Design of a PIK3CA Pyrosequencing Assay That Excludes Psuedogene Interference

Christine L. Baker1, Wade S. Samowitz1,2

1ARUP Institute for Clinical and Experimental Pathology, Salt Lake City, UT 2Department of Pathology, University of Utah Health Sciences Center, 50 North Medical Drive, Salt Lake

City, UT

IntroductionPhosphatidylinositol 3′-kinase (PIK3CA) encodes for a lipid kinase that regulates signaling pathways downstream of EGFR and is mutated in 10% to 30% of colorectal cancers. Activating mutations in this gene upregulate the AKT signaling pathway, making it a potentially interesting therapeutic target. Mutations in this gene are not reported to be exclusive of mutations in KRAS, BRAF, or NRAS. Materials and MethodsWe designed a pyrosequencing assay on the Pyromark Q24 to detect mutations in all three positions of codons 542 and 545 in exon 9 and codon 1047 in exon 20 of this gene. The exon 9 reverse PCR primer was designed to avoid amplifying a psuedogene in chromosome 22 that has over 95% homology with exons 9-13 in PIK3CA. Two hundred colorectal cancers from FFPE tissue previously characterized for KRAS mutation status were evaluated for PIK3CA mutations.ResultsOf the KRAS mutated samples 16/80 (20%) had an additional mutation in PIK3CA. The mutation rate in KRAS wild type samples was 9/120(8%). The psuedogene was not amplified in these samples. ConclusionsWe developed a PIK3CA pyrosequencing capable of detecting mutations in all three positions in the three hotspot codons with no psuedogene interference. PIK3CA mutations could indicate a potential therapeutic target, especially in tumors with KRAS mutations which would not be expected to respond to anti-EGFR therapy.

Abstract (Updated)

Phosphatidylinositol 3-kinase (PIK3CA) encodes for a the catalytic subunit of a lipid kinase that regulates signaling pathways downstream of EGFR. It is mutated in a broad spectrum of tumors including colon, ovary, breast brain and liver. It has been shown that mutations in this gene result in protein gain of function and oncogenic transformation. These mutations cause upregulation of the AKT signaling pathway, making it a potentially interesting therapeutic target as well as having some prognostic implications for cancer progression. Therapy implications include rapamyacin inhibiting oncogenic signaling in cells with PIK3 exon 9 and exon 20 mutations . Mutations in this gene also predict toxicity of platinum based therapies. It has also been shown that patients with mutations in the exon 20 of PIK3CA, but not exon 9, are associated with low response rate to the monoclonal antibodies cetuximab and panitumumab in colon cancer patients. Recently PIK3CA mutations in the both the exon 9 helical domain and the exon 20 kinase domain was associated with a poor response to trastuzumab in breast cancer patients and shorter over all survival.Mutations in this gene are not reported to be exclusive of mutations in KRAS, BRAF, or NRAS. It has been reported that in patients with KRAS wild-type tumors, the presence of PIK3CA mutation was associated with a significant increase in colon cancer-specific mortality. PIK3CA mutations can also predict local recurrences in rectal cancer patients. Patients with PIK3CA positive tumors had shorter breast cancer specific and disease free survival.The majority (~80%) of somatic mutations in PIK3CA are in three hotspots; two in codons 542 and 545 in exon 9 in the helical domain, one in codon 1047 in the exon 20 kinase domain. The gain of function mechanisms are different for the helical and kinase domain activating mutations. PIK3CA mutational status is of interest in a broad spectrum of cancers and numerous PI3K pathway targeted compounds are being introduced into clinical trials making mutations in this gene important biomarkers for therapeutic and prognostic considerations.

Introduction

Codon 545

Psuedogene Sequence

PIK3CA Sequence

Gene Reference Sequence

Pyrograms of WT Codon 545 for Gene and Psuedogene

GAG Reverse SynthesisCTC

GCG Reverse Synthesis CGC

There are other methodologies and even other pyrosequencing assays described for PIK3CA mutation detection. Some do not query all six positions of the exon 9 hotspot codons, and will miss mutations in the second or third base pair of codon 545, which accounted for 6/12(50%) of samples with codon 545 mutations. Methodologies such as those utilizing mutation-specific PCR or single nucleotide extension may not identify rarer codon mutations depending on the location and orientation of the primers. It is possible that the current reported frequency of the exon 9 mutations could be inflated by detection of psuedogene base pair changes or decreased by psuedogene product obscuring mutations of the gene in samples with lower tumor burden. We developed a PIK3CA pyrosequencing capable of detecting mutations in all three positions in the three hotspot codons with no psuedogene interference. PIK3CA mutations could indicate a potential therapeutic target, especially in tumors with KRAS mutations which would not be expected to respond to anti-EGFR therapy. References •Aleskandarany, M. A., Rakha, E. A., Ahmed, M. A., Powe, D. G., Paish, E. C., Macmillan, R. D., et al. PIK3CA expression in invasive breast cancer: a biomarker of poor prognosis. Breast Cancer Res Treat, 122(1), 45-53.•Aoki, M., Blazek, E., & Vogt, P. K. (2001). A role of the kinase mTOR in cellular transformation induced by the proteins P3k and Akt. Proc Natl Acad Sci U S A, 98(1), 136-141.•De Roock, W., Claes, B., Bernasconi, D., De Schutter, J., Biesmans, B., Fountzilas, G., et al. Effects of KRAS, BRAF, NRAS, and PIK3CA mutations on the efficacy of cetuximab plus chemotherapy in chemotherapy-refractory metastatic colorectal cancer: a retrospective consortium analysis. Lancet Oncol, 11(8), 753-762.•Di Nicolantonio, F., Arena, S., Tabernero, J., Grosso, S., Molinari, F., Macarulla, T., et al. Deregulation of the PI3K and KRAS signaling pathways in human cancer cells determines their response to everolimus. J Clin Invest, 120(8), 2858-2866.•Engelman, J. A., Chen, L., Tan, X., Crosby, K., Guimaraes, A. R., Upadhyay, R., et al. (2008). Effective use of PI3K and MEK inhibitors to treat mutant Kras G12D and PIK3CA H1047R murine lung cancers. Nat Med, 14(12), 1351-1356.•Esteva, F. J., Guo, H., Zhang, S., Santa-Maria, C., Stone, S., Lanchbury, J. S., et al. PTEN, PIK3CA, p-AKT, and p-p70S6K status: association with trastuzumab response and survival in patients with HER2-positive metastatic breast cancer. Am J Pathol, 177(4), 1647-1656.•He, Y., Van't Veer, L. J., Mikolajewska-Hanclich, I., van Velthuysen, M. L., Zeestraten, E. C., Nagtegaal, I. D., et al. (2009). PIK3CA mutations predict local recurrences in rectal cancer patients. Clin Cancer Res, 15(22), 6956-6962.•Jhawer, M., Goel, S., Wilson, A. J., Montagna, C., Ling, Y. H., Byun, D. S., et al. (2008). PIK3CA mutation/PTEN expression status predicts response of colon cancer cells to the epidermal growth factor receptor inhibitor cetuximab. Cancer Res, 68(6), 1953-1961.•Kang, S., Bader, A. G., & Vogt, P. K. (2005). Phosphatidylinositol 3-kinase mutations identified in human cancer are oncogenic. Proc Natl Acad Sci U S A, 102(3), 802-807.•Ligresti, G., Militello, L., Steelman, L. S., Cavallaro, A., Basile, F., Nicoletti, F., et al. (2009). PIK3CA mutations in human solid tumors: role in sensitivity to various therapeutic approaches. Cell Cycle, 8(9), 1352-1358.•Mohseni, M., & Park, B. H. PIK3CA and KRAS mutations predict for response to everolimus therapy: now that's RAD001. J Clin Invest, 120(8), 2655-2658.•Muller, C. I., Miller, C. W., Hofmann, W. K., Gross, M. E., Walsh, C. S., Kawamata, N., et al. (2007). Rare mutations of the PIK3CA gene in malignancies of the hematopoietic system as well as endometrium, ovary, prostate and osteosarcomas, and discovery of a PIK3CA pseudogene. Leuk Res, 31(1), 27-32.•Nosho, K., Kawasaki, T., Ohnishi, M., Suemoto, Y., Kirkner, G. J., Zepf, D., et al. (2008). PIK3CA mutation in colorectal cancer: relationship with genetic and epigenetic alterations. Neoplasia, 10(6), 534-541.•Ogino, S., Nosho, K., Kirkner, G. J., Shima, K., Irahara, N., Kure, S., et al. (2009). PIK3CA mutation is associated with poor prognosis among patients with curatively resected colon cancer. J Clin Oncol, 27(9), 1477-1484.•Pu, X., Hildebrandt, M. A., Lu, C., Lin, J., Stewart, D. J., Ye, Y., et al. PI3K/PTEN/AKT/mTOR pathway genetic variation predicts toxicity and distant progression in lung cancer patients receiving platinum-based chemotherapy. Lung Cancer.•Zhao, L., & Vogt, P. K. (2008). Helical domain and kinase domain mutations in p110alpha of phosphatidylinositol 3-kinase induce gain of function by different mechanisms. Proc Natl Acad Sci U S A, 105(7), 2652-2657.

Conclusions

Gene Specific Reverse PCR Primer Codon 542 545 3’ CAGTGTCCATTCACGATTTTACC5’ Exon 9 PIK3CA GAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTCACAGGTAAGTGCTAAAATGG3’ Exon 9 Pseudogene GAAATCACTGCGCAGGAGAAAGATTTTCTATGGA_CCACAGGTAAGTGCTAAAATGG3’ 3’T_GGTGTCCATTCACGATTTTACC5’ Psuedogene Specific Reverse PCR Primer

Exon 9 Primer Design

CCodon

5426

positives

GAA> AAA (6/6) c.1624G>A p.E542K

Codon 54511

positives

GAG> AAG (6/12) c.1633G>A p.E545K GGG (3/12) c.1634A>G p.E545G GCG (2/12) c. 1634A>C p.E545A GAC (1/12) c.1635G>C p.E545D

Codon 1047

7 positives

CAT> CGT (6/7) c.3140A>G p.H1047R CTT (1/7) c.3140A>T p.H1047L

Mutational Spectrum for the 3 Hotspot Codons for 200

Colorectal Cancers

Pyrograms of Positives Materials and Methods

We designed a pyrosequencing assay on the Pyromark Q24 to detect mutations in all nine base pair positions in the 3 hotspot codons: 542 and 545 in exon 9 and codon 1047 in exon 20 of this gene. The exon 9 reverse PCR primer was designed to avoid amplifying a psuedogene in chromosome 22 that has over 95% homology with exons 9-13 in PIK3CA. The 3’ end of the reverse PCR primer was designed to exploit a region that is unique to the PIK3CA gene. A second primer was designed that is unique to the psuedogene. Both primer sets were evaluated to ensure that the region had sufficient dissimilarity between the gene and psuedogene to prevent overlapping amplification. No psuedogene sequence was seen in the gene specific reaction and vice versa. Two hundred colorectal cancers (80 KRAS mutated and 120 KRAS wild type) from FFPE tissue were evaluated for PIK3CA mutations.

Of the KRAS positive samples 16/80(20%) had an additional mutation in PIK3CA. The mutation rate in KRAS wild type samples was 9/120(8%), and all were all exon 9 helical domain mutations (which does not effect efficacy of anti-EGFR therapy but is of interest for breast cancer prognosis and m-TOR , trastuzumab and other therapies).

Results

Codon

545

Psuedogene Sequence

PIK3CA Sequence

Gene Reference Sequence