Upload
regan-conway
View
96
Download
7
Embed Size (px)
DESCRIPTION
Introduction to Synthetic Biology. Dannenberg and Purdy 2012 (Tokos edits 2012). What is Synthetic Biology?. https://www.youtube.com/watch?v=rD5uNAMbDaQ. ELECTRICAL engineering solution. water = weight water
Citation preview
Introduction to Synthetic Biology
Dannenberg and Purdy 2012
(Tokos edits 2012)
What is Synthetic Biology?
• https://www.youtube.com/watch?v=rD5uNAMbDaQ
ELECTRICAL engineering solution
water = weight water<weight
MECHANICAL engineering solution
BIOLOGICAL engineering solution
BIOLOGICAL engineering solution
PCR
Genetic Engineering
Sequencing
rDNA
A LIVING HOUSE - Terreform’s Fab
Tree Hab
• How is Synthetic Biology Different? Synthetic biology uses four principles not typically found in genetics, genomics, or molecular biology: abstraction, modularity, standardization, and design and modeling.
Abstraction:
• Abstraction - you can use parts/devices/systems without having to worry about how they work.
• DNA makes parts. • Parts into devices.• Devices connected to make
systems.
Modularity:
• parts, devices and systems - connected as self-contained units and combined in any combination you want
Standardization:
• All the “Tab A’s” fit into all the “Slot B’s.”
• An everyday example - all light bulbs fit into any socket!
Designing and modeling
• build a model
• test the devices capacity – improves design – tests basic biological assumptions that
could be false
Registry of Standard biological Parts
• http://partsregistry.org/Main_Page
DNA is DNA
• E. Coli is our chassis – Can use parts from any organism– Can use parts made by a computer
Abstraction Hierarchya human invention designed to assist people in engineering complex systems
Sequences of DNA encode “parts”
Assemblies of parts make up devices
Assemblies of devices make a system
“Part” – sequence of DNA with human defined function
AAAATGCACCCGCTGTCGATCAAACGCGCGGTGGCGAATATGGTGGTCAACGCCGCCCGTTATGGCAATGGCTGGGTCAAAGTCAGCAGCGGAACGGAGCCGAATCGCGCCTGGTTCCAGGTGGAAGATGACGGTCCGGGAATTGCGCCGGAACAACGTAAGCACCTGTTCCAGCCGTTTGTCCGCGGCGACAGTGCGCGCACCATTAGCGGCACGGGATTAGGGCTGGCAATTGTGCAGCGTATCGTGGATAACCATAACGGGATGCTGGAGCTTGGCACCAGCGAGCGGGGCGGGCTTTCCATTCGCGCCTGGCTGCCAGTGCCGGTAACGCGGGCGCAGGGCATGACAAAAGAAGGGTAATCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCC
Parts assembled into Devices
AAAATGCACCCGCTGTCGATCAAACGCGCGGTGGCGAATATGGTGGTCAACGCCGCCCGTTATGGCAATGGCTGGGTCAAAGTCAGCAGCGGAACGGAGCCGAATCGCGCCTGGTTCCAGGTGGAAGATGACGGTCCGGGAATTGCGCCGGAACAACGTAAGCACCTGTTCCAGCCGTTTGTCCGCGGCGACAGTGCGCGCACCATTAGCGGCACGGGATTAGGGCTGGCAATTGTGCAGCGTATCGTGGATAACCATAACGGGATGCTGGAGCTTGGCACCAGCGAGCGGGGCGGGCTTTCCATTCGCGCCTGGCTGCCAGTGCCGGTAACGCGGGCGCAGGGCATGACAAAAGAAGGGTAATCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCC
Parts assembled into Devices
AAAATGCACCCGCTGTCGATCAAACGCGCGGTGGCGAATATGGTGGTCAACGCCGCCCGTTATGGCAATGGCTGGGTCAAAGTCAGCAGCGGAACGGAGCCGAATCGCGCCTGGTTCCAGGTGGAAGATGACGGTCCGGGAATTGCGCCGGAACAACGTAAGCACCTGTTCCAGCCGTTTGTCCGCGGCGACAGTGCGCGCACCATTAGCGGCACGGGATTAGGGCTGGCAATTGTGCAGCGTATCGTGGATAACCATAACGGGATGCTGGAGCTTGGCACCAGCGAGCGGGGCGGGCTTTCCATTCGCGCCTGGCTGCCAGTGCCGGTAACGCGGGCGCAGGGCATGACAAAAGAAGGGTAATCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCC
Device to System
Plasmids and Transformation
Now for the Good Part(2009 Cambridge iGEM Team)
The Problem
• Toxins contaminate the environment
• Detection can be expensive and complicated
• Can cheap bacteria be used as toxin indicators that change color in response to toxin levels?
The Color-Generating Device
• Contain violacein pigment devices(ORF from Chromobacterium violacein)
Genes re-engineered to produce purple and green in E. Coli
• If all 5 genes in the ORF are expressed - purple pigment produced
• If third gene in ORF sequence is removed - green pigment produced
The Chassis
• To a Synthetic Biologist
=Escherichia coli
Bacterial transformation of Escherichia coli
• Two different strains of E. coli (4-1 & 4-2)• Two different plasmids (pPRL & pGRN)
• Can we expect the devices to behave the same in each Can we expect the devices to behave the same in each strain, or will the chassis have an effect on the intensity strain, or will the chassis have an effect on the intensity of color produced?of color produced?
Creation of a Bacterial Cell Controlledby a Chemically Synthesized Genome
Dan Gibson, +21, Ham Smith and Craig Venter
Science (2010) 329: 52
PCR for watermarks
M. mycoides genome
transplanted to M. capricolum
Creation of a Bacterial Cell Controlledby a Chemically Synthesized Genome
Dan Gibson, +21, Ham Smith and Craig Venter
Science (2010) 329: 52
New Directions: The Ethics of Synthetic Biology and Emerging Technologies
December 2010
Presidential Commissionfor the Study of Bioethical Issues