Corynebacterium diphtheriae Iron-Regulated Surface ProteinHbpA Is Involved in the Utilization of the Hemoglobin-Haptoglobin Complex as an Iron Source

Lindsey R. Lyman,a Eric D. Peng,a Michael P. Schmitta

aLaboratory of Respiratory and Special Pathogens, Division of Bacterial, Parasitic, and Allergenic Products,Center for Biologics Evaluation and Research, Food and Drug Administration, Silver Spring, Maryland, USA

ABSTRACT Corynebacterium diphtheriae utilizes various heme-containing proteins,including hemoglobin (Hb) and the hemoglobin-haptoglobin complex (Hb-Hp), asiron sources during growth in iron-depleted environments. The ability to utilizeHb-Hp as an iron source requires the surface-anchored proteins HtaA and eitherChtA or ChtC. The ability to bind hemin, Hb, and Hb-Hp by each of these C. diphthe-riae proteins requires the previously characterized conserved region (CR) domain. Inthis study, we identified an Hb-Hp binding protein, HbpA (38.5 kDa), which is in-volved in the acquisition of hemin iron from Hb-Hp. HbpA was initially identifiedfrom total cell lysates as an iron-regulated protein that binds to both Hb and Hb-Hpin situ. HbpA does not contain a CR domain and has sequence similarity only to ho-mologous proteins present in a limited number of C. diphtheriae strains. Transcrip-tion of hbpA is regulated in an iron-dependent manner that is mediated by DtxR, aglobal iron-dependent regulator. Deletion of hbpA from C. diphtheriae results in a re-duced ability to utilize Hb-Hp as an iron source but has little or no effect on theability to use Hb or hemin as an iron source. Cell fractionation studies showed thatHbpA is both secreted into the culture supernatant and associated with the mem-brane, where its exposure on the bacterial surface allows HbpA to bind Hb and Hb-Hp. The identification and analysis of HbpA enhance our understanding of iron up-take in C. diphtheriae and indicate that the acquisition of hemin iron from Hb-Hpmay involve a complex mechanism that requires multiple surface proteins.

IMPORTANCE The ability to utilize host iron sources, such as heme and heme-containing proteins, is essential for many bacterial pathogens to cause disease. Inthis study, we have identified a novel factor (HbpA) that is crucial for the use of he-min iron from the hemoglobin-haptoglobin complex (Hb-Hp). Hb-Hp is consideredone of the primary sources of iron for certain bacterial pathogens. HbpA has no sim-ilarity to the previously identified Hb-Hp binding proteins, HtaA and ChtA/C, and isfound only in a limited group of C. diphtheriae strains. Understanding the functionof HbpA may significantly increase our knowledge of how this important humanpathogen can acquire host iron that allows it to survive and cause disease in thehuman respiratory tract.

KEYWORDS Corynebacterium, haptoglobin, hemoglobin, htaA, iron acquisition

Corynebacterium diphtheriae is the cause of the severe human respiratory diseasediphtheria. The bacterium colonizes and replicates in the upper respiratory tract

and elaborates the potent exotoxin diphtheria toxin (DT), which is responsible for muchof the morbidity associated with this disease (1–3). Transcription of the tox gene, whichencodes DT, is regulated by iron with optimal expression occurring in low-iron envi-ronments, a condition that is predicted to exist at the site of colonization in the host(2, 4). The iron regulation of tox transcription is mediated by the DtxR repressor, which

Received 8 November 2017 Accepted 28December 2017

Accepted manuscript posted online 8January 2018

Citation Lyman LR, Peng ED, Schmitt MP. 2018.Corynebacterium diphtheriae iron-regulatedsurface protein HbpA is involved in theutilization of the hemoglobin-haptoglobincomplex as an iron source. J Bacteriol 200:e00676-17. https://doi.org/10.1128/JB.00676-17.

Editor Olaf Schneewind, University of Chicago

Copyright © 2018 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Michael P. Schmitt,michael.schmitt@fda.hhs.gov.

RESEARCH ARTICLE

crossm

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 1Journal of Bacteriology

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

similarly controls the expression of numerous genes in C. diphtheriae, many of whichare involved in iron transport and metabolism (5–8).

The acquisition and utilization of iron are essential for the growth of almost allbacteria and are required by most pathogens to cause disease (9–11). Althoughessential for virulence, iron is not easily available to invading bacterial pathogens sincemuch of it is sequestered intracellularly by heme, which is bound primarily by hemo-globin (12). In the extracellular environment, much of the iron is bound by the hostglycoproteins transferrin and lactoferrin (13, 14). To survive in the iron-limited environ-ment of the host, bacteria have evolved a variety of iron- and heme-scavengingsystems, including high-affinity siderophore iron transporters as well as receptor-mediated mechanisms to import hemin through the cell wall and into the cytosol (11,15, 16).

Bacterial heme transport systems were first identified and characterized in Gram-negative pathogens, such as Yersinia enterocolitica, Vibrio cholerae, and Neisseria men-ingitidis, where it was shown that TonB-dependent receptors in the outer membranecould bind hemin or various hemoproteins and mobilize the hemin through the outermembrane into the periplasm (17–20). Once in the periplasmic space, hemin-specificsolute binding proteins would bind hemin and deliver it to its cognate ABC transporterin the cytoplasmic membrane (19). Hemin-specific ABC transport systems facilitate theuptake of hemin into the cell, where the heme or heme iron is then made available forcellular metabolism (12). In addition to membrane-binding protein-dependent uptakesystems, some Gram-negative bacteria, such as Serratia marcescens and various Pseu-domonas species, secrete heme binding proteins, known as hemophores. Hemophoresbind to hemoproteins in the extracellular medium, where they extract the heme anddeliver it to receptors on the bacterial cell surface (21). The genes encoding many of thedifferent heme uptake systems in Gram-negative bacteria are transcriptionally regu-lated by iron, which is mediated by the Fur protein, a global iron-dependent regulatoryfactor that functions in a manner similar to that of DtxR (22).

Hemin transport in Gram-positive bacteria shares some similarities to that of Gram-negative organisms in that both use ABC-type hemin uptake systems to transporthemin through the bacterial membrane (12). However, the binding of hemin andhemoproteins at the cell surface is remarkably different between these groups ofbacteria. The most notable difference is that since Gram-positive bacteria lack outermembrane receptors, they interact with hemin and hemoproteins through surfaceproteins that are tethered to the bacteria either through a covalent linkage to the cellwall that is mediated by sortases or through anchoring to the cytoplasmic membraneby a C-terminal transmembrane domain (12, 23, 24). The hemin transport system inStaphylococcus aureus has been extensively studied and shown to utilize seven surfaceproteins, designated iron-regulated surface determinants (Isd), to transport hemin (25).The surface-exposed IsdB and IsdH proteins are initially involved in binding hemoglo-bin (Hb) and the hemoglobin-haptoglobin complex (Hb-Hp) at the surface of thebacteria using unique binding regions known as NEAT (near iron transporter) domains(12, 25–28). These proteins extract the hemin from hemoproteins, where the hemin issubsequently moved through the cell wall by a relay mechanism that involves the cellwall-anchored proteins IsdA and IsdC (29, 30). IsdC transfers hemin to the ABC hemin-specific transporter IsdDEF, which facilitates the movement of hemin into the cytosol(31). Intracellular hemin is either incorporated into heme-containing proteins or isdegraded by the heme-degrading mono-oxygenase enzymes IsdG and IsdI, wherehemin iron is made available for cellular metabolism (32). The IsdH, IsdB, IsdA, and IsdCproteins are all covalently anchored to the cell wall through the action of sortases (25,33). The IsdH and IsdB proteins contain multiple NEAT domains that bind either heminor Hb, while the single NEAT domains in IsdA and IsdC have specificity only for hemin(27, 34–36). Other bacteria that utilize Isd-like proteins for hemin transport includeBacillus anthracis, Listeria monocytogenes, and Streptococcus pyogenes, which expressthe surface heme-binding proteins Shr and Shp (23, 37–40).

In C. diphtheriae, the acquisition of hemin iron requires the hmu region, which carries

Lyman et al. Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 2

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

genes encoding the ABC-type hemin transporter, HmuTUV, and two hemin-bindingproteins, HtaA and HtaB (24, 41). HtaA (61 kDa) is a surface-exposed protein that istethered to the cytoplasmic membrane through a C-terminal transmembrane regionand contains two conserved regions (CR1 and CR2) that bind hemin, Hb, and variousother hemoproteins (42, 43). Mutations in htaA and in the hmuTUV genes result inreduced ability of C. diphtheriae to utilize Hb as an iron source (24) but do not fullyabolish hemin iron uptake from Hb, which indicates that an alternate mechanism forhemin iron acquisition exists. The binding of hemin and Hb to the CR domains requiresa conserved histidine and two conserved tyrosine residues; all three of these residuesare also associated with the hemin iron utilization function of HtaA (42). Hemin transferstudies showed that HtaA acquired hemin from Hb in vitro and that the hemin boundto HtaA can be subsequently transferred to HtaB (42). The HtaB protein (36 kDa)contains a single hemin-binding CR domain, and a recent study proposed that HtaBfunctions as an intermediate in the transport of hemin through the cell wall (24, 42).While the CRs found in Corynebacterium share functional similarities with the NEATdomains present in the Isd proteins and to the Shr or Shp proteins in streptococcalspecies (24), they lack any significant sequence similarity to the NEAT domains.

We recently described the iron-regulated chtA-chtB and cirA-chtC genetic regions,which are organized as two-gene operons that encode hemin and Hb-binding mem-brane proteins with sequence similarity to HtaA and HtaB (44). The ChtA and ChtCproteins (83.9 kDa and 74.3 kDa, respectively) contain an N-terminal secretion signaland a C-terminal anchoring region like that found in HtaA (44). Cell fractionation studiesshow that ChtA and ChtC are present on the membrane and exposed on the cellsurface; however, they are also found in the supernatant, suggesting that theseproteins are secreted, which could be due to a weak association with the membrane orto natural shedding of the membrane during growth. Both ChtA and ChtC harbor asingle N-terminal CR domain that is essential for hemin and Hb binding. The twoproteins exhibit significant sequence homology to each other; however, similarity ofChtA and ChtC to HtaA is observed only in the CR domain (44).

A recent study that examined the ability of C. diphtheriae to use various hemopro-teins as iron sources showed that C. diphtheriae utilized Hb-Hp, human serum albumin(HSA), and myoglobin (Mb) as hemin iron sources for growth in low-iron medium (43).A deletion mutant of htaA was unable to use Hb-Hp-iron and showed significantlyreduced ability to use hemin iron from HSA and Mb. Deletion of the chtA or chtC geneshad no effect on the ability of C. diphtheriae to use any of these host iron sources forgrowth under iron-starved conditions; however, a chtA chtC double mutant was sig-nificantly reduced in its ability to use Hb-Hp as an iron source (43). The double mutantwas not affected in its ability to use heme iron from Hb, HSA, or Mb. These findingsdemonstrated that the use of Hb-Hp iron required both HtaA and either ChtA or ChtC(ChtA/C). The mechanism as to how HtaA and ChtA/C function to scavenge hemin ironfrom Hb-Hp is not known, although it was proposed that these large surface-anchoredproteins may form a complex on the cell surface to facilitate the extraction of heminfrom the Hb-Hp complex (43). The question as to whether ChtA and ChtC haveredundant functions with regard to Hb-Hp iron utilization was not addressed in theseearlier reports.

In this study, we have identified an iron-regulated protein, HbpA (previouslyDIP2330), that is involved in the utilization of Hb-Hp as an iron source. We show thatthis novel protein is produced in large quantities during growth in low-iron mediumand is found on the cell surface and in the culture supernatant. HbpA does not possessa hemin or Hb-binding CR domain but can bind both Hb and the Hb-Hp complex.Surprisingly, recombinant HbpA is unable to bind hemin, a characteristic that is uniqueamong all other previously characterized Hb-binding proteins involved in hemin irontransport. HbpA has sequence homology to proteins found only in certain strains of C.diphtheriae and appears to represent a new class of Hb- and Hb-Hp binding protein.

Analysis of the Hb-Hp-Binding Protein HbpA Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 3

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

RESULTSIdentification of a novel Hb-Hp binding protein in C. diphtheriae. To further

understand the interaction of Hb and Hb-Hp with C. diphtheriae surface proteins, weperformed studies in which either Hb or Hb-Hp was incubated in situ with C. diphtheriaeproteins that had been separated by gel electrophoresis and transferred to nitrocellu-lose membranes. Both Hb and Hb-Hp bound strongly to a single band that migrated atapproximately 40 kDa, and this binding was present predominantly in the membraneand supernatant fractions from bacteria grown under low-iron conditions (Fig. 1A andB). Lysates of bacteria grown under high-iron conditions did not bind to either Hb orHb-Hp (Fig. 1A and B).

A protein of approximately 40 kDa, which corresponds to the Hb-Hp-binding proteinin Fig. 1A, was detected in the supernatant fraction in low-iron cultures followingCoomassie blue staining of proteins separated by SDS-PAGE (Fig. 1C, band indicated byan arrow). This 40-kDa band was excised from the gel and subjected to liquidchromatography-tandem mass spectrometry (LC-MS/MS). Peptide analysis of the LC-MS/MS results indicated that two putative membrane proteins with a predicted size ofapproximately 38 kDa were the most likely candidates for the Hb-Hp binding protein;these two proteins are annotated in the genome sequence of C. diphtheriae strainNCTC13129 (45) as DIP2330 and DIP0659 (Table 1). Sequence analysis of the two genesand their upstream regions revealed that only dip2330 (designated hbpA) contained a

FIG 1 In situ binding of Hb-Hp (A) and Hb (B) to immobilized proteins following cell fractionation of C. diphtheriae 1737. Cellular fractions areindicated as follows: supernatant (Sup), total cell lysate (Total), cytosolic (Cyto), and membrane (Mem). C. diphtheriae 1737 was grown in mPGTmedium under low-iron (0.25 �M FeCl3) and high-iron (10 �M FeCl3) conditions. The binding of Hb-Hp was detected by anti-Hp antibodies andHb binding was detected using anti-Hb antibodies as described in Materials and Methods. (C) Coomassie blue staining of SDS-PAGE gel containingcell fractions obtained from C. diphtheriae 1737 following growth in low- and high-iron mPGT medium. The arrow indicates the approximately40-kDa protein band that was excised from the gel and used for LC-MS/MS analysis. Protein sizes are indicated to the left of the gel in kilodaltons,and M represents the molecular mass marker. Experiments were repeated multiple times with similar results; a representative experiment isshown.

TABLE 1 LC-MS/MS results

Correspondinggenea

Protein name(if known) Description Score Coverage (%)

No. of uniquepeptides

Molecularmass (kDa) Calculated pI

dip2330 HbpA Putative membrane protein 568.68 52.56 22 38.5 6.74dip0659 Putative membrane protein 258.37 51.65 18 38.7 5.02dip2069 Putative secreted protein 54.05 17.51 6 41.9 4.79dip0522 ChtC Putative membrane protein 17.74 10.18 5 74.3 5.49dip2116 Putative membrane-anchored

protein35.00 10.67 4 56.8 5.58

aGene annotation from C. diphtheriae strain NCTC13129. Genes in boldface were deemed the most likely candidates to encode Hb-Hp-binding proteins.

Lyman et al. Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 4

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

putative DtxR binding site upstream of the predicted open reading frame, suggestingthat hbpA is iron regulated (Fig. 2), which is consistent with the expression observed forthe 40-kDa Hb-Hp-binding protein identified in the in situ studies (Fig. 1A).

The hbpA promoter is regulated by DtxR and iron. To determine if transcriptionof hbpA is regulated by iron levels, we moved a DNA fragment containing the hbpAupstream intergenic region into the promoter probe plasmid pSPZ to construct pSPZ-hbpA. Plasmid pSPZ-hbpA was assessed for promoter activity in the C. diphtheriae 1737wild-type strain and in the isogenic dtxR mutant strain by determining �-galactosidaseactivity following growth in high-iron (10 �M FeCl3) and low-iron (0.25 �M FeCl3)medium. The LacZ activity in the wild-type strain showed that transcription wasstrongly repressed under high-iron conditions and that iron-dependent repression wasalleviated in the dtxR mutant strain, a finding consistent with DtxR-mediated regulationof transcription (Fig. 3A).

Transcription of hbpA was directly measured by isolating RNA from the wild-typestrain grown under high- and low-iron conditions and using quantitative real-time PCR(qPCR) to assess relative RNA levels for hbpA and adjacent genes. The qPCR findingsshowed an �60-fold reduction in hbpA mRNA when bacteria were grown in high-ironmedium compared to growth in low-iron medium (Fig. 3B). The adjacent genes dip2329and dip2331 were also probed by qPCR and did not show any regulation by iron,indicating that hbpA is likely a monocistronic gene (Fig. 2A). The tox gene, which served

FIG 2 (A) Genetic map of hbpA and adjacent genes. The intergenic region upstream of hbpA contains theputative promoter region for hbpA (P) and a DtxR binding site. The signal sequence (SS), the transmem-brane region (TM), and the lysine-glutamic acid-rich region (K/E) are also shown. (B) The DNA sequenceof the �10 and �35 promoter elements (underlined) and the putative DtxR binding site (bold) upstreamof the hbpA gene are shown. The arrow indicates the start site for transcription as determined by 5= RACE.The 19-bp consensus DtxR binding site is shown below the hbpA DtxR binding site; the most highlyconserved residues in the consensus sequence are indicated in bold.

FIG 3 Transcription of hbpA is regulated by iron. (A) LacZ activity was measured from cultures of C. diphtheriae wild-type strain1737 (1737wt) and strain 1737ΔdtxR carrying the promoter probe plasmid pSPZ-hbpA. Strains were grown in high-iron (10 �MFeCl3) and low-iron (0.25 �M FeCl3) mPGT medium. (B) qPCR was used to directly measure transcription of hbpA and adjacentgenes (dip2329 and dip2331) by assessing mRNA levels of C. diphtheriae 1737wt grown under low- or high-iron conditions asdescribed above for the LacZ assays. Analysis of the tox gene was used as a positive control for iron regulation. Expressionobserved under low-iron conditions is normalized to a value of 1 (shown by a dotted line) for each gene to assess relativeexpression. Experiments were done at least three times; graphs show means with standard deviations.

Analysis of the Hb-Hp-Binding Protein HbpA Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 5

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

as a positive control for iron regulation, was strongly repressed under high-ironconditions, as expected. Further analysis of the hbpA promoter region by 5= rapidamplification of cDNA ends (RACE) showed that transcription of hbpA initiates at a Cresidue located within the DtxR binding site (Fig. 2B). Putative �10 and �35 promoterelements were present at appropriate distances upstream from the transcription startsite. Analysis of the DtxR binding site showed that it matched with 14/19 bases of theconsensus sequence, which includes most of the highly conserved residues (Fig. 2B).We used an electrophoretic mobility shift assay (EMSA) to confirm the binding of DtxRto the hbpA promoter region. Purified DtxR bound to the full-length intergenic region(377 bp, PhbpA) as well as the 3= 175-bp fragment (P3=) that is predicted to harbor theDtxR binding site, but DtxR failed to bind to the 205-bp fragment in the 5= region (P5=)(Fig. 4). A DNA fragment carrying the tox promoter (Ptox) served as a positive controlfor DtxR binding. Together these data indicate that hbpA transcription is regulated inresponse to iron levels in a DtxR-dependent manner.

We observed that hbpA is located near the genes encoding the ChrS/ChrA (ChrS/A)heme-responsive two-component signal transduction system (Fig. 2A). Since the hbpAgene product appears to be associated with Hb and Hb-Hp binding, we analyzed thetranscription of hbpA in the presence of Hb, a factor known to activate the regulatoryfunctions of the ChrS/A system (46). While the presence of Hb in the growth mediumstrongly activated transcription of the hrtAB promoter, a known heme-activated pro-moter (47), Hb had no effect on transcription from the hbpA promoter on plasmidpSPZ-hbpA, suggesting that transcription of hbpA is not regulated by Hb and likely notaffected by the ChrS/A system (data not shown).

HbpA is associated with the membrane and secreted into the medium. Se-quence analysis of HbpA indicates that it contains an N-terminal secretion signal anda putative C-terminal transmembrane region (Fig. 5), a structural organization that issimilar to those of other C. diphtheriae Hb-Hp-binding proteins, including HtaA, ChtA,and ChtC. However, unlike these other known Hb-Hp-binding proteins in C. diphtheriae,HbpA does not contain a CR domain, a region required for binding hemin, Hb, andHb-Hp by HtaA, ChtA, and ChtC. BLAST analysis indicates that HbpA shows sequencesimilarity only to proteins in a limited number of C. diphtheriae strains, and a Pfam

FIG 4 DtxR binds to the hbpA promoter region. (A) EMSA shows that DtxR is able to bind to DNAfragments carrying the putative DtxR binding site upstream of the hbpA gene (PhbpA and P3=). The PtoxDNA fragment was used as a positive control and carries the DtxR binding site for the tox promoter. Thepresence (�) or absence (�) of DtxR in the binding reaction mixture is indicated above the gel. (B) DNAfragments that were used in the EMSA are shown below a genetic map of the hbpA-dip2329 intergenicregion. The location of the DtxR binding site is indicated (red box). The ability or inability of the DNAfragments to bind to DtxR is indicated by a plus sign or a minus sign, respectively.

FIG 5 Predicted amino acid sequence for HbpA. The N-terminal secretion signal and C-terminal transmem-brane region are underlined. Bold residues indicate a highly charged region near the C terminus.

Lyman et al. Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 6

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

assessment indicates that HbpA does not contain any known conserved functionalmotifs. While the amino acid sequences required for binding to hemoproteins by HbpAare not known, HbpA does contain in its C terminus a highly charged region ofunknown function that contains numerous lysine and glutamic acid residues; 41/71amino acids in this region are charged residues (Fig. 5; indicated in bold).

To better understand the cellular localization and function of HbpA, we cloned thehbpA gene into an expression vector and purified the recombinant HbpA protein.Purified HbpA was used to produce polyclonal antibodies as described in Materials andMethods. Protein localization studies showed that HbpA, which is expressed only underlow-iron conditions, is both secreted into the extracellular medium and associated withthe cytoplasmic membrane (Fig. 6A). We constructed a nonpolar deletion mutant ofhbpA in the C. diphtheriae 1737 wild-type strain, designated 1737ΔhbpA. The deletionin 1737ΔhbpA was confirmed by the absence of HbpA in mutant strain 1737ΔhbpAgrown in low-iron medium (Fig. 6B). The cloned hbpA gene on pKN-hbpA restoredexpression of HbpA in 1737ΔhbpA, and the recombinant HbpA protein was localized inthe same cellular fractions and exhibited iron-dependent expression similar to that ofthe wild-type strain (Fig. 6B).

Whole-cell extracts from 1737ΔhbpA failed to bind Hb or Hb-Hp in situ, whichconfirms that HbpA is responsible for the strong binding to both hemoproteins (Fig. 6C;data not shown for Hb-Hp). Whole-cell extracts from wild-type strain 1737 grown undereither low- or high-iron conditions are shown as positive controls for HbpA binding toHb in situ (Fig. 6C). The purified recombinant HbpA protein that was electrophoresedusing SDS-PAGE or native gels and then transferred to nitrocellulose was able to bindHb and Hb-Hp in situ (Fig. 6C and D; not shown for native gels).

HbpA is involved in the utilization of Hb-Hp as an iron source. To determine ifthe hbpA deletion mutant, 1737ΔhbpA, was affected in its ability to utilize iron fromvarious hemin sources, wild-type strain 1737 and 1737ΔhbpA were grown in iron-

FIG 6 (A) Protein fractionation studies were done with C. diphtheriae 1737wt grown in low-iron (0.25 �M FeCl3) or high-iron (10 �MFeCl3) mPGT medium. Proteins present in various cellular fractions were separated by SDS-PAGE, and HbpA was detected by Westernblotting using anti-HbpA antibodies. Strain 1737wt carried the pKN2.6Z vector (pKN). Cell fractions are the same as those describedfor Fig. 1A. Purified recombinant Strep-tag-tagged HbpA is also shown (Pure HbpA). (B) Protein fractionation was done with1737ΔhbpA carrying pKN2.6Z or pKN-hbpA grown in low- or high-iron medium. (C) Total cell lysates from 1737wt and 1737ΔhbpAthat were grown in mPGT at the indicated iron levels were bound with Hb in situ. Hb binding was detected using anti-Hb antibodies.Purified HbpA is also shown. The right panel shows the Coomassie blue-stained gel of the total cell lysates and purified HbpA. (D)In situ binding with Hb-Hp was performed with the same 1737wt cell lysates and purified HbpA as those described for panel C; Hb-Hpbinding was detected using anti-Hp antibodies. Experiments were repeated multiple times with similar results; a representativeexperiment is shown.

Analysis of the Hb-Hp-Binding Protein HbpA Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 7

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

depleted medium in which either Hb, Hb-Hp, or hemin was provided as the sole ironsource. Strain 1737ΔhbpA showed wild-type levels of growth when FeCl3 or hemin wasused as an iron source, but the mutant exhibited significantly reduced growth relativeto the wild type when Hb-Hp was used as the sole iron source (Fig. 7A). A small butstatistically significant reduction in growth was observed for 1737ΔhbpA with Hb;however, the biological relevance of this decrease is unclear. These observationsindicate that HbpA is involved in the acquisition of iron from Hb-Hp but is not requiredfor the use of iron from hemin and has little if any function in the use of Hb-iron.

The cloned hbpA gene on pKN-hbpA restored the ability of the hbpA mutant to useHb-Hp as an iron source to wild-type levels of growth (Fig. 7B). Strain 1737Δ4, whichcarries deletions for the genes encoding all four Hb-Hp-binding proteins (HtaA, ChtA,ChtC, and HbpA), was unable to use Hb-Hp as an iron source, and the presence of thecloned hbpA gene had no effect on growth of the mutant, as expected (Fig. 7B).

We previously reported that strain 1737 with deletion of htaA showed little if anygrowth when Hb-Hp was the sole iron source; however, strains with mutation in eitherchtA or chtC showed wild-type levels of growth when Hb-Hp was used as an iron source(43). Surprisingly, a chtA chtC double mutant exhibited very poor growth in thepresence of Hb-Hp, similar to the growth levels observed with the htaA mutant (43). Weshowed in an experiment illustrated in Fig. 7B that growth of the chtA chtC doublemutant with Hb-Hp as the sole iron source can be restored to wild-type levels by eitherthe cloned chtA or chtC gene, indicating that ChtA and ChtC have similar if not identicalfunctions with regard to the use of Hb-Hp as an iron source. Together, these findingsindicate that in C. diphtheriae strain 1737, HtaA, ChtA or ChtC (ChtA/C), and HbpA areall required for wild-type levels of growth when Hb-Hp is provided as the sole ironsource.

HbpA is exposed on the bacterial surface and is able to bind Hb-Hp. Whole-cellenzyme-linked immunosorbent assay (ELISA) studies that utilized C. diphtheriae 1737cultures grown in either high- or low-iron medium showed that HbpA can be detectedon the cell surface with antibodies directed against the HbpA protein. In the wild-typestrain, HbpA was detected at significantly higher levels after growth under low-ironthan high-iron conditions (Fig. 8). Only low levels were observed in the hbpA deletionmutant, and detection of HbpA was restored in 1737ΔhbpA in the presence of thecloned hbpA gene on pKN-hbpA. Control experiments using antibodies specific to ChtCor DtxR confirmed previous results (44) showing that ChtC is surface exposed andrepressed under high-iron conditions, while DtxR is an intracellular protein that is notexposed on the cell surface (Fig. 8).

FIG 7 (A) Growth assays were done with 1737wt and 1737ΔhbpA in mPGT medium containing either FeCl3(0.25 �M), hemin (0.5 �M), Hb (4.7 �g/ml), or Hb-Hp (4.7 and 8.75 �g/ml); **, P � 0.0001; *, P � 0.02compared to 1737wt. (B) Growth assays were done with Hb-Hp (4.7 and 8.75 �g/ml) provided as the soleiron source to the 1737 strains indicated below the graph. Vector pKN2.6Z is indicated as pKN. **, P � 0.004compared to both 1737wt/pKN and 1737ΔhbpA/pKN-hbpA. Experiments were done at least three times;graphs show means with standard deviations.

Lyman et al. Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 8

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

We also used whole-cell ELISAs to assess whether Hb or Hb-Hp can bind to thesurface of wild-type and various mutant strains of C. diphtheriae 1737. Bacteria thatwere grown in high- and low-iron media were incubated with either Hb or Hb-Hp andthen examined for the presence of bound hemoprotein using antibodies directedagainst either Hp (to detect Hb-Hp) or Hb (to detect Hb). Using the wild-type strain1737, we showed (Fig. 9A) that Hb and Hb-Hp bind strongly to bacteria that weregrown under low-iron conditions. Moreover, in the 1737Δ4 mutant, the binding ofthese hemoproteins to the cell surface under low-iron conditions is significantlyreduced from the levels observed in the wild-type strain. The binding of Hb or Hb-Hpin high-iron medium is similar for 1737Δ4 and for the wild type.

To assess the impact of Hb-Hp binding by each of the four binding proteins whosegenes are deleted in 1737Δ4, we examined the Hb-Hp binding profiles of individualmutants. We found that with deletion of htaA, chtA, or chtC, the double mutant 1737ΔchtA/ΔchtC or the triple mutant 1737ΔhtaA/ΔchtA/ΔchtC showed wild-type levels ofbinding to Hb-Hp (Fig. 9B). Only 1737ΔhbpA and 1737Δ4 showed a reduction inbinding to Hb-Hp. The presence of the cloned htaA, chtA, or chtC genes in 1737Δ4 didnot significantly increase binding to Hb-Hp above the levels detected in 1737Δ4carrying the vector only (Fig. 9C); however, the presence of the cloned hbpA generestored binding to Hb-Hp to wild-type levels in 1737Δ4 and 1737ΔhbpA.

HbpA does not bind hemin. All previously characterized Hb binding proteins in C.diphtheriae can also bind hemin (24, 44). We noted in Fig. 5 that HbpA does not harbora CR domain, a region shown to be essential for the binding of Hb, Hb-Hp, and heminin other hemoprotein binding proteins in C. diphtheriae. We used UV-visible spectros-copy to determine if purified HbpA is able to bind hemin. Purified HbpA in the presenceof 5 �M hemin did not show a peak absorbance in the 400-nm range, a spectral regionthat is characteristic of hemin binding by proteins (25) (Fig. 10). The hemin-bindingprotein HtaA, which shows a significant increase in the 400-nm range in the presenceof hemin, was used as a hemin-binding control for these studies (24). The ChtAC-terminal region (C term), which does not bind hemin (44), was used as a negativecontrol and exhibits a spectral profile similar to that of HbpA. These findings providestrong evidence that HbpA is unable to bind hemin.

DISCUSSION

The release of the Hb tetramer following lysis of erythrocytes results in the formationof the Hb dimer methemoglobin, which is rapidly, and virtually irreversibly, bound by

FIG 8 Whole-cell ELISA studies indicate that HbpA is surface exposed. C. diphtheriae 1737strains weregrown in either high-iron (10 �M FeCl3) or low-iron (0.25 �M FeCl3) mPGT medium and then transferredto a 96-well ELISA plate, where they were further incubated in PBS and processed as described inMaterials and Methods. HbpA was detected using anti-HbpA antibodies. ***, P � 0.001 compared to1737wt under low-iron conditions. ChtC and DtxR were detected with anti-ChtC and anti-DtxR antibod-ies, respectively. A single well on the ELISA plate was coated with purified DtxR as a control for anti-DtxRantibodies. Alkaline phosphatase-labeled secondary antibodies were used for detection. Experimentswere done at least three times; graphs show means with standard deviations.

Analysis of the Hb-Hp-Binding Protein HbpA Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 9

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

the acute-phase serum protein Hp (48). The binding of Hb to Hp greatly reduces thetoxicity of Hb and facilitates the removal of Hb from circulation through binding anduptake of the Hb-Hp complex by macrophages that contain the Hb-Hp receptor, CD163(48, 49). The Hb-Hp complex is one of the primary host iron sources used by certain

FIG 9 Hb and Hb-Hp bind to the surface of C. diphtheriae 1737. (A) Whole-cell ELISAs were used to assessbinding of Hb and Hb-Hp to 1737wt and 1737Δ4 that were grown in either high-iron (10 �M FeCl3) orlow-iron (0.25 �M FeCl3) mPGT medium. Cells were prepared for ELISAs as described for Fig. 8. Hb or Hb-Hpwas detected with antibodies directed against Hb or Hp, respectively. Significance compared to low-ironconditions: ***, P � 0.001; ****, P � 0.0001. (B) 1737 strains shown below the graph were grown in low-ironmPGT medium and tested by whole-cell ELISA for Hb-Hp binding. ****, P � 0.001 compared to 1737wt. (C)1737wt, 1737ΔhbpA, and 1737Δ4 carrying the indicated plasmid were grown under low-iron conditionsand tested for Hb-Hp binding as described above. ****, P � 0.0001 compared to 1737wt/pKN. Alkalinephosphatase-labeled secondary antibodies were used for detection. Experiments were done at least threetimes; graphs show means with standard deviations.

FIG 10 UV-visible spectroscopy was used to assess hemin binding to protein. Proteins at 5 �Mconcentration were incubated for 20 min at room temperature with or without 5 �M hemin and thendialyzed against PBS to remove free hemin. Experiments were done multiple times; a representativeexperiment is shown.

Lyman et al. Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 10

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

bacterial pathogens (50). While the nature of the host heme sources available to C.diphtheriae during infection is not known, it is likely that various heme compounds areused as iron sources during infection. In respiratory diphtheria, the bacteria colonize thepharyngeal mucosa and adjacent regions in the upper respiratory tract, which resultsin the formation of the characteristic pseudomembrane, an inflammatory necroticlesion that appears as an adherent, fibrinous structure (2). The deleterious effects ofdiphtheria toxin occur at the site of colonization in the respiratory tract and at distantorgans, most notably in cardiac muscle and neural tissue (4). The presence of thebacteria and the activity of the toxin result in localized inflammation, tissue destruction,and an associated serosanguinous discharge that generates an environment at the siteof colonization that likely results in the accumulation of host serum proteins, includingthe hemoprotein Hb-Hp. In this study, we have identified HbpA as a novel iron-regulated Hb- and Hb-Hp-binding protein in C. diphtheriae that is found both anchoredto the membrane and present in the extracellular medium. A C. diphtheriae mutant thatcarries a nonpolar deletion of the hbpA gene shows reduced ability to utilize Hb-Hp asan iron source, suggesting that HbpA functions in the utilization of hemin iron fromHb-Hp. Together with HtaA and ChtA/C, HbpA is the fourth Hb-Hp-binding protein inC. diphtheriae that is involved in the use of hemin iron from Hb-Hp.

The acquisition of hemin from Hb in Gram-positive bacteria, such as S. aureus andStreptococcus pyogenes, is proposed to utilize a surface-anchored protein in which aunique region of the protein, such as a NEAT domain, binds to Hb, resulting in therelease of hemin (37). The extracted hemin is thought to bind to a separate hemin-binding domain on the same protein, as proposed for the Shr protein in S. pyogenes andIsdB and IsdH in S. aureus (51, 52). B. anthracis utilizes the hemophores IsdX1 and IsdX2and the cell surface receptor Hal in the utilization of Hb as an iron source (53, 54). IsdX2is unusual in that it contains 5 NEAT domains, all of which bind Hb with variousaffinities, and all but the NEAT2 domain also bind hemin (55). IsdX2 is proposed tofunction as a secreted hemophore that binds Hb and hemin in the extracellularmedium and then delivers hemin to proteins, such as IsdC, on the bacterial surface (53).However, it was shown that approximately 20% of IsdX2 is cell associated, where it mayalso function as a surface receptor for Hb and hemin (53, 55). The C-terminal region ofIsdX2 contains a transmembrane sequence that is very similar to the putativemembrane-anchoring region present in the Hb-Hp-binding proteins in C. diphtheriae(HtaA, ChtA/C, and HbpA) and to the Shr protein in S. pyogenes (56). It was notdetermined whether this C-terminal region in IsdX2 is responsible for anchoring theprotein to the bacterial membrane.

While the use of Hb-Hp as an iron source has been described for several Gram-positive bacteria, the identification of specific proteins that are required for wild-typelevels of growth when Hb-Hp is used as the sole iron source has been reported only forC. diphtheriae (43). A study that examined the role of S. aureus IsdH, a protein knownto bind Hb-Hp, showed that an isdH mutant exhibited growth equivalent to that of thewild-type strain when Hb-Hp was the sole iron source (57), suggesting that either IsdHis not involved in the use of Hb-Hp or that other proteins may also be involved in theacquisition of hemin iron from Hb-Hp. While IsdB and Shr are known to bind Hb-Hp (28,38), their involvement in the use of the hemoprotein as an iron source has not beenreported; both proteins are active in the use of Hb as an iron source (23, 36). It has notbeen determined whether the IsdX1, IsdX2, and Hal proteins in B. anthracis can bindHb-Hp or utilize this hemoprotein as an iron source. A recent study reported that theS. aureus IsdH and IsdB proteins can bind Hb-Hp in vitro, but only IsdH was shown toremove hemin from Hb-Hp and to inhibit binding of Hb-Hp to its cellular receptor,CD163 (28). IsdH was also shown to inhibit the uptake of Hb-Hp by CD163-expressingcells, a function that IsdB was unable to perform. The authors proposed that a functionfor IsdH, in addition to hemin transport, may be to limit the removal of Hb-Hp fromcirculation by blocking binding to CD163, which may allow higher concentrations ofHb-Hp to be available as an iron source for the pathogen (28). With regard toGram-positive bacteria, only the C. diphtheriae HtaA, ChtA/C, and HbpA proteins are

Analysis of the Hb-Hp-Binding Protein HbpA Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 11

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

known to be involved in the use of Hb-Hp as an iron source. It has not been determinedif any of these Hb-Hp-binding proteins from C. diphtheriae can inhibit binding of Hb-Hpto the CD163 receptor. In contrast to the limited studies regarding Hb-Hp iron use inGram-positive bacteria, the use of hemin iron from Hb-Hp has been well studied inGram-negative pathogens, including Haemophilus influenzae and Neisseria meningitidis(37).

While the specific mechanism utilized by C. diphtheriae strain 1737 to obtain ironfrom Hb-Hp is not known, it appears to require three surface components for wild-typelevels of growth when Hb-Hp is the sole iron source. We showed previously that HtaAand ChtA/C are essential for growth with Hb-Hp; either a single mutation in htaA or thedouble mutant in chtA and chtC resulted in little if any growth when Hb-Hp was the soleiron source (43). Based on this observation, we proposed that HtaA and ChtA/C mayform a complex on the surface that initially binds Hb-Hp, which is followed by removalof hemin from the hemoprotein, by an unknown mechanism, and then transfer ofhemin to other hemin-binding CR domains on HtaA and/or HtaB. We also recognizethat the initial steps in the use of Hb-Hp may be a sequential process; for example,rather than formation of a complex between HtaA and ChtA/C, Hb-Hp may bind initiallyto ChtA/C, where Hb or hemin is extracted, and then hemin or Hb (or even Hb-Hp)binds to HtaA.

In this report, we show that an hbpA mutant exhibits approximately 65% reductionin growth relative to the wild type with Hb-Hp, suggesting that HbpA facilitates orenhances the use of iron from Hb-Hp, but does not exhibit the same requirement forgrowth as HtaA. There are several features of HbpA that set it apart from other Hb- andHb-Hp-binding surface proteins, including (i) the inability to bind hemin, (ii) its rela-tively small size (38 kDa), (iii) the lack of conserved functional motifs (such as a CR orNEAT domain) or any significant sequence homology to known proteins, and (iv) thepresence of high levels of HbpA in the culture supernatant and in the membrane. Theinability of HbpA to bind hemin suggests that HbpA may function early in the hemeuptake process through its capacity to bind Hb-Hp. HbpA is present at approximately2-fold-higher levels in the supernatant than the amount of HbpA associated with thecell (M. P. Schmitt and L. R. Lyman, unpublished observation). The abundance of HbpAin the extracellular environment may allow it to scavenge Hb-Hp and present it to thesurface receptors HtaA and/or ChtA/C. Alternatively, HbpA may be part of a complex onthe bacterial surface, where it functions with the other receptors in the binding ofHb-Hp and assists in the subsequent release of heme. A dual function for HbpA on thebacterial surface and in the supernatant is also possible, similar to the functionproposed for the B. anthracis IsdX2 protein (53, 55). However, it is clear from thewhole-cell binding studies that HbpA does not require the presence of the other knownreceptors to bind Hb-Hp on the cell surface, and it seems likely that the reason HbpAis responsible for much of the binding to Hb-Hp at the bacterial surface and in thesupernatant is the abundance of the HbpA protein in both of these fractions. A modeldepicting the utilization of Hb-Hp as an iron source by C. diphtheriae and the possiblerole of HbpA and other surface proteins is shown in Fig. 11.

In a previous report, we sought to determine the distribution of the htaA, chtA,and chtC genes among diverse C. diphtheriae strains (44). Our analysis included 19strains, of which 11 strains contained all three of the genes, 1 strain lacked onlychtA, and 7 strains lacked functional copies of all three genes. The completegenome sequence was known for only 14 of these strains. A phylogenetic analysisof the 14 sequenced C. diphtheriae strains indicates that strains that contain thehtaA, chtA, or chtC genes show a much higher overall genetic similarity to eachother than they do to strains that lack the genes (58). A review of these 19 strainsrevealed the presence of the hbpA gene only in those strains that also containedfunctional copies of htaA, chtA, and chtC. None of these four genes are geneticallylinked on the C. diphtheriae chromosome. Moreover, C. diphtheriae strains that wereassociated with a clonal group of isolates that dominated the diphtheria outbreakin the 1990s in the Former Soviet Union (FSU) also contained functional genes htaA,

Lyman et al. Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 12

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

chtA, chtC, and hbpA (44). Table 2 shows the distribution of the hbpA genes amonga diverse collection of 23 C. diphtheriae strains; the data presented show a correlationbetween the presence of hbpA and the presence of htaA, chtA, and chtC. While proteins involvedin the acquisition of heme iron from host hemoproteins are known to be important virulencefactors, additional studies are needed to determine if these C. diphtheriae Hb-Hp-bindingproteins have a role in the virulence of this important human pathogen.

MATERIALS AND METHODSBacterial strains and media. Table 3 lists Escherichia coli and C. diphtheriae strains used in this study.

Bacterial stocks were maintained in 20% glycerol at �80°C, and routine cultures were grownin Luria-Bertani (LB) medium for E. coli or heart infusion broth (Difco, Detroit, MI) containing 0.2% Tween80 (HIBTW) for C. diphtheriae strains. Modified PGT (mPGT) is a semidefined medium used for low-irongrowth conditions for C. diphtheriae and has been previously described (59). Antibiotics were used at 50�g/ml for kanamycin, 100 �g/ml for spectinomycin, 100 �g/ml for ampicillin, and 10 �g/ml for nalidixicacid. Antibiotics, ethylenediamine di(o-hydroxyphenylacetic acid) (EDDA), Tween 80, and Hp (human,Hp1-1) were obtained from Sigma Chemical Co., and purified Hb (human) was purchased from MPBioMedicals.

Plasmid construction. Table 3 lists the plasmids used in this study, and Table 4 lists the primers usedfor PCR amplification. C. diphtheriae wild-type strain 1737 was used as the source of genomic DNA for allplasmid constructs that utilized PCR unless otherwise noted. The promoter probe vector pSPZ containsa promoterless lacZ gene and was used to construct an hbpA promoter-LacZ fusion to measureexpression of the hbpA promoter (60). The 377-bp intergenic region upstream of the hbpA start codonwas amplified by PCR and cloned into pSPZ to construct plasmid pSPZ-hbpA. The pET-hbpA expressionplasmid was constructed by ligating a PCR-derived 873-bp fragment that harbors a portion of the hbpAcoding region into the vector pET24(a�). The pET-hbpA construct includes an N-terminal Strep-tag andcarries deletions of the N-terminal secretion signal and the C-terminal transmembrane region of HbpA.Plasmid pKN-hbpA contains the complete coding region and the upstream promoter region for hbpA ona PCR-derived 1,436-bp fragment in vector pKN2.6Z (41).

Deletion mutant construction. A nonpolar allelic replacement technique previously described (61)was used to create a deletion mutant of hbpA in C. diphtheriae 1737. The 5= and 3= ends of the hbpA gene,including regions upstream and downstream of the coding region, were amplified by PCR, purified by gelextraction, and then used as a template in a second PCR, which resulted in a single DNA fragmentcontaining the deleted region. This fragment was digested with appropriate restriction enzymes, ligated

FIG 11 Model of hemin uptake from Hb-Hp in C. diphtheriae strain 1737. Secreted HbpA binds to Hb-Hp in theextracellular environment, and HbpA is proposed to then facilitate the binding of Hb-Hp to surface receptorsChtA/C, HtaA, and HbpA. Alternatively, Hb-Hp may bind directly to surface receptors, bypassing the need for thesecreted HbpA. Following the binding of Hb-Hp to the surface receptors, it is proposed that hemin is extractedfrom Hb-Hp by an unknown mechanism and transported into the cytosol by a protein relay system that mayinvolve HtaA, HtaB, and HmuT. HmuT is a lipid-anchored hemin binding protein that is associated with thehemin ABC transporters HmuU and HmuV. Once in the cytosol, hemin is degraded by the heme oxygenase,HmuO, and the hemin-bound iron is made available for cellular metabolism.

Analysis of the Hb-Hp-Binding Protein HbpA Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 13

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

into the pCR-Blunt II-TOPO vector (Invitrogen), and then excised from the TOPO vector and ligated intopK18mobsacB (62). The pK18mobsacB vector contains an origin of replication that functions in E. coli butnot in C. diphtheriae. The resulting pK18mobsacBΔhbpA plasmid was transformed into E. coli S17-1 andthen mated into C. diphtheriae 1737 wild-type and 1737ΔhtaA/ΔchtA/ΔchtC strains. The deletion of hbpAin the 1737 strains was confirmed by PCR. Deletion of the dtxR gene in 1737 was done using the sameprocedure and plasmid constructs as those previously used to make the dtxR deletion in strain C7 (47).

Protein analysis and antibody production. Purification of DtxR was performed as describedpreviously with modifications (44, 63). C. diphtheriae DtxR was purified using the two-plasmid system inE. coli DH5�. An overnight culture grown at 30°C with appropriate antibiotics was diluted into fresh LBmedium and grown to mid-logarithmic growth phase. Expression of DtxR was induced by heat shock at42°C for 30 min and growth at 37°C for 3 h. Bacterial cells were pelleted, resuspended in lysis buffer (42mM NaH2PO4, 58 mM Na2HPO4, 50 mM NaCl, 5 mM MgCl2) with protease inhibitor cocktail (Roche), andlysed by sonication. Following sonication, cell debris was removed through centrifugation, and theclarified lysate was run through nickel-nitrilotriacetic acid (Ni-NTA)–agarose (Qiagen). The Ni-NTA–agarose was washed using lysis buffer, and protein was eluted using elution buffer (50 mM NaH2PO4, 300mM NaCl, 250 mM imidazole, pH 8.0). Fractions containing DtxR were dialyzed twice against phosphate-buffered saline (PBS) and once against PBS with 15% glycerol. Protein samples were stored at �20°C priorto use.

E. coli strain BL21(DE3) was used to express recombinant Strep-tagged HbpA using a previouslydescribed method (42) with the following modifications. Isopropyl-�-D-1-thiogalactopyranoside (IPTG)induction was done at 27°C, and the bacteria were lysed using the FastPrep cell lysis system (MPBiomedical) (64) followed by centrifugation for 10 min at 4°C. Lysis was done in buffer W (100 mMTris-HCl [pH 8.0], 150 mM NaCl) as recommended by the manufacturer for purification of Strep-tag-tagged proteins. Strep-tag-tagged HbpA present in the cell extract was purified using a Strep-TactinSepharose column (IBA Life Sciences) as per the manufacturer’s instructions and eluted in buffer E (100mM Tris-HCl [pH 8.0], 150 mM NaCl, 2.5 mM desthiobiotin). The HbpA protein recovered after elutionfrom the column was dialyzed against PBS and then against PBS with 20% glycerol and stored at �20°C.The purified HbpA protein was used to generate antibodies in guinea pigs using standard methods(Cocalico Biologicals, Inc.). For cell fractionation analyses, cell lysates were prepared with the FastPrepsystem as described above, with the exception that lysis was done in PBS. Following lysis (total protein),500-�l samples were centrifuged for 90 min at 65,000 rpm in a Beckman Optima TLX ultracentrifuge at4°C. The supernatant contains cytosolic proteins, while the pellet, which was resuspended in 100 �l ofPBS– 0.05% Tween 20 (PBST), contains the membrane fraction.

Proteins that were stained with Coomassie blue and excised from SDS-PAGE gels were identifiedusing LC-MS/MS analysis, which was performed by the FDA/CBER core facility.

Heme iron utilization assays. Iron utilization was assessed using a growth assay as previouslydescribed (43). Briefly, C. diphtheriae strains were grown overnight at 37°C in HIBTW and then diluted 1:2with HIBTW and incubated for 1 to 2 h. Following the incubation, 500 �l of culture was centrifuged

TABLE 2 Analysis of HbpA and other Hb-Hp-binding proteins in C. diphtheriae strains

Strain Origin/description

Presence of gene(s):Amino acididentity (%)a ReferencechtA, chtC, htaA hbpA

1737 FSU/epidemic strain � � 100 67NCTC13129 FSU/epidemic strain � � 100 451716 FSU/epidemic strain � � 100 671718 FSU/epidemic strain � � 100 671897 FSU/epidemic strain � � 100 671751 FSU �b � 67G4193 FSU �b � 67C7 USA/research � � 68PW8 USA/vaccine � � 69CDCE8392 CDC � � 8INCA402 Brazil � � 8BH8 Brazil � � 831A Brazil � � 8241 Brazil � � 96 8HC01 Brazil � � 96 8HC02 Brazil �c � 54 8HC03 Brazil � � 54 8VA01 Brazil � � 44 8HC04 Brazil � � 44 8ISS4749 Italy � � 54 70ISS4746 Italy � � 53 70ISS4060 Italy � � 70aPercent amino acid identity to HbpA in strain 1737.bThe status of htaA is not known for strains 1751 and G4193.cThe chtA gene is deleted in strain HC02.

Lyman et al. Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 14

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

and resuspended in 1 ml mPGT containing 1 �M FeCl3 and grown for 4 to 6 h at 37°C until the cultureshad reached log phase. The log-phase cultures were used to inoculate fresh mPGT medium thatcontained FeCl3 (at 0.25 or 10 �M), hemin (0.5 �M), Hb (4.7 �g/ml), or Hb-Hp (prebound at roomtemperature for 30 min with Hb at 4.7 �g/ml and Hp at 8.75 �g/ml) to a predicted optical density at 600nm (OD600) of 0.03. After 16 to 18 h of growth, the OD600 was measured. GraphPad Prism was used forstatistical analysis of growth.

Beta-galactosidase assays. C. diphtheriae strains containing the pSPZ-promoter fusion constructswere incubated as described above for the iron utilization assays. The final overnight cultures weregrown in 0.25 or 10 �M FeCl3 in mPGT, following which LacZ activity was assessed as previouslydescribed (44). Assays to assess the impact of Hb on hbpA promoter activity were done in HIBTWmedium. The final overnight cultures in HIBTW contained either no added supplements, Hb at 325 �g/ml,EDDA at 18 �g/ml, or both Hb and EDDA.

Gel electrophoresis and Western blot analysis. For Western blot analysis, cell lysates or purifiedproteins were separated by SDS-PAGE (65) and stained with Bio-Safe Coomassie blue (Bio-Rad) ortransferred to nitrocellulose membranes using a semidry transfer cell (24). Western blot procedures wereperformed as described previously (24). Anti-HbpA (Cocalico Biologics, Inc.), anti-Hb, and anti-Hp (SigmaChemical Co.) antibodies were used at a 1:10,000 dilution. Horseradish peroxidase-labeled secondaryantibodies (Sigma) were used at 1:50,000 to detect binding of the primary antibody per establishedprocedures (24).

For the in situ binding study to identify proteins that bind Hb or Hb-Hp, the Western blot procedurewas modified as follows: after nitrocellulose membranes were blocked in Tris-buffered saline with 0.05%Tween 20 (TBS-T) with 5% blotting grade blocking powder (Bio-Rad), an additional incubation step wasdone in Hb (10.1 �g/ml in TBS-T) or Hb-Hp (prebound for 30 min at room temperature with Hb at 10.1�g/ml and Hp at 8.75 �g/ml in TBS-T) for 1 h at 37°C. Following the 1-h incubation, membranes werewashed three times with TBS-T for 5 to 15 min before proceeding with the primary antibody step.

The following procedure was used to assess HbpA binding to Hb-Hp under nondenaturing condi-tions: Tris-glycine gels with 10% acrylamide-bis (30% solution, 29:1; Bio-Rad) were hand cast and usedwith native sample buffer (Bio-Rad) and 1� Tris-glycine running buffer to separate proteins. Gels were

TABLE 3 Strains and plasmids used in this study

Strain or plasmid Relevant characteristics or usea Reference or source

C. diphtheriae strains1737 Wild type, Gravis biotype, tox� 671737ΔhtaA Deletion of htaA in 1737 241737ΔchtA Deletion of chtA in 1737 441737ΔchtC Deletion of chtC in 1737 441737ΔchtA/ΔchtC/ΔhtaA Deletion of chtA, chtC, and htaA in 1737 441737ΔchtA/ΔchtC Deletion of chtA and chtC in 1737 441737ΔhbpA Deletion of hbpA in 1737 This study1737Δ4 Deletion of chtA, chtC, htaA, and hbpA in 1737 This study1737ΔdtxR Deletion of dtxR in 1737 This study

E. coli strainsBL21(DE3) Protein expression NovagenDH5� Cloning strain InvitrogenS17-1 RP4 mobilization functions 61EPI400 Cloning strain LucigenOne Shot TOP10 Cloning of PCR fragments Invitrogen

PlasmidspET24(a)� Expression vector, Knr MilliporepET-hbpA Strep-tag coding sequence-tagged hbpA cloned into

pET24(a)�This study

pKN2.6Z C. diphtheriae shuttle vector, Knr 41pET-htaA Strep-tag coding sequence-tagged htaA cloned into

pET24(A)�42

pET-Cterm Strep-tag-tagged C-terminal domain of ChtA inpET24(a)�

44

pKN-htaA pKN2.6Z carrying the htaA gene 24pKN-chtC pKN2.6Z carrying the chtC gene 43pKN-hbpA pKN2.6Z carrying the hbpA gene This studypK18mobsacB C. diphtheriae shuttle vector, Knr 62pSPZ Promoter probe vector, Spcr 60pSPZ-hbpA pSPZ with hbpA promoter region This studypCR-Blunt-II-TOPO Cloning of PCR fragments, Knr InvitrogenpMS298 Encodes C. diphtheriae dtxR under T7 control, Ampr 63pGP1-2 Encodes temp-inducible T7 RNA polymerase, Knr 71

aKn, kanamycin; Spc, spectinomycin; Amp, ampicillin.

Analysis of the Hb-Hp-Binding Protein HbpA Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 15

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

transferred to nitrocellulose membranes as described above for in situ binding analysis. HbpA was notsubjected to boiling or high temperatures, reducing conditions, or any detergents such as SDS duringthis procedure.

Identification of surface proteins and hemoprotein binding studies using whole cells. To verifythe surface exposure of various proteins and to assess binding of Hb-Hp, a whole-cell ELISA was used.A previously described protocol was followed to determine surface exposure of proteins in whole cells(44). Briefly, bacterial cultures were grown to stationary phase under low-iron (0.25 �M FeCl3) orhigh-iron (10 �M FeCl3) conditions in mPGT medium. Bacteria were harvested by centrifugation,resuspended in PBS, and then incubated overnight at 37°C in microtiter plates. The plates were thenwashed, followed by incubation with blocking buffer (5% blotting grade blocking powder [Bio-Rad] inPBST). The bacteria were then incubated with protein-specific primary antibodies, followed by incubationwith alkaline phosphatase-linked secondary antibodies. All antibodies were diluted 1:1,000 in blockingbuffer, and all incubation steps were done at 37°C for 1 h. Substrate p-nitrophenyl phosphate (pNPP;Sigma Chemical Co.) was used to develop the signal, which was read at 405 nm on a Multiskan FC fromThermo Scientific.

To assess Hb-Hp binding to cell surface proteins, a similar ELISA protocol was followed. Microtiterplates were coated with bacterial cultures and blocked as described above. Following the blocking step,the plates were incubated with Hb-Hp (prebound for 30 min at room temperature with Hb at 10.1 andHp at 8.75 �g/ml in PBST) for 1 h at 37°C. After incubation with Hb-Hp, an additional set of three washesin PBST were done, and the assay proceeded as described above for the whole-cell ELISA. Anti-haptoglobin antibodies were used to detect Hb-Hp bound to the cells’ surface.

UV-Vis spectroscopy. Purified Strep-tag-tagged HbpA was analyzed for hemin binding by UV-visible(UV-Vis) spectroscopy using a Genesys 10S UV-Vis system from Thermo Scientific. Purified Strep-tag-

TABLE 4 Primers used in this study

Primer use andname Amplified region

Approximatesize (bp) Sequence (5=–3=)a

qPCRRTDIP2330_1 hbpA 152 CTCTCGGGTGGAGAACAAAGRTDIP2330_2 CTGCCTTGGAGTTGAGGAAGRTDIP2329_1 dip2329 226 CTGATCCGCCAACAAGGTATRTDIP2329_2 TGTGGATTTGGCTGTGGTTARTDIP2331_1 dip2331 234 ACGAACCACTGGGTGTTCTCRTDIP2331_2 CGGAAAGGATTGTCTCGGTARTgyrB1 gyrB 166 GGTCTGACCATTACGCTGGTRTgyrB2 TCTTCTCGCGTTTCTTTGGTRTtox1 tox 224 GAACAGGCGAAAGCGTTAAGRTtox2 TTTTTGATAGGGCCATGCTC

EMSAP2330 Fwd1 biotin PhbpA 377 Biotin-CCCCCCCGTTTCCTCCGGTGAAATAATTAP2330 Rev1 biotin Biotin-CCCCCCATTCAAGATTGATTCCTTTGAGGGP2330 Fwd2 biotin P3= hbpA 175 Biotin- CCCCCCGGCCCCTAACTGACAAATTAGP2330 Rev1 biotin Biotin-CCCCCCATTCAAGATTGATTCCTTTGAGGGP2330 Fwd1 biotin P5= hbpA 205 Biotin-CCCCCCCGTTTCCTCCGGTGAAATAATTAP2330 Rev2 biotin Biotin-CCCCCCGCCTATTTTTCCTATATGCAAAGGPtox Fwd biotin tox 232 Biotin-CCCCCCCTCATTGAGGAGTAGGTCCCPtox Rev biotin Biotin-CCCCCCCATGGGCTGAAGGTGGGG

Promoter fusionP2330 Fwd hbpA 377 GCACGTCGACCGTTTCCTCCGGTGAAATAATTAP2330 Rev GATCGGATCCATTCAAGATTGATTCCTTTGAGGG

Complement cloneP2330 Fwd hbpA pKN2.6Z 1,436 GCACGTCGACCGTTTCCTCCGGTGAAATAATTA2330 compl Rev GACTGGATCCTGGGGCTTAACGCACGAAC

Expression clone2330 streptag Fwd hbpA pET24(a)� 873 GATCGCTAGCTGGAGCCACCCGCAGTTCGAAAAG

GGTGCAGCAGAAGAAGTAAAAAATGCCG2330 Rev GATGAAGCTTTTATGCCTTGGAGTTGAGGAAGC

Deletion mutants2330 5= KO Fwd Up hbpA 744 GATGGGATCCACAAGGTATTCACGTTCTCCG2330 5= KO Rev GGTGGTCAGGATATTCAAGATTG2330 3= KO Fwd Down hbpA 762 CAATCTTGAATATCCTGACCACCCATTTGTTC

GTGCGTTAAGCC2330 3= KO Rev GTTCGTCGACGTTGACTAGGAGGCCTTCG

aRestriction sites are underlined, and the Strep-tag sequence is indicated in bold type.

Lyman et al. Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 16

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

tagged HtaA (42) was used as a positive control, and the purified Strep-tag-tagged C-terminal domain ofChtA (C term) (44) was used as a negative binding control. Proteins at 5 �M in PBS buffer with 20%glycerol were incubated at room temperature with 5 �M hemin for 20 min, dialyzed three times againstPBS to remove free hemin, and then analyzed by UV-visible absorption scan using wavelengths from 200to 600 nm. Baseline absorbance was established using samples containing only PBS buffer.

Electrophoretic mobility shift assay. Purified DtxR was incubated at room temperature for 15 minwith biotinylated DNA fragments in DtxR binding buffer (20 mM Na2HPO4, 50 mM NaCl, 2 mMdithiothreitol [DTT], 5 mM MgCl2, 0.05 �g/�l sonicated salmon sperm DNA, 0.5 mM FeSO4, and 10%glycerol [pH 7.0]). Samples were separated by gel electrophoresis in 5% acrylamide with 20 mM Na2HPO4

and 1 mM DTT, pH 7.0, at 4°C for 70 min. Following gel electrophoresis, transfer of samples was done at4°C onto a nylon membrane (Invitrogen) in 0.5� Tris-borate-EDTA (TBE; Bio-Rad). Biotinylated DNAfragments were detected by the LightShift chemiluminescent EMSA kit (Thermo Scientific).

RNA isolation and qPCR. Wild-type C. diphtheriae was grown to mid-logarithmic phase in mPGTwith either 0.25 or 10 �M FeCl3; 95% ethanol and 5% phenol were added at a 1:10 dilution to cells priorto centrifugation. Following centrifugation, cells were suspended in PBS with 5% ethanol, 0.5% phenol,and 14.3 mM 2-mercaptoethanol (Sigma-Aldrich). Cells were lysed in Matrix B (MP Biomedicals); 750 �lof TRIzol LS reagent (Thermo Fisher Scientific) was added to the lysate, and samples were briefly vortexedand then centrifuged at 4°C for 5 min to remove cell debris. Approximately 700 �l of supernatant wascollected and processed according to the Direct-zol RNA MiniPrep kit instructions (Zymo Research). TotalRNA was treated using the Turbo DNA-free kit (Ambion). The ProtoScript II first strand cDNA synthesis kit(New England BioLabs, Inc.) was used to generate cDNA, and the Luna Universal qPCR master mix (NewEngland BioLabs, Inc.) was used for detection. Primers were designed using Primer 3 (66). Data werecollected by a LightCycler 96 system (Roche) and analyzed using the ΔΔCq method (where Cq isquantification cycle). Normalization of Cq values was done against gyrB.

RACE assays. Total RNA isolated from wild-type C. diphtheriae strain 1737 grown under iron-limitedconditions was subjected to Ambion Turbo DNase I treatment (Invitrogen). An hbpA-specific primer(DIP2330_GSP1, TGG TGC ATG GAG GAA TTT TTG G) was used to prime reverse transcription from thetotal RNA following directions using the 5= RACE system for rapid amplification of cDNA ends, version 2.0(ThermoFisher Scientific). A poly(C) tail was added to the product and used to prime PCR in conjunctionwith a second hbpA-specific primer (DIP2330_GSP2, TGA TGA CTA ATC CAT CCC CAT AC). The productwas purified using the Geneclean kit (MP Biomedicals) and submitted for sequencing (Macrogen).

ACKNOWLEDGMENTSThis work was supported by the intramural research program at the Center for

Biologics Evaluation and Research, Food and Drug Administration.We thank Scott Stibitz and Paul Carlson for helpful comments on the manuscript.

REFERENCES1. Zasada AA. 2015. Corynebacterium diphtheriae infections currently and in

the past. Przegl Epidemiol 69:439 – 444, 569 – 474.2. Hadfield TL, McEvoy P, Polotsky Y, Tzinserling VA, Yakovlev AA. 2000. The

pathology of diphtheria. J Infect Dis 181(Suppl 1):S116 –S120. https://doi.org/10.1086/315551.

3. Collier RJ. 2001. Understanding the mode of action of diphtheria toxin: aperspective on progress during the 20th century. Toxicon 39:1793–1803.https://doi.org/10.1016/S0041-0101(01)00165-9.

4. Holmes RK. 2000. Biology and molecular epidemiology of diphtheriatoxin and the tox gene. J Infect Dis 181(Suppl 1):S156 –S167. https://doi.org/10.1086/315554.

5. Boyd J, Oza MN, Murphy JR. 1990. Molecular cloning and DNA sequenceanalysis of a diphtheria tox iron-dependent regulatory element (dtxR)from Corynebacterium diphtheriae. Proc Natl Acad Sci U S A 87:5968 –5972. https://doi.org/10.1073/pnas.87.15.5968.

6. Schmitt MP, Holmes RK. 1991. Iron-dependent regulation of diphtheriatoxin and siderophore expression by the cloned Corynebacterium diph-theriae repressor gene dtxR in C. diphtheriae C7 strains. Infect Immun59:1899 –1904.

7. Kunkle CA, Schmitt MP. 2003. Analysis of the Corynebacterium diphthe-riae DtxR regulon: identification of a putative siderophore synthesis andtransport system that is similar to the Yersinia high-pathogenicity island-encoded yersiniabactin synthesis and uptake system. J Bacteriol 185:6826 – 6840. https://doi.org/10.1128/JB.185.23.6826-6840.2003.

8. Trost E, Blom J, de Castro Soares S, Huang IH, Al-Dilaimi A, Schroder J,Jaenicke S, Dorella FA, Rocha FS, Miyoshi A, Azevedo V, Schneider MP,Silva A, Camello TC, Sabbadini PS, Santos CS, Santos LS, Hirata R, Jr,Mattos-Guaraldi AL, Efstratiou A, Schmitt MP, Ton-That H, Tauch A. 2012.Pangenomic study of Corynebacterium diphtheriae that provides insightsinto the genomic diversity of pathogenic isolates from cases of classical

diphtheria, endocarditis, and pneumonia. J Bacteriol 194:3199 –3215.https://doi.org/10.1128/JB.00183-12.

9. Krewulak KD, Vogel HJ. 2008. Structural biology of bacterial iron uptake.Biochim Biophys Acta 1778:1781–1804. https://doi.org/10.1016/j.bbamem.2007.07.026.

10. Skaar EP. 2010. The battle for iron between bacterial pathogens andtheir vertebrate hosts. PLoS Pathog 6:e1000949. https://doi.org/10.1371/journal.ppat.1000949.

11. Sheldon JR, Laakso HA, Heinrichs DE. 2016. Iron acquisition strategies of bac-terial pathogens. Microbiol Spectr 4(2). https://doi.org/10.1128/microbiolspec.VMBF-0010-2015.

12. Choby JE, Skaar EP. 2016. Heme synthesis and acquisition in bacterialpathogens. J Mol Biol 428:3408–3428. https://doi.org/10.1016/j.jmb.2016.03.018.

13. Otto BR, Verweij-van Vught AM, MacLaren DM. 1992. Transferrins andheme-compounds as iron sources for pathogenic bacteria. Crit RevMicrobiol 18:217–233. https://doi.org/10.3109/10408419209114559.

14. Morgenthau A, Pogoutse A, Adamiak P, Moraes TF, Schryvers AB. 2013.Bacterial receptors for host transferrin and lactoferrin: molecular mech-anisms and role in host-microbe interactions. Future Microbiol8:1575–1585. https://doi.org/10.2217/fmb.13.125.

15. Crosa JH, Mey AR, Payne SM (ed). 2004. Iron transport in bacteria. ASMPress, Washington, DC.

16. Hammer ND, Skaar EP. 2011. Molecular mechanisms of Staphylococcusaureus iron acquisition. Annu Rev Microbiol 65:129 –147. https://doi.org/10.1146/annurev-micro-090110-102851.

17. Wyckoff EE, Mey AR, Payne SM. 2007. Iron acquisition in Vibrio cholerae.Biometals 20:405– 416. https://doi.org/10.1007/s10534-006-9073-4.

18. Desai PJ, Nzeribe R, Genco CA. 1995. Binding and accumulation of heminin Neisseria gonorrhoeae. Infect Immun 63:4634 – 4641.

19. Stojiljkovic I, Hantke K. 1994. Transport of haemin across the cytoplasmic

Analysis of the Hb-Hp-Binding Protein HbpA Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 17

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

membrane through a haemin-specific periplasmic binding-protein-dependent transport system in Yersinia enterocolitica. Mol Microbiol13:719 –732. https://doi.org/10.1111/j.1365-2958.1994.tb00465.x.

20. Henderson DP, Payne SM. 1994. Characterization of the Vibrio choleraeouter membrane heme transport protein HutA: sequence of the gene,regulation of expression, and homology to the family of TonB-dependent proteins. J Bacteriol 176:3269 –3277. https://doi.org/10.1128/jb.176.11.3269-3277.1994.

21. Cescau S, Cwerman H, Letoffe S, Delepelaire P, Wandersman C, Biville F.2007. Heme acquisition by hemophores. Biometals 20:603– 613. https://doi.org/10.1007/s10534-006-9050-y.

22. Troxell B, Hassan HM. 2013. Transcriptional regulation by ferric uptakeregulator (Fur) in pathogenic bacteria. Front Cell Infect Microbiol 3:59.https://doi.org/10.3389/fcimb.2013.00059.

23. Ouattara M, Cunha EB, Li X, Huang YS, Dixon D, Eichenbaum Z. 2010. Shrof group A Streptococcus is a new type of composite NEAT proteininvolved in sequestering haem from methaemoglobin. Mol Microbiol78:739 –756. https://doi.org/10.1111/j.1365-2958.2010.07367.x.

24. Allen CE, Schmitt MP. 2009. HtaA is an iron-regulated hemin binding proteininvolved in the utilization of heme iron in Corynebacterium diphtheriae. JBacteriol 191:2638–2648. https://doi.org/10.1128/JB.01784-08.

25. Mazmanian SK, Skaar EP, Gaspar AH, Humayun M, Gornicki P, Jelenska J,Joachmiak A, Missiakas DM, Schneewind O. 2003. Passage of heme-ironacross the envelope of Staphylococcus aureus. Science 299:906 –909.https://doi.org/10.1126/science.1081147.

26. Pilpa RM, Robson SA, Villareal VA, Wong ML, Phillips M, Clubb RT. 2009.Functionally distinct NEAT (NEAr Transporter) domains within the Staph-ylococcus aureus IsdH/HarA protein extract heme from methemoglobin.J Biol Chem 284:1166 –1176. https://doi.org/10.1074/jbc.M806007200.

27. Zhu H, Xie G, Liu M, Olson JS, Fabian M, Dooley DM, Lei B. 2008. Pathwayfor heme uptake from human methemoglobin by the iron-regulatedsurface determinants system of Staphylococcus aureus. J Biol Chem283:18450 –18460. https://doi.org/10.1074/jbc.M801466200.

28. Saederup KL, Stodkilde K, Graversen JH, Dickson CF, Etzerodt A, Hansen SW,Fago A, Gell D, Andersen CB, Moestrup SK. 2016. The Staphylococcus aureusprotein IsdH inhibits host hemoglobin scavenging to promote heme acqui-sition by the pathogen. J Biol Chem 291:23989–23998. https://doi.org/10.1074/jbc.M116.755934.

29. Tiedemann MT, Heinrichs DE, Stillman MJ. 2012. Multiprotein hemeshuttle pathway in Staphylococcus aureus: iron-regulated surface deter-minant cog-wheel kinetics. J Am Chem Soc 134:16578 –16585. https://doi.org/10.1021/ja305115y.

30. Muryoi N, Tiedemann MT, Pluym M, Cheung J, Heinrichs DE, Stillman MJ.2008. Demonstration of the iron-regulated surface determinant (Isd)heme transfer pathway in Staphylococcus aureus. J Biol Chem 283:28125–28136. https://doi.org/10.1074/jbc.M802171200.

31. Grigg JC, Vermeiren CL, Heinrichs DE, Murphy ME. 2007. Haem recogni-tion by a Staphylococcus aureus NEAT domain. Mol Microbiol 63:139 –149. https://doi.org/10.1111/j.1365-2958.2006.05502.x.

32. Skaar EP, Gaspar AH, Schneewind O. 2004. IsdG and IsdI, heme-degrading enzymes in the cytoplasm of Staphylococcus aureus. J BiolChem 279:436 – 443. https://doi.org/10.1074/jbc.M307952200.

33. Mazmanian SK, Liu G, Ton-That H, Schneewind O. 1999. Staphylococcusaureus sortase, an enzyme that anchors surface proteins to the cell wall.Science 285:760 –763. https://doi.org/10.1126/science.285.5428.760.

34. Fonner BA, Tripet BP, Eilers BJ, Stanisich J, Sullivan-Springhetti RK, MooreR, Liu M, Lei B, Copie V. 2014. Solution structure and molecular deter-minants of hemoglobin binding of the first NEAT domain of IsdB inStaphylococcus aureus. Biochemistry 53:3922–3933. https://doi.org/10.1021/bi5005188.

35. Torres VJ, Pishchany G, Humayun M, Schneewind O, Skaar EP. 2006.Staphylococcus aureus IsdB is a hemoglobin receptor required for hemeiron utilization. J Bacteriol 188:8421– 8429. https://doi.org/10.1128/JB.01335-06.

36. Pishchany G, Sheldon JR, Dickson CF, Alam MT, Read TD, Gell DA,Heinrichs DE, Skaar EP. 2014. IsdB-dependent hemoglobin binding isrequired for acquisition of heme by Staphylococcus aureus. J Infect Dis209:1764 –1772. https://doi.org/10.1093/infdis/jit817.

37. Sheldon JR, Heinrichs DE. 2015. Recent developments in understandingthe iron acquisition strategies of Gram positive pathogens. FEMS Micro-biol Rev 39:592– 630. https://doi.org/10.1093/femsre/fuv009.

38. Bates CS, Montanez GE, Woods CR, Vincent RM, Eichenbaum Z. 2003.Identification and characterization of a Streptococcus pyogenes operon

involved in binding of hemoproteins and acquisition of iron. InfectImmun 71:1042–1055. https://doi.org/10.1128/IAI.71.3.1042-1055.2003.

39. Zhu H, Liu M, Lei B. 2008. The surface protein Shr of Streptococcuspyogenes binds heme and transfers it to the streptococcal heme-binding protein Shp. BMC Microbiol 8:15. https://doi.org/10.1186/1471-2180-8-15.

40. Fisher M, Huang YS, Li X, McIver KS, Toukoki C, Eichenbaum Z. 2008. Shris a broad-spectrum surface receptor that contributes to adherence andvirulence in group A Streptococcus. Infect Immun 76:5006 –5015. https://doi.org/10.1128/IAI.00300-08.

41. Drazek ES, Hammack CA, Schmitt MP. 2000. Corynebacterium diphtheriaegenes required for acquisition of iron from haemin and haemoglobin arehomologous to ABC haemin transporters. Mol Microbiol 36:68 – 84.https://doi.org/10.1046/j.1365-2958.2000.01818.x.

42. Allen CE, Schmitt MP. 2011. Novel hemin binding domains in the Co-rynebacterium diphtheriae HtaA protein interact with hemoglobin andare critical for heme iron utilization by HtaA. J Bacteriol 193:5374 –5385.https://doi.org/10.1128/JB.05508-11.

43. Allen CE, Schmitt MP. 2015. Utilization of host iron sources by Coryne-bacterium diphtheriae: multiple hemoglobin-binding proteins are essen-tial for the use of iron from the hemoglobin-haptoglobin complex. JBacteriol 197:553–562. https://doi.org/10.1128/JB.02413-14.

44. Allen CE, Burgos JM, Schmitt MP. 2013. Analysis of novel iron-regulated,surface-anchored hemin-binding proteins in Corynebacterium diphthe-riae. J Bacteriol 195:2852–2863. https://doi.org/10.1128/JB.00244-13.

45. Cerdeno-Tarraga AM, Efstratiou A, Dover LG, Holden MT, Pallen M,Bentley SD, Besra GS, Churcher C, James KD, De Zoysa A, ChillingworthT, Cronin A, Dowd L, Feltwell T, Hamlin N, Holroyd S, Jagels K, Moule S,Quail MA, Rabbinowitsch E, Rutherford KM, Thomson NR, Unwin L,Whitehead S, Barrell BG, Parkhill J. 2003. The complete genome se-quence and analysis of Corynebacterium diphtheriae NCTC13129. NucleicAcids Res 31:6516 – 6523. https://doi.org/10.1093/nar/gkg874.

46. Bibb LA, King ND, Kunkle CA, Schmitt MP. 2005. Analysis of a heme-dependent signal transduction system in Corynebacterium diphtheriae:deletion of the chrAS genes results in heme sensitivity and diminishedheme-dependent activation of the hmuO promoter. Infect Immun 73:7406 –7412. https://doi.org/10.1128/IAI.73.11.7406-7412.2005.

47. Bibb LA, Schmitt MP. 2010. The ABC transporter HrtAB confers resistanceto hemin toxicity and is regulated in a hemin-dependent manner by theChrAS two-component system in Corynebacterium diphtheriae. J Bacte-riol 192:4606 – 4617. https://doi.org/10.1128/JB.00525-10.

48. Andersen CB, Torvund-Jensen M, Nielsen MJ, de Oliveira CL, Hersleth HP,Andersen NH, Pedersen JS, Andersen GR, Moestrup SK. 2012. Structureof the haptoglobin-haemoglobin complex. Nature 489:456 – 459. https://doi.org/10.1038/nature11369.

49. Kristiansen M, Graversen JH, Jacobsen C, Sonne O, Hoffman HJ, Law SK,Moestrup SK. 2001. Identification of the haemoglobin scavenger recep-tor. Nature 409:198 –201. https://doi.org/10.1038/35051594.

50. Rohde KH, Dyer DW. 2004. Analysis of haptoglobin and hemoglobin-haptoglobin interactions with the Neisseria meningitidis TonB-dependentreceptor HpuAB by flow cytometry. Infect Immun 72:2494–2506. https://doi.org/10.1128/IAI.72.5.2494-2506.2004.

51. Spirig T, Malmirchegini GR, Zhang J, Robson SA, Sjodt M, Liu M, KrishnaKumar K, Dickson CF, Gell DA, Lei B, Loo JA, Clubb RT. 2013. Staphylo-coccus aureus uses a novel multidomain receptor to break apart humanhemoglobin and steal its heme. J Biol Chem 288:1065–1078. https://doi.org/10.1074/jbc.M112.419119.

52. Ouattara M, Pennati A, Devlin DJ, Huang YS, Gadda G, Eichenbaum Z. 2013.Kinetics of heme transfer by the Shr NEAT domains of Group A Streptococ-cus. Arch Biochem Biophys 538:71–79. https://doi.org/10.1016/j.abb.2013.08.009.

53. Maresso AW, Garufi G, Schneewind O. 2008. Bacillus anthracis secretesproteins that mediate heme acquisition from hemoglobin. PLoS Pathog4:e1000132. https://doi.org/10.1371/journal.ppat.1000132.

54. Balderas MA, Nobles CL, Honsa ES, Alicki ER, Maresso AW. 2012. Hal is aBacillus anthracis heme acquisition protein. J Bacteriol 194:5513–5521.https://doi.org/10.1128/JB.00685-12.

55. Honsa ES, Maresso AW. 2011. Mechanisms of iron import in anthrax.Biometals 24:533–545. https://doi.org/10.1007/s10534-011-9413-x.

56. Honsa ES, Fabian M, Cardenas AM, Olson JS, Maresso AW. 2011. The fivenear-iron transporter (NEAT) domain anthrax hemophore, IsdX2, scav-enges heme from hemoglobin and transfers heme to the surface proteinIsdC. J Biol Chem 286:33652–33660. https://doi.org/10.1074/jbc.M111.241687.

Lyman et al. Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 18

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

57. Dryla A, Gelbmann D, von Gabain A, Nagy E. 2003. Identification of anovel iron regulated Staphylococcal surface protein with haptoglobin-haemoglobin binding activity. Mol Microbiol 49:37–53. https://doi.org/10.1046/j.1365-2958.2003.03542.x.

58. Sangal V, Hoskisson PA. 2016. Evolution, epidemiology and diversity ofCorynebacterium diphtheriae: new perspectives on an old foe. InfectGenet Evol 43:364 –370. https://doi.org/10.1016/j.meegid.2016.06.024.

59. Tai SP, Krafft AE, Nootheti P, Holmes RK. 1990. Coordinate regulationof siderophore and diphtheria toxin production by iron in Coryne-bacterium diphtheriae. Microb Pathog 9:267–273. https://doi.org/10.1016/0882-4010(90)90015-I.

60. Oram DM, Jacobson AD, Holmes RK. 2006. Transcription of the contig-uous sigB, dtxR, and galE genes in Corynebacterium diphtheriae: evidencefor multiple transcripts and regulation by environmental factors. J Bac-teriol 188:2959 –2973. https://doi.org/10.1128/JB.188.8.2959-2973.2006.

61. Ton-That H, Schneewind O. 2003. Assembly of pili on the surface ofCorynebacterium diphtheriae. Mol Microbiol 50:1429 –1438. https://doi.org/10.1046/j.1365-2958.2003.03782.x.

62. Schafer A, Tauch A, Jager W, Kalinowski J, Thierbach G, Puhler A. 1994.Small mobilizable multi-purpose cloning vectors derived from the Esch-erichia coli plasmids pK18 and pK19: selection of defined deletions in thechromosome of Corynebacterium glutamicum. Gene 145:69 –73. https://doi.org/10.1016/0378-1119(94)90324-7.

63. Schmitt MP, Holmes RK. 1993. Analysis of diphtheria toxin repressor-operator interactions and characterization of a mutant repressor withdecreased binding activity for divalent metals. Mol Microbiol 9:173–181.https://doi.org/10.1111/j.1365-2958.1993.tb01679.x.

64. Burgos JM, Schmitt MP. 2016. The ChrSA and HrrSA two-component sys-tems are required for transcriptional regulation of the hemA promoter inCorynebacterium diphtheriae. J Bacteriol 198:2419–2430. https://doi.org/10.1128/JB.00339-16.

65. Laemmli UK. 1970. Cleavage of structural proteins during the assemblyof the head of bacteriophage T4. Nature 227:680 – 685. https://doi.org/10.1038/227680a0.

66. Koressaar T, Remm M. 2007. Enhancements and modifications of primerdesign program Primer3. Bioinformatics 23:1289 –1291. https://doi.org/10.1093/bioinformatics/btm091.

67. Popovic T, Kombarova SY, Reeves MW, Nakao H, Mazurova IK, WhartonM, Wachsmuth IK, Wenger JD. 1996. Molecular epidemiology of diph-theria in Russia, 1985-1994. J Infect Dis 174:1064 –1072. https://doi.org/10.1093/infdis/174.5.1064.

68. Freeman VJ. 1951. Studies on the virulence of bacteriophage-infectedstrains of Corynebacterium diphtheriae. J Bacteriol 61:675– 688.

69. Park WH, Williams AW. 1896. The production of diphtheria toxin. J ExpMed 1:164 –185.

70. Sangal V, Blom J, Sutcliffe IC, von Hunolstein C, Burkovski A, Hosk-isson PA. 2015. Adherence and invasive properties of Corynebacte-rium diphtheriae strains correlates with the predicted membrane-associated and secreted proteome. BMC Genomics 16:765. https://doi.org/10.1186/s12864-015-1980-8.

71. Tabor S, Richardson CC. 1985. A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes.Proc Natl Acad Sci U S A 82:1074 –1078.

Analysis of the Hb-Hp-Binding Protein HbpA Journal of Bacteriology

April 2018 Volume 200 Issue 7 e00676-17 jb.asm.org 19

on April 3, 2020 by guest

http://jb.asm.org/

Dow

nloaded from