74
Introduction to KEGG Susumu Goto, Masahiro Hattori, Wataru Honda, Junko Yabuzaki Kyoto University, Bioinformatics Center Systems Biology and the Omics Cascade, Karolinska Institutet, 10 June 2008

Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Embed Size (px)

Citation preview

Page 1: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Introduction to KEGG

Susumu Goto, Masahiro Hattori, Wataru Honda, Junko Yabuzaki

Kyoto University, Bioinformatics Center

Systems Biology and the Omics Cascade, Karolinska Institutet, 10 June 2008

Page 2: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Today’s Menu

•  Brief history and overview of KEGG and GenomeNet (Goto) •  KEGG resources related to genomic information (Goto) •  KEGG resources related to systems information (Honda) •  KEGG resources related to chemical information (Hattori)

Morning session

•  Searching genomic information in KEGG (Yabuzaki) •  Assembling cDNA sequences and annotating functions (Goto/Yabuzaki)

•  Handling microarray data for mapping KEGG pathways (Goto/Honda)

•  Searching and computing pathways and chemical information in KEGG (Honda/Hattori)

Afternoon session (laboratory work)

Page 3: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Genome

Transcriptome Proteome

Chemical information Metabolism Glycans Lipids

Metabolome Glycome

Molecular information

Sequences Structures Molecular interaction

Physical interaction Co-expression

Background

Various types of omics data are now available

Page 4: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Overview

•  Kyoto Encyclopedia of Genes and Genomes •  Integrated database of biological systems, genetic building blocks and chemical building blocks

KEGG (http://www.genome.jp/kegg/)

•  Kanehisa, M., et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 36, D480 (2008)

•  Kanehisa, M., et al. From genomics to chemical genomics: new developments in KEGG. Nucleic Acids Res. 34, D354 (2006)

References

Page 5: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Four Major Components of KEGG

Reconstructing biological phenomenon with various omics data and researcher’s knowledge

Chemical Information KEGG LIGAND

Genomic Information KEGG GENES

Hierarchical classification KEGG BRITE

Systems Information KEGG PATHWAY Tools

 EGassembler  KAAS  GENIES  KegArray

Tools  e-zyme  pathcomp  KegArray

Page 6: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

KEGG history with ID system

Release Database Object identifier

1995 KEGG PATHWAY map number KEGG GENOME organism code (T number) KEGG GENES locus_tag / NCBI GeneID KEGG ENZYME EC number KEGG COMPOUND C number 2001 KEGG REACTION R number 2002 KEGG ORTHOLOGY K number 2003 KEGG GLYCAN G number 2004 KEGG RPAIR A number 2005 KEGG BRITE br number KEGG DRUG D number 2008 KEGG MODULE M number KEGG DISEASE H number

Kanehisa, M., et al. Nucleic Acids Res. 36, D480 (2008)

Page 7: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Databases in GenomeNet

Established in 1991 under the Japanese Human Genome Project http://www.genome.jp/

A network of databases and computational services for genome research and related research areas in biomedical sciences

>30 databases including KEGG, GenBank, UniProt, PDB, …

>500 databases linking from/to GenomeNet

Unique ID for each entry database:entry e.g. compound:C00002 for ATP

Page 8: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Four Major Components of KEGG

Reconstructing biological phenomenon with various omics data and researcher’s knowledge

Chemical Information KEGG LIGAND

Genomic Information KEGG GENES

Hierarchical classification KEGG BRITE

Systems Information KEGG PATHWAY

Page 9: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

KEGG GENES Database Molecular building blocks of life

in the genomic space

Page 10: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

A collection of gene catalogs for all complete genomes and some partial genomes generated from publicly available resources, mostly NCBI RefSeq

http://www.genome.jp/kegg/genes.html

KEGG GENES

Page 11: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

KEGG GENES main components

KEGG Orthology (KO) Ortholog groups linked to PATHWAY and BRITE

GENES Gene catalogs of complete genomes with manual functional annotation

DGENES Gene catalogs of draft genomes with automatic functional annotation

EGENES Consensus contigs of EST data with automatic functional annotation

SSDB Sequence similarity with best-hit information for identifying ortholog/paralogs

GENES, DGENES, EGENES: Genomic information KEGG Orthology, SSDB: Relationship

Page 12: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Organisms in KEGG GENES

http://www.genome.jp/kegg/catalog/org_list.html

Page 13: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

141 Eukaryotes

43 Animals (Complete / Draft Genomes) 54 Plants (Mostly EST Consensus Contigs) 27 Fungi (Mostly Complete Genomes) 17 Protists (Mostly Complete Genomes)

633 Eubacteria (All Complete Genomes)

52 Archea (All Complete Genomes)

Total: 826 organisms (30 May 2008)

Organisms in KEGG GENES

Page 14: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

•  Hierarchical classification of organisms is based on Taxonomy database in NCBI

•  3-4 letter code / T number

Homo sapiens Escherichia coli K-12 MG1655 Escherichia coli K-12 W3110

Fugu rubripes Hordeum vulgare (barley) (EST)

Organisms in KEGG GENES

⇒  hsa ⇒  eco ⇒  ecj ⇒  dfru ⇒  ehvu

GENES

DGENES EGENES

Page 15: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Entry of GENES

Page 16: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Entry field Entry ID Entry types (CDS, RNA, Contig, etc. …) Organism name

Page 17: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Gene name field Names and synonyms of geens and/or proteins

Page 18: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Definition field Functional annotation assigned by original genome project

Page 19: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Orthology field Ortholog annotation assigned by KEGG project

Page 20: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Pathway field Links to pathway maps including this gene

Page 21: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene
Page 22: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Class field Link to BRITE functional categories

Page 23: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Another Example of BRITE

Page 24: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

SSDB field Link to SSDB for obtaining •  Orthologs:

•  BBH pairs •  Paralogs:

•  homologs in the same organism

•  Conserved gene clusters

Page 25: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene
Page 26: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Motif field Domains and motifs found in the protein sequence

Page 27: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Other DBs field

Links to other databases

LinkDB field

Page 28: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Structure field

Page 29: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Position field Locus on the genome sequence contained in the KEGG GENOME database

Page 30: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

AA seq field

Amino acid and nucleotide sequence in FASTA format and link to BLAST search in GenomeNet

NT seq field

Page 31: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

KEGG GENES main components

KEGG Orthology (KO) Ortholog groups linked to PATHWAY and BRITE

GENES Gene catalogs of complete genomes with manual functional annotation

DGENES Gene catalogs of draft genomes with automatic functional annotation

EGENES Consensus contigs of EST data with automatic functional annotation

SSDB Sequence similarity with best-hit information for identifying ortholog/paralogs

GENES, DGENES, EGENES: Genomic information KEGG Orthology, SSDB: Relationship

Page 32: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

KEGG Orthology Database Ortholog groups bridging the genomic space

and systems space

Page 33: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Linking GENES to PATHWAY

Reconstructing biological phenomenon with various omics data and researcher’s knowledge

Chemical Information KEGG LIGAND

Genomic Information KEGG GENES

Hierarchical classification KEGG BRITE

Systems Information KEGG PATHWAY

KEGG Orthology

Page 34: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

•  KEGG PATHWAY database •  Important component of the KEGG databases •  Golden standard of metabolic pathways for bioinformatics

Node: genes and compounds Edge: reactions and interactions

Linking GENES to PATHWAY

Page 35: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Compound nodes in the pathway networks

Linking GENES to PATHWAY

Page 36: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Gene/protein nodes in the pahtway networks

Linking GENES to PATHWAY

Page 37: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Thus, grouping by the orthologous relationships

Linking GENES to PATHWAY

hsa:5211 hsa:5213 hsa:5214

sce:YGR240C sce:YMR205C

eco:b1723 eco:b3916

KEGG Orthology

H. sapiens S. cerevisiae E. coli

K00850

Page 38: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Nodes in the reference pathways Reference nodes for genes of all organisms

KEGG Orthology

hsa:5211 hsa:5213 hsa:5214

sce:YGR240C sce:YMR205C

eco:b1723 eco:b3916

H. sapiens S. cerevisiae E. coli

K00850

GENES

KO

Pathways in

Reference pathway

Genes and compounds

KOs and compounds

Page 39: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

KEGG Orthology

GENES

Annotated

Unannotated

10,890 ortholog groups contain 28% of KEGG GENES entries

E. coli B. subtilis S. cerevisiae H. sapiens A. thaliana

Page 40: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

DGENES

Draft genome

GENES

Complete genome

EGENES

Transcriptome EGassembler

EST contigs

Annotation via KEGG Orthology

SW score BLASTP BLASTX

Homology & BBH

Automatic annotation

KAAS

Curation

KO, PATHWAY & BRITE

Page 41: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

KEGG Automatic Annotation Server Ortholog assignment and pathway mapping

Page 42: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

•  KEGG Automatic Annotation Server •  http://www.genome.jp/kegg/kaas/

•  Automatic annotation system for KO •  Using GENES as a template set •  More than 90% accuracy

•  Reconstruct PATHWAY by using your own data set

KAAS

Page 43: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Functional Annotation in KAAS 1.  Query gene

2.  Homologs

3.  Ortholog candidates

4.  KEGG Orthology groups

5.  Ranking of KEGG Orthology

BLAST

Cut off by bi-directional best hit rate

Grouping by KEGG Orthology

Scoring by probability and heuristics

Bi-directional best hit rate BHRab = Rf × Rr Genome A Genome B

Gene a Gene a’ Gene b’

Gene b S

S’: best hit

Rf = S / S’

Moriya, Y. et al. Nucl. Acids Res. 2007 35:W182-W185

Page 44: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Your query genome sequences KEGG GENES entries with KO

> seq 1 > seq 2 > seq 3 > seq 4 > seq 5 > seq 6 > seq 7 ⋯ ⋯ ⋯

> Your query sequences 1

> Your query sequences 2

> Your query sequences 3

> Your query sequences 4

> Your query sequences 5

Ortholog3

KO2

Score 2

Homolog

SKO = Sh - log2(mn) - log2(ΣxCkpk(1-p)x-k) k=N x

Ortholog1

KO3

Score 3

Ortholog2

KO1

Score 1

1. The highest score

1.

2. Normalization by the sequence lengths

2.

3. Weighting factor of the number of ortholog candidates

3.

Scoring and Ranking of KO

Page 45: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Moriya, Y. et al. Nucl. Acids Res. 2007 35:W182-W185

Pathway mapping in KAAS

Page 46: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

EGassembler Easy assembling nucleotide sequences

for pathway reconstruction

Page 47: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

EGassembler

1.  EST (GSS, cDNA, gDNA) sequences

2.  Sequence cleaning

3.  Repeat masking

4.  Vector masking

5.  Organelle masking

6.  Sequence assembling (CAP3)

PolyA/PolyT, Low-complexity, Low-quality filtering Short sequence removal (seqclean)

RepBase, TIGR, TREP, User’s database (RepeatMasker)

UniVec, emvec, User’s database (CrossMatch)

NCBI organelle database

Automatic all-in-one pipeline Masoudi-Nejad, A. et al. Nucl. Acids Res. 2006 34:W459-W462

http://egassembler.hgc.jp/

Page 48: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

1. EST Raw Data

Page 49: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

PolyA / PolyT tail

Low complex sequence

Low quality sequence

(Shorter than 100) Short sequence

2. Sequence Cleaning

Page 50: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Removed

Page 51: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Repetitive sequences

Libraries •  Human •  Your custom repeats library •  EGrep repeats library (Our custom repeatlibrary) •  RepBase repeats library •  TREP repeats library •  TIGR repeats library

3. Repeat Masking

Page 52: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Masked

Masked as “XXXXXX…”

Page 53: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Vector sequences

Libraries •  Your custom vector library •  EGvec vector library (Our custom vectors library) •  NCBI‘s vector library CoreRedundant •  EMBL vector library

4. Vector Masking

Page 54: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Masked

Masked as “XXXXXX…”

Page 55: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Organelle sequences

Libraries •  Your custom organelle library •  Plastids library (44 species including Arabidopsis, Chlamydomonas, Lotus, Zea mays, etc.)

•  Mitochondria library (Fungi, Metazoa, Plants, Plasmid, etc.)

5. Organelle Masking

Page 56: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Masked

Masked as “XXXXXX…”

Page 57: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Huang, X. and Madan, A. Genome Res. (1999) 9:868-877

6. Assembly by CAP3

Page 58: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Potential overlap determination by BLAST-like technique

Page 59: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Local alignment by Smith-Waterman algorithm

+ Singletons

Page 60: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Assembly

+ Singletons

contig1 contig2

contig3 contig4

contig5 contig6 contig7

Page 61: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

EST consensus contigs and Singletons in FASTA format

>contig1

>contig2

>contig3

>contig4

>contig5

>contig6

>contig7

+ Singletons >1

>2

>3

>4

Page 62: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Solanum lycopersicum (Tomato) : Taxonomy TAX: 4081

Number of accepted ESTs at NCBI : 260126 (2007/5/22) clean

Number of cleaned ESTs : 246118 (~96% left)

Assembled sequences: Contigs 19479 + Singletons 18010 (Total : 37507)

assembly

EGENES Example

Page 63: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Alignment results An example of an alignment result Cleaned sequences

Three ESTs

Page 64: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

>Contig1 GGCACGAGGAAAAAAAAAAAAAAAGAATGGATTCCAAAGCATTTCTATTTTTTGGTCTTT TTTTGGCTATTTTCCTAATGATAAGCTCTGAGATTTTAGCTACTGAGTTGGCTGAGAACT CTAAGAAATCTGAAAACAAGAATGAAGTACATGAAGCCCAATACGGTGGATATCCTGGTG GTGGTGGTGGATATGGACGCGGTGGTGGTGGTGGATATGGACGCGGTGGTGGTGGAGGAT ATGGACGTGGTGGTGGATACGGACATGGTGGTGGTGGTGGATATGGACATGGTGGTGGTG GTGGATATGGACACGGTGGTGGTGGATACGGACACCGTGGTGGCGGTGGTGGTGGACGAC GTGGTGGATACTGCCAGTATGGTTGCTGTGGCCATGGTGACAATGGTTGCTATAGGTGTT GCTCCTATAAAGGTGAGGCAATGGACAAAGTTACTCAAGCTAAGCCACACAATTAATTAA TTATGTGTGGAGTACGTAGTATATTATATTAAAACTTTTGTAATGGCAATTATGTAATAT TATTAGCAATGCTCTTTCTACTTTAGAGCTTGCTATAATATTACTAAAAATGTATTGAAT AAAAGCCATGTTGTAGTAATTTTATTATCAATATTTTATCATGATATTCATATTTACTGT ATTTCACTAATTATACCAAAAAGTTTTAGTGC …

>Contig13317 GATTTGGGAAGACCATATGGTAGAGTTAGTAGAAAGAAGCTGAAGTTGAAATTGTTGAAT AGTTGTGTTGAGAACAGAGTGAAGTTTTATAAAGCTAAGGTTTGGAAAGTGGAACATGAA GAATTTGAGTCTTCAATTGTTTGTGATGATGGTAAGAAGATAAGAGGTAGTTTGGTTGTG GATGCAAGTGGTTTTGCTAGTGATTTTATAGAGTATGACAGGCCAAGAAACCATGGTTAT CAAATTGCTCATGGGGTTTTAGTAGAAGTTGATAATCATCCATTTGATTTGGATAAAATG GTGCTTATGGATTGGAGGGATTCTCATTTGGGTAATGAGCCATATTTAAGGGTGAATAAT GCTAAAGAACCAACATTCTTGTATGCAATGCCATTTGATAGAGATTTGGTTTTCTTGGAA GAGACTTCTTTGGTGAGTCGTCCTGTTTTATCGTATATGGAAGTAAAAAGAAGGATGGTG GCAAGATTAAGGCATTTGGGGATCAAAGTGAAAAGTGTTATTGAGGAAGAGAAATGTGTG ATCCCTATGGGAGGACCACTTCCGCGGATTCCTCAAAATGTTATGGCTATTGGTGGGAAT TCAGGGATAGTTCATCCATCAACAGGGTACATGGTGGCTAGGAGCATGGCTTTAGCACCA GTACTAGCTGAAGCCATCGTCGAGGGGCTTGGCTCAACAAGAATGATAAGAGGGTCTCAA CTTTACCATAGAGTTTGGAATGGTTTGTGGCCTTTGGATAGAAGATGTGTTAGAGAATGT TATTCATTTGGGATGGAGACATTGTTGAAGCTTGATTTGAAAGGGACTAGGAGATTGTTT GACGCTTTCTTTGATCTTGATCCTAAATACTGGCAAGGGTTCCTTTCTTCAAGATTGTCT GTCAAAGAACTTGGTTTACTCAGCTTGTGTCTTTTCGGACATGGCTCAAACATGACTAGG TTGGATATTGTTACAAAATGTCCTCTTCCTTTGGTTAGACTGATTGGCAATCTAGCAATA GAGAGCCTTTGAATGTGAAAAGTTTGAATCATTTTCTTCATTTTAAA

>Contig19479 … Total : 19479 contigs

Page 65: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

>gi|56121773|gb|CV970760.1|CV970760 SlE8 SlE Solanum lycopersicum cDNA, mRNA sequence TGATAACCTAGCTTTGTGATCATAATCATGGGTTCTTCTTCTCAAAAGAGGGTTGTAGGG TTACTTCTTGTCTTGAGTATTTTCTTGGAATTGAGTGCCATCACTTTTGGTGATGATAAG TTTGAAGAGTCGAGGTGGGGTAATGATTATGGTTGTGGACGATTTGGTAGAAGGGGATGT AGTGGACGCGATCAAGGTGGTGGTAGAGGTGTTGGAGGAGGGTTTGGAGGCGGAGCTGGT GGAGGAGGAGGTC >gi|56121770|gb|CV970757.1|CV970757 SlE5 SlE Solanum lycopersicum cDNA, mRNA sequence CTTAATTCCAAAGAGTCTTGTTGTACATCCCCCAAATTTGAGGAACTGGTGGTTGGTGCA TTATCCCTGCTAGTAATGAGGCTTTTTGCTGGCGGCCCCGGCCGGGGTCGTCATTATTTG CCACATATCTTAGTGGCCATTTTGGCTCTTGTTGATATTGTTTCTGCTGACCCTTACATA TATGCCTCTCCACCACCACCGTATGTGTACAAATCCCCACCACCTCCTTCTCCTTCTCCA CCACCACCATACGTGTACAAGTCCCCGCCACCTCCTTCTCCCTCTCCTCCACCACCGTAC GTGTACAAGT >gi|117725616|gb|DB705376.1|DB705376 DB705376 Solanum lycopersicum cv. Micro-Tom leaf Solanum ly copersicum cDNA clone LEFL1088BH06 5', mRNA sequence TTTTAAAATGAATGCATATAGTGGCGAAGCATGTTCTGTAGTTAATAGGGCTTGTTGTTG TATTATAGGTATAAGAAAGATACATTTTTGCACTTAGATCCACTATGATGTGAGTTATTC AACTTGGATTTGAGTGTAAAGTGTATATATAGTTGAGGTCTTCAATCTATTACAATGTTA CGACAAATTGGATCTACAGTGGGTTCTTGGACTCACAAGAAGATCGTTGATCCTCTTCTC CAAATCCTTCGTAGGGGTGCAGAGCCAAAACAATTGGCATTCTCTGGGGCTCTTGGTGCT ACATTGGGTCTCTTTCCCATCTGTGGGGTTGCTGTGTTTCTATGTGGCGTAGCTATTGTA GTACTTGGATCCTTGTGTCATGCACCAACTGTGTTGTTGGTCAACTTCATTGTTACTCCC ATTGAGCTGAGTTTGGTGATTCCTTTCCTACGTTTAGGTGAATATGTGAGTGGTGGACCT CATTTTGCTTTGACCTCAGATGCATTAAAGAGGGTCTTCACTGGTAAAGCTTCGTGGGAA GTCTTGCTGAGCATTTACCATGCGTTGCTGGGCTGGCTTGTTGCTGTACCATTCATC …

+ 18010 singletons

Page 66: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

EGENES Example

Page 67: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene
Page 68: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

EGENES Example

Page 69: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene
Page 70: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

KegArray Mapping microarray expression data

to KEGG pathway data

Page 71: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

•  Java application for handling expression data •  http://www.genome.jp/download/

•  Microarray data with KEGG Gene IDs •  Coloring based on expression levels •  Mapping the coloring to pathway data •  ID conversion available: NCBI-GeneID, IPI, …

•  Metabolome data can be also mapped

KegArray

Page 72: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

•  GECS: Gene Expression to Chemical Structure •  Microarray data -> Carbohydrate structures •  http://www.genome.jp/tools/gecs/

•  GENIES •  Gene Network Inference Engine based on Supervised Analysis

•  Integration of multiple omics data to infer gene functions

•  Using pathway data for supervised data •  http://www.genome.jp/tools/genies/

Other tools

Page 73: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

•  KEGG is 13 years old database for genomic, chemical, and systems information.

•  Genomic information (GENES section) includes complete genomes, draft genomes and EST contigs

•  KEGG Orthology plays a key role in connecting genomic and systems information

•  Users can input their own sequences (genomes or EST collections) for reconstructing pathway data using KAAS and EGassembler

•  KegArray is a Java application for expression data •  GECS and GENIES can be used to infer glycan structures and gene functions, respectively

Summary

Page 74: Introduction to KEGG - metabolomics.se Biology/Lectures/KEGG.pdf• Gene Network Inference Engine based on Supervised Analysis • Integration of multiple omics data to infer gene

Microarray

Yeast two-hybrid

Subcellular localizaton

Phylogenetic profile

Network inference

Similarity matrix

Network inference from multiple data