGGACTCTCCAG), Notch-3 (F-
GTCCAGAGGCCAAGAGACTG, R-CAGAAGGAGGCCAGCATAAG), Dll-1 (F-
ACCTTCTTTCGCGTATGCCTCAAG, R-AGAGTCTGTATGGAGGGCTTC), and Dll-4 (F-
CGAGAGCAGGGAAGCCATGA, R-CCTGCCTTATACCTCTGTGG). cDNA was amplified
with the gene specific primers listed below using the following protocol: 5 minutes at 94°C for
the initial denaturation followed by 40 cycles of 94°C for 30 seconds, 53°C for 30 seconds, and
68°C for 30 seconds. Amplicons then underwent a final elongation period at 68°C for 10
minutes. PCR products were visualized following electrophoresis through 2% agarose-TAE (40
mM Tris, pH 8.0, 2 mM EDTA) gels impregnated with ethidium bromide. Representative
images were captured with a Kodak ImageDoc system and inverted in Adobe Photoshop CS. All
products were verified by sequencing.
Statistical Analysis
Transcript expression was analyzed by logistic regression using the LOGISTIC procedure
in SAS (SAS Institute, Inc., Cary NC). Reference values for substrata, media, and passage were
set at uncoated, growth media, and passage three, respectively. Probability values from the
logistics procedure were obtained using WALD Chi-square statistics derived from type III
analyses of effects. Initial models included all main effects and interactions. Data were
reanalyzed after removing nonsignificant effects from the model. Chi-square probability is
reported.
Doubling time data was analyzed by ANOVA using the GLM procedure of SAS. Initial
models included all main effects and interactions. Subsequent reanalysis removed all
nonsignificant effects from the model. Passage, substrata, media and horse were tested as main
83
effects. Comparisons of least squares means were examined by the PDIFF option of the
LSMEANS statement. Statistical significance for all experiments was set at p<0.05.
Results
UCB Express Markers of Pluripotent Stem Cells
Equine UCB stem cells are cultured routinely in basal media supplemented with 10% fetal
bovine serum [GM; (Koch et al., 2007; Reed and Johnson, 2008)]. Under these conditions, the
majority of cells grew in a monolayer with fibroblast-like morphology (Figure 4-1A). However,
a small portion of cells formed colonies reminiscent of embryonic stem cell colonies (Figure
1B). Oct4, nanog, Sox2, Klf4 and c-myc are involved in somatic cell reprogramming to ES-like
cells and the gene products are implicated in pluripotency (Takahashi and Yamanaka, 2006;
Takahashi et al., 2007). Total RNA was isolated from mouse ES cells and equine UCB stem
cells and analyzed by RT-PCR for expression of the aforementioned gene products. As
expected, transcripts for the reprogramming genes were detected in mouse ES cells (Figure 4-
1C). In a similar manner, Oct4, nanog, Sox2, Klf4 and c-myc amplicons were present in UCB
stem cell RNA isolates. No DNA products were evident in RT-PCR reactions in the absence of
reverse transcriptase.
GM and GM+FGF Maintain UCB Proliferation
To determine the effects of culture conditions on UCB stem cell proliferation and
stemness, cells were supplemented with a number of growth factor combinations.
Supplementation of GM with FGF2 did not disrupt morphology (Figure 4-2). However, a
combination of Tpo, Flt3 and c-kit, or CM resulted in a morphology resembling cells in
replicative senescence. Cell number change over a four-day culture period was measured and
population doubling times (PDT) determined. GM and GM+FGF maintained shorter doubling
84
times than other cultures. GM+Tpo/Flt/Kit and CM were discontinued due to morphological
changes and a prolonged PDT and cell death.
Protein Surface Matrixes Promote UCB Growth
UCB stem cells were seeded at equal cell densities on gelatin, fibronectin, collagen and
uncoated surfaces. Cell population doubling times were calculated following four days of
culture (Table 4-1). UCB stem cells on coated surfaces demonstrated faster PDTs than controls
maintained on uncoated tissue plasticware. Changes in PDT were independent of the type of
matrix used.
Additionally, PDT was increased in cells cultured in GM+FGF (35.68±1.25 hr) compared
to growth media controls (27.65±0.74 hr; p<0.0001). The interaction of media and substrata
types demonstrated that cells cultured on any type of matrix in control media have significantly
faster doubling times than their respective cultures in media supplemented with FGF2 (Table 4-
2). Cells cultured on collagen, fibronectin, and gelatin matrices in control media exhibit no
differences in growth kinetics.
Few stem cell populations are immortal in vitro, most enter replicative senescence over
time in culture. Thus, population doubling times during continuous culture were determined at
passages three, six, and nine. Time in culture significantly increases PDT from passage three
through passage nine (21.09±0. 3 hr, 34.84±1.28 hr, and 39.06±1.0 hr, respectively; p<0.0001 for
all interactions). While there was no significant effect of media at passage three (p=0.1361),
later passages showed significantly shorter doubling times when cultured in control growth
media compared to GM+FGF (p<0.0001, data not shown).
Oct4 is Maintained Throughout UCB Culture
Having determined appropriate culture conditions to maintain proliferation, markers of
stemness were measured by RT-PCR. Oct4 expression is maintained over time in culture
85
regardless of substrata or media (Table 4-3). However, nanog and Sox2 mRNA decline with
serial passage. Expression of both genes is affected by substrata, maintaining expression longer
on a protein matrix (particularly collagen) than on uncoated plasticware. Media containing
FGF2 does not affect the maintenance of either nanog or Sox2 mRNA. The presence of nanog
transcripts was significantly different among horses, suggesting an innate heterogeneity among
animals.
Notch Signaling in UCB Stem Cells
Notch signaling plays a crucial role in cell:cell communication among mature and naive
cells. In human ES cells, constitutive Notch signaling promotes differentiation, particularly to
neural cell lineages (Lowell et al., 2006). In hematopoietic stem cells (HSCs), constitutive
activation of the Notch pathway including downstream target Hes1 led to an increased self-
renewal capacity of long term in vivo repopulating HSCs (Stier et al., 2002; Kunisato et al.,
2003). The Notch signaling pathway consists of a transmembrane receptor, Notch, which is
cleaved upon the binding of an extracellular ligand. The ligands for Notch are generally also
membrane bound to adjacent cells. There are three Jagged proteins and two Delta-like ligand
(Dll) proteins that serve to activate Notch signaling. Upon ligand binding, Notch undergoes a
series of proteolytic cleavages, resulting in the release of the Notch intracellular domain (NICD)
which relocates to the nucleus and acts as a transcriptional regulator.
To determine what members of the Notch pathway were present in UCB and AdMSC, and
to compare that expression with the pathway present in mES, RT-PCR was performed for
jagged-1, jagged-2, notch-1, notch-2, notch-2, Dll-1, and Dll-2. Mouse ES exhibited amplicons
for all transcripts examined (Figure 4-3). Notch-1, Notch-3 and Jagged-1 were present in UCB
stem cells, indicating the possibility for a functional pathway in these cells. However, only the
86
ligand Jagged-1 is found in AdMSC. This suggests that adipose derived stem cells may not be
fully capable of Notch signaling but could contribute to signaling to surrounding cells.
To identify the effects of the Notch pathway on UCB proliferation, cells were cultured for
three days in media with or without the Notch inhibitor L685,458. Cell number was determined
daily by visual inspection and manual counting. Inclusion of the Notch inhibitor had no
significant effect on cell number over the three day period (Figure 4-4). Furthermore, UCB
culture in the presence of the Notch inhibitor had no effect on the presence of Oct4, nanog, or
Sox2 as determined by RT-PCR (data not shown).
Notch signaling is mediated by the transcription factors hes and hey. The presence of hes
and hey in UCB was determined. 23A2 myoblasts were used as a positive control. No
transcript was amplified for hey, however hes transcripts were present in both cell types.
Furthermore, there appeared to be no difference in cells treated with L685,458 and control cells
of either type (Figure 4-5). To further verify this, real-time PCR was performed following three
days of treatment with the Notch inhibitor. Delta Ct values are reported in Table 4-4. No
difference in expression levels was apparent in either cell type.
To verify the efficacy of the Notch inhibitor, 23A2 myoblasts were stimulated to
differentiate. The presence of BMP6 abrogates differentiation however, this can be inhibited by
the inclusion of L685,458. Control cells formed myotubes within 48 hours in differentiation
medium (Figure 4-6). At this time, 76% of nuclei were included in myosin heavy chain (MyHC)
expressing cells. The presence of BMP6 in differentiation media inhibited myotube formation,
with fewer than 10% of cells expressing MyHC. However, inhibition of the Notch pathway in
the BMP6 stimulated cells abrogated the effects of BMP6 and allowed a partial recovery of
87
differentiation. Greater than 30% of cells immunostained positive for MyHC. Supplementation
of the differentiation media with L685,458 alone had no effect on differentiation.
We conclude from these experiments that while the Notch pathway may play an important
role in differentiation of specific stem cell types, it is not crucial for the proliferation of UCB
stem cells. Furthermore, we have been unable to demonstrate that UCB stem cells have an active
Notch signaling network.
Discussion
Initial culture strategies for equine UCB stem cells involved growth on uncoated tissue
plasticware surfaces (Koch et al., 2007; Reed and Johnson, 2008) but no work has assessed the
effects of various substrata or media on the prolonged culture of these cells. Use of UCB stem
cells as injury repair aids likely will require an initial expansion in culture to provide sufficient
numbers of cells. Several media supplements were assessed for their ability to extend the
timeframe that UCB stem cells can be maintained in vitro. Expansion of human UCB stem cells
in media supplemented with thrombopoietin, Flt3 and c-kit ligand results in a population that
expresses ES-like surface markers, morphology and importantly, a delay in replicative
senescence (McGuckin et al., 2003). Passage of equine UCB stem cells in this media did not
duplicate the events and phenotypes reported for the human counterparts. Equine UCB stem
cells proliferated slowly and exhibited large nuclei with pronounced nucleoli, characteristics of
senescent fibroblasts. Close examination of the cultures indicated an absence of any cell clusters
with ES-like morphology. Because Tpo, Flt3 and c-kit were supplemented into a basal media
that supports equine UCB stem cell growth, we conclude that the growth factors are detrimental
to the routine culture and passage of these cells in vitro.
Equine UCB stem cells grown at higher densities proliferate more readily than those at
lower cell concentrations. Thus, we postulated that secreted factors may play a role in
88
maintaining growth kinetics in this population. Culture in conditioned media proved deleterious
to UCB stem cells, evidenced by poor growth kinetics and morphology suggestive of replicative
senescence. This suggests that the improvement seen in growth kinetics at higher cell densities
may be a reflection of cell:cell and extracellular matrix interactions rather than the paracrine
action of secreted factors.
Similar to conditioned media, FGF2 appears to be a hindrance to UCB stem cell
proliferation. FGF2 is mitogenic for MSCs isolated from adipose and bone marrow tissues
(Baddoo et al., 2003; Benavente et al., 2003; Rider et al., 2008). Treatment of mouse BM-MSC
with FGF2 causes an increase in proliferation without induction of differentiation (Baddoo et al.,
2003). Indeed, FGF2 reversibly inhibited MSC differentiation toward the adipogenic and
chondrogenic lineages. However, treatment of equine UCB stem cells with FGF2 resulted in
longer PDTs but no negative effects on the ES marker profile. The contrasting results may
represent specie and tissue source differences.
Nanog, Oct4, and Sox2 are key factors in maintaining ES cell pluripotency in addition to
being capable of inducing pluripotency in somatic cells (Takahashi and Yamanaka, 2006). In the
absence of nanog, mouse ES cells differentiate into presumptive endoderm lineages (Mitsui et
al., 2003). Oct4 is required to maintain pluripotency of the inner cell mass; loss of function
results in differentiation to trophectodermal lineages (Zaehres et al., 2005). The requirement of
Sox2 to maintain the expression of Oct4 has been demonstrated (Masui et al., 2007). These
transcripts, along with c-myc, are capable of inducing a pluripotent, ES-like state in somatic cells
(Takahashi and Yamanaka, 2006). Notably, the more differentiated adipose derived stem cells
lack expression of Nanog and Sox2 (data not shown). Expression of this panel of transcripts, as
well as population doubling time was used to monitor the stemness of UCB in different culture
89
conditions and over time in culture. Cells maintained Oct4 expression throughout the duration of
culture, regardless of media or substrata used. In contrast, the presence of both Nanog and Sox2
decreased with time in culture. The presence of a protein matrix prolonged expression of both
nanog and Sox2 transcripts. This was not unexpected, as most stem cells reside in a very specific
niche, a large part of which is composed of extracellular matrix. Extracellular matrix in the stem
cell niche provides not only support for adhesion, but instructive signals to maintain the naïve
state (Bi et al., 1999; Chen et al., 2007). Additionally, UCB cultured on various substrata had
decreased population doubling times compared to those on uncoated plasticware. As stem cells
divide, one daughter cell may proliferate rapidly to expand the progenitor cell population while
the other divides much more slowly or not at all to maintain the stem cell population. Thus,
slowly dividing stem cells are considered to be the more naïve population. However, when
cultured for use as a therapeutic aid, cultivation of UCB on a protein substrate decreased
population doubling time. This is a beneficial property when considering the expansion of these
cells in culture prior to use as a therapeutic aid. The loss of Nanog and Sox2 during extended
culture highlights the need for short expansion periods prior to use as a cytotherapeutic tool.
Interestingly, despite the increase in population doubling time of cells cultured in media
containing FGF2, there was no effect of FGF2 on the transcript profile of UCB. While FGF2
appears dispensable for the maintenance of pluripotency markers, its negative effects on
population doubling time preclude its use in media for UCB expansion.
In summary, we defined culture conditions sufficient to ensure ES-like gene expression
patterns for early passage equine UCB stem cells. These include maintenance on matrix protein
coated surfaces and cultivation in fetal bovine serum. Genetic markers of pluripotency declined
90
with serial passage suggesting that expansion of UCB stem cells for therapeutic purposes is
limited under the current culture conditions.
91
Figure 4-1. GM and GM+FGF support equine UCB stem cell propagation. UCB stem cells cultured in GM and GM+FGF have faster doubling times than those grown in GM containing thrombopoietin(tpo), Flt3, and c-kit, or UCB conditioned media. Population doubling times are presented below their respective phase photograph in hours ± SEM. Scale bar = 10 μm. GM = growth media; GM + FGF = growth media containing FGF2; GM + Tpo/Flt/kit = growth media containing thrombopoietin, Flt3, and c-kit; CM = conditioned media.
92
Table 4-1. Effect of substrata on equine UCB1 derived stem cell population doubling time P-value
Substrata2 PDT3 SEM4 Con Gel Fib Col Con 35.91 1.89 --- <0.0001 <0.0001 <0.0001 Gel 30.67 1.38 --- --- 0.3633 0.7634 Fib 29.72 1.34 --- --- --- 0.5427 Col 30.36 1.44 --- --- --- ---
1 UCB = umbilical cord blood 2 Con= uncoated, Gel = gelatin, Fib = fibronectin, Col = collagen 3 PDT= population doubling time in hours, N=N02(t/pdt) where N = final cell number, N0 = initial cell number, t=time, and pdt= population doubling time 4 SEM = Standard error of the mean
93
Table 4-2. Effect of substrata and media on equine UCB1 derived stem cell doubling time P-value
Substrata2 Media3 PDT4 SEM5 Con
GM
Con GM+FG
F Gel GM
Gel GM+FG
F Fib GM
Fib GM+FG
F Col GM
Col GM+FG
F Con GM 30.07 1.59 --- <0.0001 0.0628 0.0079 0.0370 0.1055 0.0091 0.0029
Con GM+FGF 41.74 3.01 --- --- <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001
Gel GM 27.32 1.50 --- --- --- <0.0001 0.8187 0.0006 0.4463 <0.0001
Gel GM+FGF 34.01 2.14 --- --- --- --- <0.0001 0.2908 <0.0001 0.7366
Fib GM 26.99 1.57 --- --- --- --- --- 0.0003 0.5941 <0.0001
Fib GM+FGF 32.46 2.05 --- --- --- --- --- --- <0.0001 0.1643
Col GM 26.21 1.18 --- --- --- --- --- --- --- <0.0001
Col GM+FGF 34.50 2.38 --- --- --- --- --- --- --- ---
1 UCB=umbilical cord blood 2 Con= uncoated, Gel = gelatin, Fib = fibronectin, Col = collagen 3 GM = growth media, GM+FGF = growth media + FGF2 4 PDT= population doubling time in hours, N=N02(t/pdt) where N = final cell number, N0 = initial cell number, t=time, and pdt= population doubling time 5 SEM = Standard error of the mean
94
Figure 4-2. Equine UCB stem cells express markers of embryonic stem cell pluripotency. RT-PCR was performed on mouse embryonic (n=1, in triplicate) and UCB stem cell (n=4, in duplicate) total RNA using primers specific for Oct4, nanog, Sox2, KLF4 and c-myc transcripts. Both populations of stem cells express transcripts for the reprogramming genes. UCB = umbilical cord blood stem cells; mES = mouse embryonic stem cells. Representative photo shown.
95
Table 4-3. Effects of horse, passage, media and substrata on mRNA expression P-value mRNA Horse Passage Media Substrata Oct4 0.3535 0.6441 1.0000 0.4272 Nanog 0.0004 0.0001 0.3018 0.0001 Sox2 0.0823 <0.0001 0.5343 0.0574
96
Figure 4-3. UCB and AdMSC express a limited number of molecules in the Notch signaling pathway. RT-PCR was performed for the transcripts listed. mES = mouse embryonic stem cells, UCB = umbilical cord blood derived stem cells, AdMSC = adipose derived stem cells
97
Figure 4-4. Inhibition of the Notch signaling pathway does not affect proliferation. UCB stem cells were cultured in the presence or absence of L685,458 for three days. Cell number was counted daily. CTL = control cells, NI = cells supplemented with L685,458
98
Figure 4-5. UCB and 23A2 myoblasts express hes. RT-PCR for the transcripts listed was performed on RNA isolated from cells treated with the Notch inhibitor, L685,458. UCB = umbilical cord blood derived stem cells, Con = control, no inhibitor, NI = cells supplemented with L685,458.
99
Table 4-4. Delta Ct values for hes realtime PCR.
Cell Type Treatment 1 dCt 2
23A2 CTL 6.54 ± 0.8
23A2 NI 7.56 ± 0.24
UCB CTL 12.36 ± 0.08
UCB NI 11.11 ± 0 15 1 CTL = control, NI = cells supplemented with L685,458 2 dCt = Delta cycle threshold value ± standard error of the mean
100
Figure 4-6. BMP6 inhibits myoblast differentiation in a Notch dependent manner. 23A2 myoblasts were placed in differentiation media in the presence or absence of 50 ng/ml BMP6 and/or the Notch inhibitor L685,458. Cells were fixed after 48 hours and immunostained for myosin heavy chain. Images were captured at 200x. The percent of cells expressing myosin heavy chain was determined and is reported below its respective panel. MyHC = myosin heavy chain
101
CHAPTER 5 CULTURE OF EQUINE UMBILICAL CORD BLOOD AND ADIPOSE DERIVED STEM
CELLS TO PROMOTE TENOCYTIC DIFFERENTIATION
Introduction
Tendons are the elastic structures that connect muscle to bone. These fibrous structures
provide tensile strength during normal movement as well as during strenuous exercise. Tendon
damage is a significant problem in the horse race industry. In the United Kingdom, nearly one
half of all injuries are related to failed tendon and ligament function (Pinchbeck et al., 2004).
The superficial digital flexor tendon (SDFT) is the anatomical and functional equivalent of the
Achilles tendon in humans (Dowling et al., 2000). Historical approaches to SDFT repair are
based upon rest and gradual reintroduction to work (Goodship et al., 1994). Recovery times
typically are greater than 6 months and the animals are prone to reinjury due to fibrocartilage
scar tissue formation (Clegg et al., 2007). Current efforts to improve repair rates and strengthen
regenerated tendons include injection of bone marrow and adipose derived MSCs (Taylor et al.,
2007). Anecdotal evidence suggests that these reagents are beneficial but no conclusive data
exists. Mononuclear cells isolated from adipose tissue improved tendon architecture when
implanted into collagenase induced lesions but resulted in no differences in the rate or quality of
repair (Nixon et al., 2008).
Scleraxis is a class II basic helix-loop-helix transcription factor expressed early during
mouse embryogenesis in the syndetome, a derivative of the somitic sclerotome compartment
(Cserjesi et al., 1995; Brent et al., 2003). Expression is associated with connective tissue and
skeleton structures during prenatal development and with periodontal ligaments, force generating
tendons, brain, lung and Sertoli cells in adult rodents (Liu et al., 1996; Perez et al., 2003; Muir et
al., 2005; Murchison et al., 2007; Pryce et al., 2007). Genetic ablation of scleraxis is embryonic
lethal prior to gastrulation with an absence of mesoderm (Brown et al., 1999). Using transgenic
102
reporter-scleraxis mice, expression of the transcription factor is largely confined to tendons early
in postnatal development and absent in the structures as they become acellular (Pryce et al.,
2007). Conditional ablation of scleraxis in the developing limb of mice produces an animal
with missing tendons in the limb; a few tendons are present but small in size (Murchison et al.,
2007). Of importance, scleraxis null animals contain no flexor tendons. In vitro work in tendon
fibroblasts suggests that scleraxis and NFATc cooperatively regulate the activity of the Col1a1
proximal promoter (Lejard et al., 2007). Overexpression of scleraxis in primary cardiac
fibroblasts significantly increased the production of Col1a2 through direct binding with the
Col1a2 promoter region (Espira et al., 2009). These data suggest a directive role of scleraxis in
the formation of mature tenocytes.
Members of fibroblast growth factor (FGF) family regulate transcription of scleraxis.
FGFs produced by the myotome supply a paracrine signal that allows formation of the
sclerotome and syndetome (Brent and Tabin, 2004). Exogenous FGF4 induces scleraxis and
tenascin C mRNA in the developing chick limb (Edom-Vovard et al., 2002). FGF8 can
substitute partially for myotome suggesting that this FGF is important for tendon progenitor
formation. Ectopic expression of RCAS-FGF8 resulted in an upregulation of scx, tnmd and type
1 collagen in the intermuscular tendons associated with visceral smooth muscle cells (Le Guen et
al., 2009). Signals transmitted in response to FGF4 and FGF8 include increased activity of
MEK1, a requisite kinase for scleraxis expression (Smith et al., 2005). Ectopic expression of
FGF5 in the developing chick inhibited muscle enlargement and promoted proliferation of
tenasin expressing fibroblasts in the hind limb (Clase et al., 2000). Ectopic expression of kinase
defective FGF receptor or constitutive active mitogen activated protein kinase phosphatase 3
(MKP3) inhibits scleraxis transcription in chick embryos. The downstream target of elevated
103
extracellular regulated kinase 1 and 2 (ERK1/2) may be the Ets transcription factor, PEA3 (Brent
and Tabin, 2004). Retroviral mis-expression of PEA3 in chick embryos causes transcription of
scleraxis; ectopic dominant inhibitory PEA3 represses scleraxis expression.
The objective of this experiment was to examine scleraxis and tenascin C mRNA
expression in equine umbilical cord blood (UCB) stem cells and equine adipose-derived
mesenchymal stem cells (AdMSCs) in response to FGF treatment. Results demonstrate that
UCB stem cells and AdMSCs express scleraxis and tenascin C. Culture in matrigel upregulated
expression of both transcripts. UCB stem cells treated with FGF2 or FGF5 causes an increase in
MEK-dependent phosphoERK1/2, although with different activation kinetics. Scleraxis mRNA
content was measured following 48 hours of treatment with either FGF2 or FGF5. Neither
caused an increase in scx over that seen on matrigel alone. However, TnC expression was
increased in AdMSC cultured with FGF2 or FGF5.
Materials and Methods
Stem Cell Culture
Umbilical cord blood stem cells (UCB) were cultured on plastic tissue culture plates coated
with 0.1% gelatin (Fisher Scientific, Pittsburgh, PA) in Dulbecco’s Modified Eagle Medium
supplemented with 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA) and 5 µg/ml
Plasmocin (InVivogen, San Diego, CA). Equine adipose derived cells (AdMSC) were purchased
from ScienCell (Carlsbad, CA). Cells were cultured on 0.1% gelatin coated tissue culture plates
in Mesenchymal Stem Cell Medium (ScienCell) according to manufacturer’s recommendations.
Cells were passaged at 70% confluency using 0.025% trypsin-EDTA. Three dimensional
cultures were achieved by growing cells on Cytodex3 collagen coated beads (Invitrogen) or
allowing cells to embed into 30% Matrigel (BD Biosciences, San Jose, CA).
104
Plasmids and Transfections
The 500 base pair minimal promoter of the mouse scleraxis gene was amplified from
C2C12 myoblasts with specific primers (F:CACACGGCCTGGCACAAAAGACCC
R:TTCGGACTGGAGTGGGGCCGCCAGC). Following sequencing to verify the identity of
the product, the promoter was cloned into the TOPO Zero Blunt vector prior to subcloning into
the pGL3 basic vector such that promoter activity would drive the expression of luciferase (Scx-
luc). C2C12 mesenchymal cells and UCB stem cells in 12 well plates were transiently
transfected with 250 ng Scx-luc and 25 ng pRL-tk, a Renilla luciferase plasmid, as a monitor of
transfection efficiency using FuGene 6.0. Media was replaced after 6 hours to include 50 ng/ml
BMP6, 10 ng/ml FGF4, or 10 ng/ml FGF5. Cells were passively lysed in luciferase lysis buffer
after 24 hours of culture and luciferase activities measured (Dual-Luciferase Reporter kit,
Promega, Madison, WI). Scx-luc activity was corrected for pRLtk activity. The mouse minimal
Scleraxis promoter was sequence verified. Analysis of the sequence by the Transcription
Element Search System (TESS, http://www.cbil.upenn.edu/cgi-bin/tess) revealed the presence of
several putative transcription factor binding sites.
Confocal Microscopy
UCB and AdMSC cultured on gelatin, matrigel, and collagen beads were fixed in 4%
paraformaldehyde for 15 minutes. Cells were permeabilized with 0.1% TritonX100 in phosphate
buffered saline (PBS) supplemented with 5% FBS. Actin filaments were visualized using
fluorescein conjugated phalloidin (Invitrogen) and nuclei were stained with Hoechst 33342. All
immunofluorescence work was completed on glass bottom plates to aid microscopy. Confocal
microscopy was performed on a Leica TCS SP5 Laser Scanning Confocal Microscope running
Leica LAS-AF software for instrument control and image analysis. Images were adjusted for
brightness and contrast in Adobe Photoshop CS.
105
Protein Isolation and Evaluation
Equine UCB and AdMSC were treated with 10 µg/ml protamine sulfate for 10 minutes to
remove signaling molecules from the extracellular matrix. Cells were placed in serum free
media for one hour prior to stimulation with FGF2, FGF4, or FGF5 in the presence or absence of
the MEK inhibitor PD98059. Cells were lysed directly into SDS PAGE sample buffer. Protein
was loaded based on equal cell number and electrophoresed across a 10% polyacrylamide gel.
ERK1/2 activity was assessed using phospho- and total-ERK1/2 antibodies (Cell Signaling
Technologies, Danvers, MA). Briefly, proteins were transferred to nitrocellulose and non-
specific binding sites were blocked with 10% non-fat dry milk in TRIS-buffered saline
supplemented with 0.1% Tween20 (TBS-T). Blots were incubated overnight at 4 °C with
primary antibody (1:1000) in blocking solution. Following extensive washing, blots were
incubated with secondary antibody (1:2000). Equal protein loading was ensured by probing
membranes with anti-tubulin (Abcam, Cambridge, MA) for one hour (1:2000) followed by
incubation in secondary antibody for one hour (1:5000) prior to visualization. Immune
complexes were visualized by chemiluminescence (ECL; GE Life Sciences, Piscataway, NJ) and
autoradiography.
Assessment of Proliferation
Cells were seeded at equal density and cultured in low serum medium (2% FBS)
supplemented with FGF2, FGF4 or FGF5 in the presence or absence of PD98059 for 48 hours.
Prior to fixation, cells were pulsed with 10 µM bromodeoxyuridine (BrdU) for two hours.
Proliferation index was determined as the proportion of cells expressing BrdU:total cell number.
All experiments were performed on UCB collections from four horses in duplicate wells with
two replicate experiments.
106
RNA Isolation, Reverse Transcription, and Polymerase Chain Reaction
Total RNA was isolated by lysis in STAT60 (Iso-Tex Diagnostics, Friendswood, TX) and
passed over RNeasy Mini columns (Qiagen, Valencia, CA). The RNA was digested with DNase
(Ambion, Austin, TX) to remove genomic DNA contaminants. One microgram of total RNA
was reverse transcribed (SuperScript III, Invitrogen) in 20 µl reaction volume. Two microliters
of first strand cDNA was amplified with gene-specific primers and AccuPrime DNA polymerase
(Invitrogen). Primer sequences are listed in Table 5-1. PCR products were visualized following
electrophoresis through 2% agarose gels impregnated with ethidium bromide. Representative
images were captured with a Kodak ImageDoc system and inverted in Adobe Photoshop CS.
Quantitative PCR
Complementary DNA reverse transcribed from 1 µg of total RNA was amplified with
SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and the appropriate
forward and reverse primers (Table 5-1; 20 pM) in an ABI 7300 Real-Time PCR System
(Applied Biosystems). Thermal cycling parameters included a denature step of 95°C for 10 min
and 50 cycles of 15 s at 95.0°C and 1 min at 60.0°C. A final dissociation step included 95°C for
15 s, 55°C for 30 s, and 95°C for 15 s. Serial dilutions of pooled samples were used to generate
standard curves to ensure generation of cycle threshold values that were within the linear range of
amplification (Castellani et al., 2004). Cycle threshold value ranges for each transcript are
reported in Table 5-2.
Results
AdMSC and UCB Express Markers of Tenocytic Cells
Immature tenocytes express the transcription factor scleraxis prior to the upregulation of
more mature markers such as tenascin C and collagen 1A2. To evaluate adipose and umbilical
107
cord blood derived stem cells for tenocytic markers, RT-PCR was performed using gene specific
primers for scleraxis and tenascin C. Messenger RNA for both transcripts were present in both
adipose and umbilical cord blood derived stem cells (Figure 5-1). Transcripts were sequenced to
verify identity.
Scleraxis Minimal Promoter Activity
The mouse minimal scleraxis promoter was sequence verified. Analysis of the sequence
by the Transcription Element Search System (TESS, http://www.cbil.upenn.edu/cgi-bin/tess)
revealed the presence of several putative transcription factor binding sites. The list of binding
sites with p-values less than or equal to 0.01 is presented in Table 5-3. Figure 5-2 shows a
schematic of the promoter highlighting potentially important regulatory sites. Of particular
interest is the presence of POU factor, Hes, SP1, and AP1 binding sites. A Klf4 binding site is
present at base pair 35, but is not included on the list as the p-value was given as 0.011.
However, there were multiple sites strongly recognized in a small region lending strength to this
prediction and its inclusion on the figure.
UCB stem cells show much lower basal levels of scleraxis promoter activity than do
C2C12s (Figure 5-3). Supplementation of C2C12 cells with BMP6 reduced luciferase
expression driven by the scleraxis promoter. FGF4 and FGF5 had no effect on the scleraxis
promoter in these cells. Scleraxis promoter activity in UCB stem cells appears to be unaffected
by supplementation with BMP6, FGF4 or FGF5. This may be due to the low basal level of the
minimal promoter’s activity. Other transcription factor binding sites may be required for full
activity of this promoter in this environment.
Downstream effectors of FGF signaling include the transcription factors Pea3 and Erm.
Activation of Pea3 and Erm is required for scleraxis expression in the developing somite (Brent
& Tabin). Thus, we examined the presence of these factors by RT-PCR in UCB stem cells. RT-
108
PCR was performed as previously described. UCB stem cells express Pea3 and Erm in addition
to scleraxis (Figure 5-4).
AdMSC and UCB Survive on Various Matrices
The three dimensional environment of a tissue results in different mechanical stresses and
cell contacts which can signal for specific cell identities. To investigate the effects of various
matrices, UCB and AdMSC were cultivated on gelatin coated plasticware, collagen coated
beads, or allowed to embed into 30% Matrigel for 48 hours (Figure 5-5). Cells were fixed in 4%
paraformaldehyde and stained with fluorescein conjugated phalloidin to visualize actin structures
and Hoechst 33342 to label nuclei. Stem cells grown on gelatin existed in a monolayer and
exhibited morphology typical of fibroblasts and MSC with visible actin filaments. Incorporation
into a 30% Matrigel resulted in the formation of colonies with compact structure. Cells show
fewer stress fibers but maintain filopodia that extend into the surrounding matrix. Culture on
collagen beads results in cells which resemble those on gelatin, albeit with apparently smaller
amounts of cytoplasmic volume. No differences in morphology were noted between cells
derived from adipose or umbilical cord blood.
Culture in Matrigel Increases Tenocyte Gene Expression
To evaluate the effects of different culture matrices on tenocyte gene expression, AdMSC
and UCB were cultured for 48 hours on gelatin, collagen coated beads, or matrigel prior to RNA
extraction. Realtime PCR revealed increases in scleraxis mRNA in both AdMSC and UCB
when cultured on matrigel (39.48 and 6.73 fold, respectively, p<0.0001; Figure 5-6). Scleraxis
transcripts were decreased in AdMSC grown on collagen coated beads (p<0.0001). Culture on
matrigel increased tenascin C expression 12.32 fold in AdMSC but not in UCB (p<0.0001).
109
Fibroblast Growth Factors Elicit Differing ERK1/2 Responses in UCB and AdMSC
Not only can FGF stimulation promote mitogenesis in stem cells, but FGF signaling
through the MAPK pathway can lead to downstream regulation of scleraxis and tenascin C.
Thus, the ERK1/2 response was examined in UCB and AdMSC following stimulation by FGF2,
FGF4, or FGF5. FGF2 elicited ERK1/2 phosphorylation in both cell types, albeit with differing
activation kinetics (Figure 5-7). FGF4 did not activate pERK1/2 in UCB, however was
responsible for a slight activation in AdMSC. Further experiments with FGF4 were discontinued
due to lack of a MAPK response in UCB. Stimulation with FGF5 elicited a transient response in
both AdMSC and UCB with similar kinetics. These results indicated that both UCB and AdMSC
are capable of downstream signaling elicited by the fibroblast growth factors.
The mitogenic effects of the fibroblast growth factors have been shown in adipose and
bone marrow derived stem cells. To clarify the effect of the fibroblast growth factors on UCB
and AdMSC proliferation, cells were cultured for 48 hours in media supplemented with FGF2 or
FGF5 in the presence or absence of the MEK inhibitor PD98059 (Figure 5-8). Cells were pulsed
with BrdU prior to fixation and quantification. Similar to bone marrow derived stem cells,
AdMSC increased proliferation when cultured in the presence of FGF2. This effect was
abrogated by the presence of PD98059. In contrast, supplementation of FGF2 to UCB retarded
BrdU incorporation in a MAPK dependent manner. Supplementation of AdMSC with FGF5
inhibited proliferation, contrasting with the increased proliferation of UCB. Inclusion of the
MEK inhibitor PD98059 reversed the effects of FGF5 in both cell types.
To determine the combined effects of three dimensional culture and stimulation of the
fibroblast growth factors on stem cell identity, UCB and AdMSC were cultured on gelatin,
collagen beads and matrigel and stimulated with FGF2 or FGF5 for 48 hours. Real-time PCR
was used to quantify changes in scx and TnC expression. UCB cultured on matrigel express
110
higher levels of scx (p<0.0001; Figure 5-9A). However, Scx tended to be decreased by
supplementation with FGF2. Levels of TnC mRNA are unaffected by culture on different
matrices or the inclusion of FGF2 or FGF5 (Figure 5-9B).
In AdMSC, scx expression was increased by culture in matrigel but decreased by culture
on collagen beads (p<0.0001; Figure 5-9C). When cultured on gelatin or matrigel, FGF5
supplementation increased TnC transcription in AdMSC (p<0.0001). Inclusion of FGF2 in the
culture media of cells grown in matrigel increased TnC transcription but to a lesser extent than
caused by FGF5 (Figure 5-9D). Inhibition of the MAPK signaling pathway by PD98059 did not
reverse the changes in scleraxis or tenascin C mRNA caused by FGF2 or FGF5 stimulation in
adipose or umbilical cord blood derived stem cells (data not shown).
Effect of FGF5 Supplementation on Actin Structure
To determine if FGF5 supplementation resulted in changes in cell morphology and actin
structure, UCB were stripped of extracellular signaling molecules using 10 µg/ml protamine
sulfate for 10 minutes. Cells were placed in serum free media for one hour prior to the addition
of 10ng/ml rhFGF5 or growth media. Those cells receiving neither growth media nor FGF5
were used as controls. UCB stem cells were fixed in 4% paraformaldehyde at times 0, 10, and
30 minutes of treatment prior to permeabilization with 0.1% TritonX100 in phosphate buffered
saline (PBS) supplemented with 5% FBS. Actin filaments were immunostained with fluorescein
conjugated phalloidin and Hoechst 33342. Morphology was visualized using a Nikon T200
microscope equipped with epifluorescence. Images were captured with NIS Elements (Nikon
Instruments, Melville, NY) software and compiled with Adobe PhotoShop CS.
No appreciable differences were visible in UCB receiving any treatment (Figure 5-10). All
cells maintained similar sizes. No treatment resulted in the formation of extensive filopodia or
111
stress fibers. Thus, we conclude that FGF5 supplementation does not have an immediate effect
on UCB actin structure.
Response of the PI3K Pathway to FGF2 and FGF5 Supplementation
To determine if FGF2 or FGF5 may be signaling through the phosphoinositol-3 kinase
pathway, an alternative to ERK1/2, we examined the expression of phosphorylated and total Akt
following stimulation with 10 ng/ml of either FGF2 or FGF5. Akt is a downstream effector of
PI3K signaling which requires phosphorylation on threonine 308 and serine 473. Western blots
were performed as previously described following treatment with FGF2 or FGF5. No
phosphorylated Akt was present at any time point following FGF2 or FGF5 supplementation
(Figure 5-11). Total Akt was maintained at similar levels throughout the experiment. This
suggests that FGF2 and FGF5 are not activating the PI3K pathway.
In conclusion, we demonstrate that AdMSC and UCB react differently to various matrices
and growth factors. To maintain an immature tenocyte-like cell, the appropriate culture
conditions for UCB appear to be culture on matrigel in the absence of any FGF supplementation.
Culture of adipose derived stem cells on matrigel in culture medium supplemented with FGF2
promotes proliferation of an early tenocyte-like phenotype.
Discussion
This work highlights the differences between adipose and umbilical cord blood derived
stem cells. Previously, we have shown that equine AdMSC express fewer stem cell markers and
possess a more limited ability to differentiate compared to UCB (Reed and Johnson, 2008).
AdMSC proliferate more rapidly than UCB regardless of the surface substrate (Reed and
Johnson, unpublished data). This suggests a difference in regenerative capabilities as more naïve
stem cells often have longer population doubling times than more differentiated cells. Few
studies have directly compared the two populations in vitro and to date, none have compared
112
their in vivo ability to assist regeneration. Adipose derived mononuclear cells were capable of
improving tendon architecture but not biomechanical properties in a collagenase induced lesion
of the SDFT (Nixon et al., 2008). No studies have been completed at this time identifying the
contribution of UCB to tendon injury. Transplantation of bone marrow derived stem cells into
tendon lesions results in decreased lesion size and greater tendon density (Crovace et al., 2007;
Pacini et al., 2007). Because of the innate expression of both scleraxis and the stem cell markers
Oct4, nanog, and Sox2, UCB stem cells may provide a better source of regenerative stimulus
than adipose derived cells.
The beneficial effects of stem cells in tendon injury may be due to the population of cells
expressing scleraxis. Bone marrow, adipose and umbilical cord blood derived stem cells express
this transcription factor prior to any in vitro manipulation ((Kuo and Tuan, 2008), Figure 1). In
AdMSC and UCB, upregulation of scleraxis occurred in response to culture on matrigel. Culture
in a three dimensional gelatin environment also upregulated scx in BMSC (Kuo and Tuan, 2008).
Expression of scleraxis precedes that of tenascin c and collagen 1a2 in the developing embryo
(Kardon, 1998; Schweitzer et al., 2001). Overexpression of scleraxis increased the transcription
of col1a2 in NIH-3T3 fibroblasts (Lejard et al., 2007; Espira et al., 2009). Scleraxis appears to
bind to the proximal promoter region of col1a2 as a heterodimer with E47 (Lejard et al., 2007).
Expression of Col1a2 increases in AdMSC and UCB grown on matrigel (data not shown). These
data suggest that the upregulation of scleraxis is consistent with the induction of an early tendon-
like cell which expresses tenascin c and collagen1a2 as it matures. Scleraxis may, in fact, drive
the expression of the more mature markers of tendon development. The population of cells that
initially express scleraxis may give rise to daughter cells which express scleraxis and further
differentiate to more mature tenocytic cells under appropriate conditions.
113
Fibroblast growth factors are required for proper syndetome formation and induction of
tenocytic lineage. As such, the response of adipose and UCB derived stem cells to FGFs was
investigated. In this work, we show that AdMSC and UCB respond very differently to
stimulation by the FGFs. Interestingly, stimulation of AdMSC and UCB with FGF2 or FGF5
resulted in opposing effects on proliferation but similar ERK1/2 activation kinetics. Changes in
proliferation were dependent upon ERK1/2, as inclusion of PD98059 abrogates all differences.
These differences are likely due to different cellular contexts and possibly different FGF receptor
expression. FGF2 can signal through a number of FGF receptor isoforms, however FGF5 is more
limited and can only signal through FGFR1c and FGFR2 (Reviewed in Clements et al., 1993;
Eswarakumar et al., 2005). It is possible that the differences in response to the fibroblast growth
factors may also occur because of variations in ERK1 and ERK2 ratios, priming the cells toward
proliferation or differentiation. AdMSC tended to express lower amounts of ERK1 relative to
ERK2 than UCB stem cells. It is tempting to speculate that the ratio of ERK1:ERK2 is related to
the stemness of the population and the subsequent ability to respond to external signals. AdMSC
may express more ERK2 in order to respond to factors signaling for terminal differentiation.
Alternatively, UCB may have higher levels of ERK1 to retain the ability to respond to both
proliferation and differentiation signals to allow self-renewal of the stem cell population as well
as creation of daughter cells primed to differentiate. As might be expected, activation of ERK1
was also reduced compared to ERK2 phosphorylation following FGF stimulation in both cell
types. This may be a preferential response of the cells to growth factors or simply due to kinase
availability.
When cultured on matrigel, scx expression increases drastically in both UCB and AdMSC.
Matrigel is composed of a mixture of growth factors (including IGF-1, PDGF, TGF-β, and EGF)
114
and extracellular matrix components laminin, collagen IV and entactin, which form a complex
three dimensional matrix at 37 °C. Entactin enables the binding of laminin to collagen IV and
the formation of a complex structural matrix. Both AdMSC and UCB embedded into the
matrigel and formed colonies with distinct cellular morphology compared to cells on gelatin or
collagen coated beads. The differences in cell:cell contact or contact with a complex ECM may
be responsible for the upregulation of tenocytic genes. Integrin signaling activated by changes in
ECM can result in differentiation of a number of stem cell types. Integrin signaling was activated
by culture of hES cells on laminin and was related to an increase in ERK1/2 activation and
subsequent decrease in Nanog and SSEA1 expression (Hayashi et al., 2007). Laminin signaling
through alpha6/beta1 integrin may direct neural differentiation of hES cells (Ma et al., 2008).
Additionally, in the kidney alpha3/beta1 integrin signaling in coordination with c-Met regulates
Wnt expression, which is responsible for epithelial cell survival in the developing kidney (Liu et
al., 2009). Activation of integrin mediated RhoA and Rho-dependent kinase (ROCK) via cyclic
strain resulted in the upregulation of tenascin C in primary skin fibroblasts (Chiquet et al., 2004).
While no strain was applied to either AdMSC or UCB, the change in tension from a flat to a
three dimensional surface may have been significant enough to activate the integrin signaling
system. The ability of UCB to upregulate scleraxis in a complex environment supports the use
of these cells as a therapeutic aid. Tendons are composed primarily of type I collagen as well as
other minor collagen and non-collagen components. Initial tendon injuries are poorly organized
but gain structure during the healing process. UCB implanted into tendon injuries should be
capable of attachment to the tendon matrix and production of collagen and other matrix proteins.
The additional strain that occurs with movement may provide additional direction for UCB to
produce the required matrix proteins for proper healing.
115
In conclusion, we have further delineated the differences between adipose and umbilical
cord blood derived stem cells. While both cell types upregulate scleraxis expression in response
to culture on matrigel, they respond very differently to stimulation with fibroblast growth factors.
We have established culture conditions appropriate to induce an early tenocytic lineage. Further
work should clarify the mechanisms behind such changes.
116
Table 5-1. Real-time PCR primers
Primer Sequence
Expected Product Size, bp
Standard Curve Slope
Primer Efficiency,
% Col1A21 F – GCACATGCCGTGACTTGAGA
R–CATCCATAGTGCATCCTTGATTAGG 127 -3.39 97.24
TnC1 F – GGGCGGCCTGGAAATG R – CAGGCTCTAACTCCTGGATGATG
70 -3.34 99.25
ScxB1 F – TCTGCCTCAGCAACCAGAGA R – TCCGAATCGCCGTCTTTC
59 -3.35 98.84
Scx2 F – AGGACCGCGACAGAAAGAC R – CAGCACGTAGTGACCAGAAGAA
261 n/a n/a
18S1 F – GTAACCCGTTGAACCCCATT R – CCATCCAATCGGTAGTAGCG
151 -3.35 98.84
Pea32 F – GTGGCAGTTTCTGGTGGCCCTG R – GACTGGCCGGTCAAACTCAGCC
n/a n/a
Erm2 F – GAGAGACTGGAAGGCAAAGTC R – CCCAGCCACCTTCTGCATGATGC
n/a n/a
1 (Taylor et al., 2009) 2 Used for endpoint PCR only.
117
Table 5-2. Cycle threshold ranges Cell Type Transcript Mean ± SEM Min Max Median UCB 18S 13.72 ± 0.06 13.15 15.59 13.59 UCB Scx 30.72 ± 0.21 27.13 33.77 30.71 UCB TnC 21.89 ± 0.29 18.67 28.20 21.27 AdMSC 18S 13.59 ± 0.06 13.13 14.18 13.57 AdMSC Scx 31.19 ± 0.55 27.10 34.31 31.54 AdMSC TnC 22.33 ± 0.64 18.44 25.65 23.10
118
Figure 5-1. AdMSC and UCB express markers of tenocytic cells. Total RNA was isolated from AdMSC and UCB prior to PCR with gene-specific primers. Scleraxis and Tenasin C mRNA are present in AdMSC and UCB stem cells. Scx, scleraxis; TnC, Tenascin C.
119
Figure 5-2. Mouse scleraxis promoter with putative transcription factor binding sites. The minimal promoter is shown with putative transcription factor binding sites highlighted in bold.
120
Table 5-3. Putative transcription factor binding sites on the mouse scleraxis minimal promoter1. Factor Beg2 Sns3 Len4 Sequence La5 Lpv6 Sp1 288 N 11 GtGGGAGGAGC 20 0 EGR2 286 R 10 GCGGGGGcGG 18 0 Sp1 283 R 10 GGgGCGGGGG 18 0 Sp1 330 N 10 GCCCCACcCC 18 0 Sp1 289 N 10 GGGGcGGAGC 18 0 Sp1 289 N 10 tGGGAGGAGC 18 0 Sp1 37 N 10 GGGgCAGGGC 18 0 Sp1 270 R 9 GAGGCGGAG 18 0 Sp1 289 R 10 GGGGcGGAGC 18 0 POU1F1a 92 R 10 TTGATTaATT 18 0 GAGA factor 169 N 16 CGCTCNNNNNNGAgAG 18 0 Sp1 270 R 10 GAGGCGGAGc 18 0 Sp1 17 N 10 AGGGcGTGGC 18 0 Sp1 37 R 10 GGGgCAGGGC 18 0 CACCC-binding factor 16 R 10 CAGGGTGgGG 18 0 Sn 222 R 11 RAcAGGTGYAC 18 0 Sp1 288 N 10 GGGGGAGGgG 18 0 HNF-3B 87 N 12 VAWTrTTKRYTY 16.58 0 AP-2alpha 278 R 8 GGCCAGGC 16 0 AP-2alpha 24 R 8 GGCCAGGC 16 0 TEF-2 18 N 8 GGGTGTGG 16 0 HNF-4alpha 53 R 12 RTGRMCYTWGcM 16 0 AREB6 223 R 8 AAAGGTGC 16 0 AP-2 284 R 7 GCGCGGG 14 0 AP-2alpha 284 R 10 SSSNKGGGGA 14 0 AP-1 243 N 7 TGAGTAA 14 0 PuF 121 N 7 GGGTGGG 14 0 AP-1 c-Jun 7 N 7 AGAGTCA 14 0 CP2 170 N 11 GCNMNANCMAG 14 0 Nkx6-1 210 N 7 CTATTAA 14 0 MEF-2 210 R 10 YTATTtWWAR 14 0 myogenin 26 R 7 CCAGGCA 14 0 En-1 114 N 7 GTAGAAT 14 0 AP-1 c-Fos c-Jun 7 R 7 AGAGTCA 14 0 GATA-1 Sp1 121 R 7 GGGTGGG 14 0 GCN4 299 R 6 TGACTG 12 0 ZF5 283 N 6 GGCGCG 12 0 CACCC-binding factor 121 N 6 GGGTGG 12 0 FACB 30 R 17 GCANNNNNNNNNNNGGC 12 0 POU3F2 95 R 7 ATTWATK 12 0 GR 54 N 6 TGAACT 12 0 USF1 HES-1 234 N 6 CACGAG 12 0 Sp1 107 R 6 CTGCCC 12 0 RAP1 317 R 10 TGNNNGGNTG 12 0
121
Table 5-3 Continued. Factor Beg2 Sns3 Len4 Sequence La5 Lpv6 Sp1 329 R 6 GGCCCC 12 0 TTF-1 109 N 9 GCNCTNNAG 12 0 GCN4 8 R 6 GAGTCA 12 0 GCN4 TGA1a 8 N 6 GAGTCA 12 0 NFAT-1 A96 220 N 6 GGAAAA 12 0 c-Myb 166 R 6 AAACGC 12 0 Zeste 31 N 6 CACTCA 12 0 FACB 157 N 15 GCANNNNNNNNNCGC 12 0 AP-1 243 N 7 TGASTMA 12 0 c-Myb 55 N 6 GAACTT 12 0 Sp1 43 N 6 GGGCAG 12 0 GCN4 31 R 6 CACTCA 12 0 abaA 116 R 6 AGAATG 12 0 GCN4 86 N 6 TGATTC 12 0 AP-4 E12 46 R 6 CAGCTG 12 0 TTF-1 195 N 9 GCNCTNNAG 12 0 CAC-binding protein 158 R 6 CACCCC 12 0 Sp1 121 R 6 GGGTGG 12 0 Sp1 122 N 6 GGTGGG 12 0 Sp1 270 N 9 KRGGCKRRK 12 0 AP-4 E12 46 N 6 CAGCTG 12 0 TBP 306 N 6 TATAAA 12 0 Sp1 192 N 6 GGGGCC 12 0 GR 103 N 6 TCTTCT 12 0 Sp1 271 N 6 AGGCGG 12 0 Zeste 334 N 6 CACTCC 12 0 NFAT-1 220 R 6 GGAAAA 12 0 GCN4 244 R 6 GAGTAA 12 0 abaA 116 N 6 AGAATG 12 0 MBF-I 228 N 7 TGCRCRC 12 0 EGR-2 286 N 10 GCGGGGGAGG 17 0.0019 CAC-BF 17 R 9 AGGGTGTGG 15.18 0.0025 v-Jun 8 R 12 GAGTCAGACAGG 15.69 0.0037 EGR-1 286 R 9 GCGGGGGAG 14.64 0.0051 V$GC_01 287 N 14 CGGGGGAGGAGCTG 14.14 0.0065 HAP3 168 N 16 ACGCTCCAACCAGAAA 14.29 0.0092 HNF-4 53 N 12 GTGAACTTAGGC 12.81 0.0093 TEF2 18 N 8 GGGTGTGG 15.72 0.01 SBF 63 R 11 GCATGCCAGGA 14.1 0.01 1Identified using Transcription Element Search System (http://www.cbil.upenn.edu/cgi-bin/tess) 2 Beginning nucleotide 3 Sense, N = normal, R = reverse 4 Length of motif, in base pairs 5 Log-likelihood score, higher is stronger 6 Approximate p-value for La score
122
Figure 5-3. Scleraxis promoter activity is not increased by growth factor supplementation in UCB stem cells. C2C12 mesenchymal cells and UCB stem cells were transiently transfected with Scx-luc and supplemented with 50 ng/ml BMP6, 10 ng/ml FGF4 or 10 ng/ml FGF5 for 24 hours. Luciferase activity was measured from cell lysates. Relative luciferase units were calculated by dividing luciferase activity by renilla expression.
123
Figure 5-4. UCB stem cells express Erm, Pea3, and Scleraxis. RT-PCR was performed on UCB stem cells with gene specific primers as shown. 18S was included as an internal control. Scx = scleraxis.
124
30% Matrigel Collagen BeadGelatin
UCB
AdM
SC
Figure 5-5. UCB and AdMSC attach to various culture surfaces. UCB and AdMSC were cultured on gelatin coated plasticware, 30% Matrigel, or on collagen coated beads for 48 hours prior to fixation. Actin structures were stained with fluorescein conjugated phalloidin and nuclei were identified with Hoechst 33342 dye. Immunofluorescence was visualized using a TCS SP5 Laser Scanning Confocal Microscope running Leica LAS-AF. Scale bar = 10 µm
125
Figure 5-6. Culture in matrigel increases tenocyte gene expression. AdMSC and UCB stem cells were cultured on gelatin coated plasticware, collagen coated beads, or 30% matrigel for 48 hours prior to RNA isolation and real-time PCR with gene-specific primers. Culture on matrigel increased scleraxis expression in AdMSC and UCB. Tenascin C mRNA was also increased by culture on matrigel. Asterisk indicates p<0.05.
126
Figure 5-7. UCB and AdMSC respond uniquely to FGF stimulation. UCB and AdMSC were stimulated with 10 ng/ml FGF2, FGF4, or FGF5 for the times shown. Protein extracts were probed with antibodies specific to phosphorylated and total ERK1/2. Tubulin antibodies were used as a loading control.
127
Figure 5-8. Fibroblast growth factors stimulate proliferation of AdMSC and UCB stem cells in a MAPK dependent manner. AdMSC and UCB stem cells were cultured in low serum media supplemented with 10 ng/ml FGF2 or FGF5 in the presence or absence of PD98059. Prior to fixation, cells were pulsed with BrdU. FGF2 inhibited proliferation of UCB but stimulated AdMSC division. FGF5 increased proliferation of UCB stem cells.
128
Figure 5-9. Culture conditions affect tenocyte gene expression in AdMSC and UCB. AdMSC and UCB stem cells were cultured for 48 hours in low serum media containing 10 ng/ml FGF2 or FGF5. Total RNA was isolated and subjected to real-time PCR with gene specific primers for scleraxis and tenascin C. Matrigel increased expression of scleraxis in UCB stem cells (A). There was no effect of matrix or FGF stimulation on TnC in UCB (B). Scleraxis expression in AdMSC was increased by culture on matrigel (C). Matrigel increased Tenascin C mRNA in AdMSC (D). This was further increased by supplementation with FGF2 or FGF5.
129
Figure 5-10. FGF5 supplementation does not affect UCB actin structure. UCB stem cells were serum starved for one hour prior to treatment with FGF5 or growth media. Cells were fixed at 0, 10 and 30 minutes prior to visualizing actin structures with fluorescein conjugated phalloidin. Nuclei were stained with Hoechst 33342. SF = serum free media, FGF5 = FGF5 containing media, GM = growth media. Scale bar = 10 µm
130
Figure 5-11. FGF2 and FGF5 do no activate Akt in UCB (A) or AdMSC (B). Cells were treated with 10 ng/ml of FGF2 or FGF5 and lysed at the time points shown. Blots were probed for phosphorylated and total Akt.
131
CHAPTER 6 SUMMARY AND CONCLUSIONS
A hierarchy exists such that embryonic stem cells retain the most plasticity while bone
marrow and adult stem cells are much more limited in their potential. Umbilical cord blood
derived stem cells retain characteristics of naïve ES cells in that they express Oct4, nanog, Sox2,
Klf4 and c-myc transcripts. Surface markers Tra1-60, Tra1-81, SSEA1 and minor amounts of
SSEA4 are also present in UCB. This population of equine stem cells can be isolated using
conventional human protocols and reagents. Proper culture conditions result in cells that can be
maintained in a proliferative state for up to fifteen passages or approximately 22 population
doublings. When cultured in appropriate media, UCB differentiate into proteoglcyan expressing
chondrocytes or calcium producing osteocytes. UCB can also enter the hepatic pathway and
form albumin producing hepatocytes. However, these cells possess limited ability to form
adipocytes and myocytes. In comparison, equine adipose derived mesenchymal stem cells
express fewer markers of stemness, lacking SSEA1, SSEA4, nanog, Sox2, and Klf4. AdMSC
lack the ability to differentiate into the immature myocytes or adipocytes formed by UCB.
Early cultures of UCB possess small colonies reminiscent of ES colonies that are lost with
time in culture. Alternate culture conditions were assessed to determine more optimal conditions
to maintain stem cell proliferation as well as maintenance of stemness. Culture in a combination
of thrombopoietin, Flt3, and c-kit or media conditioned by confluent UCB resulted in
morphology reminiscent of replicative senescence. Growth in conventional growth media (GM)
or growth media supplemented with bFGF (GM+FGF) supported cell proliferation and
morphology typical of MSC. Population doubling times were shorter in cells that did not receive
FGF supplementation. Further culture on a protein matrix (collagen, fibronectin, or laminin)
increased proliferation rates in cells cultured in GM or GM+FGF. Expression of stem cell
132
markers nanog and Sox2 were gradually lost with time in culture, however Oct4 expression
remained.
Unmanipulated UCB and AdMSC express the bHLH transcription factor scleraxis, which
is crucial to the development of flexor tendons. Culture on the complex protein matrix Matrigel
resulted in the upregulation of scleraxis in both AdMSC and UCB stem cells. In Matrigel cells
form tight colonies while they retain their fibroblast-like morphology when grown on gelatin or
collagen coated surfaces. Supplementation of FGF2 or FGF5 resulted in changes in proliferation
of both cell types, but had limited effects on scleraxis or tenascin c mRNA expression compared
to culture on matrigel alone.
Overall, this work highlights the potential of equine umbilical cord blood derived stem
cells as not only a therapeutic aid for horses but as a model system for human medicine. The
cells appear to be more naïve than either bone marrow or adipose derived stem cells yet do not
retain the tumorigenicity of embryonic stem cells. The ability to form immature myocytes as
well as hepatocytes suggests that UCB have greater plasticity than other adult stem cells. This
may be a result of a less restrictive epigenetic status than adipose derived stem cells. This open
genome structure likely allows for greater plasticity and naiveté. The apparent inability of UCB
and AdMSC to efficiently differentiate into adipose tissue was surprising but reflects other work
in the literature. In truth, the inefficiency of adipocyte formation is a positive aspect from a
clinical aspect as these cells may be less likely to precociously differentiate into that cell type if
used in vivo.
While initial populations express all of the common markers of a naïve stem cell (Oct4,
nanog, Sox2, and Klf4), the majority of these markers are lost with time in culture. This may
reflect one of several possibilities: (1) UCB stem cells may be differentiating to a more mature
133
cell type, (2) a small population of naïve stem cells express these markers and this cell type is
essentially diluted out in culture due to slower proliferation, (3) a small population of naïve stem
cells exist but are not maintained due to inappropriate culture conditions. High density, early
passage cultures contain a small number of dense colonies with morphology reminiscent of ES
cell colonies. These colonies may contain cells that are more naïve than those that grow in
monolayer culture. It is tempting to speculate that the cells which form these colonies are those
that contain the stem cell markers found in early cultures, but with passage are greatly
outnumbered by other cell types. This is further supported by the notion that generally more
naïve stem cells proliferate slowly and thus would not be expected to create as many daughter
cells as the cells which grow on a monolayer. Thus, the colony forming cells may be the true
stem cells while those which grow in a monolayer are more limited precursor cells. Further
work should evaluate the subpopulations within UCB stem cells to identify cells that may be
more or less useful in various therapeutic settings or as a model for human medicine.
The differential response of AdMSC and UCB to stimulation by fibroblast growth factors
further highlights the differences between the two cell types. It is interesting to note that while
both respond to FGF2 and FGF5 stimulation by phosphorylating ERK1/2 and activating the
MAPK pathway, there are some significant differences in the type of response. In general,
AdMSC appear to have less total ERK1 than UCB, resulting in a different ratio of the two
kinases. This may be a reflection of cells poised either for terminal differentiation or for
proliferation prior to differentiation. In other cell types, strong phosphorylation of ERK2 occurs
in response to differentiation signals, while ERK1 responses are associated with proliferation.
The response of ERK1 to stimulation by FGFs was weak in both cell types; ERK2
phosphorylation in response to FGF was predominant. However, UCB retain higher amounts of
134
ERK1 than AdMSC which may allow them to better respond to other mitogenic factors. This
may suggest that a more naïve stem cell may have a higher ratio of ERK1:ERK2 than more
differentiated cell types. These cells may be poised to respond to extracellular factors differently
than AdMSC.
The expression of low levels of scleraxis in immature cells is not surprising, as many stem
cells exist in a state poised for differentiation and transcribe low levels of mRNAs required for
that transformation. Not only is scleraxis upregulated in cells grown on Matrigel, but the
morphology of the cells changes drastically. The response of UCB to Matrigel is exciting and
presents many possibilities for future research. The changes in gene transcription may or may
not be directly related to the change in morphology. Integrin signaling and interaction with other
ECM components likely result in changes that may allow differentiation. The growth factor
concentrations and/or combinations present in Matrigel may signal for transcriptional changes
independent of the structure of the extracellular matrix. Alternatively, the changes may result
from changes in tensional stress, ligand:receptor interactions with the extracellular matrix, or
differences in cell:cell contact. Likely, a combination of stimuli allow for the formation of a
cluster of cells similar to tendon precursor cells. Complete differentiation is not recorded at this
stage, likely for a variety of reasons. The combination of growth factors that initiates early
tendon precursor development is likely not sufficient for complete maturation. Another
combination or different ratios of growth factors could help complete the transition. In vivo,
tendon cells are subjected to a high degree of strain on a daily basis as a result of movement.
Many cell types require cyclic or tensional stress to completely differentiate and it would be
extremely surprising were it not also true for tendon cells. Adding strain to UCB cultured in
135
Matrigel may stimulate the production and secretion of matrix proteins required for tendon repair
and/or maintenance.
Equine UCB provide more than a potential therapeutic aid for injuries in the horse. The
horse provides an excellent model of athletic tendon injury in the human, as injuries to the SDFT
correlate extremely well to injuries of the Achilles tendon, a frequent spot of injury in human
athletes. Horses are treated as athletes and undergo similar training programs as human athletes.
Overtraining and overuse injuries result in setbacks in training and competition in both species.
Equine umbilical cord blood derived stem cells are readily available and possess characteristics
of human UCB stem cells, making them an attractive choice for a model of human medicine.
The horse provides a useful model of injury and can be used to determine the usefulness of UCB
in treating tendon and other musculoskeletal injuries.
136
APPENDIX A SUPPLEMENTARY DATA
Mouse Embryonic Stem Cell Culture and Differentiation
Mouse embryonic stem cells (mES) are commonly used to study the developmental
processes that occur in an ordered manner in the developing embryo. Under proper conditions,
mES cells can be maintained in a proliferative, pluripotent state. However, mES cells can also
undergo spontaneous or directed differentiation to form cells from all three germ layers. In
culture medium containing leukemia inhibitory factor (LIF), mES cells maintain a pluripotent
phenotype. Cells grow in colonies with light refractile edges (Figure A-1A). Individual cells
can rarely be distinguished from the colony. As colonies grow in an unrestricted manner (i.e.
without fresh media or appropriate passaging), the cells will begin differentiating into a wide
variety of cell type. Initially, colonies develop a ring of epithelial cells that surround the colony
(Figure A-1B). Cells remaining in the inner portion during this stage may retain greater levels of
pluripotency. However, with continuing differentiation, cells migrate away from the colony,
forming a monolayer with cells of a wide variety of phenotypes (Figure A-1C).
Formation of embroid bodies (EBs) allows for a more synchronous protocol for
differentiation. This process allows an individual cell to form a colony which can then be treated
and compared with other colonies (also from a single cell). Naïve mES colonies are washed off
the tissue culture plate and placed in suspension culture in media lacking LIF. The EBs cannot
easily attach and are forced to grow into larger spherical colonies. Individual EBs can then be
placed back onto tissue culture dishes and allowed to fully differentiate in media lacking LIF.
Spontaneous differentiation results in the formation of a wide variety of cell types, including
neural, myogenic, and hepatogenic cells (Figure A-2).
137
Alternative UCB Differentiation Protocols
Following is a brief description of differentiation protocols that were tested on UCB stem
cells but were not reported in earlier work due to the lack of success.
Myogenic Differentiation
UCB stem cells were plated on gelatin coated plasticware and cultured in DMEM
containing 10% FBS and 10 µM azacytidine for 24 hours. The media was subsequently replaced
with low glucose DMEM containing 5% FBS. Cells were continuously cultured in this media for
up to three weeks. No evidence of myogenic differentiation was found. RT-PCR for the
myogenic regulatory factors MyoD and Myf5 was negative. No immunostaining of desmin or
myosin heavy chain could be detected.
Neural Differentiation
To initiate neural differentiation, three protocols were attempted. The first two protocols
contain the same basic components but included either low or high amounts of FBS (2% and
10%, respectively). This medium was based on αMEM and contained 10 ng/ml PDGF, 10 ng/ml
bFGF and 10 ng/ml EGF in addition to serum. The third media was DMEM supplemented with
15% FBS, 20 ng/ml bFGF, 50 ng/ml neural growth factor (NGF) and 0.5 mM IBMX. Cells were
maintained in these media for up to three weeks. Following culture time, cells were
immunostained for nestin, glial fibrillary acidic protein (GFAP), and beta-3-tubulin. No
immunoreactivity was apparent at any time.
Adipogenic Differentiation
Three protocols for adipogenic differentiation were attempted during this study. The
previously described protocol gave the greatest level of success and is thus the protocol of choice
for UCB. However, it should be noted that the efficiency of differentiation remained extremely
low. A low glucose DMEM based media containing 10% FBS, 1 µM dexamethasone, 0.5 mM
138
IBMX, 100 µM indomethacin, and 10 ng/ml insulin was used to culture cells for up to three
weeks. The second protocol used αMEM supplemented with 10% FBS, 1 µM dexamethasone,
0.5mM IBMX, 50 µM indomethacin, and 5 ng/ml insulin. As rabbit serum has been shown to
increase the efficiency of adipogenic differentiation, it was substituted for FBS in all media as an
additional set of media concoctions. Neither media presented here (whether supplemented with
FBS or rabbit serum) produced cells that stained positive for Oil Red O or contained lipid
vacuoles. Only limited success was noted with the previously described protocol, which was not
enhanced by the inclusion of rabbit serum.
Quantification of Oct4, nanog, and Sox2 Across Time in Culture
To quantify expression of Oct4, nanog, and Sox2 in UCB stem cells across time in culture,
real time PCR was performed. Multiple primer sets were tested by end point PCR for Oct4.
Those primer sets that produced a single band of the appropriate size were then tested by real
time PCR, using a standard curve method. While a number of primer sets provided a product
after end point PCR, real time PCR results were inconsistent. The dissociation curves for Oct4
had multiple peaks, indicating the presence of multiple products. Dissociation curves for the
positive control samples (mES) contained a single peak. The single peak found in curves from
mES samples overlapped one of the peaks found in the dissociation curve for UCB samples,
indicating the presence of the correct transcript. It is important to note that the magnitude of the
peak was much higher in mES samples than UCB samples.
Standard curves were performed to ensure that the values obtained were within a linear
range. The curves obtained for the internal control (18S) had a slope of -3.325 and R2 value of
0.994 indicating nearly 100% primer efficiency and an appropriate standard curve on which to
base quantifications. However, Oct4, nanog and Sox2 lacked standard curves that were
139
consistent across multiple plates. Moreover, these curves had slopes indicating less than 75%
primer efficiency.
Multiple primer sets were tested to ensure the results obtained were not simply due to
inefficient primers. All primers resulted in inefficient standard curves and poor dissociation
curves with multiple peaks. Increasing the annealing temperature also had no effect on the
multiple peaks of the dissociation curve.
Importantly, reactions that lacked reverse transcriptase in the cDNA amplification process
contained no product in either end point or real time PCR. It should also be noted that internal
controls amplified a single band in end point that reflects the single peak in the dissociation
curve in UCB as well as mES. Further work on these transcripts was discontinued, as they were
not the primary focus of the project.
140
Figure A-1. Stages of mES colony differentiation. Naïve mES colonies maintain a compact shape with no discernable individual cells (A, day one). More differentiated colonies often have a ring of epithelial cells surrounding a more densely packed core (B, day two). Fully differentiating cells adopt the morphology of their mature cell type and are commonly found in monolayers on the culture surface (C, day 5). Scale bar = 10 µm
141
Figure A-2. mES embroid bodies differentiate into a variety of cell types. mES stem cells were allowed to spontaneously differentiate. Following differentiation cells were fixed in 4% paraformaldehyde and immunostained for myosin heavy chain (A), nestin (B), and cytokeratin 18 (C). Hoechst 33342 was used to visualize nuclei.
142
APPENDIX B TABLE OF PRIMER SEQUENCES
Table B-1. Primer sequences and sources.
Primer Sequence Size, bp Source
Col1A2 F – GCACATGCCGTGACTTGAGA R–CATCCATAGTGCATCCTTGATTAGG
127 Taylor et al., 2009
TnC F – GGGCGGCCTGGAAATG R – CAGGCTCTAACTCCTGGATGATG
70 Taylor et al., 2009
ScxB F – TCTGCCTCAGCAACCAGAGA R – TCCGAATCGCCGTCTTTC
59 Taylor et al., 2009
Scx F – AGGACCGCGACAGAAAGAC R – CAGCACGTAGTGACCAGAAGAA
261 NM_001105150.1
18S F – GTAACCCGTTGAACCCCATT R – CCATCCAATCGGTAGTAGCG
151 Taylor et al., 2009
Pea3 F – GTGGCAGTTTCTGGTGGCCCTG R – GACTGGCCGGTCAAACTCAGCC
315 XM_001917508.1
Erm F – GAGAGACTGGAAGGCAAAGTC R – CCCAGCCACCTTCTGCATGATGC
293 XM_001499099.1
GAPDH F – GATTCCACCCATGGCAAGTTCCATGGCAC R – GCATCGAAGGTGGAAGAGTGGGTGTCACT
688 XM_001496020
Col2A1 F – CAGCTATGGAGATGACAACCTGGC R – CGTGCAGCCATCCTTCAGGACAG
240 NM_001081764.1
Sox9 F – GCTCCCAGCCCCACCATGTCCG R – CGCCTGCGCCCACACCATGAAG
293 XM_001498424.2
Osteonectin F – CCCATCAATGGGGTGCTGGTCC R – GTGAAAAAGATGCACGAGAATGAG
149 NM_001143953.1
RunX2 F – CGTGCTGCCATTCGAGGTGGTGG R – CCTCAGAACTGGGCCCTTTTTCAG
350 XM_001502519.2
Albumin F – AACTCTTCGTGCAACCTACGGTGA R – AATTTCTGGCTCAGGCGAGCTACT
431 NM_001082503.1
Cytokeratin 18
F – GGATGCCCCCAAATCTCAGGACC R – GGGCCAGCTCAGACTCCAGGTGC
340 XM_001490377.1
GAPDH, realtime
F – GAGATCCCGCCAACATC R – CTGACAATCTTCAGGGAATTGTC
207 XM_001496020.1
Oct4 F – GCTGCAGAAGTGGGTGGAGGAAGC R – GCCTGGGGTACCAAAATGGGGCCC
363 XM_001490108.2
Nanog F – GTCTCTCCTCTGCCTTCCTCCATGG R – CCTGTTTGTAGCTAAGGTTCAGGATG
267 XM_001498808.1
Sox2 F – AACGGCAGCTACAGCATGA R – TGGAGTGGGAGGAAGAGGTA
282 NM_001143799.1
Klf4 F – TGGGCAAGTTTGTGTTGAAG R – TGACAGTCCCTGTTGCTCAG
336 XM_001492956.2
c-myc F – GACGGTAGCTCGCCCAAG R – ACCCCGATTCTGACCTTTTG
240 XM_001497991.2
143
Table B-1 Continued.
Primer Sequence Size, bp Source
Jagged-1 F – GCCTGGTGACAGCCTTCTAC R – GGGGCTTCTCCTCTCTGTCT
305 XM_001495238.2
Jagged-2 F – CATGATCAACCCCGAGGAC R – CGTACTGGTCGCAGGTGTAG
169 XM_001494763.2
Notch-1 F – GAGGACCTGGAGACCAAGAAGGTTC R – AGATGAAGTCGGAGATGACGGC
297 XM_001498582.2
Notch-2 F – GCAGGAGCAGGAGGTGATAG R – GCGTTTCTTGGACTCTCCAG
188 NM_010928.2
Notch-3 F – GTCCAGAGGCCAAGAGACTG R – CAGAAGGAGGCCAGCATAAG
219 NM_008716.2
Dll-1 F – ACCTTCTTTCGCGTATGCCTCAAG R – AGAGTCTGTATGGAGGGCTTC
221 NM_007865.3
Dll-4 F – CGAGAGCAGGGAAGCCATGA R – CCTGCCTTATACCTCTGTGG
378 NM_019454.2
144
LIST OF REFERENCES
Amit, M., Carpenter, M.K., Inokuma, M.S., Chiu, C.P., Harris, C.P., Waknitz, M.A., Itskovitz-Eldor, J., and Thomson, J.A. (2000). Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Developmental biology 227, 271-278.
Aoi, T., Yae, K., Nakagawa, M., Ichisaka, T., Okita, K., Takahashi, K., Chiba, T., and Yamanaka, S. (2008). Generation of pluripotent stem cells from adult mouse liver and stomach cells. Science (New York, N.Y 321, 699-702.
Aoki, M., Yasutake, M., and Murohara, T. (2004). Derivation of functional endothelial progenitor cells from human umbilical cord blood mononuclear cells isolated by a novel cell filtration device. Stem cells (Dayton, Ohio) 22, 994-1002.
Arinzeh, T.L., Peter, S.J., Archambault, M.P., van den Bos, C., Gordon, S., Kraus, K., Smith, A., and Kadiyala, S. (2003). Allogeneic mesenchymal stem cells regenerate bone in a critical-sized canine segmental defect. The Journal of bone and joint surgery 85-A, 1927-1935.
Arney, K.L., and Fisher, A.G. (2004). Epigenetic aspects of differentiation. Journal of cell science 117, 4355-4363.
Arnhold, S.J., Goletz, I., Klein, H., Stumpf, G., Beluche, L.A., Rohde, C., Addicks, K., and Litzke, L.F. (2007). Isolation and characterization of bone marrow-derived equine mesenchymal stem cells. American journal of veterinary research 68, 1095-1105.
Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., and Lovell-Badge, R. (2003). Multipotent cell lineages in early mouse development depend on SOX2 function. Genes & development 17, 126-140.
Awad, H.A., Boivin, G.P., Dressler, M.R., Smith, F.N., Young, R.G., and Butler, D.L. (2003). Repair of patellar tendon injuries using a cell-collagen composite. J Orthop Res 21, 420-431.
Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jorgensen, H.F., John, R.M., Gouti, M., Casanova, M., Warnes, G., Merkenschlager, M., and Fisher, A.G. (2006). Chromatin signatures of pluripotent cell lines. Nature cell biology 8, 532-538.
Baal, N., Reisinger, K., Jahr, H., Bohle, R.M., Liang, O., Munstedt, K., Rao, C.V., Preissner, K.T., and Zygmunt, M.T. (2004). Expression of transcription factor Oct-4 and other embryonic genes in CD133 positive cells from human umbilical cord blood. Thrombosis and haemostasis 92, 767-775.
Babaie, Y., Herwig, R., Greber, B., Brink, T.C., Wruck, W., Groth, D., Lehrach, H., Burdon, T., and Adjaye, J. (2007). Analysis of Oct4-dependent transcriptional networks regulating self-renewal and pluripotency in human embryonic stem cells. Stem cells (Dayton, Ohio) 25, 500-510.
145
Baddoo, M., Hill, K., Wilkinson, R., Gaupp, D., Hughes, C., Kopen, G.C., and Phinney, D.G. (2003). Characterization of mesenchymal stem cells isolated from murine bone marrow by negative selection. Journal of cellular biochemistry 89, 1235-1249.
Baird, A., Schubert, D., Ling, N., and Guillemin, R. (1988). Receptor- and heparin-binding domains of basic fibroblast growth factor. Proceedings of the National Academy of Sciences of the United States of America 85, 2324-2328.
Bartunek, J., Croissant, J.D., Wijns, W., Gofflot, S., de Lavareille, A., Vanderheyden, M., Kaluzhny, Y., Mazouz, N., Willemsen, P., Penicka, M., Mathieu, M., Homsy, C., De Bruyne, B., McEntee, K., Lee, I.W., and Heyndrickx, G.R. (2007). Pretreatment of adult bone marrow mesenchymal stem cells with cardiomyogenic growth factors and repair of the chronically infarcted myocardium. American journal of physiology 292, H1095-1104.
Battula, V.L., Bareiss, P.M., Treml, S., Conrad, S., Albert, I., Hojak, S., Abele, H., Schewe, B., Just, L., Skutella, T., and Buhring, H.J. (2007). Human placenta and bone marrow derived MSC cultured in serum-free, b-FGF-containing medium express cell surface frizzled-9 and SSEA-4 and give rise to multilineage differentiation. Differentiation; research in biological diversity 75, 279-291.
Benavente, C.A., Sierralta, W.D., Conget, P.A., and Minguell, J.J. (2003). Subcellular distribution and mitogenic effect of basic fibroblast growth factor in mesenchymal uncommitted stem cells. Growth factors (Chur, Switzerland) 21, 87-94.
Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., Jaenisch, R., Wagschal, A., Feil, R., Schreiber, S.L., and Lander, E.S. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315-326.
Bi, W., Deng, J.M., Zhang, Z., Behringer, R.R., and de Crombrugghe, B. (1999). Sox9 is required for cartilage formation. Nature genetics 22, 85-89.
Bianchi, G., Banfi, A., Mastrogiacomo, M., Notaro, R., Luzzatto, L., Cancedda, R., and Quarto, R. (2003). Ex vivo enrichment of mesenchymal cell progenitors by fibroblast growth factor 2. Experimental cell research 287, 98-105.
Bieback, K., Kern, S., Kluter, H., and Eichler, H. (2004). Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood. Stem cells (Dayton, Ohio) 22, 625-634.
Boeuf, H., Hauss, C., Graeve, F.D., Baran, N., and Kedinger, C. (1997). Leukemia inhibitory factor-dependent transcriptional activation in embryonic stem cells. The Journal of cell biology 138, 1207-1217.
Bonanno, G., Perillo, A., Rutella, S., De Ritis, D.G., Mariotti, A., Marone, M., Meoni, F., Scambia, G., Leone, G., Mancuso, S., and Pierelli, L. (2004). Clinical isolation and functional characterization of cord blood CD133+ hematopoietic progenitor cells. Transfusion 44, 1087-1097.
146
Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther, M.G., Kumar, R.M., Murray, H.L., Jenner, R.G., Gifford, D.K., Melton, D.A., Jaenisch, R., and Young, R.A. (2005). Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122, 947-956.
Boyer, L.A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L.A., Lee, T.I., Levine, S.S., Wernig, M., Tajonar, A., Ray, M.K., Bell, G.W., Otte, A.P., Vidal, M., Gifford, D.K., Young, R.A., and Jaenisch, R. (2006). Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441, 349-353.
Brandenberger, R., Wei, H., Zhang, S., Lei, S., Murage, J., Fisk, G.J., Li, Y., Xu, C., Fang, R., Guegler, K., Rao, M.S., Mandalam, R., Lebkowski, J., and Stanton, L.W. (2004). Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation. Nature biotechnology 22, 707-716.
Brent, A.E., Schweitzer, R., and Tabin, C.J. (2003). A somitic compartment of tendon progenitors. Cell 113, 235-248.
Brent, A.E., and Tabin, C.J. (2004). FGF acts directly on the somitic tendon progenitors through the Ets transcription factors Pea3 and Erm to regulate scleraxis expression. Development (Cambridge, England) 131, 3885-3896.
Brodke, D., Pedrozo, H.A., Kapur, T.A., Attawia, M., Kraus, K.H., Holy, C.E., Kadiyala, S., and Bruder, S.P. (2006). Bone grafts prepared with selective cell retention technology heal canine segmental defects as effectively as autograft. J Orthop Res 24, 857-866.
Brown, D., Wagner, D., Li, X., Richardson, J.A., and Olson, E.N. (1999). Dual role of the basic helix-loop-helix transcription factor scleraxis in mesoderm formation and chondrogenesis during mouse embryogenesis. Development (Cambridge, England) 126, 4317-4329.
Bruder, S.P., Kurth, A.A., Shea, M., Hayes, W.C., Jaiswal, N., and Kadiyala, S. (1998). Bone regeneration by implantation of purified, culture-expanded human mesenchymal stem cells. J Orthop Res 16, 155-162.
Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P., Jones, R.S., and Zhang, Y. (2002). Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science (New York, N.Y 298, 1039-1043.
Carlin, R., Davis, D., Weiss, M., Schultz, B., and Troyer, D. (2006). Expression of early transcription factors Oct-4, Sox-2 and Nanog by porcine umbilical cord (PUC) matrix cells. Reprod Biol Endocrinol 4, 8.
Castellani, L.W., Gargalovic, P., Febbraio, M., Charugundla, S., Jien, M.L., and Lusis, A.J. (2004). Mechanisms mediating insulin resistance in transgenic mice overexpressing mouse apolipoprotein A-II. Journal of lipid research 45, 2377-2387.
147
Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S., and Smith, A. (2003). Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113, 643-655.
Chan, J., O'Donoghue, K., Gavina, M., Torrente, Y., Kennea, N., Mehmet, H., Stewart, H., Watt, D.J., Morgan, J.E., and Fisk, N.M. (2006). Galectin-1 induces skeletal muscle differentiation in human fetal mesenchymal stem cells and increases muscle regeneration. Stem cells (Dayton, Ohio) 24, 1879-1891.
Chan, J., Waddington, S.N., O'Donoghue, K., Kurata, H., Guillot, P.V., Gotherstrom, C., Themis, M., Morgan, J.E., and Fisk, N.M. (2007). Widespread distribution and muscle differentiation of human fetal mesenchymal stem cells after intrauterine transplantation in dystrophic mdx mouse. Stem cells (Dayton, Ohio) 25, 875-884.
Chang, F., Ishii, T., Yanai, T., Mishima, H., Akaogi, H., Ogawa, T., and Ochiai, N. (2008a). Repair of large full-thickness articular cartilage defects by transplantation of autologous uncultured bone-marrow-derived mononuclear cells. J Orthop Res 26, 18-26.
Chang, S.A., Lee, E.J., Kang, H.J., Zhang, S.Y., Kim, J.H., Li, L., Youn, S.W., Lee, C.S., Kim, K.H., Won, J.Y., Sohn, J.W., Park, K.W., Cho, H.J., Yang, S.E., Oh, W.I., Yang, Y.S., Ho, W.K., Park, Y.B., and Kim, H.S. (2008b). Impact of myocardial infarct proteins and oscillating pressure on the differentiation of mesenchymal stem cells: effect of acute myocardial infarction on stem cell differentiation. Stem cells (Dayton, Ohio) 26, 1901-1912.
Chang, Y.J., Tseng, C.P., Hsu, L.F., Hsieh, T.B., and Hwang, S.M. (2006). Characterization of two populations of mesenchymal progenitor cells in umbilical cord blood. Cell biology international 30, 495-499.
Chen, H.K., Hung, H.F., Shyu, K.G., Wang, B.W., Sheu, J.R., Liang, Y.J., Chang, C.C., and Kuan, P. (2005). Combined cord blood stem cells and gene therapy enhances angiogenesis and improves cardiac performance in mouse after acute myocardial infarction. European journal of clinical investigation 35, 677-686.
Chen, J., Sanberg, P.R., Li, Y., Wang, L., Lu, M., Willing, A.E., Sanchez-Ramos, J., and Chopp, M. (2001). Intravenous administration of human umbilical cord blood reduces behavioral deficits after stroke in rats. Stroke; a journal of cerebral circulation 32, 2682-2688.
Chen, S.S., Fitzgerald, W., Zimmerberg, J., Kleinman, H.K., and Margolis, L. (2007). Cell-cell and cell-extracellular matrix interactions regulate embryonic stem cell differentiation. Stem cells (Dayton, Ohio) 25, 553-561.
Cheng, T., Rodrigues, N., Shen, H., Yang, Y., Dombkowski, D., Sykes, M., and Scadden, D.T. (2000). Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science (New York, N.Y 287, 1804-1808.
Chenn, A., and McConnell, S.K. (1995). Cleavage orientation and the asymmetric inheritance of Notch1 immunoreactivity in mammalian neurogenesis. Cell 82, 631-641.
148
Cheshier, S.H., Morrison, S.J., Liao, X., and Weissman, I.L. (1999). In vivo proliferation and cell cycle kinetics of long-term self-renewing hematopoietic stem cells. Proceedings of the National Academy of Sciences of the United States of America 96, 3120-3125.
Chew, J.L., Loh, Y.H., Zhang, W., Chen, X., Tam, W.L., Yeap, L.S., Li, P., Ang, Y.S., Lim, B., Robson, P., and Ng, H.H. (2005). Reciprocal transcriptional regulation of Pou5f1 and Sox2 via the Oct4/Sox2 complex in embryonic stem cells. Molecular and cellular biology 25, 6031-6046.
Chiquet, M., Sarasa-Renedo, A., and Tunc-Civelek, V. (2004). Induction of tenascin-C by cyclic tensile strain versus growth factors: distinct contributions by Rho/ROCK and MAPK signaling pathways. Biochimica et biophysica acta 1693, 193-204.
Choi, S.C., Kim, S.J., Choi, J.H., Park, C.Y., Shim, W.J., and Lim, D.S. (2008). Fibroblast growth factor-2 and -4 promote the proliferation of bone marrow mesenchymal stem cells by the activation of the PI3K-Akt and ERK1/2 signaling pathways. Stem cells and development 17, 725-736.
Clase, K.L., Mitchell, P.J., Ward, P.J., Dorman, C.M., Johnson, S.E., and Hannon, K. (2000). FGF5 stimulates expansion of connective tissue fibroblasts and inhibits skeletal muscle development in the limb. Dev Dyn 219, 368-380.
Clegg, P.D., Strassburg, S., and Smith, R.K. (2007). Cell phenotypic variation in normal and damaged tendons. International journal of experimental pathology 88, 227-235.
Clements, D.A., Wang, J.K., Dionne, C.A., and Goldfarb, M. (1993). Activation of fibroblast growth factor (FGF) receptors by recombinant human FGF-5. Oncogene 8, 1311-1316.
Crovace, A., Lacitignola, L., De Siena, R., Rossi, G., and Francioso, E. (2007). Cell therapy for tendon repair in horses: an experimental study. Veterinary research communications 31 Suppl 1, 281-283.
Cserjesi, P., Brown, D., Ligon, K.L., Lyons, G.E., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., and Olson, E.N. (1995). Scleraxis: a basic helix-loop-helix protein that prefigures skeletal formation during mouse embryogenesis. Development (Cambridge, England) 121, 1099-1110.
Cummings, B.J., Uchida, N., Tamaki, S.J., Salazar, D.L., Hooshmand, M., Summers, R., Gage, F.H., and Anderson, A.J. (2005). Human neural stem cells differentiate and promote locomotor recovery in spinal cord-injured mice. Proceedings of the National Academy of Sciences of the United States of America 102, 14069-14074.
Dani, C., Chambers, I., Johnstone, S., Robertson, M., Ebrahimi, B., Saito, M., Taga, T., Li, M., Burdon, T., Nichols, J., and Smith, A. (1998). Paracrine induction of stem cell renewal by LIF-deficient cells: a new ES cell regulatory pathway. Developmental biology 203, 149-162.
149
Dorotka, R., Windberger, U., Macfelda, K., Bindreiter, U., Toma, C., and Nehrer, S. (2005). Repair of articular cartilage defects treated by microfracture and a three-dimensional collagen matrix. Biomaterials 26, 3617-3629.
Dowling, B.A., Dart, A.J., Hodgson, D.R., and Smith, R.K. (2000). Superficial digital flexor tendonitis in the horse. Equine veterinary journal 32, 369-378.
Dvorak, P., Dvorakova, D., Koskova, S., Vodinska, M., Najvirtova, M., Krekac, D., and Hampl, A. (2005). Expression and potential role of fibroblast growth factor 2 and its receptors in human embryonic stem cells. Stem cells (Dayton, Ohio) 23, 1200-1211.
Edom-Vovard, F., Schuler, B., Bonnin, M.A., Teillet, M.A., and Duprez, D. (2002). Fgf4 positively regulates scleraxis and tenascin expression in chick limb tendons. Developmental biology 247, 351-366.
Espira, L., Lamoureux, L., Jones, S.C., Gerard, R.D., Dixon, I.M., and Czubryt, M.P. (2009). The basic helix-loop-helix transcription factor scleraxis regulates fibroblast collagen synthesis. Journal of molecular and cellular cardiology.
Eswarakumar, V.P., Lax, I., and Schlessinger, J. (2005). Cellular signaling by fibroblast growth factor receptors. Cytokine & growth factor reviews 16, 139-149.
Evans, M.J., and Kaufman, M.H. (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154-156.
Faundez, A.A., Taylor, S., and Kaelin, A.J. (2006). Instrumented fusion of thoracolumbar fracture with type I mineralized collagen matrix combined with autogenous bone marrow as a bone graft substitute: a four-case report. Eur Spine J 15 Suppl 5, 630-635.
Feinberg, A.P. (2007). Phenotypic plasticity and the epigenetics of human disease. Nature 447, 433-440.
Fong, H., Hohenstein, K.A., and Donovan, P.J. (2008). Regulation of self-renewal and pluripotency by Sox2 in human embryonic stem cells. Stem cells (Dayton, Ohio) 26, 1931-1938.
Fortier, L.A., Nixon, A.J., Williams, J., and Cable, C.S. (1998). Isolation and chondrocytic differentiation of equine bone marrow-derived mesenchymal stem cells. American journal of veterinary research 59, 1182-1187.
Fuchs, J.R., Hannouche, D., Terada, S., Zand, S., Vacanti, J.P., and Fauza, D.O. (2005). Cartilage engineering from ovine umbilical cord blood mesenchymal progenitor cells. Stem cells (Dayton, Ohio) 23, 958-964.
Gang, E.J., Bosnakovski, D., Figueiredo, C.A., Visser, J.W., and Perlingeiro, R.C. (2007). SSEA-4 identifies mesenchymal stem cells from bone marrow. Blood 109, 1743-1751.
150
Gang, E.J., Hong, S.H., Jeong, J.A., Hwang, S.H., Kim, S.W., Yang, I.H., Ahn, C., Han, H., and Kim, H. (2004a). In vitro mesengenic potential of human umbilical cord blood-derived mesenchymal stem cells. Biochemical and biophysical research communications 321, 102-108.
Gang, E.J., Jeong, J.A., Hong, S.H., Hwang, S.H., Kim, S.W., Yang, I.H., Ahn, C., Han, H., and Kim, H. (2004b). Skeletal myogenic differentiation of mesenchymal stem cells isolated from human umbilical cord blood. Stem cells (Dayton, Ohio) 22, 617-624.
Gao, X., Tate, P., Hu, P., Tjian, R., Skarnes, W.C., and Wang, Z. (2008). ES cell pluripotency and germ-layer formation require the SWI/SNF chromatin remodeling component BAF250a. Proceedings of the National Academy of Sciences of the United States of America 105, 6656-6661.
Gerecht-Nir, S., Dazard, J.E., Golan-Mashiach, M., Osenberg, S., Botvinnik, A., Amariglio, N., Domany, E., Rechavi, G., Givol, D., and Itskovitz-Eldor, J. (2005). Vascular gene expression and phenotypic correlation during differentiation of human embryonic stem cells. Dev Dyn 232, 487-497.
Ginis, I., Luo, Y., Miura, T., Thies, S., Brandenberger, R., Gerecht-Nir, S., Amit, M., Hoke, A., Carpenter, M.K., Itskovitz-Eldor, J., and Rao, M.S. (2004). Differences between human and mouse embryonic stem cells. Developmental biology 269, 360-380.
Giordano, A., Galderisi, U., and Marino, I.R. (2007). From the laboratory bench to the patient's bedside: an update on clinical trials with mesenchymal stem cells. Journal of cellular physiology 211, 27-35.
Giovannini, S., Brehm, W., Mainil-Varlet, P., and Nesic, D. (2008). Multilineage differentiation potential of equine blood-derived fibroblast-like cells. Differentiation; research in biological diversity 76, 118-129.
Gong, Z., Calkins, G., Cheng, E.C., Krause, D., and Niklason, L.E. (2008). Influence of Culture Medium on Smooth Muscle Cell Differentiation from Human Bone Marrow-Derived Mesenchymal Stem Cells. Tissue Eng Part A.
Goodship, A.E., Birch, H.L., and Wilson, A.M. (1994). The pathobiology and repair of tendon and ligament injury. The Veterinary clinics of North America 10, 323-349.
Goodwin, H.S., Bicknese, A.R., Chien, S.N., Bogucki, B.D., Quinn, C.O., and Wall, D.A. (2001). Multilineage differentiation activity by cells isolated from umbilical cord blood: expression of bone, fat, and neural markers. Biol Blood Marrow Transplant 7, 581-588.
Greco, S.J., Liu, K., and Rameshwar, P. (2007). Functional similarities among genes regulated by OCT4 in human mesenchymal and embryonic stem cells. Stem cells (Dayton, Ohio) 25, 3143-3154.
151
Gronthos, S., Franklin, D.M., Leddy, H.A., Robey, P.G., Storms, R.W., and Gimble, J.M. (2001). Surface protein characterization of human adipose tissue-derived stromal cells. Journal of cellular physiology 189, 54-63.
Guest, D.J., and Allen, W.R. (2007). Expression of cell-surface antigens and embryonic stem cell pluripotency genes in equine blastocysts. Stem cells and development 16, 789-796.
Guest, D.J., Smith, M.R., and Allen, W.R. (2008). Monitoring the fate of autologous and allogeneic mesenchymal progenitor cells injected into the superficial digital flexor tendon of horses: preliminary study. Equine veterinary journal 40, 178-181.
Guilak, F., Lott, K.E., Awad, H.A., Cao, Q., Hicok, K.C., Fermor, B., and Gimble, J.M. (2006). Clonal analysis of the differentiation potential of human adipose-derived adult stem cells. Journal of cellular physiology 206, 229-237.
Gupta, M.C., Theerajunyaporn, T., Maitra, S., Schmidt, M.B., Holy, C.E., Kadiyala, S., and Bruder, S.P. (2007). Efficacy of mesenchymal stem cell enriched grafts in an ovine posterolateral lumbar spine model. Spine 32, 720-726; discussion 727.
Hankemeier, S., van Griensven, M., Ezechieli, M., Barkhausen, T., Austin, M., Jagodzinski, M., Meller, R., Bosch, U., Krettek, C., and Zeichen, J. (2007). Tissue engineering of tendons and ligaments by human bone marrow stromal cells in a liquid fibrin matrix in immunodeficient rats: results of a histologic study. Archives of orthopaedic and trauma surgery 127, 815-821.
Hatoya, S., Torii, R., Kondo, Y., Okuno, T., Kobayashi, K., Wijewardana, V., Kawate, N., Tamada, H., Sawada, T., Kumagai, D., Sugiura, K., and Inaba, T. (2006). Isolation and characterization of embryonic stem-like cells from canine blastocysts. Molecular reproduction and development 73, 298-305.
Hayashi, Y., Furue, M.K., Okamoto, T., Ohnuma, K., Myoishi, Y., Fukuhara, Y., Abe, T., Sato, J.D., Hata, R., and Asashima, M. (2007). Integrins regulate mouse embryonic stem cell self-renewal. Stem cells (Dayton, Ohio) 25, 3005-3015.
He, X., Gonzalez, V., Tsang, A., Thompson, J., Tsang, T.C., and Harris, D.T. (2005). Differential gene expression profiling of CD34+ CD133+ umbilical cord blood hematopoietic stem progenitor cells. Stem cells and development 14, 188-198.
Henderson, J.K., Draper, J.S., Baillie, H.S., Fishel, S., Thomson, J.A., Moore, H., and Andrews, P.W. (2002). Preimplantation human embryos and embryonic stem cells show comparable expression of stage-specific embryonic antigens. Stem cells (Dayton, Ohio) 20, 329-337.
Henikoff, S., Furuyama, T., and Ahmad, K. (2004). Histone variants, nucleosome assembly and epigenetic inheritance. Trends Genet 20, 320-326.
Hildebrandt, C., Buth, H., and Thielecke, H. (2009). Influence of cell culture media conditions on the osteogenic differentiation of cord blood-derived mesenchymal stem cells. Ann Anat 191, 23-32.
152
Holm, M., Kvistgaard, H., Dahl, C., Andersen, H.B., Hansen, T.K., Schiotz, P.O., and Junker, S. (2006). Modulation of chemokine gene expression in CD133+ cord blood-derived human mast cells by cyclosporin A and dexamethasone. Scandinavian journal of immunology 64, 571-579.
Hong, S.H., Gang, E.J., Jeong, J.A., Ahn, C., Hwang, S.H., Yang, I.H., Park, H.K., Han, H., and Kim, H. (2005). In vitro differentiation of human umbilical cord blood-derived mesenchymal stem cells into hepatocyte-like cells. Biochemical and biophysical research communications 330, 1153-1161.
Hough, S.R., Clements, I., Welch, P.J., and Wiederholt, K.A. (2006). Differentiation of mouse embryonic stem cells after RNA interference-mediated silencing of OCT4 and Nanog. Stem cells (Dayton, Ohio) 24, 1467-1475.
Huang, J.I., Durbhakula, M.M., Angele, P., Johnstone, B., and Yoo, J.U. (2006). Lunate arthroplasty with autologous mesenchymal stem cells in a rabbit model. The Journal of bone and joint surgery 88, 744-752.
Huang, S., Law, P., Francis, K., Palsson, B.O., and Ho, A.D. (1999). Symmetry of initial cell divisions among primitive hematopoietic progenitors is independent of ontogenic age and regulatory molecules. Blood 94, 2595-2604.
Huangfu, D., Osafune, K., Maehr, R., Guo, W., Eijkelenboom, A., Chen, S., Muhlestein, W., and Melton, D.A. (2008). Induction of pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2. Nature biotechnology 26, 1269-1275.
Hyslop, L., Stojkovic, M., Armstrong, L., Walter, T., Stojkovic, P., Przyborski, S., Herbert, M., Murdoch, A., Strachan, T., and Lako, M. (2005). Downregulation of NANOG induces differentiation of human embryonic stem cells to extraembryonic lineages. Stem cells (Dayton, Ohio) 23, 1035-1043.
Im, G.I., Kim, D.Y., Shin, J.H., Hyun, C.W., and Cho, W.H. (2001). Repair of cartilage defect in the rabbit with cultured mesenchymal stem cells from bone marrow. J Bone Joint Surg Br 83, 289-294.
Jaenisch, R., and Bird, A. (2003). Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nature genetics 33 Suppl, 245-254.
Jenuwein, T., and Allis, C.D. (2001). Translating the histone code. Science (New York, N.Y 293, 1074-1080.
Jeong, J.A., Gang, E.J., Hong, S.H., Hwang, S.H., Kim, S.W., Yang, I.H., Ahn, C., Han, H., and Kim, H. (2004). Rapid neural differentiation of human cord blood-derived mesenchymal stem cells. Neuroreport 15, 1731-1734.
Johnson, D.E., Lee, P.L., Lu, J., and Williams, L.T. (1990). Diverse forms of a receptor for acidic and basic fibroblast growth factors. Molecular and cellular biology 10, 4728-4736.
153
Juncosa-Melvin, N., Shearn, J.T., Boivin, G.P., Gooch, C., Galloway, M.T., West, J.R., Nirmalanandhan, V.S., Bradica, G., and Butler, D.L. (2006). Effects of mechanical stimulation on the biomechanics and histology of stem cell-collagen sponge constructs for rabbit patellar tendon repair. Tissue engineering 12, 2291-2300.
Jurga, M., Lipkowski, A.W., Lukomska, B., Buzanska, L., Kurzepa, K., Sobanski, T., Habich, A., Coecke, S., Gajkowska, B., and Domanska-Janik, K. (2009). Generation of Functional Neural Artificial Tissue from Human Umbilical Cord Blood Stem Cells. Tissue Eng Part A.
Kadivar, M., Khatami, S., Mortazavi, Y., Shokrgozar, M.A., Taghikhani, M., and Soleimani, M. (2006). In vitro cardiomyogenic potential of human umbilical vein-derived mesenchymal stem cells. Biochemical and biophysical research communications 340, 639-647.
Kang, X.Q., Zang, W.J., Bao, L.J., Li, D.L., Song, T.S., Xu, X.L., and Yu, X.J. (2005). Fibroblast growth factor-4 and hepatocyte growth factor induce differentiation of human umbilical cord blood-derived mesenchymal stem cells into hepatocytes. World J Gastroenterol 11, 7461-7465.
Kardon, G. (1998). Muscle and tendon morphogenesis in the avian hind limb. Development (Cambridge, England) 125, 4019-4032.
Katz, A.J., Tholpady, A., Tholpady, S.S., Shang, H., and Ogle, R.C. (2005). Cell surface and transcriptional characterization of human adipose-derived adherent stromal (hADAS) cells. Stem cells (Dayton, Ohio) 23, 412-423.
Kern, S., Eichler, H., Stoeve, J., Kluter, H., and Bieback, K. (2006). Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem cells (Dayton, Ohio) 24, 1294-1301.
Kestendjieva, S., Kyurkchiev, D., Tsvetkova, G., Mehandjiev, T., Dimitrov, A., Nikolov, A., and Kyurkchiev, S. (2008). Characterization of mesenchymal stem cells isolated from the human umbilical cord. Cell biology international 32, 724-732.
Kim, J.W., Kim, S.Y., Park, S.Y., Kim, Y.M., Kim, J.M., Lee, M.H., and Ryu, H.M. (2004). Mesenchymal progenitor cells in the human umbilical cord. Annals of hematology 83, 733-738.
Kisiday, J.D., Kopesky, P.W., Evans, C.H., Grodzinsky, A.J., McIlwraith, C.W., and Frisbie, D.D. (2008). Evaluation of adult equine bone marrow- and adipose-derived progenitor cell chondrogenesis in hydrogel cultures. J Orthop Res 26, 322-331.
Koch, T.G., Heerkens, T., Thomsen, P.D., and Betts, D.H. (2007). Isolation of mesenchymal stem cells from equine umbilical cord blood. BMC biotechnology 7, 26.
Koerner, J., Nesic, D., Romero, J.D., Brehm, W., Mainil-Varlet, P., and Grogan, S.P. (2006). Equine peripheral blood-derived progenitors in comparison to bone marrow-derived mesenchymal stem cells. Stem cells (Dayton, Ohio) 24, 1613-1619.
154
Kogler, G., Sensken, S., Airey, J.A., Trapp, T., Muschen, M., Feldhahn, N., Liedtke, S., Sorg, R.V., Fischer, J., Rosenbaum, C., Greschat, S., Knipper, A., Bender, J., Degistirici, O., Gao, J., Caplan, A.I., Colletti, E.J., Almeida-Porada, G., Muller, H.W., Zanjani, E., and Wernet, P. (2004). A new human somatic stem cell from placental cord blood with intrinsic pluripotent differentiation potential. The Journal of experimental medicine 200, 123-135.
Kon, E., Muraglia, A., Corsi, A., Bianco, P., Marcacci, M., Martin, I., Boyde, A., Ruspantini, I., Chistolini, P., Rocca, M., Giardino, R., Cancedda, R., and Quarto, R. (2000). Autologous bone marrow stromal cells loaded onto porous hydroxyapatite ceramic accelerate bone repair in critical-size defects of sheep long bones. Journal of biomedical materials research 49, 328-337.
Kondo, K., Shintani, S., Shibata, R., Murakami, H., Murakami, R., Imaizumi, M., Kitagawa, Y., and Murohara, T. (2009). Implantation of adipose-derived regenerative cells enhances ischemia-induced angiogenesis. Arteriosclerosis, thrombosis, and vascular biology 29, 61-66.
Kong, K.Y., Ren, J., Kraus, M., Finklestein, S.P., and Brown, R.H., Jr. (2004). Human umbilical cord blood cells differentiate into muscle in sjl muscular dystrophy mice. Stem cells (Dayton, Ohio) 22, 981-993.
Kramer, J., Hegert, C., Hargus, G., and Rohwedel, J. (2005). Mouse ES cell lines show a variable degree of chondrogenic differentiation in vitro. Cell biology international 29, 139-146.
Kuang, S., Kuroda, K., Le Grand, F., and Rudnicki, M.A. (2007). Asymmetric self-renewal and commitment of satellite stem cells in muscle. Cell 129, 999-1010.
Kumar, B.M., Yoo, J.G., Ock, S.A., Kim, J.G., Song, H.J., Kang, E.J., Cho, S.K., Lee, S.L., Cho, J.H., Balasubramanian, S., and Rho, G.J. (2007). In vitro differentiation of mesenchymal progenitor cells derived from porcine umbilical cord blood. Molecules and cells 24, 343-350.
Kunath, T., Saba-El-Leil, M.K., Almousailleakh, M., Wray, J., Meloche, S., and Smith, A. (2007). FGF stimulation of the Erk1/2 signalling cascade triggers transition of pluripotent embryonic stem cells from self-renewal to lineage commitment. Development (Cambridge, England) 134, 2895-2902.
Kunisato, A., Chiba, S., Nakagami-Yamaguchi, E., Kumano, K., Saito, T., Masuda, S., Yamaguchi, T., Osawa, M., Kageyama, R., Nakauchi, H., Nishikawa, M., and Hirai, H. (2003). HES-1 preserves purified hematopoietic stem cells ex vivo and accumulates side population cells in vivo. Blood 101, 1777-1783.
Kuo, C.K., and Tuan, R.S. (2008). Mechanoactive tenogenic differentiation of human mesenchymal stem cells. Tissue Eng Part A 14, 1615-1627.
155
Kuroda, T., Tada, M., Kubota, H., Kimura, H., Hatano, S.Y., Suemori, H., Nakatsuji, N., and Tada, T. (2005). Octamer and Sox elements are required for transcriptional cis regulation of Nanog gene expression. Molecular and cellular biology 25, 2475-2485.
Le Guen, L., Notarnicola, C., and de Santa Barbara, P. (2009). Intermuscular tendons are essential for the development of vertebrate stomach. Development (Cambridge, England) 136, 791-801.
Lee, M.W., Choi, J., Yang, M.S., Moon, Y.J., Park, J.S., Kim, H.C., and Kim, Y.J. (2004a). Mesenchymal stem cells from cryopreserved human umbilical cord blood. Biochemical and biophysical research communications 320, 273-278.
Lee, M.W., Moon, Y.J., Yang, M.S., Kim, S.K., Jang, I.K., Eom, Y.W., Park, J.S., Kim, H.C., Song, K.Y., Park, S.C., Lim, H.S., and Kim, Y.J. (2007). Neural differentiation of novel multipotent progenitor cells from cryopreserved human umbilical cord blood. Biochemical and biophysical research communications 358, 637-643.
Lee, M.W., Yang, M.S., Park, J.S., Kim, H.C., Kim, Y.J., and Choi, J. (2005). Isolation of mesenchymal stem cells from cryopreserved human umbilical cord blood. International journal of hematology 81, 126-130.
Lee, O.K., Kuo, T.K., Chen, W.M., Lee, K.D., Hsieh, S.L., and Chen, T.H. (2004b). Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood 103, 1669-1675.
Lee, P.L., Johnson, D.E., Cousens, L.S., Fried, V.A., and Williams, L.T. (1989). Purification and complementary DNA cloning of a receptor for basic fibroblast growth factor. Science (New York, N.Y 245, 57-60.
Lee, T.I., Jenner, R.G., Boyer, L.A., Guenther, M.G., Levine, S.S., Kumar, R.M., Chevalier, B., Johnstone, S.E., Cole, M.F., Isono, K., Koseki, H., Fuchikami, T., Abe, K., Murray, H.L., Zucker, J.P., Yuan, B., Bell, G.W., Herbolsheimer, E., Hannett, N.M., Sun, K., Odom, D.T., Otte, A.P., Volkert, T.L., Bartel, D.P., Melton, D.A., Gifford, D.K., Jaenisch, R., and Young, R.A. (2006). Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125, 301-313.
Lefebvre, V., Behringer, R.R., and de Crombrugghe, B. (2001). L-Sox5, Sox6 and Sox9 control essential steps of the chondrocyte differentiation pathway. Osteoarthritis and cartilage / OARS, Osteoarthritis Research Society 9 Suppl A, S69-75.
Lejard, V., Brideau, G., Blais, F., Salingcarnboriboon, R., Wagner, G., Roehrl, M.H., Noda, M., Duprez, D., Houillier, P., and Rossert, J. (2007). Scleraxis and NFATc regulate the expression of the pro-alpha1(I) collagen gene in tendon fibroblasts. The Journal of biological chemistry 282, 17665-17675.
Li, H.S., Wang, D., Shen, Q., Schonemann, M.D., Gorski, J.A., Jones, K.R., Temple, S., Jan, L.Y., and Jan, Y.N. (2003). Inactivation of Numb and Numblike in embryonic dorsal forebrain impairs neurogenesis and disrupts cortical morphogenesis. Neuron 40, 1105-1118.
156
Li, T.S., Komota, T., Ohshima, M., Qin, S.L., Kubo, M., Ueda, K., and Hamano, K. (2008). TGF-beta induces the differentiation of bone marrow stem cells into immature cardiomyocytes. Biochemical and biophysical research communications 366, 1074-1080.
Li, X., Zhou, S.G., Imreh, M.P., Ahrlund-Richter, L., and Allen, W.R. (2006). Horse embryonic stem cell lines from the proliferation of inner cell mass cells. Stem cells and development 15, 523-531.
Liang, J., Wan, M., Zhang, Y., Gu, P., Xin, H., Jung, S.Y., Qin, J., Wong, J., Cooney, A.J., Liu, D., and Songyang, Z. (2008). Nanog and Oct4 associate with unique transcriptional repression complexes in embryonic stem cells. Nature cell biology 10, 731-739.
Lin, T., Chao, C., Saito, S., Mazur, S.J., Murphy, M.E., Appella, E., and Xu, Y. (2005). p53 induces differentiation of mouse embryonic stem cells by suppressing Nanog expression. Nature cell biology 7, 165-171.
Liu, G., Zhao, L., Zhang, W., Cui, L., Liu, W., and Cao, Y. (2008). Repair of goat tibial defects with bone marrow stromal cells and beta-tricalcium phosphate. Journal of materials science 19, 2367-2376.
Liu, T.M., Martina, M., Hutmacher, D.W., Hui, J.H., Lee, E.H., and Lim, B. (2007). Identification of common pathways mediating differentiation of bone marrow- and adipose tissue-derived human mesenchymal stem cells into three mesenchymal lineages. Stem cells (Dayton, Ohio) 25, 750-760.
Liu, Y., Chattopadhyay, N., Qin, S., Szekeres, C., Vasylyeva, T., Mahoney, Z.X., Taglienti, M., Bates, C.M., Chapman, H.A., Miner, J.H., and Kreidberg, J.A. (2009). Coordinate integrin and c-Met signaling regulate Wnt gene expression during epithelial morphogenesis. Development (Cambridge, England) 136, 843-853.
Liu, Y., Cserjesi, P., Nifuji, A., Olson, E.N., and Noda, M. (1996). Sclerotome-related helix-loop-helix type transcription factor (scleraxis) mRNA is expressed in osteoblasts and its level is enhanced by type-beta transforming growth factor. The Journal of endocrinology 151, 491-499.
Loh, Y.H., Wu, Q., Chew, J.L., Vega, V.B., Zhang, W., Chen, X., Bourque, G., George, J., Leong, B., Liu, J., Wong, K.Y., Sung, K.W., Lee, C.W., Zhao, X.D., Chiu, K.P., Lipovich, L., Kuznetsov, V.A., Robson, P., Stanton, L.W., Wei, C.L., Ruan, Y., Lim, B., and Ng, H.H. (2006). The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nature genetics 38, 431-440.
Lowell, S., Benchoua, A., Heavey, B., and Smith, A.G. (2006). Notch promotes neural lineage entry by pluripotent embryonic stem cells. PLoS biology 4, e121.
Lowry, W.E., Richter, L., Yachechko, R., Pyle, A.D., Tchieu, J., Sridharan, R., Clark, A.T., and Plath, K. (2008). Generation of human induced pluripotent stem cells from dermal fibroblasts. Proceedings of the National Academy of Sciences of the United States of America 105, 2883-2888.
157
Ma, N., Ladilov, Y., Moebius, J.M., Ong, L., Piechaczek, C., David, A., Kaminski, A., Choi, Y.H., Li, W., Egger, D., Stamm, C., and Steinhoff, G. (2006). Intramyocardial delivery of human CD133+ cells in a SCID mouse cryoinjury model: Bone marrow vs. cord blood-derived cells. Cardiovascular research 71, 158-169.
Ma, W., Tavakoli, T., Derby, E., Serebryakova, Y., Rao, M.S., and Mattson, M.P. (2008). Cell-extracellular matrix interactions regulate neural differentiation of human embryonic stem cells. BMC developmental biology 8, 90.
Maherali, N., Sridharan, R., Xie, W., Utikal, J., Eminli, S., Arnold, K., Stadtfeld, M., Yachechko, R., Tchieu, J., Jaenisch, R., Plath, K., and Hochedlinger, K. (2007). Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell stem cell 1, 55-70.
Marcacci, M., Kon, E., Moukhachev, V., Lavroukov, A., Kutepov, S., Quarto, R., Mastrogiacomo, M., and Cancedda, R. (2007). Stem cells associated with macroporous bioceramics for long bone repair: 6- to 7-year outcome of a pilot clinical study. Tissue engineering 13, 947-955.
Markov, V., Kusumi, K., Tadesse, M.G., William, D.A., Hall, D.M., Lounev, V., Carlton, A., Leonard, J., Cohen, R.I., Rappaport, E.F., and Saitta, B. (2007). Identification of cord blood-derived mesenchymal stem/stromal cell populations with distinct growth kinetics, differentiation potentials, and gene expression profiles. Stem cells and development 16, 53-73.
Martin-Rendon, E., Hale, S.J., Ryan, D., Baban, D., Forde, S.P., Roubelakis, M., Sweeney, D., Moukayed, M., Harris, A.L., Davies, K., and Watt, S.M. (2007). Transcriptional profiling of human cord blood CD133+ and cultured bone marrow mesenchymal stem cells in response to hypoxia. Stem cells (Dayton, Ohio) 25, 1003-1012.
Masui, S., Nakatake, Y., Toyooka, Y., Shimosato, D., Yagi, R., Takahashi, K., Okochi, H., Okuda, A., Matoba, R., Sharov, A.A., Ko, M.S., and Niwa, H. (2007). Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells. Nature cell biology 9, 625-635.
Matsuda, T., Nakamura, T., Nakao, K., Arai, T., Katsuki, M., Heike, T., and Yokota, T. (1999). STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells. The EMBO journal 18, 4261-4269.
Mayshar, Y., Rom, E., Chumakov, I., Kronman, A., Yayon, A., and Benvenisty, N. (2008). Fibroblast growth factor 4 and its novel splice isoform have opposing effects on the maintenance of human embryonic stem cell self-renewal. Stem cells (Dayton, Ohio) 26, 767-774.
McDonald, J.W., Liu, X.Z., Qu, Y., Liu, S., Mickey, S.K., Turetsky, D., Gottlieb, D.I., and Choi, D.W. (1999). Transplanted embryonic stem cells survive, differentiate and promote recovery in injured rat spinal cord. Nature medicine 5, 1410-1412.
158
McGuckin, C.P., Pearce, D., Forraz, N., Tooze, J.A., Watt, S.M., and Pettengell, R. (2003). Multiparametric analysis of immature cell populations in umbilical cord blood and bone marrow. European journal of haematology 71, 341-350.
Mehlhorn, A.T., Zwingmann, J., Finkenzeller, G., Niemeyer, P., Dauner, M., Stark, B., Sudkamp, N.P., and Schmal, H. (2009). Chondrogenesis of Adipose-Derived Adult Stem Cells in a Poly-Lactide-Co-Glycolide Scaffold. Tissue Eng Part A.
Meirelles Lda, S., and Nardi, N.B. (2003). Murine marrow-derived mesenchymal stem cell: isolation, in vitro expansion, and characterization. British journal of haematology 123, 702-711.
Meshorer, E., Yellajoshula, D., George, E., Scambler, P.J., Brown, D.T., and Misteli, T. (2006). Hyperdynamic plasticity of chromatin proteins in pluripotent embryonic stem cells. Developmental cell 10, 105-116.
Mignatti, P., Morimoto, T., and Rifkin, D.B. (1992). Basic fibroblast growth factor, a protein devoid of secretory signal sequence, is released by cells via a pathway independent of the endoplasmic reticulum-Golgi complex. Journal of cellular physiology 151, 81-93.
Miki, T., Bottaro, D.P., Fleming, T.P., Smith, C.L., Burgess, W.H., Chan, A.M., and Aaronson, S.A. (1992). Determination of ligand-binding specificity by alternative splicing: two distinct growth factor receptors encoded by a single gene. Proceedings of the National Academy of Sciences of the United States of America 89, 246-250.
Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., and Yamanaka, S. (2003). The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113, 631-642.
Mrugala, D., Bony, C., Neves, N., Caillot, L., Fabre, S., Moukoko, D., Jorgensen, C., and Noel, D. (2008). Phenotypic and functional characterisation of ovine mesenchymal stem cells: application to a cartilage defect model. Annals of the rheumatic diseases 67, 288-295.
Muir, T., Sadler-Riggleman, I., and Skinner, M.K. (2005). Role of the basic helix-loop-helix transcription factor, scleraxis, in the regulation of Sertoli cell function and differentiation. Molecular endocrinology (Baltimore, Md 19, 2164-2174.
Murchison, N.D., Price, B.A., Conner, D.A., Keene, D.R., Olson, E.N., Tabin, C.J., and Schweitzer, R. (2007). Regulation of tendon differentiation by scleraxis distinguishes force-transmitting tendons from muscle-anchoring tendons. Development (Cambridge, England) 134, 2697-2708.
Muschler, G.F., Nitto, H., Matsukura, Y., Boehm, C., Valdevit, A., Kambic, H., Davros, W., Powell, K., and Easley, K. (2003). Spine fusion using cell matrix composites enriched in bone marrow-derived cells. Clinical orthopaedics and related research, 102-118.
159
Ng, L.J., Wheatley, S., Muscat, G.E., Conway-Campbell, J., Bowles, J., Wright, E., Bell, D.M., Tam, P.P., Cheah, K.S., and Koopman, P. (1997). SOX9 binds DNA, activates transcription, and coexpresses with type II collagen during chondrogenesis in the mouse. Developmental biology 183, 108-121.
Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Scholer, H., and Smith, A. (1998). Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95, 379-391.
Nishiyama, N., Miyoshi, S., Hida, N., Uyama, T., Okamoto, K., Ikegami, Y., Miyado, K., Segawa, K., Terai, M., Sakamoto, M., Ogawa, S., and Umezawa, A. (2007). The significant cardiomyogenic potential of human umbilical cord blood-derived mesenchymal stem cells in vitro. Stem cells (Dayton, Ohio) 25, 2017-2024.
Niwa, H. (2001). Molecular mechanism to maintain stem cell renewal of ES cells. Cell structure and function 26, 137-148.
Niwa, H., Burdon, T., Chambers, I., and Smith, A. (1998). Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes & development 12, 2048-2060.
Niwa, H., Miyazaki, J., and Smith, A.G. (2000). Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nature genetics 24, 372-376.
Nixon, A.J., Dahlgren, L.A., Haupt, J.L., Yeager, A.E., and Ward, D.L. (2008). Effect of adipose-derived nucleated cell fractions on tendon repair in horses with collagenase-induced tendinitis. American journal of veterinary research 69, 928-937.
Nunes, V.A., Cavacana, N., Canovas, M., Strauss, B.E., and Zatz, M. (2007). Stem cells from umbilical cord blood differentiate into myotubes and express dystrophin in vitro only after exposure to in vivo muscle environment. Biology of the cell / under the auspices of the European Cell Biology Organization 99, 185-196.
Oedayrajsingh-Varma, M.J., Ham, S.M.v., Knippenberg, M., Helder, M.N., Klein Nulend, J., Schouten, T.E., Ritt, M.J.P.F., and Milligen, F.J.v. (2006). Adipose tissue-derived mesenchymal stem cell yield and growth characteristics are affected by the tissue-harvesting procedure.
Ogawa, Y., Sawamoto, K., Miyata, T., Miyao, S., Watanabe, M., Nakamura, M., Bregman, B.S., Koike, M., Uchiyama, Y., Toyama, Y., and Okano, H. (2002). Transplantation of in vitro-expanded fetal neural progenitor cells results in neurogenesis and functional recovery after spinal cord contusion injury in adult rats. Journal of neuroscience research 69, 925-933.
Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M., and Hamada, H. (1990). A novel octamer binding transcription factor is differentially expressed in mouse embryonic cells. Cell 60, 461-472.
Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Generation of germline-competent induced pluripotent stem cells. Nature 448, 313-317.
160
Orii, H., Sotome, S., Chen, J., Wang, J., and Shinomiya, K. (2005). Beta-tricalcium phosphate (beta-TCP) graft combined with bone marrow stromal cells (MSCs) for posterolateral spine fusion. Journal of medical and dental sciences 52, 51-57.
Orr-Urtreger, A., Bedford, M.T., Burakova, T., Arman, E., Zimmer, Y., Yayon, A., Givol, D., and Lonai, P. (1993). Developmental localization of the splicing alternatives of fibroblast growth factor receptor-2 (FGFR2). Developmental biology 158, 475-486.
Pacini, S., Spinabella, S., Trombi, L., Fazzi, R., Galimberti, S., Dini, F., Carlucci, F., and Petrini, M. (2007). Suspension of bone marrow-derived undifferentiated mesenchymal stromal cells for repair of superficial digital flexor tendon in race horses. Tissue engineering 13, 2949-2955.
Park, I.H., Zhao, R., West, J.A., Yabuuchi, A., Huo, H., Ince, T.A., Lerou, P.H., Lensch, M.W., and Daley, G.Q. (2008). Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451, 141-146.
Pearson, S., Sroczynska, P., Lacaud, G., and Kouskoff, V. (2008). The stepwise specification of embryonic stem cells to hematopoietic fate is driven by sequential exposure to Bmp4, activin A, bFGF and VEGF. Development (Cambridge, England) 135, 1525-1535.
Peled, T., Mandel, J., Goudsmid, R.N., Landor, C., Hasson, N., Harati, D., Austin, M., Hasson, A., Fibach, E., Shpall, E.J., and Nagler, A. (2004). Pre-clinical development of cord blood-derived progenitor cell graft expanded ex vivo with cytokines and the polyamine copper chelator tetraethylenepentamine. Cytotherapy 6, 344-355.
Perez, A.V., Perrine, M., Brainard, N., and Vogel, K.G. (2003). Scleraxis (Scx) directs lacZ expression in tendon of transgenic mice. Mechanisms of development 120, 1153-1163.
Pesce, M., Orlandi, A., Iachininoto, M.G., Straino, S., Torella, A.R., Rizzuti, V., Pompilio, G., Bonanno, G., Scambia, G., and Capogrossi, M.C. (2003). Myoendothelial differentiation of human umbilical cord blood-derived stem cells in ischemic limb tissues. Circulation research 93, e51-62.
Pevny, L.H., and Lovell-Badge, R. (1997). Sox genes find their feet. Current opinion in genetics & development 7, 338-344.
Phillips, B.W., Hentze, H., Rust, W.L., Chen, Q.P., Chipperfield, H., Tan, E.K., Abraham, S., Sadasivam, A., Soong, P.L., Wang, S.T., Lim, R., Sun, W., Colman, A., and Dunn, N.R. (2007). Directed differentiation of human embryonic stem cells into the pancreatic endocrine lineage. Stem cells and development 16, 561-578.
Piedrahita, J.A., Zhang, S.H., Hagaman, J.R., Oliver, P.M., and Maeda, N. (1992). Generation of mice carrying a mutant apolipoprotein E gene inactivated by gene targeting in embryonic stem cells. Proceedings of the National Academy of Sciences of the United States of America 89, 4471-4475.
161
Pinchbeck, G.L., Clegg, P.D., Proudman, C.J., Stirk, A., Morgan, K.L., and French, N.P. (2004). Horse injuries and racing practices in National Hunt racehorses in the UK: the results of a prospective cohort study. Vet J 167, 45-52.
Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K., Douglas, R., Mosca, J.D., Moorman, M.A., Simonetti, D.W., Craig, S., and Marshak, D.R. (1999). Multilineage potential of adult human mesenchymal stem cells. Science (New York, N.Y 284, 143-147.
Plotnikov, A.N., Schlessinger, J., Hubbard, S.R., and Mohammadi, M. (1999). Structural basis for FGF receptor dimerization and activation. Cell 98, 641-650.
Porat, Y., Porozov, S., Belkin, D., Shimoni, D., Fisher, Y., Belleli, A., Czeiger, D., Silverman, W.F., Belkin, M., Battler, A., Fulga, V., and Savion, N. (2006). Isolation of an adult blood-derived progenitor cell population capable of differentiation into angiogenic, myocardial and neural lineages. British journal of haematology 135, 703-714.
Price, E.M., Prather, R.S., and Foley, C.M. (2006). Multipotent adult progenitor cell lines originating from the peripheral blood of green fluorescent protein transgenic swine. Stem cells and development 15, 507-522.
Pryce, B.A., Brent, A.E., Murchison, N.D., Tabin, C.J., and Schweitzer, R. (2007). Generation of transgenic tendon reporters, ScxGFP and ScxAP, using regulatory elements of the scleraxis gene. Dev Dyn 236, 1677-1682.
Punzel, M., Zhang, T., Liu, D., Eckstein, V., and Ho, A.D. (2002). Functional analysis of initial cell divisions defines the subsequent fate of individual human CD34(+)CD38(-) cells. Experimental hematology 30, 464-472.
Rebelatto, C.K., Aguiar, A.M., Moretao, M.P., Senegaglia, A.C., Hansen, P., Barchiki, F., Oliveira, J., Martins, J., Kuligovski, C., Mansur, F., Christofis, A., Amaral, V.F., Brofman, P.S., Goldenberg, S., Nakao, L.S., and Correa, A. (2008). Dissimilar differentiation of mesenchymal stem cells from bone marrow, umbilical cord blood, and adipose tissue. Experimental biology and medicine (Maywood, N.J 233, 901-913.
Reed, S.A., and Johnson, S.E. (2008). Equine umbilical cord blood contains a population of stem cells that express Oct4 and differentiate into mesodermal and endodermal cell types. Journal of cellular physiology 215, 329-336.
Ren, H., Cao, Y., Zhao, Q., Li, J., Zhou, C., Liao, L., Jia, M., Zhao, Q., Cai, H., Han, Z.C., Yang, R., Chen, G., and Zhao, R.C. (2006). Proliferation and differentiation of bone marrow stromal cells under hypoxic conditions. Biochemical and biophysical research communications 347, 12-21.
Reubinoff, B.E., Pera, M.F., Fong, C.Y., Trounson, A., and Bongso, A. (2000). Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nature biotechnology 18, 399-404.
162
Rhyu, M.S., Jan, L.Y., and Jan, Y.N. (1994). Asymmetric distribution of numb protein during division of the sensory organ precursor cell confers distinct fates to daughter cells. Cell 76, 477-491.
Richardson, L.E., Dudhia, J., Clegg, P.D., and Smith, R. (2007). Stem cells in veterinary medicine--attempts at regenerating equine tendon after injury. Trends in biotechnology 25, 409-416.
Rider, D.A., Dombrowski, C., Sawyer, A.A., Ng, G.H., Leong, D., Hutmacher, D.W., Nurcombe, V., and Cool, S.M. (2008). Autocrine fibroblast growth factor 2 increases the multipotentiality of human adipose-derived mesenchymal stem cells. Stem cells (Dayton, Ohio) 26, 1598-1608.
Ringrose, L., Ehret, H., and Paro, R. (2004). Distinct contributions of histone H3 lysine 9 and 27 methylation to locus-specific stability of polycomb complexes. Molecular cell 16, 641-653.
Rodda, D.J., Chew, J.L., Lim, L.H., Loh, Y.H., Wang, B., Ng, H.H., and Robson, P. (2005). Transcriptional regulation of nanog by OCT4 and SOX2. The Journal of biological chemistry 280, 24731-24737.
Romanov, Y.A., Svintsitskaya, V.A., and Smirnov, V.N. (2003). Searching for alternative sources of postnatal human mesenchymal stem cells: candidate MSC-like cells from umbilical cord. Stem cells (Dayton, Ohio) 21, 105-110.
Rosner, M.H., Vigano, M.A., Ozato, K., Timmons, P.M., Poirier, F., Rigby, P.W., and Staudt, L.M. (1990). A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345, 686-692.
Rovira, M., Delaspre, F., Massumi, M., Serra, S.A., Valverde, M.A., Lloreta, J., Dufresne, M., Payre, B., Konieczny, S.F., Savatier, P., Real, F.X., and Skoudy, A. (2008). Murine embryonic stem cell-derived pancreatic acinar cells recapitulate features of early pancreatic differentiation. Gastroenterology 135, 1301-1310, 1310 e1301-1305.
Ruzicka, K., Grskovic, B., Pavlovic, V., Qujeq, D., Karimi, A., and Mueller, M.M. (2004). Differentiation of human umbilical cord blood CD133+ stem cells towards myelo-monocytic lineage. Clinica chimica acta; international journal of clinical chemistry 343, 85-92.
Saito, S., Ugai, H., Sawai, K., Yamamoto, Y., Minamihashi, A., Kurosaka, K., Kobayashi, Y., Murata, T., Obata, Y., and Yokoyama, K. (2002). Isolation of embryonic stem-like cells from equine blastocysts and their differentiation in vitro. FEBS letters 531, 389-396.
Santos, F., and Dean, W. (2004). Epigenetic reprogramming during early development in mammals. Reproduction (Cambridge, England) 127, 643-651.
Sato, N., Meijer, L., Skaltsounis, L., Greengard, P., and Brivanlou, A.H. (2004). Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nature medicine 10, 55-63.
163
Savatier, P., Huang, S., Szekely, L., Wiman, K.G., and Samarut, J. (1994). Contrasting patterns of retinoblastoma protein expression in mouse embryonic stem cells and embryonic fibroblasts. Oncogene 9, 809-818.
Scholer, H.R., Balling, R., Hatzopoulos, A.K., Suzuki, N., and Gruss, P. (1989a). Octamer binding proteins confer transcriptional activity in early mouse embryogenesis. The EMBO journal 8, 2551-2557.
Scholer, H.R., Hatzopoulos, A.K., Balling, R., Suzuki, N., and Gruss, P. (1989b). A family of octamer-specific proteins present during mouse embryogenesis: evidence for germline-specific expression of an Oct factor. The EMBO journal 8, 2543-2550.
Schwartz, R.E., Reyes, M., Koodie, L., Jiang, Y., Blackstad, M., Lund, T., Lenvik, T., Johnson, S., Hu, W.S., and Verfaillie, C.M. (2002). Multipotent adult progenitor cells from bone marrow differentiate into functional hepatocyte-like cells. The Journal of clinical investigation 109, 1291-1302.
Schweitzer, R., Chyung, J.H., Murtaugh, L.C., Brent, A.E., Rosen, V., Olson, E.N., Lassar, A., and Tabin, C.J. (2001). Analysis of the tendon cell fate using Scleraxis, a specific marker for tendons and ligaments. Development (Cambridge, England) 128, 3855-3866.
Scotet, E., and Houssaint, E. (1995). The choice between alternative IIIb and IIIc exons of the FGFR-3 gene is not strictly tissue-specific. Biochimica et biophysica acta 1264, 238-242.
Shinin, V., Gayraud-Morel, B., Gomes, D., and Tajbakhsh, S. (2006). Asymmetric division and cosegregation of template DNA strands in adult muscle satellite cells. Nature cell biology 8, 677-687.
Smith, R.K., Korda, M., Blunn, G.W., and Goodship, A.E. (2003). Isolation and implantation of autologous equine mesenchymal stem cells from bone marrow into the superficial digital flexor tendon as a potential novel treatment. Equine veterinary journal 35, 99-102.
Smith, T.G., Sweetman, D., Patterson, M., Keyse, S.M., and Munsterberg, A. (2005). Feedback interactions between MKP3 and ERK MAP kinase control scleraxis expression and the specification of rib progenitors in the developing chick somite. Development (Cambridge, England) 132, 1305-1314.
Solchaga, L.A., Penick, K., Porter, J.D., Goldberg, V.M., Caplan, A.I., and Welter, J.F. (2005). FGF-2 enhances the mitotic and chondrogenic potentials of human adult bone marrow-derived mesenchymal stem cells. Journal of cellular physiology 203, 398-409.
Sottile, V., Thomson, A., and McWhir, J. (2003). In vitro osteogenic differentiation of human ES cells. Cloning and stem cells 5, 149-155.
Sparrow, R.L., Cauchi, J.A., Ramadi, L.T., Waugh, C.M., and Kirkland, M.A. (2002). Influence of mode of birth and collection on WBC yields of umbilical cord blood units. Transfusion 42, 210-215.
164
Spradling, A.C., and Zheng, Y. (2007). Developmental biology. The mother of all stem cells? Science (New York, N.Y 315, 469-470.
Stenderup, K., Justesen, J., Clausen, C., and Kassem, M. (2003). Aging is associated with decreased maximal life span and accelerated senescence of bone marrow stromal cells. Bone 33, 919-926.
Stewart, A.A., Byron, C.R., Pondenis, H., and Stewart, M.C. (2007). Effect of fibroblast growth factor-2 on equine mesenchymal stem cell monolayer expansion and chondrogenesis. American journal of veterinary research 68, 941-945.
Stier, S., Cheng, T., Dombkowski, D., Carlesso, N., and Scadden, D.T. (2002). Notch1 activation increases hematopoietic stem cell self-renewal in vivo and favors lymphoid over myeloid lineage outcome. Blood 99, 2369-2378.
Stojkovic, M., Lako, M., Stojkovic, P., Stewart, R., Przyborski, S., Armstrong, L., Evans, J., Herbert, M., Hyslop, L., Ahmad, S., Murdoch, A., and Strachan, T. (2004). Derivation of human embryonic stem cells from day-8 blastocysts recovered after three-step in vitro culture. Stem cells (Dayton, Ohio) 22, 790-797.
Suda, J., Suda, T., and Ogawa, M. (1984a). Analysis of differentiation of mouse hemopoietic stem cells in culture by sequential replating of paired progenitors. Blood 64, 393-399.
Suda, T., Suda, J., and Ogawa, M. (1984b). Disparate differentiation in mouse hemopoietic colonies derived from paired progenitors. Proceedings of the National Academy of Sciences of the United States of America 81, 2520-2524.
Sumi, T., Fujimoto, Y., Nakatsuji, N., and Suemori, H. (2004). STAT3 is dispensable for maintenance of self-renewal in nonhuman primate embryonic stem cells. Stem cells (Dayton, Ohio) 22, 861-872.
Sun, B., Roh, K.H., Lee, S.R., Lee, Y.S., and Kang, K.S. (2007). Induction of human umbilical cord blood-derived stem cells with embryonic stem cell phenotypes into insulin producing islet-like structure. Biochemical and biophysical research communications 354, 919-923.
Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861-872.
Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676.
Talens-Visconti, R., Bonora, A., Jover, R., Mirabet, V., Carbonell, F., Castell, J.V., and Gomez-Lechon, M.J. (2006). Hepatogenic differentiation of human mesenchymal stem cells from adipose tissue in comparison with bone marrow mesenchymal stem cells. World J Gastroenterol 12, 5834-5845.
165
Tanaka, T.S., Kunath, T., Kimber, W.L., Jaradat, S.A., Stagg, C.A., Usuda, M., Yokota, T., Niwa, H., Rossant, J., and Ko, M.S. (2002). Gene expression profiling of embryo-derived stem cells reveals candidate genes associated with pluripotency and lineage specificity. Genome research 12, 1921-1928.
Tang, X.P., Zhang, M., Yang, X., Chen, L.M., and Zeng, Y. (2006). Differentiation of human umbilical cord blood stem cells into hepatocytes in vivo and in vitro. World J Gastroenterol 12, 4014-4019.
Taylor, S.E., Smith, R.K., and Clegg, P.D. (2007). Mesenchymal stem cell therapy in equine musculoskeletal disease: scientific fact or clinical fiction? Equine veterinary journal 39, 172-180.
Taylor, S.E., Vaughan-Thomas, A., Clements, D.N., Pinchbeck, G., Macrory, L.C., Smith, R.K., and Clegg, P.D. (2009). Gene expression markers of tendon fibroblasts in normal and diseased tissue compared to monolayer and three dimensional culture systems. BMC musculoskeletal disorders 10, 27.
Thompson, S., Clarke, A.R., Pow, A.M., Hooper, M.L., and Melton, D.W. (1989). Germ line transmission and expression of a corrected HPRT gene produced by gene targeting in embryonic stem cells. Cell 56, 313-321.
Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. (1998). Embryonic stem cell lines derived from human blastocysts. Science (New York, N.Y 282, 1145-1147.
Tielens, S., Verhasselt, B., Liu, J., Dhont, M., Van Der Elst, J., and Cornelissen, M. (2006). Generation of embryonic stem cell lines from mouse blastocysts developed in vivo and in vitro: relation to Oct-4 expression. Reproduction (Cambridge, England) 132, 59-66.
Todorova, M.G., Soria, B., and Quesada, I. (2008). Gap junctional intercellular communication is required to maintain embryonic stem cells in a non-differentiated and proliferative state. Journal of cellular physiology 214, 354-362.
Tondreau, T., Meuleman, N., Delforge, A., Dejeneffe, M., Leroy, R., Massy, M., Mortier, C., Bron, D., and Lagneaux, L. (2005). Mesenchymal stem cells derived from CD133-positive cells in mobilized peripheral blood and cord blood: proliferation, Oct4 expression, and plasticity. Stem cells (Dayton, Ohio) 23, 1105-1112.
Torrente, Y., Belicchi, M., Sampaolesi, M., Pisati, F., Meregalli, M., D'Antona, G., Tonlorenzi, R., Porretti, L., Gavina, M., Mamchaoui, K., Pellegrino, M.A., Furling, D., Mouly, V., Butler-Browne, G.S., Bottinelli, R., Cossu, G., and Bresolin, N. (2004). Human circulating AC133(+) stem cells restore dystrophin expression and ameliorate function in dystrophic skeletal muscle. The Journal of clinical investigation 114, 182-195.
Tropel, P., Noel, D., Platet, N., Legrand, P., Benabid, A.L., and Berger, F. (2004). Isolation and characterisation of mesenchymal stem cells from adult mouse bone marrow. Experimental cell research 295, 395-406.
166
Vassilieva, S., Guan, K., Pich, U., and Wobus, A.M. (2000). Establishment of SSEA-1- and Oct-4-expressing rat embryonic stem-like cell lines and effects of cytokines of the IL-6 family on clonal growth. Experimental cell research 258, 361-373.
Vendrame, M., Cassady, J., Newcomb, J., Butler, T., Pennypacker, K.R., Zigova, T., Sanberg, C.D., Sanberg, P.R., and Willing, A.E. (2004). Infusion of human umbilical cord blood cells in a rat model of stroke dose-dependently rescues behavioral deficits and reduces infarct volume. Stroke; a journal of cerebral circulation 35, 2390-2395.
Vendrame, M., Gemma, C., de Mesquita, D., Collier, L., Bickford, P.C., Sanberg, C.D., Sanberg, P.R., Pennypacker, K.R., and Willing, A.E. (2005). Anti-inflammatory effects of human cord blood cells in a rat model of stroke. Stem cells and development 14, 595-604.
Vendrame, M., Gemma, C., Pennypacker, K.R., Bickford, P.C., Davis Sanberg, C., Sanberg, P.R., and Willing, A.E. (2006). Cord blood rescues stroke-induced changes in splenocyte phenotype and function. Experimental neurology 199, 191-200.
Viateau, V., Guillemin, G., Bousson, V., Oudina, K., Hannouche, D., Sedel, L., Logeart-Avramoglou, D., and Petite, H. (2007). Long-bone critical-size defects treated with tissue-engineered grafts: a study on sheep. J Orthop Res 25, 741-749.
Vidal, M.A., Kilroy, G.E., Johnson, J.R., Lopez, M.J., Moore, R.M., and Gimble, J.M. (2006). Cell growth characteristics and differentiation frequency of adherent equine bone marrow-derived mesenchymal stromal cells: adipogenic and osteogenic capacity. Vet Surg 35, 601-610.
Wagner, W., Wein, F., Seckinger, A., Frankhauser, M., Wirkner, U., Krause, U., Blake, J., Schwager, C., Eckstein, V., Ansorge, W., and Ho, A.D. (2005). Comparative characteristics of mesenchymal stem cells from human bone marrow, adipose tissue, and umbilical cord blood. Experimental hematology 33, 1402-1416.
Wakitani, S., Nawata, M., Tensho, K., Okabe, T., Machida, H., and Ohgushi, H. (2007). Repair of articular cartilage defects in the patello-femoral joint with autologous bone marrow mesenchymal cell transplantation: three case reports involving nine defects in five knees. Journal of tissue engineering and regenerative medicine 1, 74-79.
Wakitani, S., Saito, T., and Caplan, A.I. (1995). Myogenic cells derived from rat bone marrow mesenchymal stem cells exposed to 5-azacytidine. Muscle & nerve 18, 1417-1426.
Wang, J., Levasseur, D.N., and Orkin, S.H. (2008). Requirement of Nanog dimerization for stem cell self-renewal and pluripotency. Proceedings of the National Academy of Sciences of the United States of America 105, 6326-6331.
Wang, J., Rao, S., Chu, J., Shen, X., Levasseur, D.N., Theunissen, T.W., and Orkin, S.H. (2006). A protein interaction network for pluripotency of embryonic stem cells. Nature 444, 364-368.
167
Wang, J.A., Fan, Y.Q., Li, C.L., He, H., Sun, Y., and Lv, B.J. (2005a). Human bone marrow-derived mesenchymal stem cells transplanted into damaged rabbit heart to improve heart function. Journal of Zhejiang University. Science 6, 242-248.
Wang, L., and Detamore, M.S. (2009). Insulin-like growth factor-I improves chondrogenesis of predifferentiated human umbilical cord mesenchymal stromal cells. J Orthop Res.
Wang, L., Duan, E., Sung, L.Y., Jeong, B.S., Yang, X., and Tian, X.C. (2005b). Generation and characterization of pluripotent stem cells from cloned bovine embryos. Biology of reproduction 73, 149-155.
Watanabe, N., Woo, S.L., Papageorgiou, C., Celechovsky, C., and Takai, S. (2002). Fate of donor bone marrow cells in medial collateral ligament after simulated autologous transplantation. Microscopy research and technique 58, 39-44.
Wen, Z., Zhong, Z., and Darnell, J.E., Jr. (1995). Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82, 241-250.
Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein, B.E., and Jaenisch, R. (2007). In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature 448, 318-324.
White, J., Stead, E., Faast, R., Conn, S., Cartwright, P., and Dalton, S. (2005). Developmental activation of the Rb-E2F pathway and establishment of cell cycle-regulated cyclin-dependent kinase activity during embryonic stem cell differentiation. Molecular biology of the cell 16, 2018-2027.
Wichterle, H., Lieberam, I., Porter, J.A., and Jessell, T.M. (2002). Directed differentiation of embryonic stem cells into motor neurons. Cell 110, 385-397.
Wilke, M.M., Nydam, D.V., and Nixon, A.J. (2007). Enhanced early chondrogenesis in articular defects following arthroscopic mesenchymal stem cell implantation in an equine model. J Orthop Res 25, 913-925.
Willing, A.E., Lixian, J., Milliken, M., Poulos, S., Zigova, T., Song, S., Hart, C., Sanchez-Ramos, J., and Sanberg, P.R. (2003). Intravenous versus intrastriatal cord blood administration in a rodent model of stroke. Journal of neuroscience research 73, 296-307.
Worster, A.A., Brower-Toland, B.D., Fortier, L.A., Bent, S.J., Williams, J., and Nixon, A.J. (2001). Chondrocytic differentiation of mesenchymal stem cells sequentially exposed to transforming growth factor-beta1 in monolayer and insulin-like growth factor-I in a three-dimensional matrix. J Orthop Res 19, 738-749.
Worster, A.A., Nixon, A.J., Brower-Toland, B.D., and Williams, J. (2000). Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. American journal of veterinary research 61, 1003-1010.
168
Wu, K.H., Zhou, B., Mo, X.M., Cui, B., Yu, C.T., Lu, S.H., Han, Z.C., and Liu, Y.L. (2007a). Therapeutic potential of human umbilical cord-derived stem cells in ischemic diseases. Transplantation proceedings 39, 1620-1622.
Wu, K.H., Zhou, B., Yu, C.T., Cui, B., Lu, S.H., Han, Z.C., and Liu, Y.L. (2007b). Therapeutic potential of human umbilical cord derived stem cells in a rat myocardial infarction model. The Annals of thoracic surgery 83, 1491-1498.
Wu, M., Kwon, H.Y., Rattis, F., Blum, J., Zhao, C., Ashkenazi, R., Jackson, T.L., Gaiano, N., Oliver, T., and Reya, T. (2007c). Imaging hematopoietic precursor division in real time. Cell stem cell 1, 541-554.
Wu, Q., Chen, X., Zhang, J., Loh, Y.H., Low, T.Y., Zhang, W., Zhang, W., Sze, S.K., Lim, B., and Ng, H.H. (2006). Sall4 interacts with Nanog and co-occupies Nanog genomic sites in embryonic stem cells. The Journal of biological chemistry 281, 24090-24094.
Xiao, J., Nan, Z., Motooka, Y., and Low, W.C. (2005). Transplantation of a novel cell line population of umbilical cord blood stem cells ameliorates neurological deficits associated with ischemic brain injury. Stem cells and development 14, 722-733.
Xu, C., Inokuma, M.S., Denham, J., Golds, K., Kundu, P., Gold, J.D., and Carpenter, M.K. (2001). Feeder-free growth of undifferentiated human embryonic stem cells. Nature biotechnology 19, 971-974.
Xu, R.H., Peck, R.M., Li, D.S., Feng, X., Ludwig, T., and Thomson, J.A. (2005). Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells. Nature methods 2, 185-190.
Yahata, T., Muguruma, Y., Yumino, S., Sheng, Y., Uno, T., Matsuzawa, H., Ito, M., Kato, S., Hotta, T., and Ando, K. (2008). Quiescent human hematopoietic stem cells in the bone marrow niches organize the hierarchical structure of hematopoiesis. Stem cells (Dayton, Ohio) 26, 3228-3236.
Yamashita, A., Takada, T., Nemoto, K., Yamamoto, G., and Torii, R. (2006). Transient suppression of PPARgamma directed ES cells into an osteoblastic lineage. FEBS letters 580, 4121-4125.
Yamashita, Y.M., Jones, D.L., and Fuller, M.T. (2003). Orientation of asymmetric stem cell division by the APC tumor suppressor and centrosome. Science (New York, N.Y 301, 1547-1550.
Yamashita, Y.M., Mahowald, A.P., Perlin, J.R., and Fuller, M.T. (2007). Asymmetric inheritance of mother versus daughter centrosome in stem cell division. Science (New York, N.Y 315, 518-521.
Yan, H., and Yu, C. (2007). Repair of full-thickness cartilage defects with cells of different origin in a rabbit model. Arthroscopy 23, 178-187.
169
Yanez, R., Lamana, M.L., Garcia-Castro, J., Colmenero, I., Ramirez, M., and Bueren, J.A. (2006). Adipose tissue-derived mesenchymal stem cells have in vivo immunosuppressive properties applicable for the control of the graft-versus-host disease. Stem cells (Dayton, Ohio) 24, 2582-2591.
Yates, A., and Chambers, I. (2005). The homeodomain protein Nanog and pluripotency in mouse embryonic stem cells. Biochemical Society transactions 33, 1518-1521.
Yeom, Y.I., Fuhrmann, G., Ovitt, C.E., Brehm, A., Ohbo, K., Gross, M., Hubner, K., and Scholer, H.R. (1996). Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells. Development (Cambridge, England) 122, 881-894.
Ying, Q.L., Nichols, J., Chambers, I., and Smith, A. (2003). BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 115, 281-292.
Yoshimura, H., Muneta, T., Nimura, A., Yokoyama, A., Koga, H., and Sekiya, I. (2007). Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and tissue research 327, 449-462.
Young, R.G., Butler, D.L., Weber, W., Caplan, A.I., Gordon, S.L., and Fink, D.J. (1998). Use of mesenchymal stem cells in a collagen matrix for Achilles tendon repair. J Orthop Res 16, 406-413.
Yuan, H., Corbi, N., Basilico, C., and Dailey, L. (1995). Developmental-specific activity of the FGF-4 enhancer requires the synergistic action of Sox2 and Oct-3. Genes & development 9, 2635-2645.
Zaehres, H., Lensch, M.W., Daheron, L., Stewart, S.A., Itskovitz-Eldor, J., and Daley, G.Q. (2005). High-efficiency RNA interference in human embryonic stem cells. Stem cells (Dayton, Ohio) 23, 299-305.
Zeng, X., and Rao, M.S. (2007). Human embryonic stem cells: long term stability, absence of senescence and a potential cell source for neural replacement. Neuroscience 145, 1348-1358.
Zhang, J., Tam, W.L., Tong, G.Q., Wu, Q., Chan, H.Y., Soh, B.S., Lou, Y., Yang, J., Ma, Y., Chai, L., Ng, H.H., Lufkin, T., Robson, P., and Lim, B. (2006). Sall4 modulates embryonic stem cell pluripotency and early embryonic development by the transcriptional regulation of Pou5f1. Nature cell biology 8, 1114-1123.
Zhao, Y., Wang, H., and Mazzone, T. (2006). Identification of stem cells from human umbilical cord blood with embryonic and hematopoietic characteristics. Experimental cell research 312, 2454-2464.
Zheng, J.K., Wang, Y., Karandikar, A., Wang, Q., Gai, H., Liu, A.L., Peng, C., and Sheng, H.Z. (2006). Skeletal myogenesis by human embryonic stem cells. Cell research 16, 713-722.
170
Zhou, G., Liu, W., Cui, L., Wang, X., Liu, T., and Cao, Y. (2006). Repair of porcine articular osteochondral defects in non-weightbearing areas with autologous bone marrow stromal cells. Tissue engineering 12, 3209-3221.
Zhu, Y., Liu, T., Song, K., Ning, R., Ma, X., and Cui, Z. (2008). ADSCs differentiated into cardiomyocytes in cardiac microenvironment. Molecular and cellular biochemistry.
171
BIOGRAPHICAL SKETCH
Sarah Reed was born in Bellefonte, Pennsylvania, to Lisa and Howard Grove, Jr. She
grew up riding and showing Quarter Horses and was a member of 4-H and the American Quarter
Horse Youth Association. Sarah graduated as valedictorian from Bellefonte Area High School in
Bellefonte, Pennsylvania in 2000. Following high school, Sarah pursued a bachelor’s degree in
equine science at Delaware Valley College where she graduated summa cum laude in December
2003. While at DVC, Sarah was involved in the Equine Science Organization and the
agricultural honor society, Delta Tau Alpha. Following graduation, she worked as a laboratory
technician for Dr. Sally E. Johnson at the Pennsylvania State University. In July 2004, Sarah
married Jared Reed. Upon Dr. Johnson’s move to the University of Florida, Sarah enrolled as a
master’s student and completed her degree in Dr. Johnson’s laboratory. The title of her master’s
thesis was Identification of Differentially Expressed Proteins as a Result of Raf Kinase Activity.
Sarah continued her education with Dr. Johnson, pursuing her doctoral degree in the Animal
Molecular and Cellular Biology program. While working on her degree, Sarah stayed involved
with the horse industry by working at Sundaram Farms in Newberry, Florida and taking show
jumping lessons from Beth Stelzleni and Ella Rukin. Sarah currently resides in Alachua, Florida,
with her husband, Jared, and their two dogs, Annie and Bella. She and Jared are active members
of Grace United Methodist Church at Fort Clarke. Sarah enjoys photography, horseback riding,
and reading fiction in her spare time.
