International · Managing Editor Jona A. Aguilar Assistant Managing Editor Al-Fayed D. Paradji ... plagiarism/similarity Index within zero (0) to ten (10) % only, and (6) ... ranged

InternationalEditors/Consultants Engr. Zahangir Alam, Ph. D. Bio-Environmental Engineering International Islamic University of Malaysia Malaysia Lindon Bastatas, Ph. D. Physics Oaklahoma State University University of Texas United States of America William D Taala, MLS, RL Library Manager IT Lecturer Dr. Maazen Fakeeh Medical Library Fakeeh College for Medical Sciences Kingdom of Saudi Arabia Filoteo B Franco, Jr., MLS, RL Library Manager Prince Muhammad Bin Salman College for Business and Entrepreneurship Kingdom of Saudi Arabia Professor Dr Mohammad Abul Basher Faculty of Medicine Bioscience and Nursing MAHSA University Poomjai Sa-adchom, Ph.D. Energy Technology/MechanicalEngineering King Mongkut’s University of Technology Thonburi Thailand Tanissara Pinijmontree, Ph. D. Computational and Apply Polymer Science Suranaree University of Technology Thailand

NationalEditors/Consultants Niel L. Ningal, Ph. D. Animal Nutrition University of the Philippines-Los Banos Alma P. Rosillo-Magno, Ph. D. Horticulture University of the Philippines-Los Banos Engr. Peter Ralph B. Galicia, Ph. D. Maritime Studies John B. Lacson Foundation Maritime University Mark E. Patalinghug, Ph. D. Criminal Justice University of Cebu Soceline N. Batisla-ong, Ph. D. General Science Iloilo State College of Fisheries

LocalEditors/Consultants Rolando P. Malalay, Ph. D. Mathematics/ Statistics Mindanao State University-IIT Joe-an G. Cuaresma, Ed. D Science Education Education Supervisor II Teacher Education Commission on Higher Education IX Carlo Ting Nabo, Ed. D. Research Education Ph. D. Candidate University of San Carlos

EditorialBoard

Abram M. Eustaquio, MBA Chair Bashiruddin A. Ajihil, Ed. D. Vice Chair Azenath M. Eustaquio, MS Treasurer Alfredo S. Eustaquio, MBA (cand.) Member Michael Vincent P. Caceres, Ph. D. (cand.) Member

EditorialStaff Michael Vincent P. Caceres, Ph. D. (cand.) Editor in-chief (interim) Angelo M. Solo, MPA Managing Editor Jona A. Aguilar Assistant Managing Editor Al-Fayed D. Paradji Editorial Assistant Radzhata K. Sawadjaan Copy Editor Kei Ann Jerwiza J. Sadda-alun Assistant Copy Editor Jenny Rose E. Jimlani Assistant Copy Editor

Volume 1

2020

Manuscript Submission Research and Publication Unit (RPU) University Research and Development Center Universidad de Zamboanga Main Campus, Tetuan Zamboanga City, Philippines Region of Southeast Asia Email: [email protected] www.uz.edu.ph Landline: 991-1135 local 255 _______________________________________________ Bi-Annual Publication ISSN 2704-419X ISSN National Center of the Philippines National Library of the Philippines Manila, Philippines Copyright by Universidad de Zamboanga 2020 Book Cover and Design: Ms. Radzhata K. Sawadjaan All rights reserved. No part of this Research Review may be reproduced in any form without written permission from the publisher or author. Published by: Universidad de Zamboanga Main Campus, Tetuan Printed in the Philippines Astoria Printing and Publishing The views and opinions expressed by the authors are their own and do not reflect the position of the University Research and Development Center.

he advancement and promotion of research and development in the organization brings opportunities for possible grants and recognitions in many different ways as it calls for its mandate to promote wide utilization, dissemination and publication of various

researches conducted and developed. In the new industrial era referred to as the Industry 4.0, it has given a huge impact and developmental changes in the organizations both in the public or private sectors which contributed a lot in most of the developing countries like the Philippines. The benefit of the Industrial Revolution 4.0 includes improving the processes, service delivery to the customers, increases productivity and quality of outputs, reduced labor costs since less human intervention is needed, provides transparent logistics, improved accuracy in inventory and forecasts and shortens the process of services, among others.

The Science Asia Review (SAR) of the Universidad de Zamboanga University Research and Development Center (URDC) primarily aims to gather researches from various fields as a way to disseminate the findings for optimum utilization. The SAR is an international refereed research journal examined by experts from Malaysia, Thailand, Liberia, France, and Saudi Arabia.

The editorial board requires a standardized format and guidelines in the submission of the manuscript for uniformity purposes; (1) minimum of 10 pages and maximum of 15 pages single space using Arial font, (2) inclusive of abstract, objectives/statement, framework, scope, methodology, discussion, conclusion and references/bibliography, (3) list of references/bibliography only those directly cited on the submitted paper, (4) attach Research Ethics Certificate as standard requirement (5) plagiarism/similarity Index within zero (0) to ten (10) % only, and (6) application of software tools such as SPSS, GIS etc. must be duly licensed.

All papers submitted for publication will be sent to the panel of reviewers who will scrutinize and examine the manuscripts specifically the contents using sets of criteria. More so, reviewers’ recommendations are taken into consideration for the improvement and revisions of the manuscripts.

EDITORIAL POLICY

T

contents articles Hybrids Developed from Pollen Parents 1 Derived from Anther Culture towards Increasing Rice Yield Joanne D. Caguiat Marie Stela F. Ablaza Mariechelle M. Rosario Virginia P. Luciano Leonilo V. Gramaje Frodie P. Waing Dindo Agustin A. Tabanao

Age and Curing Time on the Nutrient Quality 21 and Shelf-Life of Chevon mara Nora C. Cabaral

Cassava Production in Ameliorated Soil Using 45

CRH and Biochar Marcella S. Icalla Christian B. Apostol

Growth, Cortisol Level, Blood Lipid Profile and Meat 56 Quality of Pekin Ducks Fed with Different Levels of Azolla under Two Types of Production System Nora C. Cabaral Prime Gilbert T. Rieta

Meta-Analysis of Different Prediction 75 Models on the Weight Estimation of Goats Using External Body Measurements Irene F. Almazan Nora C. Cabaral

Meta-Analysis of Different Prediction Models on 89 the Weight Estimation of Philippine Native Pigs Using External Body Measurements Nora C. Cabaral Elmar D. Serrano

Utilization of Biochar in the Production of Cassava 100

(Manihot esculenta) Grown in Clayey Soil Marcela S. Icalla Christian B. Apostol

Influence of Cashew Apple (Anacardium 121 occidentale) on the Stress Level, Productivity, Organoleptic Property and Profitability of Broiler Chickens Noel S. Tumbagahon Nora C. Cabaral

Phenotypic Characterization of Various 148 Goat Gene Pool (Capra hircus) in Oriental Mindoro Rosalie Malvaz Nora C. Cabaral

Evaluation of Published Lamp Primers for 174 Amplifying blaCTX-M9 Gene Expressing the Extended Spectrum Beta Lactamase (Esbl) of E. Coli Dorothy Joy Salvador Noble

Hydro Vortex Free Energy Generator (HVFEG) 193 Aldwin Yves M. Oyao Jon Alvin Macariola

ARCProS: A Decision Support System for Academic 213 Ranking, Classification and Promotion System for the Faculty of Universidad de Zamboanga Neil Mark Z. Bacasong Dante D. Dinawanao

1

HYBRIDS DEVELOPED FROM POLLEN PARENTS DERIVED FROM ANTHER

CULTURE TOWARDS INCREASING RICE YIELD

Joanne D. Caguiat

Marie Stela F. Ablaza

Mariechelle M. Rosario

Virginia P. Luciano

Leonilo V. Gramaje Frodie P. Waing

Dindo Agustin A. Tabanao

Philippine Rice Research Institute

ABSTRACT Utilization of hybrid rice offers 15 to 20 % yield advantage over inbred, thus offers a higher income to farmers. Anther culture technology advances the development of hybrid rice by increasing breeding efficiency and reducing cost. This study aims to develop rice hybrids crossed between cytoplasmic male-sterile lines as female parent and male pollen parent lines generated through anther culture. Hybrids were then evaluated in different nurseries viz., testcross nursery (TCN), observational nursery (ON), and preliminary yield trial (PYT). In TCN, three rice hybrids (PR48755H, PR48758H, and PR48765H) attained yield ranged of 5.8 tha-1 to 7.0 tha-1 against released inbred check (PSB Rc18, PSB Rc82, NSIC Rc222 and NSIC Rc240) with only 4.3 tha-1 to 5.5 tha-1 yield. Forwarded to ON, these hybrids yielded 6.1 tha-1 to 10.3 tha-1 as compared to the check varieties viz., Mestiso 19, Mestiso 20 and PSB Rc18 with 5.0 tha-1 to 6.1 tha-1. In PYT, they yielded 7.1 tha-1 to 8.6 tha-1 compared to the 3.3 tha-1 to 5.6 tha-1 grain yield of the check varieties. These hybrids were identified moderately resistant to green leafhopper, while PR48755H and PR48758H were identified resistant to leaf blast and brown planthopper. The study proved the efficiency of anther culture in developing superior rice hybrids with increased yield thereby helping farmers’ increase rice productivity.

Keywords: Hybrid rice development, yield trial, anther culture, Philippines

2

Introduction ice is vital for almost half of the world population. The Philippines is one of the countries with the highest per capita (>110 kg/person/year). Rapid increase in human population and decrease in arable land and limited water

resources need all approaches employed to increasing rice productivity (FAO, 2018). Utilization of hybrid rice is one of the strategies that could help increase rice production in the world and in the Philippines. It is based on the heterosis or hybrid vigor of the F1 progenies produced from mating two parent lines. This technology enables the development of hybrid progenies with superior quality over both parents and promises a 15-20 % yield advantage compared to conventional inbred varieties under the same input levels (Ying et al., 2014). Hybrid rice has been cultivated in different parts of the country since the first hybrids was introduced: Magat (PSB Rc26H), commercially released in 1994, and Mestizo 1 (PSB Rc72H) in 1997. Since then, Filipino rice breeders have constantly bred and developed superior parental lines and hybrid varieties.

Progenitors or parent lines dictate the success of hybrid rice

breeding in terms of quality and diversity. Techniques such as in vitro mutagenesis (IVM) and in vitro culture (IVC) is essential for discovering promising new hybrid parent lines. In vitro culture (IVC) induces mutation generating gametoclonal or somaclonal variants which may be exploited to improve or develop new varieties. Doubled haploid (DH) via anther culture (AC) is one of the most exploited IVC systems. DH technology has recently changed the way inbreds are developed in breeding programs. It greatly reduces the time required to obtain inbreds compared with six or more generations of selfing. Anther culture, an innovative method for hastening the generation of homozygous doubled haploid (DH), can be used to accelerate the varietal improvement programs in rice (Herawati et al, 2010). The advantage of this method is that such heterotic attributes are fixed in the homozygous condition as a consequence of chromosome doubling. In practice, anther culture applied to hybrid rice has led to the release of several new varieties (Germana, 2010; Mishra et al., 2015). Potential hybrids make it possible to develop superior gametic genotypes that possess the vigor and fitness of the hybrid. Development of high yielding rice varieties through tissue culture viz. anther culture accelerates the

R

3

breeding cycle by reducing the generation needed to fix a population (above F7-F9 generations) in a short period of time (F1 or advanced breeding lines) (Germana, 2010; Mishra et al., 2015). Previous studies have shown that it is possible to obtain as desirable genotypes from the anther culture of F1 rice hybrids as from the F2 or F3 population (Yin et al., 1983). It is evident that new rice varieties have been successfully developed from the anther culture of F1 hybrids as studies have been reported from China (Germana, 2010; Mishra et al., 2015).

The production of homozygous lines is a long procedure

using conventional breeding methods. Conversely, the production of DH lines from an F1 cross could lead rapidly to homozygous lines which could allow faster exploitation of the genetic variation of the segregating population via DH production than by classical breeding methods. DH production via anther culture technique hastens the breeding cycle by cutting the time to attain homozygosity. The DH technology shortens the breeding cycle significantly by rapid development of completely homozygous lines in 2–3 generations, instead of the conventional inbred line development process which takes between 6–8 generations to derive lines with ~99% homozygosity (Germana, 2010; Mishra et al, 2015). Indeed, the production of doubled haploids through androgenesis is a very useful tool for producing high yielding homozygous cereal lines in a relatively short time (Hennawy et al., 2011). Generally, DH technology allows for the creation of stable haploids after recombination of parents with broad genetic variation. DH derivatives can be selected for improved traits such as yield, earliness, plant height, nutritional quality and pest and disease resistance, in a fully homozygous state. Selected genotypes can be used as homogenous varieties or as breeding parents in the ensuing crosses and selection cycles (Germana, 2010; Mishra et al., 2015).

Evaluation of experimental hybrids is an important part of

variety development which enables the identification of entries with superior performance in terms of yield, resistance to pest and diseases and other morpho-agronomic traits to be released for public use. A series of tests composed of the observation nursery (ON), preliminary yield trial (PYT) and multi-location yield trial (MYT) serve this purpose. Information consolidated from these trials serves as bias of selection and advancing particular entries for the national

4

cooperative tests of hybrid materials (NCT-Hybrid) and the subsequent release as public hybrids (Germana, 2010; Mishra et al., 2015).

Accurate grain yield estimates and adaptation patterns

which covers multi-environment and wide-scale testing is very important towards proper positioning and adoptation strategy of hybrid varieties. Gaps in these performance testing encourages the public sector to have more efficient collaboration and pro-active partnership with partners and stakeholders to properly utilize assets and capabilities and to change approaches in managing and adapting factors relevant to rice production (Tabanao et al., 2015).

Aside from yield, evaluation for pest and disease resistance

is also important. Approximately 52 % of the global production of rice is lost annually caused by biotic stress factors, of which 25% is attributed to the attack of insect pests. Brown planthoppers (BPH) causes significant yield loss in most of the cultivars in Asia while green leafhoppers can transmit rice tungro virus in addition to plant damage. In addition, diseases such as bacterial leaf blight (BLB), rice blast, rice tungro disease, and sheath blight damage the rice plant and can even cause up to 100% yield loss if susceptible variety is used. Thus, utilization and deployment of resistant rice varieties is essential to boost rice production.

Objectives

This study aimed to develop male parent lines using anther culture technology and to generate experimental hybrids with anther culture-derived parent lines. This also aimed to evaluate the performance of experimental hybrids based on yield and other important morpho-agronomic traits in different yield trial nurseries and to evaluate their reaction to selected pest and diseases.

Materials and Methods

Generation of DH Hybrid Parents through IVC

The study was conducted at the Central Experiment Station (CES)-Philippine Rice Research Institute (PhilRice) from 2014 dry season (DS) to 2016 wet season (WS). Anther culture activity was

5

done at the tissue culture laboratory under the Plant Breeding and Biotechnology Division (PBBD) while induced screening for pest and disease reaction was done at the screenhouses of the Crop Protection Division (CPD).

Healthy rice boots of hybrid male parent (restorer) lines

consisted of crosses between restorer x restorer lines were collected in the field/screenhouse during 7-9 in the morning or 4-6 in the afternoon. Collected boots were washed with water and disinfected with 70% alcohol and wrapped with moisten cheesecloth and plastic bag and placed inside the refrigerator at 7-10oC (cold treatment) for three to eight days. Spikelets/florets were surfaced sterilized with 50% bleach for 15 minutes and rinsed thrice with sterile distilled water. Anthers were cultured in callus induction medium containing N6 (Chu et al., 1975; 1978). Generated cultures were maintained in the dark, at 26±30C, until calli were formed, 40 to 65 days from plating. The calli were transferred into regeneration medium (MSK2), which contains Murashige and Skoog (1962) basal salts, supplemented with NAA (0.5 mg/L), kinetin (2.0 mg/L) and sucrose (30 g/L). The cultures were placed on benches, illuminated with fluorescent bulbs, at 27±2 0C, for four to six weeks, within which shoots and roots developed from differentiated calli.

Plantlets regenerated from the calli were taken out of the

test tubes, hardened and maintained in the screenhouse until maturity (Figure 1). Sterile plants were considered haploid while fertile plants were considered doubled haploid. Seeds at the first selfing generation (R1) per doubled haploid plant are considered as one doubled haploid line (DHL). Harvested seeds of restorer line derived from anther culture were used as male pollen parent crossed with female parent (cytoplasmic male-sterile line) in the source nursery to generate F1 hybrids.

6

Figure 1 Anther culture of restorer x restorer (male pollen parent): a) anther excision, b) callused anthers in callus induction media, c) callus formation, d) calli in induction media, e) calli subjected to regeneration media, f) generated regenerants

Generation of Experimental Hybrids in the Source Nursery

Female parent lines that were cytoplasmic male-sterile lines (CMS) such as IR68897A, IR58025A, and PRH1A were crossed to six anther culture derived restorer lines as male pollen parent generating six F1 experimental hybrids (Table 1). Staggered planting of parent lines based on maturity was done with one-week interval to ensure synchronized flowering. Before flowering, three CMS plants together with three male pollen parents were balled from the source nursery and paired in pollination chambers. Supplemental pollination was done by tapping the male parent during anthesis to obtain high seed set (Figure 2). Table 1 Generated Experimental Hybrids Crossed between Cytoplasmic Male-Sterile Lines (CMS) and Male Pollen Parents Derived through Anther

Year Generated

Hybrid Entry Female parent

(CMS) Male pollen parent AC-

derived

2014DS PR47591H IR68897A PR45595HY-AC 2014DS PR47592H IR68897A PR45606HY-AC 2014DS PR47611H IR68897A PR45583HY-AC 2014WS PR48755H PRH1A PR46660HY-AC

2014WS PR48758H PRH1A PR46661HY-AC

2014WS PR48765H IR58025A PR46661HY-AC

7

Figure 2 Generation of experimental hybrids in the source nursery: a) Leaf clipping, b) pairing of female (CMS) and male (restorer) parent in hybridization chamber, c) enclosing plastic barrier, d) established female and male parents, and e) matured plants in hybridization chamber

Evaluation of Yield Performance of Hybrids

Field preparation was performed at least 21 days prior to transplanting in order to allow seeds of weeds to germinate and stubbles to decompose before transplanting. Field levelling was performed a day before transplanting to allow the mud to settle and for proper distribution of field water. Seeds were pre-germinated prior to sowing and soaked for 15 hours followed by washing with clean water and incubated for 24-36 hours. Seedlings were raised via raised-bed method with a seeding rate of 50 grams of seeds per square meter. Twenty-one days after sowing, the seedlings were pulled and transplanted. Single seedlings were transplanted at 20x20 cm planting distance. Testcross Nursery (TCN)

Generated experimental hybrids from the source nursery

along with parent lines and check varieties (PSB Rc 18, PSB Rc 82, NSIC Rc 240, Mestiso 19 and Mestiso 20) were evaluated in the testcross nursery (TCN). Entries were planted in three rows x seven

8

hills per entry in an augmented design. Five plants per entry were randomly selected for the measurement of plant height (cm), number of tillers, panicle length (cm), number of grains per panicle, filled and unfilled grains and plot yield (tha-1). Data on days to maturity and phenotypic acceptability were also gathered. Excellent F1 combinations were selected based on their superiority in terms of crop standing and yield advantage over their parent lines and check varieties. The selected F1 combinations were forwarded to seed production for observational nursery (SPON) for seed increased and for further evaluation in the observational nursery (ON) for one season. Observation Nursery (ON)

Entries identified from the TCN with 5% yield advantage over the check varieties, with good phenotypic acceptability and good morpho-agronomic acceptability were evaluated in the ON. The trial was laid out in augmented design using 105-hill plots, with the test entries assigned randomly next to each of their male parents without replication into incomplete blocks each with complete sets of checks. Grain yield (kg ha-1) data were collected from 2.1-m2 crop cuts and corrected to a moisture factor (MF) value of 1.0 at moisture content (MC) of 14%. Analysis of variance was carried out using SAS. Selection of best lines were based on standard heterosis as primarily represented by grain yield, fertility levels, pest and disease resistance, phenotypic acceptability and other morpho-agronomic traits such as maturity, plant height, and productive tiller count. Yield advantage was computed over all the checks. Generally, entries with 5% yield advantage over hybrid and inbred checks were advanced for PYT. Identified outstanding hybrids were then forwarded to seed production for preliminary yield trial (SPPYT) for seed increased preceding evaluation at preliminary yield trial nursery (PYT) for another one season.

Preliminary Yield Trial (PYT)

The trial was laid out in randomized complete block design with three replications using 224-hill plots. Morpho-agronomic traits measured were maturity, plant height, and productive tiller count. Grain yield (kg/ha) data were collected from 7.40-m2 crop cuts and corrected to a moisture factor value of 1.0 at MC=14%. Only those with

9

5% grain yield advantage than the check varieties, with pest and disease resistance, good morpho-agronomic traits and good phenotypic acceptability were selected and forwarded to seed production for multi-location trial (SPMYT) for evaluation in multi-location yield trial nurseries (MYT) for two seasons and consequently selected hybrids can then be submitted to the National Cooperative Trial (NCT) for four-season evaluation and varietal released. The general workflow is summarized in Figure 3. This study was only limited from the development of male pollen parent, generation and performance evaluation of hybrids from the TCN to PYT.

Figure 3 Workflow for the Development of Anther Culture Derived Male Pollen Parents and Performance of Generated Hybrids in Different Yield Trial Nurseries

Evaluation for Pest and Disease Resistance

Selected hybrid entries along with checks were evaluated for pest resistance such as brown plant hopper (BPH) and green leaf hopper (GLH) and for disease resistance such as leaf blast and bacterial leaf blight (BLB). Screening was done through induced methods at the screenhouse of Philippine Rice Research Institute (PhilRice) during 2016 wet season.

Male pollen parent x Male pollen parent

F1

Generation of anther culture lines

Testcross Nursery

Observation Nursery

Preliminary Yield Trial Evaluation Nursery

Multi-location Yield Trial Nursery

National Cooperative Test

Seed production of experimental hybrids and parents

10

For blast screening, ten grams of hybrid seeds per entry were planted in a 50cm row with 10cm spacing. Three spreader rows of local susceptible check IR50 were planted around the test plot. Every ten rows of test entry, 1 row of standard susceptible check IR72, 1 row of resistant check PSB Rc10 and 1 row of the local susceptible check IR50 were planted. Test plants were evaluated at 30-35 days after sowing.

Leaf clipping method was used for screening of entries to

BLB. Approximately 1-2 cm of the leaf tip is cut with a pair of scissors previously dipped in bacterial suspension or clippers with bacterial suspension on the cutting edge. To cut several leaves in a hill, a small plastic bottle containing the inoculum and attached to a garden clipper is used for inoculation (Kauffman et al., 1973). The plants were scored for severity of lesions using lesion length measurement based on standard evaluation system of IRRI (SES). The assessment of disease severity was based on lesion length measurement or estimation of percent diseased leaf area at 14 days after inoculation (Table 2). Table 2 Scoring System for Evaluation of BLB Resistance

Greenhouse Test

Lesion Length (cm) Description

0-5 R

>5 MR

>10 MS

>15 S

9 >50

Screening for insect resistance of the hybrids and checks

was done in in collaboration with the Crop Protection Division (CPD) at the Central Experiment Station (CES) of PhilRice in Muñoz, Nueva Ecija, Philippines. Entries were evaluated in the screenhouse and the rating for the BPH (Table 3) and GLH (Table 4) resistance was done when the susceptible check was completely wilted or damaged using the rating scale stated in Tables 3 and 4.

11

Table 3 Rating Scale for BPH Resistance Screening

Index Rating Description of damage

1 R Very slight damage

3 MR First and second leaves of most plants partially yellowing

5 I Pronounced yellowing and stunting or about 10 to 25% of the plants wilting

7 MS More than half of the plants wilting or dead and remaining plants severely stunted or drying

9 S All plants dead

Table 4 Rating Scale for GLH Resistance Screening

Index Rating Description of damage

1 R Very slight damage

3 MR First and second leaves yellowing

5 I All leaves yellow, pronounced stunting or both

7 MS More than half of the plants dead, remaining plants wilting, severely stunted

9 S All plants dead

Results and Discussion Line per se Performance of Anther Culture-derived Pollen Parents

Anthers from restorer x restorer crosses were subjected to in vitro culture (IVC). Anthers were plated, formed and regenerants were transferred to the screenhouse for seed increased. Only those which survived and generated seeds were used and utilized as male pollen parents in the source nursery. During 2014 dry season (DS), three selected male pollen parents derived through anther culture (PR45583HY-AC, PR45595HY-AC, PR45606HY-AC) were crossed with

12

IR68897A, a cytoplasmic male sterile line (CMS) that generated experimental hybrids (Table 5). Based on their yield performance in the testcross nursery, these parent lines exhibited 29.47 to 34.01 % yield advantage (YA) over the check PSB Rc 18 and with 22.91 to 27.31 % YA to the check PSB Rc 82 (Table 5). In 2014 wet season (WS), two pollen parents (PR46661HY-AC and PR46660HY-AC) derived through anther culture showed comparable yields against the check varieties (PSB Rc 82, PSB Rc 18 and NSIC Rc 240). These entries had 2.3 % YA against the PSB Rc 82 check and were crossed with two CMS lines (IR58025A and PRH1A) that generated experimental hybrids evaluated in the testcross nursery (Table 5).

The selection of parent lines derived through anther culture

is feasible in this study just as presented in the paper of Murovec and Bohanec (2012) wherein a fixed gene in a dominant or recessive form is present in regenerated population which facilitates selection of more suitable plants. In addition, Wu et al., (2012) reported the possibility of obtaining uniform lines in one generation through plant tissue culture. Same in this study, male pollen parents through anther culture of restorer x restorer lines were developed and used in generating hybrids. This is in replacement of the usual conventional method of developing parent lines from crossing of two parent lines for one season, selection from the segregating population for almost three years followed by yield trial evaluation before they can be used as male parents.

13

Table 5 Yield and Yield Advantage of Male Pollen Parent Lines Derived through Anther Culture over Check Varieties in the Testcross Nursery at 2014 Dry and Wet Season

Year/ Season

Female parent (CMS)

Male pollen parent

Yield of pollen parent (tha-1)

Yield advantage of male pollen parents over checks (%)

NSIC Rc240

NSIC Rc222

PSB Rc18

PSB Rc82

2014DS

IR68897A

PR45595HY-AC

5.35 - - 34.01 27.31

2014DS

IR68897A

PR45583HY-AC

5.28 - - 32.23 25.62

2014DS

IR68897A

PR45606HY-AC

5.16 - - 29.37 22.91

2014DS

PSB Rc 18 (check)

3.99 - - 0.03 -4.97

2014DS

PSB Rc 82 (check)

4.20 - - 5.30 0.04

2014DS

Mestiso 19 (check)

4.21 - - 5.51 0.23

2014DS

Mestiso 20 (check)

5.27 - - 32.01 25.41

2014WS

IR58025A

PR46661HY-AC

4.40 -2.22 -20.00 -8.33 2.33

2014WS

PRH1A PR46661HY-AC

4.40 -2.22 -20.00 -8.33 2.33

2014WS

PRH1A PR46660HY-AC

4.40 -2.22 -20.00 -8.33 2.33

2014WS

PSB Rc 82 (check)

4.30 -4.44 -21.82 -10.42 0.00

2014WS

NSIC Rc 240 (check)

4.50 0.00 -18.18 -6.25 4.65

2014WS

PSB Rc 18 (check)

4.80 6.67 -12.73 0.00 11.63

- unavailable/no data, DS= Dry Season, WS= Wet Season

Yield Performance of Experimental Hybrids in Yield Trial Nurseries

For ON 2015DS, only eight hybrids that reached the 15 % YA over the check varieties PSB Rc 18, PSB Rc 82, and Mestiso 19 were selected. The maturity (DAS) of these entries ranged from 110 to 123 with average of 117. Plant height ranged from 86 to 109 with average of 98 cm while the number of tillers ranged from 11 to 16 with an average number of 13 (Table 6). Crossed using male pollen parent

14

derived from anther culture, the three top high yielding hybrids (PR47591H, PR47592H, and PR47611H) yielded 5.16 to 5.35 tha-1. PR47591H had 1.51 to 33.97 % YA over the four check varieties (PSB Rc 18, PSB Rc 82, Mestiso 19 and Mestiso 20). PR47611H had 0.16 to 32.19 YA over the four checks while PR47592H had 22.62 to 29.34 YA over the three checks PSB Rc 18, PSB Rc 82 and Mestiso 19. Top selections were forwarded for further evaluation in the PYT in the succeeding seasons.

Forwarded in the preliminary yield trial nursery (PYT) during 2016 dry season (DS), the three hybrids PR47592H, PR47591H, and PR47611H yielded 7.76, 6.65 and 5.97 tha-1 as compared to check varieties with yield ranged from 6.77 tha-1 (NSIC Rc 222) to 7.35 tha-1 (Mestiso 20) (Table 7). Only PR47592H had the YA of 5.59 to 14.68 % over the four check varieties (PSB Rc82, NSIC Rc222, Mestiso 20 and Mestiso 55) and this hybrid is among the top selection in the PYT (Figure 4). Table 6 Grain Yield and Morpho-agronomic Performance of Hybrid Entries and Check Varieties (PSB Rc 18, PSB Rc 82, Mestiso 19 and Mestiso 20) in the Observation Nursery (ON) for 2015 D

Hybrid Maturity

(DAS) Height

(cm) Tiller

Number

Grain Yield

(tha-1)

Yield advantage of F1 over check (%)

PSB Rc 18

PSB Rc 82

Mestiso 19

Mestiso 20

PR47591H 120 99 16 5.35 33.97 27.26 27.02 1.51

PR47589H 120 103 13 5.30 32.90 26.24 26.00 0.70

PR47611H 122 96 14 5.28 32.19 25.57 25.33 0.16

PR47592H 118 104 11 5.16 29.34 22.86 22.62 -2.00

PR47586H 116 96 12 5.15 29.07 22.61 22.37 -2.20

PR47568H 118 86 12 4.94 23.70 17.51 17.28 -6.27

PR47566H 118 96 12 4.91 23.11 16.94 16.72 -6.72

PR47606H 117 89 16 4.88 22.16 16.04 15.82 -7.44

PSBRc 18 123 100 14 3.99 - - - -

PSBRc 82 110 95 16 4.20 - - - -

Mestiso 19 110 109 13 4.21 - - - -

Mestiso 20 111 106 11 5.27 - - - -

15

Table 7 Grain Yield Performance of Hybrid Entries and Check Varieties (PSB Rc 82, NSIC Rc 222, Mestiso 20 and Mestiso 55) in the PYT for 2016 DS

Hybrid

Maturity

(DAS)

Plant height (cm)

Tiller Number

Grain yield (tha-1)

Yield advantage of F1 over check (%) Mestiso

20 Mestiso

55 PSB Rc82

NSIC Rc 222

PR47592H 113 98 13 7.76 5.59 6.87 13.48 14.68 PR46997H 115 103 12 7.13 -2.98 -1.8 4.28 5.38 PR47567H 112 90 13 7.04 -4.32 -3.15 2.84 3.92 PR47591H 112 89 13 6.65 -9.58 -8.48 -2.82 -1.79 PR47589H 109 95 13 6.44 -12.4 -11.34 -5.85 -4.86 PR47570H 106 90 15 6.07 -17.43 -16.42 -11.25 -10.32 PR47611H 113 92 13 5.97 -18.87 -17.89 -12.81 -11.89 PR46992H 107 96 12 5.85 -20.39 -19.42 -14.44 -13.54 PR46565H 110 92 14 5.29 -28.13 -27.25 -22.75 -21.94 PR45675H 105 118 11 5.19 -29.39 -28.53 -24.11 -23.31 Mestiso 20 115 102 13 7.35 Mestiso 55 113 98 15 7.27 PSB Rc 82 114 99 17 6.84 NSIC Rc 222 115 99 15 6.77

Figure 4

PR47592H Hybrid is the Top Selection in Preliminary Yield Trial in 2016

DS

For 2014 WS, out of 808 entries evaluated, 14 entries were

selected based on their 5% YA over the check varieties (PSB Rc 18, PSB

Rc82, NSIC Rc 222 and NSIC Rc240) in the TCN. The three hybrids

(PR48755H, PR48758H and PR48765H) with pollen parents derived

from anther culture were noted to be higher yielding as compared to

check varieties. These hybrids were forwarded to ON for another trial

of evaluation during 2015WS.

16

In observation nursery during 2015 WS, 59 experimental

hybrids developed from crosses involving 13 female parents (12 CMS

lines and 1 TGMS line), and 39 male parents were evaluated for

morpho-agronomic traits and grain yield. Out of these, 15 hybrids

passed the 5% YA criteria over the check varieties in the ON during the

WS (Table 8). Among the highest yielding, PR48765H exhibited 66.08

to 107.59% YA over the four check varieties while the other hybrid

PR48755 generated from pollen parent derived from anther culture

has 23.17 to 53.96% YA over the checks. Selected hybrids were

forwarded to PYT evaluation.

For 2016 WS in PYT, a total of 14 experimental hybrids were

evaluated in the preliminary yield trial nursery for grain yield and

important morpho-agronomic traits such as maturity, plant height,

and number of productive tillers. Eight hybrids were identified and

selected based on its 14.25 to 161.15 % YA over the four check varieties

(PSB Rc 18, Mestiso 19, Mestiso 48 and Mestiso 55) (Table 9).

PR48765H again yielded highest with 8.56 tha-1 and recorded YA

from 52.13 % against Mestiso 19 to 161.15 % YA against PSB Rc 18.

PR48758H yielded second with 7.75 tha-1 yield while PR48755H came

third as highest yielding entry.

Development of high yielding experimental hybrids using

male pollen parents derived from anther culture shows great

promise based on the exhibited yield performances of selected

hybrids mentioned above. The potential use of anther culture

technology to eliminate the negative alleles from traditional or

landraces was explored which resulted to large genotypic variances

and able to select lines comparable with elite maize lines (Stringens

et al., 2013). The experimental hybrids in this study are not directly

the product of anther culture but instead they are generated using

male pollen parents derived from anther culture. This could still be in

agreement with the report of El-Hennawy et al., (2011) that double

haploid lines derived from variety exhibited differences in yield.

17

Figure 5

Grain Yield Performance of Hybrid Entries and Check Varieties (PSB Rc

18, PSB Rc 82, NSIC Rc 222 and NSIC Rc 240) in the TCN for 2014WS

Table 8 Grain Yield and Morpho-Agronomic Performance of Hybrid Entries in

the ON for 2015 WS

Hybrid Maturity

(DAS) Height

(cm)

Tiller

num

ber

Grain

yield

(tha-1 )


PSB

Rc18

PSB

Rc82

Mestiso

19

Mestiso

20

PR48765H 123 129 15 10.31 78.82 66.08 107.59 68.23 PR48796H 119 130 9 9.22 59.87 48.49 85.60 50.41 PR47220H 111 121 8 8.99 55.77 44.67 80.83 46.54 PR46837H 121 107 8 8.44 46.30 35.88 69.85 37.64 PR48768H 120 130 12 7.97 38.21 28.37 60.46 30.03 PR48769H 123 124 13 7.92 37.28 27.50 59.37 29.15 PR48755H 120 114 9 7.65 32.61 23.17 53.96 24.76 PR48794H 111 116 9 7.58 31.39 22.03 52.54 23.61 PR48775H 124 125 11 7.42 28.69 19.52 49.40 21.07 PR36474H 119 125 11 7.32 26.94 17.90 47.36 19.42 PR48800H 111 109 12 7.21 25.01 16.11 45.13 17.61 PR48776H 124 132 12 6.73 16.75 8.43 35.53 9.83 PR48806H 122 115 11 6.72 16.55 8.25 35.31 9.65 PR48791H 114 110 11 6.72 16.43 8.14 35.17 9.54 PR48805H 111 109 10 6.62 14.75 6.58 33.22 7.95 Mestiso 19 112 111 9 4.97 PSB Rc 82 117 113 11 6.21 PSB Rc 18 117 118 11 5.77 Mestiso 20 121 128 12 6.13

0.00

2.00

4.00

6.00

8.00P

R4

875

5H

TC

N4

42

TC

N70

1

PR

48

758

H

TC

N6

89

TC

N16

1

TC

N12

0

TC

N14

4

TC

N8

74

TC

N8

53

TC

N8

84

PR

48

765

H

TC

N8

5

TC

N14

7

NSI

C R

c 22

2

PS

B R

c 18

NSI

C R

c 24

0

PS

B R

c 8

2

Est

imat

ed

gra

in y

ield

(t

ha-

1)

Experimental Hybrids and Checks

18

Table 9

Grain Yield and Morpho-Agronomic Performance of Hybrid Entries in

the PYT for 2016 WS

Entry Maturity (DAS)

Plant Height

(cm) Tiller

Number

Grain yield (tha-1)


Mestiso 19

Mestiso 48

Mestiso 55

PSB Rc18

PR48765H 113 120 14 8.56 52.13 64.25 53.88 161.15

PR48758H 119 116 12 7.75 37.58 48.54 39.17 136.18

PR48755H 123 118 14 7.07 25.51 35.52 26.96 115.46

PR48775H 121 117 13 6.73 19.53 29.05 20.91 105.18

PR48796H 117 124 15 6.66 18.28 27.71 19.64 103.04

PR48767H 116 113 11 6.63 17.78 27.17 19.14 102.20

PR48769H 116 108 11 6.46 14.70 23.84 16.02 96.89

PR46840H 113 109 14 6.43 14.25 23.35 15.57 96.12

Mestiso 19 116 118 13 5.63 - - - -

Mestiso 48 116 116 13 5.21 - - - -

Mestiso 55 111 113 13 5.57 - - - -

PSB Rc18 116 111 13 3.28 - - - -

Pest and Disease Reaction of Hybrids

Based on induced screening method in 2016WS, the three

hybrids (PR48765H, PR48758H and PR48755H) were all moderately resistant to green leaf hopper (glh) while the hybrid PR48755H was resistant to leaf blast and brown plant hopper (bph). PR48758H was also noted to be resistant to leaf blast and moderately resistant to bph. According to Draz (2004) several lines can be developed through anther culture and may be used as donor sources of high yield, good grain quality, resistance to blast and stemborer.

19

Table 10 Pest and Disease Reaction of Experimental Hybrids under Induced Screening Method

-no data, S= susceptible, MS=Moderately susceptible, R= Resistant, MR= Moderately

Resistant.

Conclusion

Anther culture was utilized for rapid development of male

pollen parent such as restorer line (R) by subjecting the Rx R crosses

to anther culture. Using these pollen parents (PR45583HY-AC,

PR45595HY-AC, PR45606HY-AC, PR46661HY-AC, and PR46660HY-

AC), experimental hybrids were generated and evaluated in different

yield trial nurseries such as testcross nursery, observation nursery

and preliminary yield trial nurseries. Yield performances of identified

three hybrids (PR47591H, PR47592H, and PR47611H) during 2014 DS

and another three hybrids (PR48755H, PR48758H, and PR48765H)

during 2014 WS had surpassed check varieties accounting for hybrid

vigor and increase heterosis. The hybrids also exhibited moderate

resistance to resistance reaction to one or more pests. These parent

lines will be utilized as donor sources while hybrids can be further

evaluated in different multi-location and nomination to National

Cooperative Test (NCT).

The study was successful in hastening the development of

parent lines using AC-derived restorer lines for generation of F1

hybrids with consistent yield advantage against the check varieties

across yield trial nurseries which helped increase efficiency of the

breeding program and reduced development costs. These hybrids

can be used to increase rice production in the farmers’ field and

hopefully help achieve rice security.

20

Literatures Cited Draz, A. E. (2004). Contribution and utilization of anther culture lines in rice

improvement in Egypt. El-Hennawy, M. A., Abdalla A. F., Shafey S. A. & Al-Ashkar I. M. (2011). Ann Agril Sci.,

56(2), 63-72. FAO. (2018). Rice market monitor: Trade and markets division. Food and agriculture

organization of the United Nations. Germana MA. (2010). Anther culture for haploid and doubled haploid production. Plant

Cell Tiss. Organ Cult.; 104:283-300. Hennawy, E., Abdalla, M. A., Shafey, A.F., & Al-Ashkar, A. S., (2011). Production of

doubled haploid wheat lines (Triticum aestivum L.) using anther culture technique. Ann. Agri. Sci.,56 (2), 63–72

Herawati, R., Bambang, P. & Dewi, I. (2010). Characterization of doubled Haploid

derived from anther culture for new Type Upland Rice. 38. Mishra R, Rao G J N, Rao R N and Kaushal P (2015). Development and characterization

of elite doubled haploid lines from two Indica rice hybrids. Elsevier, 22(6), pp.290–299.

Murovec, J. and Bohanec, B., (2012). Haploids and doubled haploids in plant breeding.

In Plant breeding. InTech. Tabanao DA, Carampatana JE, Pocsedio AE, Gramaje LV, Garcia VC, San Gabrield RC,

Padolina TF, Rigor AT (2015). Multi-location adaptation tests of hybrid rice varieties in the Philippines. Philippine Journal of Crop Science Vol.40 No.2 pp.25-32 ref.44

Stringens, A., Schipprack, W., Reif, J.C., Melchinger, A., (2013). Unlocking the genetic

diversity of maize landraces with doubled haploids opens new avenues for breeding.

PLoS One 8, e57234. http://dx.doi.org/10.1371/journal.pone.0057234 Wu, X., Chang, X., & Jing, R. (2012). Genetic insight into yield associated traits of wheat

grown in multiple rain-fed environments. PlOS One, 7(2), e31249. http://dx.doi.org/10.1371/journal.pone.0031249

Yin GD, Zeng RY, Wang XY, Yen ZL, Liu HR (1983) Studies on utilization of anther culture

breeding in rice. In: Shen JH, Zhang ZH, Shi SD (eds) Studies on anther culture breeding in rice (in Chinese, English abstract). Agri Press, Beijing, pp 55-60.

http://dx.doi.org/10.1371/journal.pone.0057234

21

AGE AND CURING TIME ON THE NUTRIENT QUALITY AND SHELF-LIFE OF

CHEVON MARA

Nora C. Cabaral Mindoro State College of Agriculture and Technology

ABSTRACT Chevon contains low fat and cholesterol and high levels of long-chain UFA that is good for the heart and blood circulation. Despite the benefits, not everyone can enjoy chevon because it is not a regular fare in markets. Anyone who wants chevon must purchase the whole animal, which makes it quite expensive; hence processing it into a product - “mara” that can be accessible to consuming public is taken into consideration. The study aims to determine the quality and shelf-life of chevon mara as influenced by animal’s age and curing time. Data were analyzed using ANOVA following 4X4 factorial CRD, while significant differences between treatments were analyzed using Scheffe’s Test and Friedman Test for sensory evaluation. Results revealed that animal’s age significantly affects (p<0.01) the physicochemical content of chevon mara in terms of shrinkage, dehydration rate, CP, total fat, MC, carbohydrate, energy, cholesterol, calcium, potassium, texture, and flavor. However, curing time significantly affects (p<0.01) the CP, MC, carbohydrate, and energy content. The pH, color, off-flavor, and general acceptability of chevon mara are comparable (p>0.05) and are not affected by the animal’s age and curing time. Results revealed that processed chevon mara using 12, 14 and 16 months’ goats, regardless of curing time can be stored at chiller for 3 months. Keywords: Curing period, mara, meat quality, nutrient content, yeast and mold counts, physicochemical analysis

22

Introduction

oat production is increasingly becoming popular among livestock raisers in the Philippines. Goats are easy to manage, can subsist on native vegetation, and have a short gestation period, thus rapidly earning a niche in the local market. Hence, goat raising is known as one of the

“sun-rising industries” in Philippine Agriculture (Cerbito et al., 2012; PCAARRD, 2011).

Goat raising only requires a minimum initial capital investment and production inputs but provides a good return to the expenses, family labor, and production of high-value products like meat (chevon) and milk. Consumers are interested in goat meat as a source of relatively lean meat, especially in developed countries with a high incidence of cardiovascular diseases (Banskalieva et al., 2000; Madruga et al., 2006). Goat meat contains low percentages of fat and cholesterol and high levels of long-chain unsaturated fatty acids (UFA) compared with other domestic animals. However, according to Banskalieva et al., (2000), the fatty acids composition of goat meat has received little research attention as compared to that given to milk and meat obtained from other animal sources. However, not everyone can enjoy such products, particularly chevon, because it is not yet a regular fare in wet markets. Anyone who wants one would have to purchase the whole animal, which makes it quite expensive.

The aforementioned necessitates that something has to be

done to make chevon available to the consuming public. Processing it into products that can be stored and made available may help solve the problem and make chevon more appealing to those who are not so keen on consuming it. Chevon “mara” is one of the promising products developed that may provide the solution.

Chevon “mara” is a colored, shredded and dried meat

product made from goat meat. Due to its arid state, it is stable and can be stored at room temperature for several days (Torres, 2002). However, while varying degrees of success have been recorded in testing different protocols of processing, information on the effect of goat age and curing time on the shelf life of this processed meat is

not yet investigated. Hence, this study was conducted.

G

23

Objectives

The study aims to determine the following: (1) effect of goat age and curing time on the physical attributes and organoleptic properties of chevon mara; (2) determine how age and curing time influences the shelf-life of chevon “mara”; and (3) establish the right combination of factors (age and curing time) that would show the best result in the production of chevon “mara” as protein source.

Materials and Methods Materials

Five heads of male native goat (Capra hircus) of varying ages (2 for 10 months, 12 months, 14 months and 16 months) were purchased from the nearest goat farm in Oriental Mindoro and were slaughtered for the production of chevon “mara”. The ingredients used in producing “mara” are shown in Table 1.

Table 1 Ingredients that were Used in the Production of Chevon mara per Kilogram of Meat

INGREDIENTS AMOUNT NEEDED (grams)

Brown sugar 40 Pangasinan salt 18 Praque powder 4

Ground black pepper 2 Garlic Powder 1.7

Methods

Experimental design and treatments. A total of 32 kg of cubed chevon from five male native goats (BW=25±2.5kg) were randomly allotted to four treatment groups with four replicates per treatment following a 4 x 4 factorial arrangement in a Completely Randomized Design (CRD). The factors involved are curing time (30 minutes, 1 hour, 1.5 hours and 2 hours) and age of the buck (10, 12, 14, and 16 months old).

Selection of animals for slaughter. Healthy male native goats

of the following ages were selected and used for chevon “mara”

24

production: 10, 12, 14, and 16 months. One animal per age group was selected.

To be certain that the animal selected to represent each age

group was the right animal, its pedigree was taken if it is available. If not, its approximate age was determined through the raiser’s estimate body measurement (i.e., BL and BH) and dentition. The animals selected should be free from physical defects and other faults that might affect the quality of chevon to be used for “mara” production. This was accomplished by making a detailed inspection of the physical attributes of the candidate goats. Slaughtering the Sampled Goats

The goats were subjected to similar slaughtering process if only to be certain that the quality of the chevon taken from them is not altered in any way. Five hours before slaughter, the animals were drenched with vinegar to remove the characteristic goaty taste of chevon.

Stunning. Stunning goats was done with the same tools for

stunning hogs, but can easily be accomplished with the use of ordinary carpenter’s hammer. A good blow at the forehead where two imaginary lines originating from the base of the horn to the opposite eyes meet is given to the animal. One blow was usually enough to stun. However, a second blow was sometimes necessary.

Sticking. Sticking goats was done by holding the animal in a

position with the knee, on or behind the shoulder. Then the lower jaw was grasped with the hand, and the head was pulled back. With the back positioned towards the cervical bones, the knife was inserted at the back of the jaw as close as possible to the neck bones. At this position, the outer portion of the neck was cut clear and through, severing the blood vessels, the windpipe, gullet, and fleece.

Flaying. The fleece of the animal is removed in a manner

slightly different from that of the cattle and carabaos. Precaution was taken never to allow the meat to come in contact with the hairs or fleece of the animal to avoid imparting a goaty odor to the meat. Both hind legs were tied with a rope, and the carcass was suspended in a convenient hanger or branch.

25

The skin around both knees at the hindlegs was cut, and from this cut, the skin is opened at the inner portion of the thighs. The skin was removed by starting with a knife followed by pulling the hide with one hand while thumbing or fisting it with another hand. Thumbing or fisting was forcing the thumb or fist in between the pelt and the body, and in the process, the pelt was severed. The head of the animal was removed at the atlas joint.

At least 8 kg of lean chevon was trimmed from each

slaughtered animal. The meat was taken from the thigh, shoulder and flank parts of the animal. Preparation of Chevon mara Samples

Chevon Preparation. Eight (8) kilograms of lean chevon was used per age category and was prepared in bulk before curing. The meat was cubed to about an inch in size to facilitate processing and was chilled in a refrigerator for about 5 hours before processing to prevent undue spoilage of the samples during processing.

While the chevon is being chilled, the dry curing mixture was

prepared. All the ingredients were checked for availability and weighed according to what is required of each for the amount of chevon to be processed into plain “mara,” as indicated in Table 3. The curing ingredients were manually mixed thoroughly to be as homogenous as possible. The chevon taken from the different goat age categories was soaked separately in each of the four curing mixtures prepared. To ensure the application of the curing mixture, hand mixing was done.

Curing. The 8 kg chevon with the curing mixture was divided

into 500g samples, each one to represent a replication of the goat age category in each of the four lengths of curing time. Four (4) of these samples were assigned as representatives of the age category in each of the four lengths of curing time to be tested. Hence, 16 samples with 500g per samples, four from each age category, were subjected to each of the following curing times: 30 mins, 1 hour, 1.5 hours, and 2 hours.

“Mara” Processing. Separately, the cured chevon from the

different goat age categories and lengths of curing time was placed

26

in a baking pan and covered with aluminum foil. The sample was tenderized in a pressure cooker at 121oC for 35-45 minutes or until tender. When tender, the cured chevon was allowed to cool and drain at room temperature.

To produce the “mara,” the cured chevon was shredded using forks. It was then dried by stirring it continuously in a frying pan over a very low flame to prevent overcooking of some portions. Drying was limited to 500g shredded chevon at a time for even drying and case hardening of the fibers (Arganosa and Babaan, 1985).

Data Collection

Physico-chemical Analysis. Samples from each of the 16 samples from various age and curing time combinations were subjected to physico-chemical analysis to determine and compare their nutrient contents such as moisture content, crude protein, carbohydrates, energy, total fat and other important nutrient contents such as calcium and potassium. The cholesterol content and pH value were also determined. Samples were submitted to the Food and Nutrition Research Institute (FNRI), Department of Science and Technology (DOST), Bicutan, Taguig City for analysis.

Sensory Evaluation. To determine their eating quality,

samples of the “mara” from different goat age and curing time categories were evaluated by 10-20 trained panelists. Evaluation for color, texture, flavor, off-flavor, and general acceptability was done. A 5-point hedonic scale was used for this purpose. Color _____ 5 – Very acceptable _____ 4 – Slightly acceptable _____ 3 – Neither acceptable nor unacceptable _____ 2 – Slightly unacceptable _____ 1 – Very unacceptable Texture _____ 5 – Very fine _____ 4 – Fine _____ 3 – Neither fine nor coarse _____ 2 – Coarse _____ 1 – Very coarse

27

Flavor _____ 5 – Very rich meat flavor _____ 4 – Rich meat flavor _____ 3 – Neither rich nor bland _____ 2 – Bland _____ 1 – Very bland Off - flavor _____ 5 – Not detectable _____ 4 – Slightly detectable _____ 3 – Detectable _____ 2 – Moderately detectable _____ 1 – Very detectable General acceptability _____ 5 – Very acceptable _____ 4 – Slightly acceptable _____ 3 – Neither acceptable nor unacceptable _____ 2 – Very unacceptable _____ 1 – Very unacceptable

Rehydration Test. The ability of the dried “mara” to reabsorb moisture was determined by placing a sample of “mara” on a stainless bowl then pouring in around 100 ml of hot water with a temperature of about 60℃. Mara was allowed to rehydrate for 30 minutes. After which, it was drained for another 30 minutes using a funnel with filter paper and an Erlenmeyer flask. The rehydrated mara sample was weighed. The yield was computed as follows: % Yield = Rehydrated sample – Weight of the sample

Weight of the sample

Shelf-life Test. Samples were submitted to Food and Nutrition

Research Institute (FNRI), Department of Science and Technology (DOST), Bicutan, Taguig City for yeast and mold count. Statistical Analysis

All data collected were consolidated, organized, encoded, and tabulated. Data were analyzed using the Mixed procedure of the Analysis of Variance using the SAS Software. The model includes the

x 100

28

age, curing time, and age x curing time following 4x4 factorial of the Completely Randomized Design. Scheffe’s Test was used to determine significant differences between treatment combinations while sensory evaluation was analyzed using the Friedman Test.

Results and Discussion

Fresh samples of chevon were analyzed for proximate analysis and pH (Table 2) and were used as the basis for the discussion of the nutrient content of chevon after processing it into the final product called mara.

Results showed that meat of 10 months old native goats

have the highest moisture content with 74.99% due to its low DM content (25.01%) while the meat samples from 16 months of age contain a moisture content of 72.35% with a DM of 27.65%. The crude protein of meat from 10 months old native goats has the lowest CP and CFat content of 19.27% and 2.06%, respectively while 14 months old native goats have meat with 22.50% CP, 2.94% CFat and has the lowest content of ash with 1.04%. The meat from 12 months goats has the highest pH of 6.2, 16 months of age with 6.0 while 10 and 12 months goats have a pH of 5.8. Table 2 Proximate Analysis and pH of Fresh Chevon Samples (g/100g) before Processing into Chevon mara

NUTRIENTS AGE (months)

10 12 14 16

Moisture 74.99 73.06 73.52 72.35 Crude Protein 19.27 20.81 22.50 22.47 Crude Fat 2.06 2.76 2.94 2.64 Ash 3.68 3.37 1.04 2.54 DM 25.01 26.94 26.48 27.65 pH 5.8 6.2 5.8 6.0

Shrinkage

The shrinkage of chevon mara as influenced by different curing time and age of the animal used in the experiment were presented in Table 3. Results showed that regardless of curing time,

29

the shrinkage that was obtained in chevon mara processed from 10 and 12 months old native goats had significantly higher (P<0.01) shrinkage compared to that of the shrinkage of chevon mara processed using 14 and 16 months old native goats.

Results suggest that the highest shrinkage of chevon mara

using the 10 and 12 months old native goats was due to its higher moisture content (Table 2 and Table 7). This result conforms to the findings of Stancov et al., (2002); Badua et al., (2007) and Devendra, 1998 as cited by Malekian et al., (2014) who reported that the water amount in meat is relatively high which could be explained by the young age of slaughtering the goats and the comparatively low degree of fattening (Table 6). Table 3 Shrinkage of Processed and Cooked Chevon mara as Influenced by Different Curing Time and Age

CURING TIME

AGE (months)

10 12 14 16

30 minutes 41.96a 39.25a 33.09b 28.94b 1 hour 40.21a 36.73a 32.64b 27.20b 1.5 hours 41.24a 38.26a 31.70b 27.20b 2 hours 40.45a 36.76a 30.19b 23.73b

Legend: Means within row with different superscripts are significantly different (P<0.01).

Dehydration Rate

Dehydration rate was determined to evaluate the capacity of chevon mara to absorb and/or hold water as influenced by different curing time and age from where the chevon mara sample was taken and the results of the analysis were shown in Table 4. Moreover, results revealed that regardless of curing time, the dehydration rate that was obtained in chevon mara using 16 months old native goats had significantly higher (P<0.01) dehydration rate than the dehydration rate of chevon mara processed using 10 and 12 months old native goats but are comparable (P>0.05) with the

30

dehydration rate of chevon mara that was made using 14 months old native goat.

Results imply that goat meat processed into chevon mara

using 14 and 16 months of age has lower shrinkage (Table 3) while increasing dehydration rate (Table 4). This is in contrast with the higher shrinkage and lower rehydration rate obtained in chevon mara that was processed using 10 and 12 months old native goat that can be attributed to its higher moisture content (Table 7) and lower fat content (Table 6).

In addition, results were similar to the findings of Stancov et

al., (2002); Badua et al., (2007) and Devendra, 1998 as cited by Malekian et al., (2014) who mentioned that the capacity of the meat to hold and absorbed water is correlated to the age from where the sample meat is taken. Moreover, they also emphasized that the water holding capacity of the meat is directly correlated to the age of the animal. Crude Protein

The crude protein content of chevon mara was determined before and after processing the meat into mara. Results showed that curing time and age significantly affects the crude protein content of chevon mara and was presented in Table 5 and 6. Results revealed that processing chevon mara using 10 months old native goats had significantly (P<0.01) higher crude protein (CP) content compared to that of the CP content of the chevon mara made from 12, 14 and 16 months old native goats.

Results also showed that regardless of age, curing chevon

mara at 2 hours had significantly (P<0.01) higher CP content with 41.23% compared to chevon mara cured at 1.5 hours, 1 hour and 30 minutes with a CP content of 39.98%, 39.30%, and 38.60%, respectively.

Results conform to the findings of Stancov et al., (2002) and

Devendra, 1998 as cited by Malekian et al., (2014) who also mentioned that age and curing time indeed affects CP content of the meat sample. This results can be associated to the curing materials used specifically salt (Table 1) due to osmosis which absorbs water

31

that makes the cured chevon mara more concentrated that consequently affects the DM of the sample, hence increases the CP content.

Table 4 Dehydration Rate of Processed and Cooked Chevon mara Using Different Curing Time and Age

CURING TIME AGE (months)

10 12 14 16

30 minutes 32.11c 35.50bc 38.17ab 41.27a 1 hour 31.28c 36.17bc 38.72ab 44.60a 1.5 hours 33.17c 36.83bc 39.73ab 42.27a 2 hours 35.83c 37.83bc 37.83ab 42.93a


Table 5 Crude Protein Content (%) of Chevon mara Using Different Curing Time and Age


10 12 14 16

30 minutes 41.9a 35.7b 35.9b 38.2b 1 hour 41.8a 38.6b 40.4b 36.4b 1.5 hours 44.6a 39.9b 39.3b 39.3b 2 hours 45.0a 41.3b 39.2b 38.9b


Table 6 Crude Protein Content (%) of Chevon mara at Different Curing Time

CURING TIME CRUDE PROTEIN CONTENT

30 minutes 38.60c 1 hour 39.30bc

1.5 hours 39.98b 2 hours 41.23a

Legend: Means within column with different superscripts are significantly different (P<0.01).

Total Fat

The total fat of chevon mara as affected by the age of animals used as meat samples and curing time was shown in Table 7. Results indicated highly significant results (P<0.01) in the total fat content of chevon mara as affected by age but comparable (P>0.05) based on curing time. Results revealed that processed chevon mara

32

using 16 months old native goats had significantly (P<0.01) higher total fat content than the total fat content of chevon mara processed using slaughtered and processed native goat’s meat at 14, 12 and 10 months of age. Results can be associated with the highest shrinkage (Table 3) and low dehydration rate (Table 4) of chevon mara using the 10 and 12 months old native goats that can be due to its higher moisture content (Table 7). This result conforms to the findings of Stancov et al., (2002); PCAARRD, (2006); Badua et al., (2007) and Devendra, 1998 as cited by Malekian et al., (2014) who reported that when the moisture content in the meat is relatively high which could be explained by the young age of slaughtering the goats, then it has a comparatively low degree of fattening. Table 7 Total Fat Content (%) of Processed Chevon mara Using Different Curing Time and Age

CURING TIME

AGE (months)

10 12 14 16

30 minutes 4.2d 10.3c 14.2b 15.2a 1 hour 4.2d 10.3c 13.8b 14.1a 1.5 hours 4.3d 10.3c 12.1b 14.9a 2 hours 4.4d 11.4c 12.7b 13.1a


Moisture Content

The moisture content of the processed chevon mara as affected by the age of animals used as meat samples and curing time was shown in Table 8 and Table 9. Results indicated highly significant results (P<0.01) in the moisture content of chevon mara as affected by age and curing time.

Table 8 shows that processed chevon mara using 10 months

old native goats had significantly (P<0.01) higher moisture content than the moisture content of chevon mara processed using slaughtered and processed native goat’s meat at 12, 14 and 16 months of age. Results can be associated with the highest shrinkage (Table 3) and low dehydration rate (Table 4) of chevon mara using the 10 months old native goats. This result was in line to the findings of Stancov et al., (2002); PCAARRD (2006); Badua et al., (2007) and

33

Malekian et al., (2014) who stated that when the moisture content is relatively high in the meat, then it has a comparatively low degree of fattening and low capacity to hold water due to saturation.

On the other hand, results on the effect of curing time on the

moisture content (MC) of chevon mara (Table 9) shows that chevon mara cured at 30 minutes with MC of 34.38% was significantly (P<0.01) higher than the moisture content of chevon mara samples cured 1 hour, 1.5 hours and 2 hours with 32.90%, 31.60%, and 31.48%, respectively.

Results were in line to the findings of Stancov et al., (2002);

Tsabalala and Strydom (2003) and Malekian et al., (2014) who also mentioned that age and curing time indeed affects the MC of the meat sample. This results can be associated to the curing materials used specifically salt (Table 1) due to osmosis which absorbs water that makes the cured chevon mara more concentrated that consequently affects the DM and MC of the meat sample. Table 8 Moisture Content (%) of Processed Chevon mara Using Different Age of Goats

CURING TIME

AGE (months)

10 12 14 16

30 minutes 37.6a 33.0b 31.7c 31.5c 1 hour 35.3a 33.0b 28.7c 28.2c 1.5 hours 34.4a 32.8b 31.0c 27.7d 2 hours 35.8a 32.3b 30.6c 27.7d


Table 9 Moisture Content (%) of Chevon mara at Different Curing Time

CURING TIME MOISTURE CONTENT

30 minutes 34.38a 1 hour 32.90b

1.5 hours 31.60bc 2 hours 31.48c


34

Carbohydrate

The carbohydrate of chevon mara as affected by the age of animals used as meat samples and curing time is shown in Table 10 and 11. Results indicated highly significant results (P<0.01) in the carbohydrate content of chevon mara as affected by age and curing time.

Results revealed that processed chevon mara using 16

months old native goats had significantly (P<0.01) higher carbohydrate content than the chevon mara samples using slaughtered and processed native goat’s meat at 14, 12 and 10 months of age. Results can be attributed to the fact that chevon mara samples from the 16 months old native goats exhibited highest fat content (Table 7) that is directly correlated to the energy (Table 12) that consequently yields higher carbohydrate content of the meat samples (Rajkumar et al., 2004).


carbohydrate (CHO) content of chevon mara (Table 10) showed that chevon mara cured at 2 hours with CHO content of 11.70% was significantly (P<0.01) higher than the CHO content of chevon mara samples cured 30 minutes, 1 hour and 1.5 hours with 9.35%, 10.57%, and 10.75%, respectively. Results were in line to the findings of and Rajkumar et al., (2004) and Malekian et al., (2014) who also mentioned that curing time indeed significantly affects the CHO content of the meat sample which could be associated with fat and energy content.

Table 10 Carbohydrate Content (%) of Processed Chevon mara Using Different Age of Goats


10 12 14 16

30 minutes 9.0b 9.4b 10.5b 12.5a 1 hour 8.3b 10.3b 10.6b 11.1a 1.5 hours 8.5b 10.1b 11.7b 13.9a 2 hours 8.3b 10.1b 10.7b 15.5a


35

Table 11 Carbohydrate (%) of Chevon mara at Different Curing Time

CURING TIME CARBOHYDRATE CONTENT

30 minutes 9.35c 1 hour 10.57b

1.5 hours 10.75b 2 hours 11.70a


Energy

The energy content of chevon mara as influenced by different curing period and age of animals used as meat samples is presented in Table 12 and 13. Results showed highly significant results (P<0.01) in the energy content of chevon mara as affected by age and curing time.

Results have shown that processed chevon mara using 16

months old native goats had significantly (P<0.01) higher energy content than the energy content of chevon mara processed using slaughtered and processed native goat’s meat at 14, 12, and 10 months of age. Results can be attributed to the fact that chevon mara samples from the 16 months old native goats exhibited highest fat content (Table 7) that is directly correlated to the carbohydrate (Table 10 and 11) that consequently yields higher energy content of the meat samples (Rajkumar et al., 2004).


energy content of chevon mara (Table 12) showed that chevon mara cured at 2 hours with energy content of 296.50 kcal/100g was significantly (P<0.01) higher than the energy content of chevon mara samples cured 30 minutes and 1 hour with 280.50 kcal/100g, 287.75 kcal/100g, respectively but is comparable to the energy content of chevon mara samples cured at 1.5 hours with 295.50 kcal/100g.

Results were in line to the findings of and Rajkumar et al.,

(2004) and Malekian et al., (2014) who also stated that curing time indeed significantly affects the energy content of the meat sample which could be attributed with fat and carbohydrate content.

36

Table 12 Energy Content (kcal/100g) of Processed Chevon mara Using Different Age of Goats

CURING TIME

AGE (months)

10 12 14 16

30 minutes 252d 270c 296b 315a 1 hour 243d 273c 312b 326a 1.5 hours 259d 292c 307b 398a 2 hours 250d 312c 314b 322a


Table 13 Energy Content (kcal/100g) of Chevon mara at Different Curing Time

CURING TIME ENERGY CONTENT

30 minutes 280.50c 1 hour 287.75b

1.5 hours 295.50a 2 hours 296.50a


Cholesterol

The results of the analysis on the cholesterol content of chevon mara as affected by the age of animals used as meat samples and curing time is presented in Table 14. Results indicated highly significant results (P<0.01) in the cholesterol content of chevon mara as affected by age but comparable (P>0.05) based on curing time.

Results revealed that processed chevon mara using 16

months old native goats had significantly (P<0.01) higher cholesterol content than the cholesterol content of chevon mara processed using slaughtered and processed native goat’s meat at 14, 12 and 10 months of age. Results can be associated with the highest fat content (Table 7) and energy (Table 12 and 13) of chevon mara using the 16 months old native goats that can be due to its lower moisture content (Table 8). This result conforms to the findings of Stancov et al., (2002);

37

Badua et al., (2007) and Devendra, 1998 as cited by Malekian et al., (2014) who reported that when the moisture content in the meat is relatively low, which could be explained by the older age of slaughtering the goats, then it has a comparatively high degree of fattening which contributes to the higher cholesterol level. Table 14 Cholesterol Content (mg/100g) of Processed Chevon mara Using Different Curing Time and Age


10 12 14 16

30 minutes 127d 146c 206b 221a 1 hour 127d 150c 217b 270a 1.5 hours 128d 154c 257b 292a 2 hours 131d 143c 201b 314a


Calcium

The calcium content of chevon mara as affected by the age of animals used as meat samples and curing time is shown in Table 15. Results indicated highly significant results (P<0.01) in the total fat content of chevon mara as affected by age but comparable (P>0.05) on curing time. Results revealed that processed chevon mara using 10 months old native goats had significantly (P<0.01) higher calcium content than the calcium content of chevon mara processed using slaughtered and processed native goat’s meat at 12, 14 and 16 months of age.

Results can be attributed to the fact that younger animals

contain a higher amount of calcium that was needed in bone and teeth formation (99% of body calcium in the bones and teeth), nerve and muscle function (Badua et al., 2007). On the other hand, older animals had a lesser amount of calcium due to exhausted utilization of calcium that was associated with the softening of bones in adult animals with increased porosity and brittleness.

38

Table 15 Calcium Content of Processed Chevon mara (mg/100g) Using Different Curing Time and Age


10 12 14 16

30 minutes 20a 16b 13b 11c 1 hour 21a 17b 13b 11c 1.5 hours 20a 17b 14b 11c 2 hours 22a 16b 14b 11c


Potassium

The potassium content of chevon mara as affected by the age of animals used as meat samples and curing time was shown in Table 16. Results indicated highly significant results (P<0.01) in the total fat content of chevon mara as affected by age but comparable (P>0.05) on curing time. Results revealed that processed chevon mara using 10 months old native goats had significantly (P<0.01) higher potassium content than chevon mara processed using slaughtered and processed native goat’s meat at 12, 14, and 16 months of age.

Results can be associated to the fact that older animals had

a lesser amount of potassium due to its utilization of potassium for rumen digestion, acid-base balance and appropriate nutrient regulation (Badua et al., 2007). Hence, potassium decreases as age advances. Table 16 Potassium Content (mg/100g) of Processed Chevon mara Using Different Curing Time and Age


10 12 14 16

30 minutes 506a 480b 462c 451c 1 hour 503a 488b 465c 444c 1.5 hours 542a 504b 451c 457c 2 hours 575a 503b 480c 494c


39

pH Value The pH value of the processed chevon mara was measured

using the pH meter, and results are presented in Table 17. Results showed that the quality of chevon mara in terms of pH level did not significantly affect the age of the animals where the meat sample is taken and based on curing time. Results were in line to the findings of Stancov et al., (2002) and Malekian et al., (2014) who reported that meat sample pH was comparable (P>0.05) regardless of the age of the animals where the sample is taken and curing period. Table 17 pH Value of Processed Chevon mara (mg/100g) Using Different Curing Time and Age


10 12 14 16

30 minutes 6.3a 6.1a 6.2a 6.2a 1 hour 6.3a 6.2a 6.2a 6.1a 1.5 hours 6.2a 6.2a 6.1a 6.1a 2 hours 6.2a 6.2a 6.1a 6.1a

Legend: Means within row and column with similar superscripts are not significantly different (P>0.05).

Shelf-life

The shelf-life was specifically based on the mold and yeast

count on the processed chevon mara after 3 months of analysis and observation. The results are presented in Table 18. Based on the analysis done by the FNRI-DOST, the highest count of mold and yeast was observed in the meat coming from the processed chevon mara using 10 months old native goats that was cured for 1.5 and 2 hours with less than 1000 counts and is very high compared to the other treatment combination which only contains less than 100 molds and yeasts.

Results can be associated to the fact that younger animals

contain higher moisture content (Table 1 and Table 8) that can enhance the growth of different microorganism and increases the count of molds and yeasts (Badua et al., 2010; PCAARRD, 2006). Also, this could be due to the high hexanal and pentanal - aldehyde content of the meat that serves as an index of meat flavor deterioration

40

(MFD) and further oxidation during storage (Fereidoon and Pegg, 2007). Table 18 Mold and Yeast Count of Processed Chevon mara (mg/100g) as Influenced by Different Curing Time and Age


10 12 14 16

30 minutes <100 counts <100 counts <100 counts <100 counts 1 hour <100 counts <100 counts <100 counts <100 counts 1.5 hours <1000 counts <100 counts <100 counts <100 counts 2 hours <1000 counts <100 counts <100 counts <100 counts

Organoleptic Properties

Chevon mara quality parameters namely color, texture, flavor, juiciness, off-flavor, and general acceptability are presented in Table 19 to 23.

Color. Based on the 5-hedonic scale and the results of the

analysis on processed chevon mara color, all samples, regardless of curing time and age of the animals where the meat sample was taken exhibited comparable (P>0.05) color and falls under slightly to very acceptable (3.75 - 4.75 based on 5-hedonic scale).

Texture. Based on the analysis of texture and 5-hedonic

scale, results showed that the age of the animal where the chevon mara samples were taken shows comparable texture (P>0.05). On the other hand, curing time shows a significant effect on the chevon mara texture. Moreover, chevon mara cured at 2 hours shows higher (P<0.01) texture value that was significantly different to the texture value of chevon mara cured at 30 minutes but is comparable to the texture value of chevon mara cured at 1 hour and 1.5 hours.

There is no direct study regarding the effect of specific

curing time and age of animals on the texture quality of chevon mara. However, this can be associated with the favorable effect of a longer period of curing time that makes the meat fiber more fined (PCAARRD, 2006).

41

Flavor. The 5-hedonic scale and analysis revealed that regardless of curing time, chevon mara samples from 16 months old native goat exhibited higher (P<0.01) flavor value that was significantly different to the flavor value of chevon mara samples from 10 months native goat but are comparable (P>0.05) to that of the chevon mara samples from 12 and 14 months old native goats.

Results can be associated to the higher degree of fattening

(Table 6) and lower moisture content (Table 7) of chevon mara samples from 16 months old native goats that could be attributed to its age that yielded the highest flavor value based on 5-hedonic scale. This result conforms to the findings of Stancov et al., (2002); Tsabalala and Strydom (2003); PCAARRD, (2006); Badua et al., (2007) and Devendra, 1998 as cited by Malekian et al., (2014) who reported that higher fat and lower moisture content increases the flavor and juiciness quality of the meat samples.

Off-flavor. Based on the 5-hedonic scale and the results of

the analysis on processed chevon mara off-flavor, all samples, regardless of curing time and age of the animals where the meat sample was taken exhibited comparable (P>0.05) off-flavor value and falls under slightly to not detectable capric taste and odor (4.00 - 4.75 based on 5-hedonic scale).

General Acceptability. The results on the general

acceptability based on the 5-hedonic scale and the results of the analysis on processed chevon mara revealed that all samples, regardless of curing time and age of the animals where the meat sample was taken exhibited comparable (P>0.05) general acceptability value and falls under slightly to very acceptable (4.00 - 4.75 based on 5-hedonic scale).

Table 19 Color of Processed Chevon mara Using Different Curing Time and Age


10 12 14 16



42

Table 20 Texture of Processed Chevon mara Using Different Curing Time and Age


10 12 14 16

30 minutes 3.00b 3.25b 3.25b 3.00b 1 hour 3.25ab 3.50ab 3.50ab 3.50ab 1.5 hours 4.25a 3.75a 3.50ab 4.25a 2 hours 4.25a 3.75a 4.00a 4.25a


Table 21 Flavor of Processed Chevon mara Using Different Curing Time and Age


10 12 14 16

30 minutes 3.75b 4.25a 4.25a 4.25a 1 hour 3.50b 4.25ab 4.25ab 4.50a 1.5 hours 3.50b 3.75ab 3.75ab 4.50a 2 hours 3.50b 3.75ab 4.50ab 5.00a


Table 22 Off- flavor of Processed Chevon mara Using Different Curing Time and Age


10 12 14 16



Table 23 General Acceptability of Processed Chevon mara Using Different Curing Time and Age


10 12 14 16



43

Conclusions

Based on the results, animal’s age significantly affects the chemical content of chevon mara in terms of shrinkage, dehydration rate, crude protein content, total fat content, moisture content, carbohydrate, energy, cholesterol, calcium, and potassium content. Also, age affects the organoleptic properties of cooked chevon mara in terms of texture and flavor. On the other hand, curing time significantly affects the CP, MC, carbohydrate, and energy content of the chevon mara. On the other hand, the pH level, color, off-flavor, and general acceptability of chevon mara are comparable and are not affected by an animal’s age and curing time. The shelf-life of chevon mara was specifically based on the mold and yeast count after 3 months of analysis and observation. Results show that the highest count of mold and yeast was observed in the meat coming from the chevon mara samples using 10 months old native goats that were cured for 1.5 and 2 hours with less than 1000 counts that is very high compared to the other treatment combination which only contains less than 100 molds and yeasts. Literatures Cited Badua, A.T., Domingo, I.J., Martin, M., Galamgam, A.S., Suba, M.S., Salas, A., & Cruz,

E.M. (2007). Principles of Animal Science. 4th edition. Central Luzon State University (CLSU). Science City of Munoz, Nueva Ecija.

Cerbito, W., Orden, E., & Nayga, J. (2012) Rural Development Enterprise (RED) in Goats.

Proceedings. PCARRD, Los Banos, Laguna. Fereidoon, S., & Pegg, R.B. (2007) Hexanal as an indicator of meat flavor deterioration.

Journal of Food Lipids. DOI: 10.1111/j.1745-4522.1994.tb00245 .x. Madruga, M. S., Resosemito, F. S., Narain, N., Souza, W. H., Cunha, M. G. G., & Ramos,

J. L. F. (2006). Effect of raising conditions of goats on physico-chemical and chemical quality of its meat. Cienc. Tecnol. Aliment. 5(2) 100-104 Retrieved from www.somenta.org/journal ISSN 1135-8122.

Malekian, F. Khachaturyan, M., Gebrelul, S. & Henson, J.F. (2014) Composition and fatty

acid profile of goat meat sausages with added rice bran. International Journal of Food Science. Volume 2014 (2014), Article ID 686298. Retrieved from http://dx.doi.org/10.1155/2014/686298.

44

PCAARRD. (2006). The Philippine recommends for meat processing. Los Banos, Laguna, Philippines.

PCAARRD. (2011). The Philippine recommends for goat raising. Los Banos, Laguna,

Philippines. Rajkumar, V., Agnihotri, M.K., & Sharma, N. (2004). Quality and shelf life of vacuum and

aerobic packed chevon patties under refrigeration. Asian Australian Journal of Animal Science, 17, 548-553.

Tsabalala, P. A. & Strydom, P. E. (2003) Meat quality of indigenous goat and sheep

breeds. Meat Science. 65, 563-570.

45

CASSAVA PRODUCTION IN AMELIORATED SOIL USING CRH AND BIOCHAR

Marcela S. Icalla

Christian B. Apostol Mindoro State College of Agriculture and Technology

ABSTRACT

Rice hull is considered waste from rice milling and disposal is a problem. However, this waste material can have economic value if used as a soil amender. This study was conducted in MinSCAT experimental area to determine which of CRH or biochar (Factor A) applied in 10t/ha will have an impact on the yield of two cassava varieties (Factor B). Using RCBD in 3x2 factorial experiment, it was found out that cassava planted in no amender had significantly lower yield compared to the plants grown in soil with an amendment. Further, CRH and biochar applied as amender had a comparable effect on tuber circumference and number of tuber harvested per plant but not in length and weight of harvested roots. Lakan 1 grown in CRH and biochar had 12.01% and 11.45% increase in yield respectively compared with no soil amender. Lakan 2, had 11.65% and 12.11% increase in yield if grown in CRH and biochar, respectively. Statistical analysis revealed that Lakan 1 is superior compared to Lakan 2 in terms of all parameters used except for yield per hectare. The result of this study showed that either CRH or biochar amender had a positive impact on the yield of cassava.

Keywords: Agriculture, rice hull, CRH, biochar, experimental, RCBD, Philippines

46

Introduction

ice is the world’s second most important cereal crop. FAO (2016) has raised its forecast of rice production in 2016 by 1.3 million tons 746.8 tons. Nearly 482 million metric tons of husked rice was produced in the last harvesting year worldwide. But the largest share in rice production is in

Asia (Worldatlast, 2015). However, Philippine produced 13 million tons on the last year season, that led to 2.5 million tons of rice hull, which were just thrown or burned (PhilRice, 2016). Rice hull is considered waste from rice milling and disposal is a problem. However, waste material can have economic value if used as soil amender in the form of carbonized rice hull (CRH) and biochar.

As soil amender, CRH helps replenish the air in the soil, improves the water retention of the soil, serves as excellent host for beneficial microorganisms, and an ingredient for bioorganic fertilizer. Biochar, on the other hand, improves soil productivity, carbon storage, and filtration of percolating soil water reduced tensile strength of hard-setting soils, and stimulating growth activity (Lehmann and Joseph 2009). Studies conducted revealed that CRH improved garlic yield (Domingo, 2015). Preston et al., (2006) found out that increasing the application of biochar from 0 to 5 kg/m2 led to linear increases in biomass dry matter yield of 39, 100, 300 and 350 % for water spinach, Chinese cabbage, celery, cabbage and mustard green, respectively.

Biochar used as a soil amendment (Karhu et al. 2011) has

found to have beneficial effects in increasing water-holding capacity, aeration, and hydraulic conductivity. A study of Haefele et al., (2011) showed that application of untreated and carbonized rice husks increased total organic carbon, total soil N, C:N ratio, and available P and K. On a poor soil, which is identified as having low organic carbon, nitrogen content, base saturation, K availability, and cation exchange capacity; and dominated by sand, soil chemical and physical improvements increased yields by 16–35% with an amendment of 4.13 kg carbonized rice husk per square meter cropping. On the other hand, biochar processing needs to be considered with respect to energy balance and production and application cost. Using biochar as a soil amendment, instead of burning the fuel more completely,

R

47

reduces the energy efficiency of bioenergy production. However, carbon sequestration in biochar production helps mitigate climate change and the emission reductions associated with the addition of biochar to the soil appear to be greater than the fossil fuel offset in its use as fuel (Gaunt and Lehmann, 2005).

Cassava, or manioc (Manihot esculenta), is a root crop native

to tropical America that is now consumed by millions of people throughout the tropics and is used in food preparation in many industrialized processes. Although it is not well known outside the tropics, cassava now accounts for about 30 percent of the world production of roots and tubers. It is an exceptional producer of carbohydrates and a plant better able to tolerate seasonal drought than other major food crops. This crop produces a higher energy quantity, followed by corn, rice cocoyam, sorghum, and potato (Rojas, 2007). It is the major staple starch of the people in most parts of the tropics (Ayoola; Makinde, 2007).

In the Philippine, cassava is planted each year in about

120,000 hectares of agricultural land producing about 1.8 million tons for a year (Bacusmo, 2017).

Due to the advantages of using soil amender, farmers have

recently started using rice hull as biochar and CRH as alternative soil amender to increase crop yield as these materials are locally available and cheaper compared to limestone. Aside from this, the carbonization and production of biochar can be a solution to the disposal problem of this waste material. Owing to these reasons, the researchers are encouraged to conduct a research study on the effect of CRH and biochar as soil amender on the yield of cassava. This study was conducted from November 2016 to September 2017 at the experimental site of MinSCAT Main Campus, Alcate Victoria, Oriental Mindoro.

Objectives

This study aimed to evaluate the effect of CRH and biochar amelioration on the yield of two cassava varieties in terms of the number of harvested roots, average length, and diameter of roots and yield per hectare.

48


Fresh rice hull from local rice mill was used as feedstock. To fertilize the soil, decomposed chicken dung was applied as basal fertilizer. Vermicompost was applied at the rate of 500 gram per plant three months after planting. Lakan 1 and Lakan 2 cassava varieties were given by BPI/Plant Quarantine Service (BPI-PQS) two days before planting. Methods Experimental Design

A 3x2 factorial experiment in Randomized Complete Block Design (RCBD) was used in this study. Factor A were types of soil amelioration (A1: no amelioration, A2: CRH, A3: Biochar) and cassava varieties were assigned as Factor B (B1: Lakan 1, B2: Lakan 2). Having six sample plants and fourteen border plants per plot, each treatment was replicated three times. Preparation of Experimental Site

A total area of 570 sq. m was cleaned, plowed and prepared thoroughly into loosed tilt by thrice plowing and harrowing alternately with the used of hand tractor until the good tilt of the soil was attained. Tree blocks with 6 plots were made in the area representing all treatments. Plots had a dimension of 5 m by 4 m each, spaced at 1m in between at 30 cm high. There were 1m space in between blocks. CRH and biochar were applied at the rate of 5kg/m2 according to schedule except for control plots. Decomposed chicken manure was incorporated into the soil during the amelioration process. Plot signs were installed before planting. Planting and Care of the Plants

Planting materials with 20-25cm long were planted in slightly-inclined position leaving 3-5 centimeters uncovered at a distance of 1 meter per hill and 1 meter per row. Rice straws were spread on top of the plots with thick of 2 inches leaving 2 inches’ diameter from the base of cuttings to minimize the frequency of irrigation during sunny days and prevent weeds for growing.

49

Watering was done during days without rain for a month. Hand weeding likewise was done on the second month and the fourth months after planting. Off-bar cultivation was performed 4 weeks after planting followed by hilling-up 4 weeks later. Harvesting

Harvesting was done September 22, 2017, ten months after planting. The soil around the plants was removed to ease the harvesting process. Cassava stems were cut leaving a portion at the base of the plant to serve as a handle to pull the storage root up. The storage roots were detached from the stem using a sharp bolo, and roots were cleaned by removing the crumb of soil using a stick. The harvested tubers were brought to the shade for data gathering. Measurement of Storage Roots

All storage roots produced by sample plants were counted and measured. The middle portion of the storage roots of sample plants was measured using a digital caliper. Data on length of roots was obtained using meter stick. Digital weighing scale was used to determine the weight of harvested roots, and was computed based on the actual yield per plot using the formula: Y/ha= Yield/plot divided by distance of planting multiply by 10,000 sq m. Data Analysis

All data collected were consolidated, organized, encoded, and tabulated. Data were analyzed using the Analysis of Variance of the SAS Software (SAS Version 9.1.30), and Scheffe’s Test was used to determine significant differences between treatments. Level of significance and tendencies was set at P < 0.05 for all statistical tests.

Results and Discussion Types of Amelioration Number of Harvested Roots

Plants grown in CRH ameliorated soil harvested 6.50 pieces of roots comparable to the 6.95 roots produced by cassava planted

50

in biochar ameliorated soil but cassava grown in the plot without ameliorating yielded 4.85 roots which are significantly lowest among the treatment used. The result implies that either biochar or CRH from rice hull can have a positive effect on the number of roots produced by cassava. This can be attributed to the fact that biochar and CRH when applied in the soil, would improve productivity due to the reduced tensile strength of hard-setting area (Lehmann et al., 2009). It is easier for the roots to multiply and grow in the soil, which are more permeable. Soil porosity are the small voids between particles of soil. In healthy soil, these pores are large and plentiful enough to retain the water, oxygen, and nutrients that plants need to absorb through their roots and important in root development. (De Luca et al., 2009)

Length of Roots

Biochar produced the longest (36.88 cm) tuber with a mean difference of 4.03 cm to the 32.85 cm measurement of tuber produced by a plant grown with CRH and 14.18 cm difference to the shortest (22.70 cm) tuber harvested in no ameliorate soil. Soil density causes mechanical resistance of the growth restriction in compacted soil. CRH and biochar, on the other hand, makes the soil porous because of its loose composition and improves soil structure by increasing bulk density, water holding capacity, and aeration (Jindo et al.,2014). CRH has the same impact on the soil. Decreased root elongation is often accompanied by a decrease in both cell flux and axial cell extension, and recent computer-based models are increasing our understanding of these processes. In the case of mechanical impedance, massive changes in cell shape occur, giving rise to shorter fatter cells. There is still uncertainty about many aspects of this response, including the changes in cell walls that control axial versus radial extension, and the degree to which the epidermis, cortex, and stele control root elongation. Diameter of Roots Harvested

In spite of the comparable numerical value of the diameter of roots produced by cassava harvested in CRH and biochar ameliorated soil, biochar had the biggest roots produced of 7.20 cm. On the other hand, cassava planted in no amender produced small roots with 4.20 cm mean. This further confirms the data gathered in

51

the number of roots produced by ameliorated soil compared to the unameliorated. Soil, if ameliorate with CRH and biochar, will have a positive impact on the productivity of cassava. This can be explained by the advantages of using rice hull in the form of CRH and biochar as a soil amender. Availability of soil moisture is a great factor that determines the development of roots. CRH and biochar improved the water uptake of the soil as well as its availability to crops. The higher biochar application rates improved soil water permeability and holding capacity, which improved the overall plant water availability (Asai et al., 2009; Liu et al., 2009). Weight of Roots (Yield/ha)

Yield per hectare was determined by getting the weight of roots right after harvesting. Data showed that the heaviest root harvested was produced by plants grown in biochar ameliorated soil with a mean of 32.50 t/ha, followed by 29.10 t/ha produced by plants in CRH ameliorated soil while plants harvested in no amelioration obtained the least tonnage per hectare. The same findings in a different study conducted revealed that amelioration increased the yield in corn (Kimetu et al., 2008) by 2.2 t/ha, rice up to 14% (Zhang et al., 2011), and wheat by 18% (Solaiman et al., 2012).

Table 1 Yield Performance of Cassava as Affected by Types Amelioration

Factor A Amelioration

Number of harvested

root

Length (cm)

Diameter (cm)

Weight (T/ha)

Control (No amelioration)

4.85b 22.70c 4.20b 25.50c

CRH 6.50a 32.85b 6.80a 29.10b

Biochar 6.95a 36.88a 7.20a 32.50a

Mean 6.10 30.81 6.07 29.03

Legend: Means within column with different superscript are significantly different (P<0.05).

52

Comparison of Varieties Used in the Study

Its yield potential can characterize a good cassava cultivar. Cassava varieties used in this study showed no differences in all parameters used except for the yield per hectare. However, it is worth noteing that Lakan 1 produced more roots, longer and bigger compared with Lakan 2. Though data showed no statistical differences, Lakan 1, having longer and bigger roots influenced the weight of harvested roots. A heavier root with computed 29.88 ton per hectare was incomparable to the 26.10t/ha produced by Lakan 2. The data is similar to the projected harvest indicated in the “Technoguide on Cassava Production” (DA-AFIS, 2011). Differences in the weight can be attributed to the varietal character of each variety. Lakan 1 potential yield is 35-45t/ha, while Lakan 2 is 25t/ha (Cassava Production: Cassava Variety Selection, 2016). Table 2 Comparison of Lakan 1 and Lakan 2 as to Yield Performance

Factor B Variety

Number of harvested root

Length (cm)

Diameter (cm)

Weight (Y/ha)

Lakan 1 7.90a 33.55a 7.95a 30.88a

Lakan 2 6.40a 32.90a 6.50a 26.10b

Mean 7.15 33.25 7.25 28.49

Legend: Means within column with different superscript are significantly different (P<0.05).

Effect of Treatment Combination on the Yield of Cassava

In the combined effect of types of amelioration and variety tested, it was revealed that the least number of harvested roots was produced by Lakan 2 grown in no soil amender with a mean of 5.63 while the most harvested roots were produced by Lakan 1, grown in plots with biochar amender. The shortest roots were harvested in no soil amender planted with Lakan 2 variety while the longest roots were harvested in biochar-amended soil planted with Lakan 1 with a mean difference of 7.42 cm. Further, Lakan 1, planted in either CRH or biochar had the biggest circumference (7.58 cm), but Lakan 2 grown

53

in unamended soil consistently had the smallest tuber produced. Rice hull as soil amender either in the form of CRH or biochar had a positive effect on the weight of harvested roots per hectare. The heaviest yield of 35.24 t/ha was obtained by Lakan 1 grown in biochar amended(A3B1) soil, which has 12.01% heavier mean in the yield of Lakan 1 grown in unamended soil. The same variety planted in CRH followed it ameliorated soil (A2B1) which has 11.45% increased in 27.68 t/ha yield of the unamended soil (A1B1). A positive effect of soil amelioration was further indicated by comparing the yield/ha of Lakan 2 grown in unamended soil and amended the soil with CRH and biochar. It was found out that Lakan 2 was 12.11% and 11.65% heavier if grown in CRH and biochar respectively than in no amender soil. This result confirmed the positive reaction of soybean to biochar application (Seremešić et al.,2015), the increase in yield of garden pea in 18t/ha biochar amelioration (Berlhun et al., 2017), the improvement in the yield of garlic harvested in CRH ameliorated soil (PCCARD,2016) and production of more tuber of cassava grown soil with CRH than of other substrate. (Salomes, et al., 2012). Table 3 Summary Table for Yield Performance of Cassava as Affected by Types of Amelioration and Variety

Factor AxB

Number of harvested root

Length (cm)

Diameter (cm)

Weight Ton/ha

A1B1 6.38 28.13 6.08 27.68

A1B2 5.63 27.80 5.35 23.55

A2B1 7.20 33.20 7.58 35.24

A2B2 6.45 32.88 6.65 29.76

A3B1 7.43 35.22 7.58 34.84

A3B2 6.68 34.89 6.85 30.04

Mean 6.63 32.02 6.65 30.19

Legend: A1 –control (no amender), A2-CRH amended soil, A3-biochar amended soil, B1-Lakan 1, B2-Lakan 2.

54

Conclusions

Soil amelioration in the form of CRH and biochar has a positive effect on the number of harvested roots, length, diameter, and weight of harvested roots of cassava. On the other hand, it was found out that Lakan 1 is comparable to Lakan 2 in terms of all parameters used except on the yield per hectare. Lakan 1 produce heavier roots compared to Lakan 2. Results also showed that Lakan 1 planted in biochar ameliorated soil has a 12.01% increase in yield compared to Lakan 1 grown in unameliorated soil. Further, Lakan 2 grown in no amender soil has the lowest yield per hectare.

Literatures Cited

Asai, H., Samsonb, B.K., Stephanc, H. M., Songyikhangsuthord, K., Hommaa, K., Kiyonoe, Y., & Horie, T. (2009). Biochar amendment techniques for upland Rice Production in Northern Laos: 1. Soil physical properties, leaf SPAD and grain yield. Field Crops Research. 111, (1–2), 15 pp. 81–84.

Ayoola, O. T., Makinde, E. A. (2007). Fertilizer treatment effects on performance of

cassava under two planting patterns in a cassava-based cropping system in South West Nigeria. Research Journal of Agriculture and Biological Sciences, 3, (1), pp. 13-20.

Bacusmo, J.L. (2017). Satus of and potential of the Philippines cassava industry.

Philippine Root Crops Research and Training Center(PRCRTC). Visca.Baybay,Leyte 6521-A.Philippine retrieved February 7, 2017 from http://ciat-library.ciat.cgiar.org/articulos_ciat/asia/pro.

De Luca, T.H., Mac Kenzie M.D., Gundale, MJ (2009). Biochar effects on soil nutrient

transformation. In: J Lehmann, S Joseph (Ed.), Biochar for environmental management science and technology. Earthscan, London, pp 251–280.

Haefele, S.; Konboon, Y.; Wongboon, W.; Amarante, S.; Maarifat, A.; Pfeiffer, E.;

Knoblauch, C.Effects and fate of biochar from rice residues in rice-based systems. Field Crops Res. 2011, 121,430–441.

Jindo K, Mizumoto H, Sawada Y, Sanchez-Monedero MA, Sonoki T (2014): Physical and

chemical characterization of biochars derived from different agricultural residues, Biogeosciences 11: 6613–6621.

Karhu, K., Mattila, T., Bergström, Irina., Regina, K. (2011). Biochar addition to

agricultural soil increased CH4 uptake and water holding capacity - Results from a short-term pilot field study. Agriculture, Ecosystems and Environment 140, 309–313.

55

Kimetu, J.M., Lehmann, J., Ngoze, S.O., Mugendi, D.N., Kinyangi, J.M., Riha, S., & Pell, A.N. (2008). Reversibility of soil productivity decline with organic matter of differing quality along a degradation gradient. Ecosystems, 11, 726-739.

Lehmann J, Gaunt J, Rondon M (2005): Bio-char sequestration in terrestrial

ecosystems–a review, Mitig. Adapt. Strat. Glob. Change 11: 403–427. Lehmann, J., Czimczik, C., Laird, D., Sohi, & S., (2009). Stability of boichar in the soil.

Biochar for Environmental Management - Science and Technology. J. Lehmann and S. Joseph.London, Earthscan, 183 - 205.

Liu & Zhang, F., “Removal of lead fromwater using biochars prepared from

hydrothermal liquefaction of biomass,” Journal of Hazardous Materials, 167, (1–3), 933–939.

Preston, CM., Schmidt, M.W.I (2006). Black (pyrogenic) carbon: a synthesis of current

knowledge and uncertainties with special consideration of boreal regions. Biogeosciences, 3, 397–420.

Rojas, R. (2007). Efecto de la densidad de plantación sobre el desarrollo y rendimiento

del cultivo de la yuca Manihot esculenta Crantz, bajo las condiciones agroecológicas de la Altiplanicie de Maracaibo. Revista de la Facultad de Agronomia, 24 (1), 94-112.

Solaiman, Z. M., Meney, K., Murphy, D. V., Rengel, Zhang, Z., Soils, Z. J. (2012).

Sediments DOI: 10.1007/s11368-012-0571-4.

56

GROWTH, CORTISOL LEVEL, BLOOD LIPID PROFILE AND MEAT QUALITY OF PEKIN DUCKS FED WITH DIFFERENT LEVELS OF

AZOLLA UNDER TWO TYPES OF PRODUCTION SYSTEM

Nora C. Cabaral Prime Gilbert T. Rieta

Mindoro State College of Agriculture and Technology

ABSTRACT

Commercial feeds played a vital role in poultry feeding and nutrition, but its rapid increasing price limits the industry growth. Thus alternative feedstuff as protein source like Azolla (25-35%CP) is taken into consideration. The study aims to determine how feeding Azolla affects the growth, blood cortisol and lipid profile, meat quality, and economics of raising Pekin duck under extensive and intensive production. Data were analyzed using ANOVA following 2x4 factorial CRD, and significant differences between treatments were analyzed using Scheffe’s Test and Friedman’s Test for organoleptic evaluation. Findings revealed that ducks raised under extensive production significantly (p<0.05) improved their FBW and FCR; lowered blood cortisol, enhanced meat color but were tougher than ducks raised intensively; and has significantly (p<0.05) higher income per head and ROI. Feeding Azolla significantly (p<0.05) improved the FBW and FCR; enhanced beak, shank and meat color, juiciness, flavor and general acceptability; lowered the cortisol, LDL and triglycerides but increased the HDL; and increased the income per head and ROI. The interaction of the extensive production and feeding 55-75% Azolla significantly (p<0.05) improved the FBW, FCR, blood cortisol level, and LDL content. Results suggest that feeding 55-75% Azolla under extensive production were potential CP alternative for Pekin duck raisers to reduce feed cost and consequently maximized profit.

Keywords: Blood cortisol, extensive production, intensive production, weight, shank color, economics, meat quality

57

Introduction ekin duck, which originated from China and produced for meat purposes, are known to be docile and well-adapted to Philippine climate (PCAARRD, 2012). Nowadays, aside from one of the potential sources of high quality protein, Pekin duck production became a popular venture due to

bird flu-free status of the Philippines that makes several South Korean firms looking for Philippine-based suppliers and local producers of Pekin ducks (DA, 2015).

Commercial feeds (60-80% of the total cost of production) have always played a vital role in livestock feeding and nutrition, but its rapid increasing price still limits the growth of Pekin duck production. Therefore, any modification and alteration to minimized feed cost increase profit margin (Galamgam, 2006). Either in a fresh or dried form, Azolla (Azolla pinnata) can be fed to livestock either fed directly or mixed with concentrates to cattle, poultry, sheep, goats, pigs, and rabbits. It takes a few days for the animals to get used to the taste of Azolla, therefore it is better to feed it with the concentrates in the initial stages (Giridhar et al., 2013).

Taaroa (2013) and Minh (2005) reported that the growth

performance of birds either reared in extensive (free range or scavenger) or intensive (pure confinement) has comparable body weights, ADG and FCR when given Azolla supplementation but has higher body weights, ADG and FCR compared to birds without supplementation. However, carcass, breast, and thigh proportion was significantly higher for the scavenging birds (extensive) compared to the confined birds (P<0.05). Moreover, Bhattacharyya (2016) and Taaroa (2013) emphasized that abdominal fat pad was significantly higher (P<0.01) for birds under confinement either with or without supplementation of Azolla than the scavenger or extensively raised birds. Likewise, Bhattacharyya (2016) stated that Azolla supplementation has significantly (P<0.05) lower bad cholesterol (LDL) while increasing good cholesterol (HDL) which result in reduced triglycerides in both confined and free-range birds.

Tran (2015), Norwan (2015), Balaji et al., (2010), Namra et al.,

(2010), Millward (2010), Balaji et al., (2009), and Lumpkin et al., (2003)

P

58

also reported that broilers fed with (15-30%) either fresh and/or dried Azolla has high potential in terms of growth rate, feed and economic efficiency and blood and meat cholesterol a nd thus recommended to increase its supplementation for possible potential results; hence this study was conducted. Farmers and raisers can benefit from this study not only because they can lessen their cost of production in terms of feed expenses but most specifically in producing organically grown Pekin duck that will offer health benefits to the consuming public. In addition, Azolla has higher digestibility rate due to its high protein but low lignin content, essential minerals like iron, calcium, magnesium, phosphorus, copper, manganese, magnesium, bio-active substances and bio-polymers 12,14,16; has appreciable quantities of vitamins A and vitamins B12, and chlorophyll; and contain almost all the essential amino acids like lysine, many probiotics, Biopolymers and B carotene (Norman, 2015; Ndegwa,2015; Norman,2015; Prasanna, 2010; Tran, 2015; Hasan et al., 2009; Pillai et al., 2002) that may enhance feed intake that consequently improved the meat quality.

Objectives

The study aimed to determine (1) how different levels of

Azolla affect the growth performance of Pekin ducks in terms of body weight, feed conversion ratio and dressing percentage; (2) determine the blood cortisol and lipid profile in terms of HDL, LDL, total cholesterol, and triglycerides of Pekin duck fed with different levels of Azolla; (3) determine the meat quality through sensory evaluation of Pekin duck meat given with different levels of Azolla in terms of color, texture, flavor, juiciness, tenderness and general acceptability; and (4) compute for the return on investment and income per head of Pekin ducks given with different levels of Azolla.


The study was conducted on November 05, 2016 – February

05, 2017 at Animal Production Project, MINSCAT, Victoria, Oriental Mindoro. Proximate analysis for the Azolla was conducted at Animal and Dairy Science Cluster, Nutrition laboratory, UPLB Laguna.

59

Materials

One hundred ninety-two (192), straight run day old ducklings that were caged in well-ventilated housing facilities were used in the study. Other materials include 24 drinkers and feeder, Azolla, hand gloves, face masks, commercial feeds, used newspapers, sacks, cleaning materials, weighing scale, record book, calculator and individual identification for proper recording. Experimental Animals and Feeding Management

A total of 192 straight run day old ducklings were used for feeding trials for 60 days fed with different levels of Azolla. Each level serves as one treatment. The Pekin ducks were provided with commercial feeds and different levels of Azolla. Clean drinking water was made available throughout the study. The experimental animals were in good body condition before and throughout the study.

Experimental Design and Treatments

The experiment followed a 2x4 factorial in Completely Randomized Design. The 192 straight run day old ducklings were randomly distributed to four treatments with 3 replications per treatment and 8 ducks per replication under 2 types of production systems. The treatments are as follows: INTENSIVE T1 – 100 % Pure commercial feeds T2 – 65 % Commercial feeds + 35% Azolla T3 – 45 % Commercial feeds + 55% Azolla T4 – 25 % Commercial feeds + 75% Azolla EXTENSIVE T1 – 100 % Pure commercial feeds T2 – 65 % Commercial feeds + 35% Azolla T3 – 45 % Commercial feeds + 55% Azolla T4 – 25 % Commercial feeds + 75% Azolla

60

Treatment Implementation

After the arrival, the ducklings were randomly distributed to four treatments replicated three times each for the 2 production system. Supplementation of Azolla as feed supplement was started on the second day to acclimatize the ducklings. Aside from the treatments applied, all the ducklings were given the same care and management. Duck Management

Housing Preparation. A week before the arrival of the ducks, the brooding and rearing cages was prepared. The floor of brooding cages was covered with five layers of newspapers to protect the ducklings from injury and to serve as a feeding area during the first 3 days of brooding. The sides were also covered with empty feed sacks to maintain the right temperature inside the brooding pen. The pen was preheated a few hours before the arrival of the ducklings to achieve the desired brooding temperature.

Brooding and Rearing. The ducklings were brooded for two

weeks. As a requirement, the brooding pen was provided with one 8-watt of light per replication to meet the one-watt heat requirement for every duckling during this period. Light was provided for 24 hours until the ducks reach two weeks of age.

Gathering of Raw Materials. Different level of Azolla as a

supplement for commercial feeds was done based on parts per hundred. Commercial feeds were purchased in the nearest Agricultural Supplies at Victoria and/or in Calapan, Oriental Mindoro.

Feeds and Feeding. Ducks were fed ad libitum. The ducks

were given booster crumbled from day 1 to 14, starter crumbled from day 15 to 35 and duck grower crumbled from 36-60 days. During the first three days, the feeds were thinly spread on newspaper matting. After that, feeds were placed in plastic trough-type feeders. Shifting of feeds from booster crumble to starter pellet and starter to grower pellet was done gradually within a period of three to seven days to avoid stress to the ducks. Potable drinking water was provided at all times.

61

In the first two hours of brooding, the ducklings were given water with brown sugar at the rate of 2 tbsp. per gallon. This was done to bring back the energy or electrolytes they lost during the transit from the hatchery to the experimental site. The ducklings were transported early in the morning. This was done to avoid too much stress to the ducklings.

Animal Health and Sanitation. The brooding and growing

pens were thoroughly cleaned and disinfected one week before the arrival of ducks. After the ducklings were placed in brooder pens, the box containing the ducklings during transportation was burned to prevent the growth and spread of virus and diseases. The feeders and water jars were cleaned daily. Cleanliness of the area and even the surrounding of the poultry house were maintained throughout the conduct of the study to avoid a disease outbreak.

Blood Collection. Before dressing the ducks at 60 days of

age, blood was collected through wing veins or jugular veins to evaluate the lipid profile contents in the nearest laboratory in terms of total mean cholesterol, triglycerides, low-density lipoprotein, very low-density lipoprotein, and high density lipoprotein.

Marketing. The ducks were harvested at 60 days of age.

Data Gathering The data gathered were as follows:

Initial and Final Body Weight. The initial body weight was

computed by the weight of ducklings before treatment implementation divided by the total number of ducklings per treatment replication. On the other hand, final body weight was computed by the weight of ducks after 60 days of feeding trial using the following formula: BW = Total weight of Pekin duck per replication/Total number of Pekin ducks.

Feed Conversion Ratio. The feed conversion efficiency of

Pekin ducks refers to their ability to convert feeds into the meat. This is computed by dividing the total feed consumption (determined by adding the previous amount of feed consumed to the current feed consumption) of Pekin ducks by their total body weight gain.

62

Blood Collection. Before dressing the ducks at 60 days of age, blood was collected through wing veins or jugular veins to evaluate the blood cortisol and lipid profile contents in the nearest laboratory in terms of total mean cholesterol, triglycerides, low-density lipoprotein, and high density lipoprotein.

Organoleptic Properties. After 60 days of the feeding trial,

48 dressed chickens (2 ducks per replication) were used in sensory evaluation. Breast muscles were steamed for about 45 minutes or until tender, cool, and then sliced for evaluation. The cooked breast meat was tested by 20 panelists using a score sheet with 5 points hedonic scale in terms of color, flavor, texture, juiciness, tenderness and general acceptability of the meat.

Cost and Return. The cost of producing Pekin duck fed with

different levels of Azolla was recorded and compared with the control. The following parameter was computed using the formula:

Net Income = Total sales – Total cost Income per head = Net Income / No. of ducks % ROI = (Net Income/Total Expenses) x 100

Statistical Analysis

All data collected was consolidated, organized, encoded, and tabulated. Data were analyzed using the Analysis of Variance of the SAS Software, and Scheffe’s Test was used to determine significant differences between treatments while Friedman’s Test for organoleptic or sensory evaluation.

Results and Discussion Body Weight

Production System. Findings showed that initial body weight among Pekin ducks used in the experiment were comparable (p>0.05). On the other hand, analysis on the final body weight showed that the weight of Pekin ducks raised under extensive production have significantly heavier (p<0.05) weights than the ducks raised intensively. Also, ducks raised extensively consumed

63

stones that help in the digestibility of the feeds offered and other feedstuff available in the range areas that consequently enhanced higher growth rate.

Moreover, the favorable effect of raising ducks on their

natural environment offered comfort due to exposure to fresh air and sunshine (Blokhuis et al., 2000), free access to water and other feedstuffs that might help the birds cope with heat stress by improving the heat dissipation capacity through peripheral blood and evaporation (Belay and Teeter, 1993; Zhou et al., 1999; Reece, 2004), thus relaxed the animals which consequently reduced the incidence of stress, and enhanced higher growth rate. However, Taaroa (2013) and Minh (2005) reported that the growth performance of birds either reared in extensive or intensive has comparable ADG and FCR.

Table 1 Body Weight of Pekin Duck as Affected by Type of Production System

TYPE OF PRODUCTION INITIAL BODY WEIGHT FINAL BODY WEIGHT

Extensive 173.750ª 3.241ª

Intensive 174.250ª 2.857ᵇ

Means within column having different superscripts are significantly different (P<0.05). Level of Azolla. The initial body weight among Pekin ducks

used in the experiment were comparable (p>0.05). However, analysis on the final body weight showed that the weight of Pekin ducks fed with Azolla regardless of proportion has significantly heavier (p<0.05) weights than the ducks not provided with Azolla. This can be attributed to the higher digestibility rate of Azolla due to its high protein but low lignin content, essential minerals and amino acid lysine and probiotics (Ndegwa, 2015; Norman, 2015; Prasanna, 2010; Tran, 2015; Hasan et al., 2009; Pillai et al., 2002) that consequently enhance feed intake and improve growth performance. In addition, results were in line with the findings reported by Tran (2015), Norwan (2015), Balaji et al., (2010), Namra et al., (2010), Millward (2010), Balaji et al., (2009), and Lumpkin et al., (2003). Taaroa (2013) and Minh (2005) reported that broilers fed with (15-30%) either fresh and/or dried Azolla has high growth performance with higher body weights, ADG and FCR compared to birds without supplementation and thus

64

has high potential as alternative feedstuffs for expensive protein source like soybean. Table 2 Body Weight of Pekin Duck as Affected by Feeding Higher Level of Azolla

LEVEL OF AZOLLA INITIAL BODY WEIGHT FINAL BODY WEIGHT

Pure Commercial Feeds 173.222ᵃ 2.874ᵇ 65% Commercial feeds+35% Azolla 175.556ᵃ 2.994ᵃᵇ 45% Commercial feeds+55% Azolla 174.000ᵃ 3.111ᵃᵇ 25% Commercial feeds+75% Azolla 173.222ᵃ 3.217ᵃ

Means within column having different superscripts are significantly different (P<0.05).

Interaction of Production System and Level of Azolla. Analysis on the final body weight showed that weight of Pekin ducks fed with Azolla raised under extensive production and fed with 75% Azolla has the highest weight of 3.307 kg (Table 3, p<0.05). These results can be attributed to the favorable effects of raising ducks extensively that make the ducks to consume stones that facilitate a higher rate of digestibility and increase nutrient absorption from the commercial feeds and Azolla in the ration. Table 3 Final Body Weight of Pekin Duck as Affected by the Interaction of Type of Production System and Feeding of Higher Level of Azolla

LEVEL OF AZOLLA Extensive Production Intensive Production

Pure Commercial Feeds 3.276 2.472 65% Commercial feeds+35% Azolla 3.128 2.861 45% Commercial feeds+55% Azolla 3.256 2.967 25% Commercial feeds+75% Azolla 3.307 3.128

Feed Consumption and Feed Conversion Ratio

Production System. Results showed that the feed consumption of ducks regardless of production type were comparable (p>0.05). However, feed conversion ratio (FCR) among Pekin ducks raised under extensive production were more efficient (p<0.05) in converting feeds into meat than ducks raised intensively (Table 4). Results can be associated with the heavier (p<0.05) weights of Pekin ducks raised under an extensive type of production.

65

However, Taaroa (2013) and Minh (2005) reported that the growth performance of birds either reared in extensive (free range or scavenger) or intensive (pure confinement) has comparable body weights, ADG and FCR. Table 4 Feed Consumption and Feed Conversion Ratio of Pekin Duck as Affected by Type of Production System

TYPE OF PRODUCTION FEED CONSUMPTION (kg/head)

FEED CONVERSION Ratio

Extensive 5.156ᵃ 1.684ᵇ

Intensive 5.153ᵃ 1.944ᵃ


Level of Azolla. Findings revealed that the feed consumption of ducks regardless of the level of Azolla in the duck’s dietary ration were comparable (p>0.05). Conversely, analysis of the FCR showed that Pekin ducks fed with Azolla were more efficient (p<0.05) in converting feeds into a kilogram of meat (Table 5). These results can be associated with the heavier (p<0.05) weights of ducks fed with Azolla. Also, findings can be due to the higher protein content of Azolla and lysine which is an essential amino acid, thus potential nutrient supplement and growth enhancer (Tran, 2015; Hasan et al., 2009; Pillai et al., 2002).

In addition, results confirmed the findings reported by

several researchers (Tran, 2015; Norwan, 2015; Balaji et al., 2010; Namra et al., 2010; Millward, 2010; Balaji et al., 2009; Lumpkin et al., 2003; Taaroa, 2013; and Minh, 2005), who reported that broilers fed with (15-30%) either fresh and/or dried Azolla have high growth performance with higher body weights, ADG and FCR. Table 5 Feed Consumption and Feed Conversion Ratio of Pekin Duck as Affected by Feeding of Higher Level of Azolla

LEVEL OF AZOLLA

FEED CONSUMPTION (kg/head)

FEED CONVERSION Ratio

Pure Commercial Feeds 5.208ᵃ 1.975ᵃ 65% Commercial feeds+35% Azolla 5.197ᵃ 1.855ᵃᵇ

45% Commercial feeds+55% Azolla 5.113ᵃ 1.743ᵇ

25% Commercial feeds+75% Azolla 5.100ᵃ 1.683ᵇ


66

Interaction of Production System and Level of Azolla. The analysis showed that regardless of product type and level of Azolla in the dietary ration, feed consumption was comparable (p>0.05). However, findings on the FCR as affected by production type and feeding Azolla showed a significant effect. Moreover, Pekin ducks raised under extensive production system fed with the highest level of Azolla (75% Azolla in the dietary ration) had the most efficient FCR with 1.613 (Table 6).

These findings can be attributed to the high crude protein

content of Azolla (Cagauan et al., 2000 and Pillai et al., 2002) and other nutrients like lysine (essential amino acid) that enhance nutrient absorption (Mishra et al., 2016) that consequently improves the efficiency of the ducks to convert feeds into meat. In addition, results confirmed the findings reported by several researchers (Tran, 2015; Norwan, 2015; Balaji et al., 2010; Namra et al., 2010; Millward, 2010; Balaji et al., 2009; Lumpkin et al., 2003; Taaroa, 2013; and Minh, 2005) who reported that broilers fed with (15-30%) either fresh and/or dried Azolla has high growth performance with higher body weights, ADG and FCR. Moreover, the favorable effect of raising ducks on their natural environment offered comfort due to exposure to fresh air and sunshine (Blokhuis et al., 2000), free access to water and other feedstuffs that might help the birds cope with heat stress by improving the heat dissipation capacity through peripheral blood and evaporation (Belay and Teeter, 1993; Zhou et al., 1999; Reece, 2004), thus relaxed the animals which consequently reduced the incidence of stress and contributes to the efficiency to convert feeds into kilogram of meat. Table 6 Feed Conversion Ratio of Pekin Duck as Affected by the Interaction of Type of Production System and Feeding of Higher Level of Azolla

LEVEL OF AZOLLA Extensive Production Intensive Production

Pure Commercial Feeds 1.683 2.267

65% Commercial feeds+35% Azolla 1.770 1.940



67

Shank and Beak Color

Production System. Observation using the 5-hedonic scale and analysis revealed that regardless of the production system, the color of the shank and beak of Pekin ducks were similar (p>0.05) with 4.208-4.238 which was light orange to dark orange. There was no direct study regarding the effect of production system on the shank and beak color of Pekin duck. However, results can be associated with the favorable effect of raising the ducks freely on their natural environment that provides comfort due to exposure to fresh air and sunshine (Blokhuis et al., 2000). Also, there was free access to water and other feedstuffs that might have helped the birds cope with heat stress by improving the heat dissipation capacity through peripheral blood and evaporation (Belay and Teeter, 1993; Zhou et al., 1999; Reece, 2004), thus relaxes the animals which consequently reduces the incidence of stress. Table 7 Shank and Beak Color of Pekin Duck as Affected by Type of Production System

TYPE OF PRODUCTION Shank and Beak Color (based on 5-hedonic scale)

Extensive 4.238ᵃ

Intensive 4.204ᵃ

Means within column having similar superscripts are not significantly different (p>0.05).

Level of Azolla. The analysis revealed that the shank and

beak color of ducks regardless of the level of Azolla in the duck’s dietary ration significantly enhanced its orange color (p<0.05, 4.200-4.483) than ducks not fed with Azolla (Table 8). There is no direct study regarding the effect of Azolla on the shank and beak color of Pekin duck. However, the results can be associated with the significantly (p<0.05) lower blood cortisol (Table 10) that can be attributed to the high crude protein content of Azolla (Cagauan et al., 2000 and Pillai et al., 2002) and other nutrients like lysine (essential amino acid) that enhance nutrient absorption (Tran, 2015; Hasan et al., 2009; Pillai et al., 2002); combats heat stress and can have favorable immune-modulatory effect in poultry without any toxicity (Mishra et al., 2016) that consequently enhances the color of the shank and beak.

68

Table 8 Shank and Beak Color of Pekin Duck as Affected by Feeding of Higher Level of Azolla

LEVEL OF AZOLLA Shank and Beak Color (based on 5-hedonic scale)

Pure Commercial Feeds 3.950ᵇ

65% Commercial feeds+35% Azolla 4.200ᵃᵇ

45% Commercial feeds+55% Azolla 4.250ᵃ

25% Commercial feeds+75% Azolla 4.483ᵃ


Blood Cortisol and Lipid Profile

Production System. The analysis revealed that the blood cholesterol, high density lipoprotein (HDL), low-density lipoprotein, and triglycerides of Pekin ducks, regardless of a production system were comparable (p>0.05). On the other hand, blood cortisol of ducks raised under extensive production had significantly lower (p<0.05) blood cortisol level compared to ducks raised intensively (Table 9). Results may be probably due to the favorable effect of raising the ducks freely on their natural environment that provides comfort due to exposure to fresh air and sunshine (Blokhuis et al., 2000), free access to water and other feedstuffs that might help the birds cope with heat stress by improving the heat dissipation capacity through peripheral blood and evaporation (Belay and Teeter, 1993; Zhou et al., 1999; Reece, 2004), thus relaxes the animals which consequently reduces the incidence of stress and cortisol level. Table 9 Blood Cortisol and Blood Lipid Profile of Pekin Duck as Affected by Type of Production System

TYPE OF PRODUCTION

CORTISOL TOTAL CHOLESTEROL

HDL LDL TRIGLYCERIDES

Extensive 7.533ᵇ 3.773ᵃ 2.145ᵃ 1.254ᵃ 0.323ᵃ

Intensive 13.758ᵃ 3.790ᵃ 2.179ᵃ 1.213ᵃ 0.301ᵃ


Level of Azolla. Findings revealed that the blood cortisol of

ducks fed with 55% Azolla had significantly lower blood cortisol

69

(p<0.05) to that of the cortisol level of ducks fed with pure commercial feeds and ducks fed with 35% and 75% Azolla. Also, ducks fed with Azolla, regardless of proportion had significantly higher (p<0.05) HDL (good cholesterol) than the ducks fed with pure concentrate. Moreover, ducks fed with 75% Azolla had significantly lower (p<0.05) LDL (bad cholesterol) and triglycerides. On the other hand, the analysis showed that the total cholesterol was comparable among ducks with or without the inclusion of Azolla in the dietary ration.

Results can be attributed to the high crude protein content

of Azolla (Cagauan et al., 2000 and Pillai et al., 2002) and other nutrients like lysine (essential amino acid) that enhance nutrient absorption, can combat heat stress and had favorable immune-modulatory effect in poultry without any toxicity (Mishra et al., 2016) that consequently lower the level of blood cortisol. Likewise, results were in line with the findings of Bhattacharyya et al., (2016) who stated that Azolla supplementation has significantly (P<0.05) lower bad cholesterol (LDL) while increasing good cholesterol (HDL) which results in reduced triglycerides. Table 10 Blood Cortisol and Blood Lipid Profile (mg/dL) of Pekin Duck as Affected by Feeding of Higher Level of Azolla

TYPE OF PRODUCTION

CORTISOL

TOTAL CHOLESTEROL

HDL

LDL

TRIGLYCERIDES

Pure Commercial Feeds

16.333ᵃ 3.907ᵃ 2.003ᵇ 1.460ᵃ 0.400ᵃ

65% Commercial feeds+35% Azolla

15.167ᵃ 3.841ᵃ 2.101ᵃᵇ 1.276ᵇ 0.339ᵃ


4.867ᶜ 3.714ᵃ 2.323ᵃ 1.160ᶜ 0.256ᵇ


6.215ᵇ 3.637ᵃ 2.222ᵃᵇ 1.032ᵈ 0.254ᵇ


Interaction of Production System and Level of Azolla.

Findings on the blood cortisol as affected by production type and feeding Azolla showed beneficial and significant effect (p<0.05). Pekin ducks fed with 55% of Azolla in the dietary ration has the least blood cortisol content (3.800 mg/dL) that was raised under extensive

70

production (Table 11). On the other hand, analysis showed that the lowest LDL (bad cholesterol) was noted in ducks raised intensively and was provided with 75% Azolla with LDL content of 0.833 mg/dL (Table 12).

Findings can be attributed to the high crude protein content

of Azolla (Cagauan et al., 2000 and Pillai et al., 2002) and other nutrients like lysine (essential amino acid) that enhances nutrient absorption that can combat heat stress and had favorable immune-modulatory effect in poultry without any toxicity (Mishra et al., 2016) that consequently lower the level of blood cortisol and lowers bad cholesterol. Results were in line to the findings of Bhattacharyya (2016) who reported that Azolla supplementation has significantly (p<0.05) lower bad cholesterol (LDL) while increasing good cholesterol (HDL) which result in reduced triglycerides in both confined and free-range birds.

Table 11 Blood Cortisol (mg/dL) as Affected by the Interaction of Type of Production System and Feeding of Higher level of Azolla

TYPE OF PRODUCTION EXTENSIVE INTENSIVE

Pure Commercial Feeds 11.000 21.667 65% Commercial feeds+35% Azolla 10.000 20.333

45% Commercial feeds+55% Azolla 3.800 5.933 25% Commercial feeds+75% Azolla 5.333 7.079


Table 12 LDL as Affected by the Interaction of Type of Production System and Feeding of Higher Level of Azolla

TYPE OF PRODUCTION EXTENSIVE INTENSIVE

Pure Commercial Feeds 1.453 1.467

65% Commercial feeds+35% Azolla 1.250 1.301 45% Commercial feeds+55% Azolla 1.119 1.201 25% Commercial feeds+75% Azolla 1.181 0.883


Organoleptic Properties

Production System. Findings revealed that the texture, odor, juiciness, flavor, and general acceptability of duck meat regardless of production systems were comparable (p>0.05). Results also showed

71

that the meat color of Pekin duck raised under extensive production system has yellower meat (4.167) that is significantly higher (p<0.05) than the meat color of Pekin duck raised intensively (3.767). In contrast, the meat of Pekin duck raised under intensive production system has significantly tender (p<0.05) meat than that of ducks raised extensively (Table 13).

Significant effects of production system on the meat color

can be associated with the fact that ducks raised extensively were exposed to the natural environment. It provided comfort through fresh air, sunshine, and access to water and other feedstuffs (grasses) that may improve and relaxes the ducks (Blokhuis et al., 2000), hence reduced stress and consequently enhanced the color quality of the meat. On the other hand, tougher meat of ducks raised extensively can be attributed to muscles and other parts of duck’s body utilized in the movement for running, eating and other activities.

Table 13 Organoleptic Properties of Pekin Duck as Affected by Type of Production System

TYPE OF PRODUCTION

COL TEX TEN ODO JUI FLV GEN

Extensive 4.167ᵃ 3.752ᵃ 3.925ᵇ 3.825ᵃ 4.185ᵃ 4.325ᵃ 4.175ᵃ

Intensive 3.767ᵇ 3.758ᵃ 4.133ᵃ 3.808ᵃ 4.055ᵃ 4.208ᵃ 4.158ᵃ


Legend: COL –color; TEX –texture; TEN –tenderness; ODO –odor; JUI –juiciness; FLV –flavour; GEN – general acceptability.

Level of Azolla. Findings revealed that the texture,

tenderness, and odor of duck meat were comparable (p>0.05) and are not affected by feeding Azolla. On the other hand, findings revealed that color, juiciness, flavor, and general acceptability of duck meat provided with Azolla in the dietary ration were significantly enhanced.

These results can be associated with the higher digestibility

rate of Azolla due to its high protein but low lignin content, essential minerals like iron, calcium, magnesium, phosphorus, copper, manganese, magnesium, bio-active substances and bio-polymers

72

12,14,16. Azolla also has appreciable quantities of vitamins A and vitamins B12, and chlorophyll, and contains almost all the essential amino acids like lysine, many probiotics, Biopolymers and B carotene (Norman, 2015; Ndegwa,2015; Norman,2015; Prasanna, 2010; Tran, 2015; Hasan et al., 2009; Pillai et al., 2002) that may enhance feed intake that consequently improves the meat quality in terms of the color, flavor, juiciness and general acceptability of ducks fed with Azolla. Table 14 Organoleptic Properties of Pekin Duck as Affected by Feeding of Higher Level of Azolla

TYPE OF PRODUCTION

COL TEX TEN ODO JUI FLV GEN

Pure commercial Feeds

3.617b 3.567a 3.900a 3.750a 3.500b 3.933b 4.000b

65% Commercial feeds + 35% Azolla

3.933ab 3.867a 3.883a 3.750a 4.067a 3.983b 4.033b


4.100ab 3.817a 4.000a 3.850a 4.433a 4.583a 4.350a


4.217a 3.567a 4.083a 3.917a 4.500a 4.567a 4.283a


Legend: COL –color; TEX –texture; TEN –tenderness; ODO –odor; JUI –juiciness; FLV –flavour; GEN – general acceptability.

Economics

Production system. Results showed that ducks raised under extensive production system had significantly higher (p<0.05) income per head and return on investment. This can be attributed to the heavier weights (p<0.05) of ducks and efficient conversion of feeds into kilogram of meat. Table 15 Economics of Raising Pekin Duck as Affected by Type of Production System

TYPE OF PRODUCTION INCOME PER HEAD RETURN ON INVESTMENT

Extensive 56.466a 78.738a Intensive 43.311b 60.248b


73

Level of Azolla. The analysis revealed that raising ducks fed with Azolla regardless of the level had significantly (p<0.05) higher income per head and return on investment compared to ducks fed with pure commercial feeds. These results can be associated with lower total feed cost and suggest that Azolla can be used as a potential alternative protein source as a substitute to expensive protein source like soybean.

In addition, results can be attributed to the higher

digestibility rate of Azolla due to its high protein but low lignin content, essential minerals and amino acid lysine and probiotics (Ndegwa, 2015; Norman, 2015; Prasanna, 2010; Tran, 2015; Kathirvelan et al., 2015; Hasan et al., 2009; Pillai et al., 2002) that consequently enhances feed intake and improves growth performance, which increase profit margin. Table 16 Economics of Raising Pekin Duck as Affected by Feeding of Higher Level of Azolla

LEVEL OF AZOLLA INCOME PER HEAD RETURN ON INVESTMENT

Pure commercial Feeds 33.581b 56.328b 65% Commercial feeds + 35% Azolla

51.657a 68.655ab


55.003a 73.644a


59.131a 79.345a


Conclusions Results show that ducks raised under extensive production system significantly (p<0.05) improved the final body weight and feed conversion ratio; lowers blood cortisol and had enhanced meat color but are tougher than the ducks raised intensively. Moreover, Pekin ducks raised under extensive production has significantly (p<0.05) higher income per head and return on investment. Likewise, feeding Azolla also significantly (p<0.05) improved the final body weight and feed conversion ratio; enhanced the color of the beak and shank, meat color, juiciness, flavor, and general acceptability; lowers

74

the cortisol, LDL (bad cholesterol) and triglycerides but increases the HDL (good cholesterol); and significantly (p<0.05) increased the income per head and ROI. Furthermore, the interaction of the extensive production system and feeding 55-75% Azolla in Pekin duck ration significantly (p<0.05) affected the final body weight, feed conversion ratio, blood cortisol level, and LDL content.

Literatures Cited Balaji, K., Jalaludeen, A., & Kannan, A. (2010) Effect of dietary Azolla on cholesterol

content in broiler chicken. Indian Vet. Journal, 87(5), 478-480. Blokhuis, HJ., Ekkel, ED., Korte, SM., Hopster, H., & Van Reenen, C.G. (2000). Farm

animal welfare research in interaction with society. PubMed. Vet. Q. 22:217-222.

Kathirvelan, S. Banupriya, C., & Purushothaman, M.R. (2015). Alternate and sustainable

feed for livestock. International Journal of Science, Environment and Technology. 4(4,) 1153 – 1157.

Lambio, A. (2010). Poultry production in the tropics. University of the Philippines Los

Baños, Laguna, Philippines: University Publication Office. P. 103. Minh, D. V. (2005) Effect of supplementation, breed, season and location on feed

intake and performance of scavenging chickens. Swedish University of Agricultural Sciences. ISSN 1652- 6880 ISBN91-576-6900-7.

Namra, M.M.M., N.A. Hataba & Hala M. Abdel Wahed. (2010). The productive

performance of growing fayoumi chicks fed restricted diets supplemented with free fresh Azolla. Animal Prod. Inst., Agric. Research Center, Ministry of Agriculture. Egypt. Poult. Sci., 30 (III), 747-762.

Ndegwa, O. (2015) Diversify your livestock feeds with Azolla. Retrieved on October 3,

2017 from http://ea-agribusiness.co.ug/diversify-your-livestock-feeds-with-azolla/.

PCAARRD. (2012) Industry status of chicken. Retrieved December 14, 2017, from

http://www.pcaarrd.dost.gov.ph/home/momentum/poultry/index.php?option=com_ content&task=view&id=76&Itemid=110.

Pillai, S. P., & Rajamony, S. (2002). AZOLLA – A sustainable feed substitute for livestock.

Leisa India. Taaroa, E. (2013) Azolla Feeding. Retrieved September 2017, from

http://www.punachicksfarm.com/2013/04/azolla-feeding-trial-results.html

75

META-ANALYSIS OF DIFFERENT PREDICTION MODELS ON THE WEIGHT

ESTIMATION OF GOATS USING EXTERNAL BODY MEASUREMENTS

Irene F. Almazan

Nora C. Cabaral Mindoro State College of Agriculture and Technology

ABSTRACT

The study was conducted to validate seven prediction models from several publications on the weight estimation of goats using meta-analysis. The experiment followed a 2x8 factorial experiment in a Completely Randomized Design. Differences of means between sex and prediction models were analyzed using Scheffe’s test. Analysis revealed comparable actual body weight (ABW), body length (BL) and heart girth (HG) among 113 goats studied regardless of sex and breed. Heart girth had the highest degree of correlation (r=0.966) while BL has a degree of correlation of r=0.703 to ABW. Estimated weights using prediction models 3 and 7 were comparable to ABW of males, females and weight regardless of sex. Prediction model 5 was significantly higher while prediction models 1,2,4 and 6 are significantly lower to the ABW. Regardless of sex, prediction models 3 and 7 can be used by smallhold goat raisers as an alternative way to estimate weights of goats during marketing to minimized profit losses. However, comparative analysis revealed that prediction model 7(BW,kg=-53.061+1.120*HG,cm) is more accurate/precise in relation to ABW, hence conversion tables were made for easy dissemination and utilization by farmers during actual marketing. Findings serve as empirical data to study goat’s DNA for HG (marker-assisted-selection) for conservation or improvement due to its strong correlation to ABW. Keywords: Meta-analysis, prediction models, weight estimation, heart girth, correlation, body length

76

Introduction ody weight of an animal is essential to maximize profits, determine the dosage level of drugs and the amount of feed to be given to the animal (Perez et al., 2016). In countries where the sale price is based on weight, live weight has a direct relation to the profitability of the

enterprise (Abegaz and Awgichew, 2009). Marketing of goats is based primarily on actual body weight, and this requires the use of weighing scales. Properly calibrated livestock scales are the most accurate and consistent method for determining body weight (Abegaz and Awgichew, 2009). However, majority of farmers engaged in the production of goats do not have access to weighing scales due to high cost. Weighing scales are also difficult to use in the field especially if the animals are uncooperative (Perez et al., 2016). Goat raisers can rely on the estimation of body weight using certain body measurements which can be measured readily (Alade et al., 2008). Estimation techniques are already investigated in pigs (Murillo and Valdez 2004; Walugembe et al., 2014), cattle (Bagui and Valdez, 2007; PCAARD, 2002) and horses (Marante et al., 2009; Macatangay and Valdez, 2002). Estimating live weight using body measurements is practical, faster, easier and cheaper in the rural areas where the weighing scales are usually non-existent (Tsegaye et al., 2013).

Estimation must be close to the actual live weight as possible to maximize profits and avoid over and under dosing of medication (Perez et al., 2016). The most common parameters used for body measurements are: head length, head depth, frontal width, ear length, body length, withers height, rump height, body depth, heart girth, width at withers, shank circumference, tail length and width (Gurcan, 2000). However, using many body measurements to predict live weight is not simple and easy process. The least parameters used, the easiest practice is done. The less body parameters used the easier result were obtained (Pesmen and Yardimci, 2008). Although all the linear measurements can give an estimation of the animal live weight, yet it has been shown in many studies (Atta and El Khidir, 2004; Hassan and Ciroma, 1990; Koyuncu and Tuncel, 1992; Mohammed et al., 1996; Ozturk et al., 1994; Tuncel, 1982; Valdez et al., 1982; Yarkin et al., 1961) that heart girth is most appropriate and confident parameter in live weight estimations for sheep and goats. Ozturk et al., (1994) stated that heart girth was most appropriate parameter in

B

77

predicting the live weight using only one parameter in Konya Merino but in case of using two parameters body length and heart girth were found to be the most convenient parameters.

Therefore, there is a need of using simple method in weight

estimation where weighing scales are not readily available. The accuracy of functions used to predict live weight from body measurements is of immense financial contribution to livestock production enterprises. The ability of the animal producer and buyers to relate live weight through body measurements using simple method is an essential factor for better productivity and value-based trading systems. This ability would also adequately reward animal raisers rather than the middlemen that tend to gain more profit in livestock production business, especially in the developing countries (Parés et al., 2012). Moreover, several studies on various prediction models on weight estimation on goats are already published and are available for utilization (Mohammed and Amin, 1997; Thiruvenkadan, 2005; Adeyinka & Mohammed, 2006; Slippers et al., 2000; Nsoso, 2003; Cam et al., 2010; Mahieu et al., 2011) however its reliability, application on farmer’s level and its validation is not yet implemented. Thus, this prompted the researcher to conduct the study.

Materials and Methods Materials 1. 113 heads of goats (6 months up to 2 years of age) 2. tailor measuring tape 3. hanging type of weighing scale 4. calculator 5. record book 6. pen 7. dummy table Methods Experimental Design A 2x8 factorial experiment in a Completely Randomized Design (CRD) was used in the study. Sex was assigned as factor A and prediction model including the ABW as factor B. A total of 113 goats weighing

78

between 20-50 kilograms with apparently normal body condition were used in the study. Table 1 Correlation of Estimated Live Weight of Goats with Actual Live Weight Values Using Different Predictor Models from Different Authors and Publications

Source of Estimator Formula Formula of Estimate Live

Weight of Goats

Correlation, R

Pesmen andYardimci, 2008) -137.118 + 1.242*HG + 0.718*BL 0.94

Pesmen andYardimci, 2008) -100.084 + 1.698*HG 0.89

Tesfaye, 2008 -30.770 + 0.820*HG 0.87

Tesfaye, 2008 -23.420+0.670*HG 0.83

Perez et al.,2016) -50.804 + (HG*0.750) + (BL*0.4716)

0.81

Pesmen andYardimci, 2008) -59.363 + 0.848*HG + 0.287*BL 0.78

Pesmen andYardimci, 2008) - 53.061 + 1.120*HG 0.71

Factor A (Sex) A1 – Male A2 – Female Factor B (Prediction Models) B1–Actual Body Weight (kg) B2–PM1=BW,kg = -137.118 + 1.242*HG (cm) + 0.718*BL(cm)(Pesmen

and Yardimci, 2008); B3–PM2=BW,kg = -100.084 + 1.698*HG (cm) (Pesmen and Yardimci,

2008); B4–PM3=BW,kg = -30.770 + 0.820*HG (cm) (Tesfaye, 2009). B5–PM4=BW,kg = -23.420+0.670*HG (cm)(Tesfaye, 2009). B6–PM5=BW,kg = -50.804 + (HG (cm)*0.750) +(BL (cm) *0.4716)

(Perez et al., 2016); B7–PM6=BW,kg = -59.363 + 0.848*HG (cm) + 0.287*BL(cm)(Pesmen

and Yardimci, 2008) B8–PM7= BW,kg = - 53.061 + 1.120*HG (cm) (Pesmen and Yardimci,

2008);

79

Table 2 Treatment Combination Used in the Study

FACTOR A (Sex)

FACTOR B (Actual Body Weight and Prediction Model)

B1 B2 B3 B4 B5 B6 B7 B8

A1 A1B1 A1B2 A1B3 A1B4 A1B5 A1B6 A1B7 A1B8

A2 A2B1 A2B2 A2B3 A2B4 A2B5 A2B6 A2B7 A2B8

Legend: A1 – Male; A2 – Female; B1 – Actual body weight; B2 = -137.118 + 1.242*HG + 0.718*BL, B3 = -100.084 + 1.698*HG, B4 = = -30.77 + 0.82*HG, B5 = -23.42+0.67*HG, B6 = -50.804 + (HG*0.750) + (BL*0.4716), B7 -59.363 + 0.848*HG + 0.287*BL, B8 = - 53.061 + 1.120*HG

Experimental Animal

A total of 113 adult mixed breed goats from different municipalities of Oriental Mindoro were used for the weight estimation of goats using external body measurements (i.e., body length and heart girt). Marketable ages of goats were usually 6 to 8 months old (i.e., age of puberty, sold as replacement stock and for slaughter) therefore linear body measurement as predictors for body weight estimation was applied (Sevilla, 2015). A hanging type weighing scale (with capacity of up to 100 kilograms) was used to determine the actual body weight (ABW), while tailor measuring tape were used to obtain the needed body measurements (in centimetre). Specific body measurements (cm) included: body length (BL) from base of the tail to the base of the neck and heart girt (HG) the tailor measuring tape encircles the animal just behind the withers on the top and just behind the elbow on the bottom. Data Gathered

1. Body length (BL). BL can be measured as the distance from the base of the ear to the base of the tail (where it joins the body). It can also be measured as the distance from base of tail to the base of the neck (first thoracic vertebrae), or to front of the chest or to tip of the nose. Extreme care is needed to ensure that the backbone is straight in both vertical and horizontal planes.

80

2. Heart girth (HG). It refers to the circumferential measure

taken around the chest just behind the front legs and withers. The measurement should be taken to the nearest 0.5 cm. HG is a highly repeatable measure though it does vary somewhat with extremes of posture and perhaps as the animal breaths.

3. Actual weight using hanging type of weighing scale. A hanging type of weighing scale (with capacity of up to 100 kilograms) was used to determine the actual body weight [ABW]. The weighing scale was checked and calibrated before each procedure was done.It was also made sure that the goats have secure handle or attachment for lifting. In cases where the goat is difficult to handle, appropriate restraint technique was applied. This was done in the morning between 7 am - 9am before feeding time.

4. Estimated weight using the 7 prediction models PM1= BW,kg = -137.118 + 1.242*HG (cm) + 0.718*BL (cm) (Pesmen and

Yardimci, 2008); PM2=BW,kg= -100.084 + 1.698*HG (cm) (Pesmen and Yardimci, 2008);

PM3=BW,kg = -30.77 + 0.82*HG(cm) (Tesfaye, 2008). PM4=BW,kg = -23.42+0.67*HG (cm) (Tesfaye, 2008). PM5=BW,kg = -50.804 + (HG (cm)*0.750) + (BL (cm)*0.4716) (Perez et

al.,2016); PM6=BW,kg = -59.363 + 0.848*HG (cm) + 0.287*BL (cm) (Pesmen and

Yardimci, 2008); and PM7=BW,kg = - 53.061 + 1.120*HG (cm) (Pesmen and Yardimci, 2008)

A simple chart that indicates prediction model with highest reliability that correlate with actual body weight was developed and used by farmers in their marketing, feeding and veterinary services in goats. Statistical Analysis All data were analyzed using analysis of variance (ANOVA) following the 2x8 factorial experiments in Completely Randomized Design while Scheffe’s Test was used to determine the significant

81

differences between and across treatments. Statistical significance was set at p≤0.05 for all statistical tests. Linear relationship between different external body measurements in the prediction of weight of goats were analyzed using the correlation of the SAS Software. The degree of correlation was categorized into 4 levels: high correlation coefficient (r) ≥ 0.60, moderate (0.60 > r ≥ 0.30), low (r < 0.30), and non-significant (P>0.05).

Results and Discussion The study was conducted to validate different prediction models from several publications (Pesmen & Yardimci, 2008; Perez et al., 2016; Abegaz and Awgichew, 2009) on the weight estimation of goats using meta-analysis. The study included Boer, Anglo-Nubian, Saanen, Upgraded and Philippine Native goats since it is the genotypes available in Oriental Mindoro. In addition, correlation analysis of the actual body weight against the two body measurement considered in the study (i.e., body length and heart girth) was also determined. Moreover, analysis on the significant effect of age and to ascertain the best and appropriate prediction model was also conducted to recommend it for dissemination and application to the actual farm operation for the smallhold goat raisers, especially during marketing and drug administration. Actual Body Weight The data set for various body measurements (i.e., body length and heart girth) and actual body weight included 113 goats (49 males and 64 females) which were weighed 20-50kg.

The mean actual body weight and external body measurements

of various goat breeds are presented in Table 3. Based on the result of the study, analysis revealed comparable (p>0.05) actual body weight, body length and heart girth. However, though comparable, it can also be observed that males are typically larger than female which were observed on the actual body weight, body length, and heart girth of the 113 goats regardless of breeds weighed and measured with 29.032 and 27.469kg, 59.048 and 57.918 cm, and 69.000 and 67.592 cm, respectively. These differences could be due to sex dimorphisms where

82

buck is phenotypically bigger than does at the same physiological age and stage (Mwacharo et al., 2006; Lambio, 2010; Manzi et al., 2011).

Results conformed to the findings reported by Tsegaye et al.,

(2013); Alex et al., (2010); Pesmen and Yardimci (2008); Khan et al., (2006); and Thiruvenkadan (2005) who mentioned that males indeed are heavier and larger than females due to their innate characteristics (i.e., higher growth rate, bigger bone structure). Table 3 Mean Actual Body Weight and External Body Measurements of Goats, Regardless of Breed

BODY MEASUREMENTS MALE (n=49) FEMALE (n=64)

Actual Body Weight, kg 29.032a 27.469a

Body Length, cm 59.048a 57.918a

Heart Girth, cm 69.000a 67.592a

Legend: Means within rows with similar superscripts is not significantly different (p>0.05).

Correlation between Actual Body Weight and External Body Measurements

The correlation between actual body weight and external body measurements of goats weighing 20 to 50 kg is presented in Table 4. Body length and heart girth were highly correlated (r≥0.60; p<0.01) with the actual body weight regardless of sex. In general, there was a positive correlation between the two external body measurements (i.e., body length and heart girth) and actual body weight.

Heart girth had the highest degree of correlation (r=0.966)

with actual body weight while body length has a degree of correlation of r=0.703. This was in line with the findings reported by several researchers (Tsegaye et al., 2013; Pesmen and Yardimci, 2008; Khan et al., 2006; and Thiruvenkadan, 2005) who reported that heart girth and body length of goats, regardless of breeds, were highly correlated with body weight.

Moreover, results also conformed to the findings reported by

other studies (Afolayan et al., 2006; Parés, 2008; Olatunji & Adeyemo, 2009; Alex et al., 2010; Atta and El Khidir, 2004; Hassan and Ciroma, 1990; Koyuncu and Tuncel, 1992; Mohammed et al., 1996; Ozturk et al., 1994;

83

Tuncel, 1982; Valdez et al., 1982; Yarkin et al., 1961) on the weight estimation of goats and different pure breeds and crossbreed goats and sheep that were evaluated. Furthermore, these studies consistently showed that heart girth had the strongest degree of linear relationship with body weight.

Results indicated that heart girth was the best predictor of

actual body weight regardless of sex and breed among all the body measurements used in the study. This result was further supported by Tsegaye et al., (2013) who reported that heart girth explained 93-96% of the total variability in liveweight of goats, regardless of breed and sex (r=0.96 in male and r=0.93 in female). Moreover, several researchers (Tsegaye et al., 2013; Pesmen and Yardimci, 2008; Khan et al., 2006; and Thiruvenkadan, 2005; Afolayan et al., 2006; Parés, 2008; Olatunji & Adeyemo, 2009; Alex et al., 2010; Atta and El Khidir, 2004; Hassan and Ciroma, 1990; Koyuncu and Tuncel, 1992; Mohammed et al., 1996; Ozturk et al., 1994; Tuncel, 1982; Valdez et al., 1982; Yarkin et al., 1961) who reported that heart girth indeed provides the strongest degree of correlation in the actual body weight of the goats. Table 4 Correlation (r) between Actual Body Weight and the Different Body Measurements Used in the Weight Estimation of Goats, Regardless of Breed

BODY MEASUREMENTS (cm) ACTUAL BODY WEIGHT

MALE(N=49) FEMALE(N=64) ALL(N=113)

Body Length 0.856 ±10.828** 0.658±7.822* 0.703±9.246**

Heart Girth 0.989±12.411** 0.871±9.570** 0.966±10.869**

Legend: * - significant (p<0.05); ** - highly significant (p<0.01).

Meta-analysis of Various Prediction Models for Weight Estimation of Goats

Prediction equations were developed by several researchers (Tsegaye et al., 2013; Pesmen and Yardimci, 2008; Khan et al., 2006; and Thiruvenkadan, 2005; Afolayan et al., 2006; Parés, 2008; Olatunji & Adeyemo, 2009; Alex et al., 2010) that can estimate actual body weight of various goat gene pool weighing between 20 to 50 kg and thus meta-analysis of these prediction models is a need for proper

84

dissemination, utilization and application in the farmer’s level, especially to smallhold raisers.

A total of seven (7) prediction equations were used in the computation of estimated weight of goat genotypes as presented in Table 5. In general, computed and estimated weights using prediction models 3 and 7 were comparable (p>0.01) to the actual body weight of males, females and overall weight regardless of sex among goat breeds used in the study. On the other hand, prediction model 5 (males, females and combination of males and females) were significantly higher (p<0.01) to the actual body weight which is in contrast to the prediction models 1, 2, 4 and 6 which is significantly lower (p<0.01) compared to the actual body weight of goats. Table 5 Actual and Estimated Body Weight (kg) of Goats on Different Prediction Model, Regardless of Breed

WEIGHT PREDICTION MODEL MALE (N=49) FEMALE (N=64) ALL (N=113)

Actual Weight 25.117ab 23.949ab 24.611ab

PM1 = -137.118 + 1.242*HG (cm) + 0.718*BL (cm) -7.519e -10.764c -8.926d

PM2 = -100.084 + 1.698*HG (cm) 17.847cd 15.207b 16.702c

PM3 = -30.77 + 0.82*HG(cm) 26.182ab 24.906ab 25.629ab

PM4 = -23.42+0.67*HG (cm) 23.114bc 22.072ab 22.662b

PM5 = -50.804 + (HG (cm)*0.750) + (BL (cm)*0.4716 29.751a 27.723a 28.872a

PM6 = -59.363 + 0.848*HG (cm) + 0.287*BL (cm) 16.856d 15.013b 16.057c

PM7 = -53.061 + 1.120*HG (cm) 24.727ab 22.985ab 23.971ab

Means within column with different superscripts are significantly different (p<0.01).

Results (Table 5) of the study reveal that regardless of sex, prediction models 3 (BW, kg = -30.77 + 0.82*HG, cm) and 7 (BW, kg = -53.061 + 1.120*HG, cm) can be used by goat raisers particularly smallholder farmers having no capacity of buying very expensive weighing scales as an alternative way to estimate the weights of goats during marketing to reduced their profit loss. However, comparative analysis between prediction models 3 and 7 revealed that prediction model 7 (Table 6, Appendix Tables 9-11) is the best prediction model that can be utilized by smallholder farmers to estimate the actual body weight of goats regardless of sex and breed, weighing between 20 to 50 kg since only the heart girth

85

needs to obtained by the farmer prior to marketing. Furthermore, conversion tables using prediction model 7 were made for easy dissemination of the results and can utilization by farmers in the field during marketing (Table 7). Table 6 Actual and Estimated Body Weight (kg) of Goats Using Prediction Models 3 and 7, Regardless of Breed

WEIGHT PREDICTION MODEL MALE (N=49) FEMALE (N=64) ALL (N=113)

Actual Weight 25.117b 23.949b 24.611b

PM3 = -30.77 + 0.82*HG(cm) 26.182a 24.906a 25.629a

PM7 = -53.061 + 1.120*HG (cm) 24.727b 22.985b 23.971b

Means within column with different superscripts are significantly different (p<0.01).

Table 7 Conversion Table with Estimated Body Weight (kg) of Goats Using Heart Girth and Prediction Model 7

HG (cm) EBW (kg) HG (cm) EBW (kg)

49 1.82 74 29.82 50 2.94 75 30.94 51 4.06 76 32.06 52 5.18 77 33.18 53 6.30 78 34.30 54 7.42 79 35.42 55 8.54 80 36.54 56 9.66 81 37.66 57 10.78 82 38.78 58 11.90 83 39.90 59 13.02 84 41.02 60 14.14 85 42.14 61 15.26 86 43.26 62 16.38 87 44.38 63 17.50 88 45.50 64 18.62 89 46.62 65 19.74 90 47.74 66 20.86 91 48.86 67 21.98 92 49.98 68 23.10 93 51.10 69 24.22 94 52.22 70 25.34 95 53.34 71 26.46 96 54.46 72 27.58 97 55.58 73 28.70 98 56.70

86

Results further proved and showed valid evidence that actual body weight of goats has strong correlation to the heart girth and considered as the best predictor of actual body weight regardless of sex and breed among all the body measurements used in the study since PM 7 include HG in the equation. Furthermore, these results were supported by several researchers (Tsegaye et al., 2013; Pesmen and Yardimci, 2008; Khan et al., 2006; and Thiruvenkadan, 2005; Afolayan et al., 2006; Parés, 2008; Olatunji & Adeyemo, 2009; Alex et al., 2010; Atta and El Khidir, 2004; Hassan and Ciroma, 1990; Koyuncu and Tuncel, 1992; Mohammed et al., 1996; Ozturk et al., 1994; Tuncel, 1982; Valdez et al., 1982; Yarkin et al., 1961) who reported that heart girth was the strongest degree of correlation in the actual body weight of goats.

Conclusions The findings of the study led to the following conclusions:

1. External body measurements (i.e. body length and heart girth) especially HG could be used to estimate actual body weight of goats regardless of sex and breed, weighing between 20 to 50 kg because of the strong degree of correlation (r=0.966).

2. Prediction models 3 (BW, kg = -30.77 + 0.82*HG, cm) and 7

(BW, kg = -53.061 + 1.120*HG, cm) could be used by goat raisers particularly smallhold farmers having no capacity of buying very expensive weighing scales as an alternative way to estimate the weights of goats during marketing to reduce their profit loss.

3. Prediction model 5 (males, females and combination of males and females) was significantly higher to the actual body weight which is in contrast to the prediction models 1, 2, 4 and 6 which is significantly lower compared to the actual body weight of goats, hence cannot be used to estimate weight of goats, regardless of sex and breed since the computed weight using these models were far beyond the actual weight.

87

Literatures Cited Abegaz, S., & Awgichew, K. (2009). Estimation of weight and age of sheep and goats. ESGPIP

(Ethiopia Sheep and Goat Productivity Improvement Program). Technical Bulletin (23).

Adeyinka, I.A., & Mohammed, I.D. (2006). Relationship of live weight and linear

bodymeasurement in two breeds of goat of Northern Nigeria. Journal of Animal and Veterinary Advances, 5, 891-893.

Afolayan, R.A., Adeyinka, I.A., & Lakpini, C.A.M. (2006). The estimation of live weight from

body measurements in Yankasa sheep. Czech Journal of Animal.Science., 51 (8): 343–348.

Alex, R., Raghavan, K.C., & Mercey, K.A. (2010). Prediction of body weight of

Malabari goats from body measurements under field conditions. Journal of Veterinary and Animal Sciences. 11:4,30-4

Atta, M.O.A. & El khidir. (2004). Use of heart girth, wither height and Scapuloischial length

for prediction of live weight of Nilotic sheep. Small Ruminant Research. 55(1): 233-237.

Bagui NOJG & Valdez C.A. (2009). Live weight estimation of locally raised adult purebred

Brahman cattle using external body measurements. Philippine Journal Veterinary Medicine, 44(1).

Cam M.A., Olfaz, M. & Soydan E. (2010). Possibilities of using morphometrics

characteristicsas a tool for body weight prediction in Turkish hair goats (Kilkeci). Asian Journal of Animal Veterinary Advances, 5(1), 52-59.

Gurcan, I. S. (2000). Estimation of live weight by statistical methods using body

measurements in Merino sheep. Ankara Üniversity. Health Science Institute. PhD Thesis Ankara (in Turkish, English abstract)

Hassan, A., & Ciroma. A., (1990). Bodyweight measurements relationship in Nigerian Red

Sokoto goats. Department of Animal Science, Usmanu Danfodiyo University, Sokoto, Nigeria.

Khan, H., Muhammad, F., Ahmad, R., Nawaz, G., and Zubair, M. (2006). Relationship of body

weight with linear body measurements in goats. Journal of Agricultural and Biological Science 1 (3), 51-54.

Koyuncu, M. & Tuncel, E. (1992). The relationships between hair characteristics, live weight and body measurements in Anatolian Black Goats. Uludag University

Science Institute. Pub: 20. Macatangay, E., & Valdez C. (2002). Weight determination of Philippine native horses using

external body measurements. Philippine Journal of Veterinary and Animal Sciences. 28 (1),78-88.

Mahieu M., Naves M., & Arquet R. 2011. Predicting the body mass of goats from body

measurements. Livestock Research and Rural Development 23(9).

88

Marante, R.P., Torres, E.B., & Valdez, C.A. (2009). Body weight estimation of local born thoroughbred horses (Equus caballus) using external body measurements. Philippine Journal of Veterinary Medicine 44(2), 114-122.

Mohammed I. D., & Amin J. D. (1996). Estimating body weight from morphometric

measurement of Sahel (Borno White) goats, Small Ruminant Research, 24, 1-5. Murillo, M.C.K.M., & Valdez, C.A. (2004). Body weight measurement in triple weight

estimation cross pigs (Large white-landrace-duroc) using external body measurements. Philippine Journal of Veterinary Medicine, 41, 32-39.

Mwacharo, J.M., Okeyo, A. M., Kamande, G.K., and Rege, E. (2006). The small East African

shorthorn zebu cows in Kenya. Tropical Animal Health and Production, 38(1),65-74.

Nsoso, S.J., Aganga, A.A., Moganetsi, B.P., & Tshwenyane SO. (2003). Body weight, body

condition score and heart girth in indigenous Tswana goats during the dry andwet seasons in southeast Botswana. Livestock Research and Rural Devevelopment, 15(4), Article #32.

Ozturk, A., S.A. Kayis, S.S. Parlat & M. Gurkan, (1994). The possibilities of estimating the live

weight using some body measurements in Konya Merino. Journal of Animal and Research, 4(1), 23-26.

Perez, Z O., Ybañez, A P., Ybañez, R.H. D.and Sandoval, J.F.G. J. (2016). Body weight

estimation using body measurements in goats (Capra hircus) under field condition. Philippine Journal of Veterinary and Animal Science, 42(1), 1-7.

Pesmen G. & Yardimci M. (2008). Estimating the live weight using some body measurements

in Saanen goats. Archiva Zootechnica, 11(4),30-40. Sevilla, C. C. (2015). Development of goat farming in the Philippines. SEAMEO. SEARCA. Univertsity of the Philippines Los Banos Laguna. Slippers, SC, Letty B.A., & De Villiers, JF. (2000). Prediction of the body weight of Nguni

goats. South Africa Journal of Animal Science, 30(4),127-128. Thiruvenkadan, AK. (2005). Determination of best-fitted regression model for estimation of

body weight in Kanni Adu kids under farmer’s management system. Livestock Research and Rural Development, 17, 1-11.

Tuncel, E. (1982). Some hair characteristics and the relationships between live weight and

hair characteristics in Kilis Goats. Ank. Univ. Fac.Agric. Pub. p: 831. Valdez, C.A., D.V. Fagan and I.B. Vicera. 1982. The Correlation of Body Weight to External

Body Measurements in Goats. Dairy Goat J. Publishing Co., Scottsdale, AZ (EUA), 3rd International Conference on Goat Production and Disease, Tuscon, AZ (EUA).

Walugembe M, Nadiope G, Stock J D, Stalder K J, Pezo, D., & Rothschild, M.F. (2014).

Prediction of live body weight using various body measurements in Ugandan village pigs. Livestock Research and Rural Development, 26 (96).

Yarkin, I. & Eker, M. (1961). Studies on some breeding characteristics of Kilis Milk Goats.

Yearbook of the Faculty of Agriculture. pp. 43-152.

89

META-ANALYSIS OF DIFFERENT PREDICTION MODELS ON THE WEIGHT

ESTIMATION OF PHILIPPINE NATIVE PIGS USING EXTERNAL BODY MEASUREMENTS

Nora C. Cabaral Elmar D. Serrano


ABSTRACT

Prediction models (PM) for Philippine native pigs (PhilNP) weight estimation were already published. However, its reliability, proper utilization, application on farmer’s level is not yet investigated, thus determining the accurate method for PhilNP weight estimation using meta-analysis was conducted and validated using 232 heads PhilNP. The experiment followed a 2x8 factorial CRD. Factor A represents the sex while factor B represents the seven (7) PM and the ABW. Scheffe’s Test was used to determine the differences between treatments. Correlation between the ABW and external body measurements of PhilNP was analyzed using the Pearson correlation. Results revealed that males are typically larger than females due to sexual dimorphisms, which were observed on the ABW, BL, FG, and HG of all the PhilNP weighed and measured. The BL (r=0.80;p<0.01) and HG (r=96;p<0.01) were highly correlated with the ABW regardless of sex. On the other hand, FG is moderately correlated (r=0.52;p<0.05) with ABW, regardless of sex. Findings showed that regardless of sex, PM1(BW,kg=-47.57+0.84*HG,cm+0.27*BL,cm);PM2(BW,kg=6.32+0.83*HG,cm+0.27*BL,cm);PM5(BW,kg=35.59+0.95*HG,cm);anPM7(BW,kg=37.60+0.64*HG,cm+0.33*FG,cm) can be used by pig raisers particularly smallholders as an alternative method for PhilNP weight estimation during marketing to reduced their losses. However, results recommended PM5(BW,kg=-35.59+0.95*HG, cm) for faster and easier body weight estimation for PhilNP since only HG requires to be obtained before marketing.

Keywords: Meta-analysis, native pigs, prediction model, weight estimation, heart girth, correlation, body length

90

Introduction mall-scale entrepreneurs in the countryside raised native pigs for they are more resistant to parasites and disease common to other commercially-grown pigs and swine breed and can be managed through family labor and fed with locally available feedstuffs. Also, the growing health-

conscious and high demand for the Philippine native delicacy-lechon, makes the production of native pigs raised organically as one of the booming enterprises in the local swine sector. Moreover, native pigs are known for their unique ability to reproduce and grow even in bad or unfavorable conditions and low-cost production inputs such as housing and feeding.

Marketing pigs in the Philippines is based primarily on actual body weight, and this requires the use of weighing scales. However, majority of farmers engaged in the production of local native pigs do not have access to weighing scales due to the high cost, and many pig raisers rely only on “eyeball” estimation when marketing pigs” (Javier, 2001; Lettiere, 2004; Murillo and Valdez, 2004). Thus, the revenue of hog raisers is compromised, especially when the weight of pigs is underestimated against their actual weight. It is proper and appropriate to develop an accurate method of estimating body weight of the Philippine native pigs, as stated by Lettiere (2004) and Javier (2001).

Moreover, Zaragoza (2009) emphasized that the direct

method of weighing pigs involves physically moving the pigs to a weighing location and placing them on a weighing scale. Several authors (Machebe and Ezekwe, 2010; Mutua et al., 2011; Walugembe et al., 2014; Paras and Cu-Cordoves, 2014; and Suringai et al., 2014) discussed some of its disadvantages and these include requirements for high input of labor, changes in the feed behavior of pigs which might lead to weight loss, stress which at times can lead to death, and injury occurring to the people working with the pigs. In addition to that, the weighing scale may become inaccurate due to the constant physical contact of the machine with the animal and the dirty environment (Murillo, 2004; Beretti 2009; Machebe and Ezekwe, 2010). Several publications on various prediction models on weight estimation on Native pigs are already published and are available for utilization; however, its reliability, application on

S

91

farmer’s level and its validation is not yet implemented. Hence, this study was conducted.

Objectives

The study aimed to determine the (1) accuracy of various weight prediction model in relation to the actual weight of Philippine native pigs; (2) effect of sex in the various weight prediction model in relation to the actual body weight of Philippine native pigs; and (3) evaluate the correlation between actual body weight and the various external body measurements of Philippine native pigs.


The materials used in the study were the following: 1. 232 heads of Philippine Native Pigs (50 males and 182

females), 2. tape measure 3. Calculator 4. weighing scale 5. record book 6. pen

Methods

Experimental Design

A 2x8 factorial experiment in a Completely Randomized design (CRD) was used in the study. Sex was assigned as factor A and prediction model as factor B. Experimental Animal

A total of 232 Philippine native pigs (50 males and 182 females) weighing between 30 to 50 kg with apparently normal body condition was used in the study. Actual body weight of each pig was taken using a typical weighing scale, and the external body measurements (body length, heart girth, and flank girth) was obtained using an ordinary tape measure.

92

All the external body measurements were taken while the pig is in a proper standing position and restrained from any movement to avoid irregularities while taking the measurements. Data Gathered

1. Body length (cm) was measured through the curve of the back from the poll, which is the midway from between the ears up to the base of the tail.

2. Heart girth (cm) is the circumference of the animal’s chest just behind the elbow.

3. Flank girth (cm) was taken as the circumference of the pelvic region just in front of the hip of the pig.

4. Actual weight using weighing scale 5. Estimated weight using the 7 prediction models

PM1= -47.57 + 0.84 * HG(cm) + 0.27 * BL(cm) PM2= -46.32 + 0.83 * HG(cm) + 0.27 * BL(cm) PM3= -39.98 + 1.02 * HG(cm) PM4= -40.18 + 1.02 * HG(cm) PM5= -35.59 + 0.95 * HG(cm) PM6= 0.83 * BL(cm) – 33.53 PM7= -37.60 + 0.64 * HG(cm) + 0.33 * FG(cm)

Statistical Analysis

All data were analyzed using analysis of variance (ANOVA) for a 2x8 factorial experiments in Completely Randomized Design while Scheffe’s Test was used to determine the significant differences between and across treatments. Statistical significance was set at p≤0.05 for all statistical tests.

The linear relationship between different external body

measurements in the prediction of the weight of Philippine Native pigs was analyzed using the correlation of the SAS Software. The degree of correlation was categorized into 4 levels: high correlation coefficient (r) ≥ 0.60, moderate (0.60 > r ≥ 0.30), low (r < 0.30), and non-significant (P>0.05).

93

Results and Discussion Actual Body Weight

The following are the important data gathered by the researchers and the discussion of the results of the study. The data sets for various body measurements (i.e., body length, flank girth, and heart girth) and actual body weight included 232 pig observations (50 males and 182 females) which are weighed 30-50kg.

The mean actual body weight and external body

measurements of Philippine native pigs were presented in Table 2. Based on the result of the study, males were typically larger than females due to sexual dimorphisms which were observed on the actual body weight, body length, flank girth and heart girth of the 232 Philippine native pigs weighed and measured.

Results conform to the data reported by Machebe and

Ezekwe (2010); Mutua et al., (2011); Walugembe et al. (2014); Paras and Cu-Cordoves (2014); and Suringai et al. (2014) that males indeed are heavier and larger than females due to their innate characteristics (i.e., higher growth rate, bigger bone structure). Correlation between Actual Body Weight and External Body Measurements

The correlation between actual body weight and external body measurements of Philippine native pigs weighing 30 to 50 kg is presented in Table 3. Body length and heart girth were highly correlated (r≥0.60; P<0.01) with the actual body weight regardless of sex. On the other hand, flank girth was moderately correlated with actual body weight regardless of sex. In general, there was a positive correlation between various external body measurements and actual body weight.

Heart girth had the highest degree of correlation (r=0.96)

with actual body weight, followed by body length (r=0.80) and flank girth (r=0.52). This is in agreement with Eusebio et al., (1957) and Paras and Cu-Cordoves (2014) which reported that heart girth and body length of local pigs composed of Berkjala, Berkshire, and Berkjala-Berkshire crosses were highly correlated with body weight. This also conformed to other studies on the weight estimation of

94

Philippine Native pigs and different pure breeds and crossbreed pigs that were evaluated (Vergara, 1994; Groesbeck, 2003; Murillo, 2004; Lettiere, 2004; Paras and Cu-Cordoves, 2014; Walugembe et al., 2014). These studies consistently showed that heart girth had the strongest degree of linear relationship with body weight.

Table 1 Mean Actual Body Weight and External Body Measurements of Philippine Native Pigs Used in the Study

BODY MEASUREMENTS MALE (n=50) FEMALE (n=182) ALL (n=232)

ACTUAL BODY WEIGHT, kg 41.35 35.41 37.39

BODY LENGTH, cm 83.96 81.74 82.48

FLANK GIRTH, cm 72.64 65.70 68.01

HEART GIRTH, cm 81.84 76.96 78.59

Results indicate that heart girth is the best predictor of

actual body weight regardless of sex among all the body measurements used in the study. This result is supported by Paras and Cu-Cordoves (2014) who reported that heart girth explained 88% of the total variability in live weight of Philippine native pigs. Results also conform to the values (88-91%) reported by Mutua et al. (2011) using the stepwise multiple regression analysis. Moreover, adding either body length or flank girth as an independent variable in the prediction equation increased the goodness of fit (Paras and Cu-Cordoves, 2014; Mutua et al., 2011; Walugembe et al., 2014).

Table 2 Correlation (r) between Actual Body Weight and the Different Body Measurements Used in the Weight Estimation of Philippine Native Pigs

BODY MEASUREMENTS (cm) ACTUAL BODY WEIGHT

MALE(N=50) FEMALE(N=182) ALL(N=232)

BODY LENGTH 0.89 ±4.77** 0.78±5.17** 0.80±5.08**

FLANK GIRTH 0.48±5.61** 0.48±6.25* 0.52±8.86**

HEART GIRTH 0.87±5.03** 0.98±6.22** 0.96±6.13**

Legend: * = significant (p<0.05); ** = highly significant (p<0.01).

95

Validation of Various Prediction Equation

Prediction equations were developed by several researchers (Brandl & Jørgensen, 1996; Vergara, 1994; Groesbeck, 2003; Murillo, 2004; Lettiere, 2004; Machebe and Ezegwe, 2010; Agustini et al., 2011; Mutua et al., 2011; Paras and Cu-Cordoves, 2014 and Suringai et al., 2014) that can estimate actual body weight of Philippine native pigs weighing between 30 to 50 kg and thus validation of these prediction models is a need for proper dissemination, utilization, and application in the farmer’s level.

A total of seven (7) prediction equations were used in the

computation of the estimated weight of Philippine Native pigs, as presented in Table 4. In general, computed and estimated weights using prediction models 1, 2, 5 and 7 were comparable (p>0.05) to the actual body weight of males, females and overall weight regardless of the sex of the Philippine Native pigs used in the study. On the other hand, prediction models 3 and 4 (males, females, and the combination of males and females) were significantly higher (p<0.05) to the actual body weight which is in contrast to the prediction model 6 which is significantly lower (p<0.05) to the actual body weight of Philippine native pigs.

Table 3 Actual and Estimated Body Weight (kg) of Philippine Native Pigs on Different Prediction Models

WEIGHT PREDICTION MODEL MALE (N=50)

FEMALE (N=182)

ALL (N=232)

ACTUAL WEIGHT 41.352bc 35.412bc 38.382b

PM1 = - 47.57 + 0.84 * HG(cm) + 0.27 * BL(cm)

40.788bc 37.146ab 38.967b

PM2 = - 46.32 + 0.83 * HG(cm) + 0.27 * BL(cm)

41.220bc 37.627ab 39.424ab

PM3 = - 39.98 + 1.02 * HG(cm) 43.497a 38.519a 41.008a

PM4 = - 40.18 + 1.02 * HG(cm) 43.297a 38.319a 40.808a

PM5 = - 35.59 + 0.95 * HG(cm) 42.158ab 37.522ab 39.840ab

PM6 = 0.83 * BL(cm) - 33.53 35.317d 33.497c 34.407c

PM7 = - 37.60 + 0.64 * HG(cm) + 0.33 * FG(cm)

40.106c 35.335c 37.720b

Means within column with different superscript are significantly different (p<0.05).

96

Table 4 Estimated Body Weight (kg) of Philippine Native Pigs Using Heart Girth and Prediction Model 5

HG (cm) EBW (kg) HG (cm) EBW (kg) HG (cm) EBW (kg)

39 1.46 59 20.46 79 39.46 40 2.41 60 21.41 80 40.41 41 3.36 61 22.36 81 41.36 42 4.31 62 23.31 82 42.31 43 5.26 63 24.26 83 43.26 44 6.21 64 25.21 84 44.21 45 7.16 65 26.16 85 45.16 46 8.11 66 27.11 86 46.11 47 9.06 67 28.06 87 47.06 48 10.01 68 29.01 88 48.01 49 10.96 69 29.96 89 48.96 50 11.91 70 30.91 90 49.91 51 12.86 71 31.86 91 50.86 52 13.81 72 32.81 92 51.81 53 14.76 73 33.76 93 52.76 54 15.71 74 34.71 94 53.71 55 16.66 75 35.66 95 54.66 56 17.61 76 36.61 96 55.61 57 18.56 77 37.56 97 56.56 58 19.51 78 38.51 98 57.51

Results of the study revealed that regardless of sex,

prediction models 1 (BW, kg = - 47.57 + 0.84 * HG,cm + 0.27 * BL,cm); 2 (BW, kg = - 46.32 + 0.83 * HG,cm + 0.27 * BL,cm); 5 (BW, kg = - 35.59 + 0.95 * HG,cm); and 7 (BW,kg = - 37.60 + 0.64 * HG,cm + 0.33 * FG,cm) can be used by pig raisers particularly smallholder farmers having no capacity of buying very expensive weighing scales as an alternative way to estimate the weights of native pigs during marketing to reduced their profit loss.

Moreover, among the used prediction equations, the best

prediction model that can be utilized by smallholder farmers to estimate the actual body weight of Philippine native pigs weighing between 30 to 50 kg, regardless of sex was prediction model 5 (BW, kg =-35.59+0.95* HG,cm) since only the heart girth needs to be obtained by the farmer prior to marketing. Also, the body weight of an animal had a direct relation to the profitability of the enterprise and is essential to maximize profits, drug dosage administration, and the amount of feed offered. Hence, results were vital for pig farmers to improve their overall farm productivity. Furthermore, conversion tables using prediction model 5 were made for easy dissemination of the results and can be utilized by farmers in the field during

97

marketing. Findings served as a source of empirical data to further study the Philippine Native Pigs DNA as well as other pig breed-groups for the heart girth (HG) using DNA barcoding and/or marker-assisted selection for either conservation or improvement since it has a strong correlation to body weight. Hence, it could be utilized for future Philippine native pigs and other breed-groups of pigs in terms of breeding efficiency and various selection programs.

Conclusions

Based on the conditions under which this study was conducted, it is concluded that external body measurements (i.e., body length, flank girth, and heart girth) especially HG may be used to estimate actual body weight of Philippine native pigs weighing between 30 to 50 kg. In addition, adding BL or FG as an independent variable in the prediction equation increased the goodness of fit of the computed body weight concerning the actual body weight of the animal.

Results of the study reveal that regardless of sex, the prediction models 1 (BW, kg = - 47.57 + 0.84 * HG,cm + 0.27 * BL,cm); 2 (BW, kg = - 46.32 + 0.83 * HG,cm + 0.27 * BL,cm); 5 (BW, kg = - 35.59 + 0.95 * HG,cm); and 7 (BW,kg = - 37.60 + 0.64 * HG,cm + 0.33 * FG,cm) can be used by pig raisers particularly smallhold farmers having no capacity of buying very expensive weighing scales as an alternative way to estimate the weights of native pigs during marketing to reduced their profit loss.

On the other hand, prediction model 3 (BW, kg = -39.98 + 1.02 * HG,cm); 4 (BW, kg = -40.18 + 1.02 * HG,cm) and 6 (BW, kg = 0.83 * BL,cm - 33.53) cannot be used to estimate weight of Philippine native pigs, regardless of sex since the computed weight using these models were far beyond the actual weight.

98

Literatures Cited Beretti, V., P. Superchi, R. Manini, C. Cervi, & Sabbioni, A. (2009) Predicting liveweight

from body measures in Nero di Parma pigs. Annali della Facolt´a di Medicina Veterinaria. Universit´a di Parma. Vol.29, pp.129–140.

Boado, M.O. (1971) Comparison of liveweights of hogs by using a table based on

heartgirth and body length with actual scale weights. BS thesis. University of the Philippines Los Baños, College, Laguna.

Brandl. N. & E. Jørgensen, E. (1996) Determination of live weight of pigs from

dimensions measured using image analysis. Computers and Electronics in Agriculture. 15(1) 57–72.

Eusebio, J.A., G.B. Garcia, & Salmon, S.C. (1957) Estimating the liveweight of Berkjala,

Berkshire, Berkjala-Berkshire crosses from body measurements. Pp 252-260. Groesbeck, C.N. (2003). Use heart girth to estimate the weight of finishing pigs. Kansas

State University Cooperative Extension Service. Swine Update Newsletter–Spring. 25:3.

Javier, A.C. (2001). Weight determination in modern breed of hogs using body

measurements. BS thesis. College of Agriculture. University of the Philippines Los Baños. College, Laguna.

Lettiere, S.M. (2004). Liveweight and carcass determination of hogs from different

breeding systems using body measurements. BS thesis. College of Agriculture. University of the Philippines Los Baños. College, Laguna.

Machebe & A. G. Ezekwe. (2010). Predicting Body Weight of Growing-Finishing Gilts

Raised in the Tropics using Linear Body Measurements. Asian Journal of Experimental Biological Sciences.

Murillo, M.C.K.M. (2004). Body weight estimation in triple cross pigs (Largewhite-

Landrace-Duroc) using external body measurements. BS thesis. College of Agriculture. University of the Philippines Los Baños. College, Laguna.

Mutua, F.K., Dewey, C.E., Arimi S.M., Schellinge & Ogara. W. O. (2011) Prediction of live

body weight using length and girth measurements for pigs in rural Western Kenya. J Swine Health Prod19: 26–33.

Paras, E.P. & Cu-Cordoves, R.K. (2014). Estimating liveweight of Philippine native pigs

using external body measurements. Philippine Journal of Veterinary and Animal Sciences, 40(1), 47-52.

Vergara, A.D. (1994). Studies on the relationship of body length, heart girth, height and

age to the actual weights of pigs. BS thesis. College of Agriculture. University of the Philippines Los Baños. College, Laguna.

99

Walugembe, M., G. Nadiope, J. D. Stock, K. J. Stalder, D. Pezo & Rothschild, M. F. (2014). Prediction of live body weight using various body measurements in Ugandan village pigs. Livestock Research for Rural Development 26 (5).

Zaragoza, L.E.O. (2009). Evaluation of the accuracy of simple body measurements for

liveweight prediction in growing-finishing pigs. MS Thesis. Graduate College of the University of Illinios, Urbana Champaign, USA.

100

UTILIZATION OF BIOCHAR IN THE PRODUCTION OF CASSAVA (MANIHOT ESCULENTA) GROWN IN CLAYEY SOIL

Marcela S. Icalla

Christian B. Apostol Mindoro State College of Agriculture and Technology

ABSTRACT

Just like other root crops, cassava demands a growing media that provide superior growing conditions. For this matter, a compacted clayey soil needs to improve its physical and chemical characteristics to be suitable for root crop production. Thus, this study examined the combine effect of biochar from different feedstock and organic fertilizer in the growth and yield of two cassava variety planted in compacted clayey soil. A 3x3x2 factorial experiment in RCBD was used and each treatment combinations were replicated three times. It was found out that both rice hull and twigs (Factor A) biochar improved the growth and yield of cassava. On Factor B, three types of organic fertilizer have comparative effect on the growth but have significant variation on yield of crops. Factor C shown that Rajah 4 has bigger stem, bigger and longer roots, and more leaves produced while Lakan 1 has more stems and roots per plant produced. Data revealed no statistical variation on weight of harvested roots. The result of this study showed that amelioration of biochar from rice hull with combination of chicken dung as fertilizer improved the yield of Lakan 1. Keywords: Agriculture, biochar, feedstock, organic fertilizer, experimental, RCBD, Philippines

101

Introduction

orld cassava production could dip in on the account of lower planting in major producing countries (FAO, 2017). In the Philippines, however, despite of many uses of this crop, cassava is planted each year

in about 120, 000 hectares, producing 1.8 million tons of tubers only. This is relatively small compared to that of Thailand, Indonesia and Vietnam (Bascusmo, 2011). As a food crop, demand for cassava is increasing with the increase in population. Though, this industry is rather bleak, this can be associated with trade liberalization, insufficient government assistance in productivity and efficiency, technical-know-how and appropriate technology that is affordable by the farmers among other factors, which are threatening the survival of this sector.

Cassava, just like other crops needs a superior growing condition to attain the expected output. Soil is a vital factor that determined the productivity of cassava. Degraded soil possess chemical and physical constraints for crop growth like acidic or calcareous pH, low organic matter and nutrient contents, presence of toxic substances and compaction due to agricultural practices. Soil compaction is the reduction of soil volume due to external factors and this reduction lowers soil productivity. For this matter, there is a need to improve the textural and chemical condition of the soil. Application of biochar from different feedstocks and use of organic fertilizer can be a remedy for this problem.

Biochar is a form of charcoal produced from biomass, by a

process known as pyrolysis. Biochar, when added to the soil, was shown to be beneficial for growing crops. Biochar can improve the water holding capacity of soil (Case et al., 2012). Crop yield from acidic and highly weathered tropical soil improved with the application of biochar (Major et al., 2012, Rondon et al., 2012). Several published studies reported positive effects of biochar application on crop yields with rates of 5-50tons of biochar per hectare, with appropriate nutrient management. This is a large range, but often when several rates are used, the plots with the higher biochar application rate show better results (Major et al., 2010). Most of these studies reported that “activated” biochar by co-composting consistently

W

102

promotes plant growth, with better performances than those observed when composts and biochars are used individually (Joseph et al., 2010; Schulz et al., 2013). As recently demonstrated, plant growth improvement by co-composted biochar is largely mediated by nutrients capture, especially nitrate, and their subsequent slow release, hence this study was conducted. Local farmers and concerned government agencies will be benefited in this study not only because farmers can lessen their cost of production in terms of fertilizer expenses but most specifically in addressing the problem in waste disposal of rice hull; and twigs and branches specially every after typhoon where there are lots of trees and other plants have been uprooted.

Objectives

This study aimed to determine the effect of rice hull and twigs as a feedstock for biochar amelioration combined with different organic fertilizer on the growth (in terms of plant height, diameter of main stems, number of leaves) and yield (in terms of average number of harvested roots per plant, diameter and length of roots, weight of harvested roots) performance of Rajah 4 and Lakan 1 cassava.


The study was conducted from January 25 to November 16, 2017 in previously rice field which is compacted clayey soil Alcate, Victoria, Oriental Mindoro. Soil sampling and analysis were done prior to land preparation to determine the extent of compactness and nutrient component of the soil.

Materials

Fresh rice hull and twigs of different trees was used as feedstock in making biochar. It was prepared separately but with the same temperature. To fertilize the soil, decomposed chicken dung, swine dung and vermicompast were applied as basal. Pure vermi cast was applied at the rate of 500 gram per plant three months after

103

planting. Planting materials of Rajah 4 and Lakan 1 cassava variety were given by BPI- Bureau of Plant Industry – Plant Quarantine Service (BPI-PQS) two days before planting. Methods Experimental Design

A 3x3x2 factorial experiment in Randomized Complete Block Design (RCBD) was used in this study. Among the factors observed were: types of feedstock (Factor A: A1- No amelioration, A2- Rice hull, A3- Twigs), kinds of organic fertilizer (Factor B: B1-Chicken dung, B2-Swine dung, B3-vermicompost) and variety of cassava (Factor C: C1-Rajah 4, C2-Lakan 1). Each treatment was replicated three times.

Preparation of Experimental Site

A total area of 1,700 sq m was cleaned, plowed and prepared thoroughly into loosed tilt by thrice plowing and harrowing alternately with the used of hand tractor until the good tilt of the soil was attained. Plots had a dimension of 5 m by 4 m each, spaced at 0.5 m in between at 30 cm high. There were 1 m spaces in between blocks. Tree blocks were made in the area and each block five plots were laid representing all treatments. Five (5) kg of biochar per square meter was applied according to schedule except for control plots. Different organic fertilizers at a rate of 2kg/plant were incorporated into the soil during mixing of biochar. Plot signs were installed before planting.

Planting and Care of the Plants

Planting materials with 20-25cm long were planted in slightly-inclined position leaving 3-5 centimeters uncovered. Cuttings were planted at a distance of 1 meter per hill and 1 meter per row.

Care of the Plants

Rice straw was spread on top of the plots with 2 inches thickness leaving 2 inches diameter from the base of cuttings to minimize the frequency of irrigation during sunny days and prevent weeds for growing. Watering was done during days without rain for a month. Hand weeding likewise was done on the second month and

104

on the fourth month after planting. Off-bar cultivation was performed 4 weeks after planting followed by hilling-up 4 weeks later.

Harvesting

Harvesting was done after gathering the final data on growth parameter. Cassava stems were cut leaving a portion at the base of the plant to serve as handle to pull the storage root up. The storage roots were detached from the stem using a sharp bolo. Soils sticking on the roots were removed using a stick. The harvested tubers were brought to the shade for weighing and measuring for yield parameter.

Data Gathering

Data were taken from the 6 sample plants from each plot. The data gathered were as follows:

1. Plant height measurement of sample plant was done one

month after planting up to harvesting day at one month interval. Measurement was done from the base of the plant to the tip of the highest plant leaf.

2. Number of leaves from sample plants were manually counted and recorded every month from a month after planting until the day of harvesting.

3. All main stem of sample plants were counted manually on the

day of harvesting. All main stem of six sample plants were measured using digital caliper at monthly interval from one month after planting up to the day of harvesting. Diameter of 30 cm height of stem from the base of the plant were recorded and tabulated to get the average diameter of the sample plant.

4. All storage roots produced by sample plants were counted

and measured. Middle portion of all storage roots of sample plants were measured using digital caliper. Length of roots was measured using meter stick. Digital weighing scale was used to determine the weight of harvested roots.

105

Data Analysis

All data collected were consolidated, organized, encoded and tabulated. Data were analyzed using the Analysis of Variance of the SAS Software (SAS Version 9.1.30) and Scheffe’s Test was used to determine significant differences between treatments. Level of significance and tendencies was set at P ≤ 0.05 for all statistical tests.

Results and Discussion Effect of Biochar Feedstock on the Growth and Yield of Cassava

The biochar from rice hull and twigs as a source of feedstock were evaluated for their effect on the growth of cassava (Table 1). Data gathered on the harvesting day showed that regardless of feedstock used as biochar plants grown in plots with amender were significantly taller (P<0.05), with more leaves (P<0.01), and had bigger stems (P<0.05) produced compared to the plants grown in the soil control. This finding also supported the study of Preston et al (2012) which revealed the significant effect of 20 % increase in the number of leaves of Chinese cabbage (Brassica pekinensis) by biochar amelioration. Lettuce height increased by biochar incorporation to the soil (Carter et al., 2013). In the study conducted by Ty et al (2012) both height and number of leaves of Celery, Chinese cabbage, Mustard green and Water Spinach increased by biochar amelioration. In the same study, each type of vegetable, application of increasing quantities of biochar led to positive linear or curvilinear increased in biomass yield of leaves and stems. This could be attributed to the fact that biochar enhances soil, retains water for plant usage and provides nutrients for plant growth. On a microscopic level, the biochar opens a latticework of carbon which provides spaces for microbes to live. These beneficial microbes help transport nutrients and water to plants.

The number of stem produced by the plants in the plots with

twigs biochar was found out to be comparable to the plants grown in plots without amender but both were below average (3.7). However, clayey soil can be productive in terms of stem production if applied with rice hull biochar. In this study, plants in rice hull biochar had produced more stems (P<0.05) among another treatment. Rice hull biochar has the ability to improve the soil properties causing

106

improvement of crop production was observed on the study conducted by Laird et al (2010). Table 1 Effect of Types of Feedstock on the Growth of Cassava

Factor A

Plant height (cm)

Diameter of Main stem

(cm)

Number of stem

Number of leaves

A1:No biochar

135b 1.50b 3.4b 315b

A2: Rice hull 268a 3.40a 4.1a 445a

A3: Twigs 272a 2.90a 3.6b 456a

Mean 225 2.60 3.7 405.33

Legend: Means within the column with different superscripts are significantly different (<0.01).

Data on the yield of cassava (Table 2) revealed a positive

impact of biochar amelioration. Application of biochar either rice hull or twigs had heavier (P<0.05) and longer (P<0.05) roots compared to the roots produced by the plants with no amelioration. It was also shown that tuber with no amelioration was relatively thinner compared to the tuber produced in ameliorated soil with twigs and rice hull having a mean of 5.20, 8.70 and 9.30 cm respectively. No variation was detected on the average number of roots per plant as affected by types of feedstock. Increase in the yield of radish was detected as affected by biochar application with Nitrogen (Edmunds, 2012). This result conforms to the outcomes of the study conducted by Ty et al. (2012), which revealed that application of biochar at different levels improved the yield of vegetables. Yield increases for biochar application of 5 kg/m2 (50 tones/ha) were of the order of 300%, 100%, 350% and 39% for Celery cabbage, Chinese cabbage, Mustard green and Water spinach, respectively.

This finding can be attributed to the fact that root growth

in compacted soils is restricted because roots can develop a maximum pressure above which they are not able to expand in soils. Aside from the effect of penetration resistance, roots also suffer from increased anaerobic conditions in compacted soils.

107

So application of biochar from rice hull and twigs helped the development of roots of cassava which led to a better yield than of the plants grown in plots without amelioration. Biochar is light and highly porous. When biochar is added to clay, it makes the soil less dense and it increases hydraulic conductivity, which makes intuitive sense. Table 2 Effect of Types of Feedstock on the Yield of Cassava


Effect Organic Fertilizer on the Growth and Yield of Cassava

Growth of cassava showed no variation as to the kind of organic fertilizer used in this study. But it is worth noted that plots fertilized with vermicompost produced the tallest (290cm), with more stems (4.1) and leaves (455) produce. Several long-term studies have shown that the addition of compost decreases the bulk density of soil and improved its physical properties and increasing the soil water holding capacity. Also, vermicompost water-extracts, used as substrate amendments or foliar sprays, also promote the growth of strawberries (Singh et al., 2010). Chicken dung on the other hand, produced the biggest diameter of stem (3.10cm). Both results were comparable with the data gathered on the plants fertilized with swine dung and on the crop description. This means that cassava would grow on compacted clayey soil as long as it is fertilized with organic fertilizer.

Factor A

Diameter of roots

(cm)

Length of roots (cm)

Number of harvested

roots/ plant

Weight of roots (t/ha)

A1: No biochar 5.20c 22.80b 5.20a 25.20b

A2: Rice hull 9.30a 29.50a 6.01a 28.80a

A3: Twigs 8.70b 28.90a 5.80a 29.01a

Mean 7.73 27.07 5.67 27.67

108

Compacted clayey soil when fertilized with chicken dung would produce bigger (8.01cm) and longer (29.60cm) harvested root but comparable to the length and size of roots produced by the plants grown in the plots fertilized with swine dung and vermicompost. Chicken manure produced the heaviest yield of 28.80t/ha (P<0.05). Poultry manure contains useful soil nutrients that are needed for the growth of plants (Ayeni et al, 2012). Cassava can be productive even in clayey soil as long as it would be supplied with nutrients that would support its productivity. Soil with available Nitrogen and Phosphorus significantly increased with increasing rate of manure application.

Nweke et al. (2013) concluded that that the use of animal

manure in crop production is desirable as it had variable impacts on the growth and yield of crops. The use of animal manure would improve soil organic matter status, nutrient availability and good crop yield as well as ensures stability of soil structure. The animal manure is cheap, more easily accessible and available. It is a good alternative to chemical fertilizer and has sustainability effects on soil. Animal manures significantly increased the chemical soil properties. Irrespective of the manure type, soil available levels of N and P increased with increasing rates of application. On the field experiment conducted by Acharya and Kumar (2018), organic manure enhance improve garlic yield as to number of cloves, bulb size and weight. Table 3 Effect of Types of Organic Fertilizer on the Yield of Cassava


Factor B Types of organic

fertilizer

Diameter of roots

(cm)

Length of roots

(cm)

Number of harvested

roots/plant

Weight of roots (t/ha)

B1: Chicken dung 8.1a 30.0a 6.6a 28.80a B2: Swine dung 7.8a 29.6a 5.7a 27.05b B3: Vermicompost

6.8a 25.0a 6.2a 27.20b

Mean 7.57 28.2 6.17 27.48

109

Growth and Yield Differences of Cassava Varieties

Rajah 4 was superior compared to Lakan 1 in terms of plant height (234cm), diameter of stem (3.30cm) and number of leaves (490) on the time of harvesting. However, data revealed that Lakan 1 has more stems than Rajah 4. The differences in growth performance of two varieties can be attributed to the varietal characteristics (Agri Business, 2017).

As to yield parameters, Rajah 4 and Lakan 1 have shown no

variation on the diameter of roots having 7.70 cm and 7.20 cm respectively. Though Rajah 4 produced 28.20 cm long it was no difference on the 27.90 cm length of roots produced by Lakan 1. On the contrary, the number of roots produced by Lakan 1 was significantly higher (P<0.05) than the number of roots produced by the Rajah 4, but it had no effect on the weight of roots express in yield per hectare. Harvested roots were on the range of potential harvest as stated by Mariscal (2017) that cassava can easily give yield of 20-30mt/ha when provided with appropriate inputs. The number of roots per plant at harvest varies from 2 to7 each averaging 27.7 to 43.3 cm long and from 4.5 to 7.4 cm in diameter. Lakan 1 is expected to yield 32 to 34 t/ha while Rajah 4 is 33.4t/ha (BAR, 2017). Cassava varieties are generally distinguished from each other by their morphological characteristics which include leaf, stem and tuber color, leaf shape and number of storage roots. Table 4 Comparison of Two Cassava Variety (Factor C)

Legend: Means within the row with different superscripts are significantly different (<0.01.>).

Growth parameter Raiah 4

(NSIC Cv-42) Lakan 1

(UPL Cv-2)

Mean

Plant height (cm) 234a 210b 222

Diameter of the main stem (cm) 3.30a 1.90b 2.60

Number of stem 3.20b 4.50a 3.90

Number of leaves 490a 373b 431.50

Yield parameter

Diameter of roots (cm) 7.70a 7.20a 7.45

Length of roots (cm) 28.20a 27.90a 28.05

Number of harvested roots 5.80b 6.80a 6.30

Weight of roots (t/ha) 27.8a 28.20a 28.00

110

Effect of the Interaction of Type Feedstock and Organic Fertilizer on the Growth and Yield of Cassava

Data gathered showed that cassava planted in soil ameliorated with twigs biochar fertilized with vermicompost (A3B3:261.79cm) had the highest plant followed by plants grown with no amelioration but fertilized by swine dung (A1B3: 261.12) while the shortest (187.56 cm) plant was found in plots with no amelioration but fertilized with chicken dung (A1B1). This result was dissimilar to the result obtained by Olatunji et al. (2006) where plants grown in poultry manure performed better than their counterpart in other organic fertilizer used. It implies that vermicompost as fertilizer and twigs biochar has an advantage to the height of plants.

Similar to the result of application of vermicompost to

tomato at a rate of 15t/ha gave a (P<.05) significant improvement in growth and yield compared to control (Azami, R et al., 2008). The diameter of the cassava stem had grown bigger in the combination of A2B3 with a mean of 3.28 cm. On the other hand, the thinnest stem was grown in A1B1 having 2.32 cm mean. Therefore, unamended clayey soil had disadvantage in the development of stem while incorporation of rice hull biochar was an advantaged. This was the solution suggested by Biederman and Harpole (2013). There was a big difference on the number of stems produced by the types of amelioration and organic fertilizer used (AxB). The numerous (5.85) stem recorded were in the plots with combination of twigs biochar and chicken dung having a difference of 2.42 mean to the least stem produced by the combination of twigs and vermicompost. The beneficial effects of biochar on crops production have been known since ancient times. In Amazon basin, pre-Columbian populations developed the “terra preta” soils, also known as “Amazonian dark earth,” by repeating cycles of vegetation burning combined with the application of organic amendments including leaf litter, nutrient-rich kitchen wastes, and fecal materials (Kammann et al., 2016).

111

Table 5 Effect of the Interaction of Amelioration and Organic Fertilizers on Performance of Cassava

Cassava grown in clay with rice hull biochar combined with chicken dung as fertilizer (A2B1) reported to have the biggest roots with 8.9 cm diameter followed by 7.9 cm produced by no ameliorates plots but with vermicompost (A1B3) and rice hull biochar with vermicompost (A2B3). Even with the application of animal manure, clayey soil in plot with no amender (A1B1, A1B2) had the 6.8 cm roots diameter, the smallest roots in the treatment combination. Results support the findings of the study conducted by Simon et al. (2015). They stated that there is small but statistically significant, benefit of biochar application to soils on crop productivity, with a grand mean increase of 10%. Moreover, Nweke et al. (2005), reported that poultry manure contains more plant nutrients than all other organic manures.

Roots harvested in unamend soil fertilized with swine

manure was 0.71 cm shorter than the average mean of 29.13 cm. On the contrary, rice hull biochar with chicken manure produced a 3.67cm longer root than the 29.13 cm average length of harvested roots. As to count of harvested roots, A3B1 and A3B2 had the most number of roots (6.9), while rice A2B2 had the least roots harvested. Cassava grown in biochar ameliorated soils fertilized with chicken dung (A2B1 and A3B1) produced 28.20 mean yield while unameliorated soil with vermicompost had the lowest yield per hectare with a mean

Factor A x B

Plant

height (cm)

Diameter of stem

(cm)

Number of Stem

Number

of Leaves

Diameter of roots

(cm)

Length of root (cm)

Number of

harvested roots/ plant

Weight of roots

(t/ha)

A1B1 187.56 2.32 3.60 437.50 6.8 31.10 6.7 27.30

A1B2 243.76 3.20 3.65 364.50 6.8 28.20 6.6 27.10

A1B3 261.12 2.45 3.85 455.50 7.9 27.05 6.4 26.80

A2B1 249.34 2.75 4.95 429.50 8.9 32.80 5.9 28.20

A2B2 243.00 2.36 3.45 437.50 7.3 31.90 5.7 27.70

A2B3 259.85 3.28 4.10 450.00 7.9 28.70 6.1 26.90

A3B1 251.46 2.95 5.85 435.00 6.9 29.90 6.9 28.20

A3B2 245.00 2.85 3.70 443.00 7.3 25.70 6.9 28.10

A3B3 261.79 3.11 3.40 455.50 7.7 26.80 6.0 27.20

Mean 244.76 2.80 3.73 434.22 7.51 29.13 6.29 27.50

112

of 26.8t/ha. Chicken manure was the key supplier of nutrients while biochar played important role in betterment of clayey soil physical conditions. Recent studies by Boun Suy Tan (2010) about the application of biochar at 40t/ha resulted to double increase rice yield compared to control. Sokchea et al (2013) also concluded that application of 30 tonnes/ha biochar to a rice crop increased grain yield by 30% and straw yield by 40%.

Effect of the Interaction of Type Feedstock and Cassava Variety (AxC)

Rajah 4 1 variety had grown best in rice hull biochar amended

(A2C1) soil having the tallest mean of 291.04 cm. The same effect on the size of stem 0ne foot from the base of the plant where Rajah 4 planted in rice hull biochar had the biggest stem mean of 3.75 cm, a 0.83 cm bigger than the average mean of 2.93 cm. Rajah 4 produced 3.85 and 3.76 stem if planted in twigs and in rice hull amended clay soil. While the lowest number of stem was produced by the same variety planted in unamended soil. This implied that this variety is responsive to amelioration. Plants under this study had 443.44 mean leaves count, but Lakan 1 planted in no amender had 13.94 lesser. On the contrary, Lakan 1 planted in rice hull biochar produced 26.06 more leaves. Rice hull biochar, according to Saranya et al. (2011) when applied in saline soil will increase maize shoot length with maximum of 78 cm 30 days after sowing. The potential impacts of biochar as a soil amendment have been extensively reviewed in the literature, e.g. Sohi et al. (2010), and Jeffery et al. (2011). Biochar may alter the physical properties of the soil, including increasing aeration and water holding capacity of certain soils (Haefele, et al., 2011).

Combination of rice hull biochar and Rajah 4 (A2C1) had the

biggest root produced with a mean of 7.95 cm followed by 7.60 cm by Lakan 1 harvested in the same feedstock but harvested roots from control soil was found out to be the thinnest regardless of variety used (A1C1:7.20cm, A1C2:7.10cm). Low productivity can be due to the fact that clay soil presents a difficult growth environment. As compaction increases, physically inhibit roots struggle for elongation resulted to development of short roots (Shukor et al., 2015). If the soil is not permeable to root development most likely roots would not get longer. The same situation of Lakan1 grown in unamended soil which resulted to the production of the shortest roots (26.95cm).

113

Rice hull biochar would make the soil permeable, thus roots can easily grow longer. Biochar had been the reason why Rajah 4 produced the longest (31.35 cm) roots with 7.10 cm mean difference from the average length (24.25 cm) of roots in the combined effect of types of biochar and variety. Rajah 4 grown in twigs biochar had the least number of harvested roots while Rajah 4 in unamended soil had the most harvested roots. This implies that this variety can produce roots even in clayey soil without amender. It appears the same results in soybean grown in acid soil applied with biochar which yield increased by 35.97% compared with the control (Yin et al., 2012). The combined effect of types of feedstock for biochar and variety understudy harvested an average weight of 27.54 t/ha. The result was similar to the statement by Saarnio et al. (2013) that biochar application in addition to fertilizer can lead to plant growth benefits. Moreover, Rajah 4 in rice hull ameliorated soil had the heaviest (27.90 t/ha) harvested root, followed by the same variety in twigs biochar ameliorated soil (27.70 t/ha) while Lakan 1 in twigs biochar produced the lightest harvested roots (27.10 t/ha). It appears that in cassava grown in clayey soil showed higher productivity regardless of biochar substrate. Some researchers re¬ported significant increase in maize production using biochar as soil amemder (Major et al,2010). A positive effect of biochar addition on maize dry biomass could be ascribed to higher soil N-retention as also observed in Baronti et al. (2010). Table 6 Effect of Interaction of Type of Feedstock and Varieties on the Growth and Yield of Cassava

Factor A X C

Plant

height (cm)

Diameter of stem

(cm)

Number of Stem

Number

of Leaves

Diameter of roots

(cm)

Length of root

(cm)

Number of roots

Weight of

roots (t/ha)

A1C1 244.36 2.30 3.00 464.60 7.20 27.85 6.30 27.85 A1C2 222.22 2.81 3.30 429.50 7.10 26.95 6.15 27.65 A2C1 291.04 3.75 3.76 428.50 7.75 31.35 6.25 27.90

A2C2 244.90 3.10 3.30 469.50 7.60 28.80 6.40 27.05

A3C1 261.05 2.95 3.85 445.10 7.50 30.50 6.00 27.70

A3C2 245.00 2.45 3.70 443.45 7.35 29.00 6.05 27.10 Mean 251.43 2.93 3.38 443.44 7.43 24.25 6.19 27.54

114

Effect of the Interaction of Organic Fertilizer and Cassava Variety (BxC)

Rajah 4 was able to utilize nutrients present in chicken dung to produce the tallest plant (B1C1:289.66 cm). However, in the case of Lakan 1 fertilized with swine manure (B2C2), it turned out to be the shortest plant (240.04) having 2.12 mean lower than the average plant height. Data revealed the stem of Rajah 4 fertilized with vermicompost was 0.33 cm bigger than the average diameter of 2.20 cm, while Lakan 1 in swine fertilized soil was .52 cm thinner. The effect of fertilizer on the size of stem affected the number of stem produced by plants. Lakan1 fertilized with swine manure which had the thinnest stem produced more stems among the combination of Factor BxC. The number of leaves per plant was also affected by the number of stems. The numerous leaves plant was Lakan1 fertilized with swine manure (450.15) higher than average leaves with a mean count of 428.16. The findings showed that different manure had different effects on crop development and yield. Senjobi et al. (2010) reported that the use of poultry, plant and sheep/goat manures improved all the growth parameters of the leafy vegetable they worked with. Other workers have reported beneficial effects of organic manure on soil properties such as bulk density (Fawole et al., 2010), soil moisture content (Adeleye et al., 2010), water-holding capacity and other soil physical properties (Fawole et al., 2010). When organic manure is applied in sufficient quantity to the soil, it can supply all the necessary primary and secondary nutrient required for crop growth. Table 7 Effect of Interaction of the Organic Fertilizer and Variety on the Performance of Cassava

Factor B X C

Plant height (cm)

Diameter of stem

(cm)

Number of Stem

Number of

Leaves

Lobes/ leaves

Diameter of roots

(cm)

Length of

roots (cm)

Number of harvested

roots/plant

Weight of

roots (t/ha)

B1C1 289.66 2.80 3.20 387.12 7.75 8.40 29.65 6.65 28.45

B1C2 245.06 2.51 3.50 423.50 7.20 7.50 27.63 6.20 27.50

B2C1 250.22 2.85 3.34 430.50 7.35 7.35 29.95 6.45 26.50

B2C2 240.04 2.10 3.98 444.50 7.40 7.90 32.35 6.00 27.25

B3C1 243.90 2.95 3.60 450.15 7.75 7.30 30.30 6.35 28.15

B3C2 261.05 2.50 3.90 448.20 7.50 6.85 29.30 6.20 25.60

Mean 242.16 2.62 3.52 428.16 7.41 7.55 29.86 6.31 27.24

115

The biggest root harvested with a mean of 8.4 cm was produced by Rajah 4 fertilized with chicken dung while the thinnest mean of 6.85 cm was from Lakan 1 fertilized with vermicompost. However, the longest reported root of 32.35 cm was from Lakan 1 fertilized with swine manure.

Being the shortest roots producer, Lakan 1 fertilized with

chicken manure had 27.95 cm mean. Based on the data collected, the highest count of harvested roots were obtained by Rajah 1 applied with chicken dung and the least count of harvested roots was from Lakan 1 fertilized with swine manure. The effect of combined chicken dung and Rajah 4 in the size and in number of roots harvested per treatment signifies the highest yield among the treatment combination. With computed 28.45t/ha mean weight of harvested roots per hectare, Factor A X B had 1.21 t/ha heavier than the average weight of yield per hectare. Poultry manure also contains useful soil nutrients that are needed for the growth of plants (Ayeni, et al., 2012). On the contrary, there was 1.64t/ha shortfall on the average weight which was reported from the harvest of combined vermicompost and Lakan 1 variety. When organic manure is applied in sufficient quantity to the soil, it can supply all the necessary primary and secondary nutrient required for crop growth. Effect of the Interaction of Types of Feedstock, Organic Fertilizer and Variety

The highest plant height of 256.42 cm was reported to be Rajah 4 grown from the plots with rice hull biochar amender fertilized with swine manure (A2B2C1), same figure from Rajah 4 planted in twigs biochar with chicken manure as fertilizer (A3B1C1). However, the shortest plant came from Lakan 1 grown in unamended plots but with swine dung fertilizer. Three combinations produced equally thinner stem with a mean diameter of 2.48 cm, a 0.21cm difference from the 2.69cm average diameter of main stem, and that were A1B2C1, A1B2C2 and A2B3C2. It was the Rajah 4 in twigs ameliorate and swine manure (A3B2C1) that ranked first in production of bigger stem followed by Lakan 1 in no ameliorate but with chicken dung fertilizer (A1B1C2) with a mean of 3.08 and 3.03cm, respectively. There were 17.08 leaves deficient on the number of leaves produced by the Lakan 1 planted in no amender but fertilized with chicken

116

manure. However, Lakan 1grown in twigs ameliorated plots fertilized with swine manure had the most number of leaves produced. Table 8 Effect of Interaction of the Type of Feedstock, Organic Fertilizers and Variety (AxBxC) on the Growthanfd Yield of Cassava

Factor A x B

Plant height (cm)

Diameter of stem

(cm)

Number of Stem

Number of

Leaves

Diameter of roots

(cm)

Length of roots (cm)

Number of harvested

roots/ plant

Weight of roots

(t/ha)

A1B1C1 251.81 2.56 3.53 449.66 7.60 29.49 6.50 26.85

A1B1C2 215.28 3.03 3.73 423.31 7.40 27.58 6.38 27.65

A1B2C1 256.29 2.48 3.17 444.30 7.83 27.93 6.33 27.90

A1B2C2 247.17 2.48 3.44 447.80 8.25 32.08 6.15 27.05

A1B3C1 252.40 2.78 3.38 446.35 7.40 31.20 5.85 27.10

A1B3C2 252.31 2.60 3.60 431.66 7.08 28.85 6.08 27.70

A2B1C1 247.91 2.63 3.69 456.40 8.40 30.50 6.80 27.30

A2B1C2 253.61 2.83 3.65 433.83 7.80 29.65 6.65 28.10

A2B2C1 256.42 2.66 3.52 449.80 7.80 27.63 6.50 28.40

A2B2C2 244.83 2.95 3.53 441.25 8.40 29.93 6.15 28.00

A2B3C1 252.71 2.53 3.73 442.00 8.10 32.35 5.80 27.70

A2B3C2 253.61 2.48 3.55 426.86 7.05 30.30 5.90 26.90

A3B1C1 256.42 2.80 3.98 414.80 6.85 29.30 6.50 27.30

A3B1C2 245.70 2.58 3.53 440.48 7.10 27.80 6.60 26.80

A3B2C1 224.31 3.08 3.69 449.47 7.10 26.25 6.15 27.20

A3B2C2 244.38 2.73 3.75 438.85 7.40 28.95 6.35 27.30

A3B3C1 256.27 2.53 3.56 432.83 7.80 29.65 6.65 28.10 A3B3C2 247.92 2.60 3.52 457.30 7.80 27.63 6.50 26.80

Mean 247.74 2.69 3.58 440.39 7.56 29.28 6.32 27.44

Among the 18 combinations of 3 factors, it was the 8.40cm diameter of A2B1C1 and A2B2C2 which had the biggest roots produced. On the other hand, A2B3C1 produced the longest roots harvested with a mean of 32.35 cm. Moreover, the combination of A2B1C1 had the most number of harvested roots with a mean of 6.80. In addition, it was the A2B2C1, which had the highest yield with a mean of 28.4t/ha. It appears that clayey soil ameliorated with biochar became more productive compared to unameliorated soil.

The increased water holding capacity of biochar (Case et al., 2012) may have contributed to weight of harvested roots. Application of organic fertilizers improves the soil fertility by providing nutrients through mineralization, nutrient, and water holding capacity and acts as habitat for soil micro-organisms (Fischer and Glaser 2012). Murmu et al (2013) found that organic manure increases crop productivity, nitrogen utilization efficiency, and soil health compared to chemical

117

fertilizer. Similar results on the study conducted by Gupta (2011) showed the maximum root length, shoot length, dry weight of plant, number of fruits and total fruits production of Okra, which was found to be 13.20 cm, 37.56 cm, 12.64 g, 24.16 and 4864 kg/hectare respectively in case of vermicompost treatment. Combination treatment Vermicompost on the other hand, is a nourishing organic fertilizer having high amount of humus, nitrogen-2-3%, phosphorus-1.155-2.225%, potassium-1.85%-2.25%, micronutrients and more beneficial soil microbes like nitrogen-fixing bacteria (Guerrero, 2010).

Conclusions

Considering the above discussion, it is concluded that cassava showed positive responses to biochar regardless of feedstock substrates. From the data gathered, it can be concluded that organic fertilizers used in this study had comparable effect on growth and yield of cassava. However, varietal test showed that Rajah 4 was observed to be morphologically better than Lakan 1. On the combined effect of types of feedstock and OF used, it is the twigs biochar and vermicompost (A3B3) produced the tallest plant, but the combined rice hull biochar and vermicompost (A2B3) produced more stem as well as the biggest stems. Vermicompost applied in control plots (A1B3) and in twigs ameliorated soil (A3B3) had the most leaves per plant but chicken dung fertilizer in unamended clayey soil (A1B1) had the advantage in the production of lobes per leaves. Rajah4 became taller when grown in plots with rice hull biochar (A2C1).

The same variety in twigs biochar ameliorates (A3C1) had the numerous stem. Lakan1 on the other hand, when grown in rice hull biochar would have biggest stem and more leaves among the other treatment combination. As to yield, it is the Rajah4 grown in rice hull biochar (A2C1) had the biggest, longest, and the heaviest harvested roots, while Lakan1 produced more roots if grown in rice hull biochar (A2C2). Superior plant height and more lobes per leaves were observed in the combined chicken manure and Rajah4 (B1C1). The biggest stem and more leaves were found in the combination of vermicompost and Rajah4 (B3C1) but it is the Lakan1 in swine dung which had the most number of stems produced in Factor B x C.

In the combination of three factors, A2B2C1 and A3B1C1 had the same height of plants, diameter of stem was bigger in A3B2C1,

118

more stem would produce in A3B1C1, and more leaves per plant in A3B3C2. Root measurements as to biggest diameter was found out to be in the A2B1C1 and A2B2C2 but as to length, it is the A2B3C1 which produced the longest roots. The combination of A2B1C1 became favorable in the production of roots as to number, but as to weight it is the A2B2C1 which had the highest yield per hectare.

Literatures Cited Acharya, S., & Kumar, H., (2018). Effect of some organic manure on growth and yield

of garlic in greenhouse condition and cold desert high altitude ladakh region. Defense Life Journal, 3(2), 100-104, DOI:10.14429/dlsj.3.12569

Adeleye E.O., Ayeni L.S. and Ojeniyi S.O. (2010). Effect of poultry manure on soil

physico-chemical properties, leaf nutrient contents and yield of Yam (Dioscorea rotundata) on Alfisol in Southwestern Nigeria. Journal of American Science. 6(10), 871-878.

Agri Business. Cassava (Kamoteng Kahoy, Balinghoy) Production Guide. (2017).

Retrieved September 26, 2017, from http://link.springer.com/article/10.1007/s10705-009-9278-3

Biederman, L.A, Harpole, W.S. (2013). Biochar and its effects on plant productivity and

nutrient cycling: a meta-analysis. GCB bioenergy, 5, 202–214. Bureau of Agricultural Research (BAR). (2017). Cassava Production. Retrieved

November 4, 2017, from http:///bar.gov.ph/index.ph/biofuels-home/bioethanol/cassava

Carter, S., Shackley, S. Sohi, S., Suy, T.B., & Haefele S. (2013). The impact of biochar

application on soil properties and plant growth of pot grown lettuce (Lactuca sativa) and cabbage (Brassica chinensis) Agronomy, 3, 404-418; doi:10.3390/agronomy3020404

Case, S.J., McNamara, N.P.; Reay, D.S., Whitaker, J.(2012). The effect of biochar

addition on N2O and CO2 emissions from a sandy loam soil—The role of soil aeration. Soil Biol. Biochem, 51, 125–134.

FAO (Food and Agriculture Organization of United Nations) Yearbook. (2017).

Retrieved from www..fao.org Fawole, O.B., T. J. Ajayi, M.O. Aduloju and J. O. Olaniyan. (2010). The use of Parkia husk

and melon wastes as soil amendment. Journal of Agric. Research and Development, University of Ilorin. In Press.

Fischer, D., Glaser B. (2012). Synergisms between compost and biochar for sustainable

soil amelioration. In: Sunil K, Bharti A (eds.) Management of organic waste. InTech, Rijeka, Croatia, pp 167– 198. doi:10.5772/31200

119

Guerrero, R.D. (2010). Vermicompost production and its use for crop production in the Philippines; Int J Environ Eng (Special Issue on ‘Vermiculture technology’); (Eds.) Rajiv K. Sinha et al. (Accepted for publication) https://bioinfopublication. org/files/articles/5_1_1_ JFA.pdf

Gupta, A.K., Ray, B., Singh, M.P., Upadhyaya, V., Singh, C.K. Effect of fertilizers and

vermicompost on growth, yield and biochemical changes in Abelmoschus esculentus (Bhindi). Plant Archives, 11(1),285-287.

Hukor, NN., Hamid, HA., Abdu, A and Mohd, KI. (2015). Effect of soil Compaction on

Growth and Physiological Characteristics of Azadirachta excelsa Seedlings. American Journal of Plant Physiology, 10, 25-42. DOI 10.3923/ajpp.2015.25.42

Jeffery, S.; Verheijen, F.G.A., van der Velde, M., Bastos, A.C. (2012). A quantitative

review of the effects of biochar application to soils on crop productivity using meta-analysis. Agric. Ecosyst. Environ, 144, 175–187.

Joseph, SD.,Yun Lin, Amonette, JE . (2010). An investigation into the reaction of

Biochar soil. Retrieved from https://www.researchgate.net/publication/202860264_An_Investigation_into_the_Reactions _of_Biochar_in_Soil

Kammann, C., Glaser, B., & Schmidt, HP.(2016). Combining biochar and organic

amendments. Retrieved from https://www.researchgate.net/publication/301295876

Mariscal, Algerico M. (2017). Cassava Production Technology Updates. PhilRootscrops,

VSU, Visca, Baybay City, Leyte. Retrieved on February 9, 2017 in http://rfu12.da.gov.ph/images/tipsonhowto/Cassava

Murmu K, Swain DK, Ghosh BC. (2013). Comparative assessment of conventional and

organic nutrient management on crop growth and yield and soil fertility in tomato-sweet corn production system. Aust J Crop Sci., 7(11),1617–1626.

Nweke, I. A., Ijearu, S. I., Igili, D. N. 2013. Effect of different sources of animal manure

on the growth and yield of okra (Abelmoschus Esculentus L.Moench) In Ustoxic Dystropept At Enugu South Eastern, Nigeria.INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH VOLUME 2, ISSUE 3, MARCH 2013 ISSN 2277-8616. IJSTR©2013 www.ijstr.org

Olatunji, US., Ayuba, A., and Oboh, V.U.(2006). Growth and yield of okra and tomatoes

as affected by pig dung and other organic manure. Am.J.Plant Physiol., I(2), 78-85.

Preston, CM., Schmidt, MWI. (2006). Black (pyrogenic) carbon: a synthesis of current

knowledge and uncertainties with special consideration of boreal regions. Biogeosciences 3: 397–420.

Rondon, M., Major, J., Riha, SJ., Lehmann J. 2012. Nutrient leaching in a Columbian savanna Oxinol amended with biochar. J. Environ.Qual., 41, 1076-1086.doi: 10.2134/jeq2011.0128(PubMed)

120

Saarnio, S., Heimonen, K., Kettunen, R. (2013). Biochar addition indirectly affects N2O emissions via soil moisture and plant N uptake. Soil Biol. Biochem., 58, 99–106.

Schulz, H., Dunst, G., Glaser, B. 2013. Positive Effects of Composted Biochar on Plant

Growth and Soil Fertility. Agron. Sustain. Dev. (2013) 33:817-27 DOI 10.1007/s13593-013-0150 -0. https://hal.archives-ouvertes.fr/hal-01201399/document

Senjobi, B. A., Peluola C. O., Senjobi C. T., Lawal I. O., Ande O.T. & Salami B. T. (2010).

Performance of Cochorus olitorius as influenced by soil type and organic manure amendments in Yewa North Local Government Area, Ogun State. African Journal of Biotechnology, 9(33), 5309-5312.

Singh R, Gupta RK, Patil RT, Sharma RR, Asrey R, Kumar A, Jangra KK.(2010). Sequential

foliar application of vermicompost leachates improves marketable fruit yield and quality of strawberry (Fragaria x ananassa Duch.). Scientia Horticulturae, 124,34-39.

Sohi, S.P. (2010). Analysis of scientific studies published on the function of char, its

quantification, and its stability in soil. In An Assessment of the Benefits and Issues Associated with the Application of Biochar to Soil; Shackley, S., Sohi, S.P., Eds.; A Report to the Department for Environment, Food and Rural Affairs and the Department of Energy and Climate Change: London, UK, 2010; pp. 1–4.

Sokchea, H., Borin, K., & Preston T. R. (2013). Effect of biochar from rice husks

(combusted in a downdraft gasifier or a paddy rice dryer) on production of rice fertilized with biodigester effluentor urea. Livestock Research for Rural Development, 25, Article #004. Retrieved, from http://www.lrrd.org/lrrd25/1/sokc25004.htm

Steiner, C., Teixeira W.G., Lehmann, J., Nehls T., De Macedo J.L.V., Blum, W.E.H., &

Zech, W. (2007). Long term effects of manure, charcoal and mineral fertilization on crop production and fertility on a highly weathered Central Amazonian upland soil, Plant Soil 291, 275–290.

Ty, C., Sina, V., Borin, Preston, TR. (2012). Effect of different levels of biochar on the

yield and nutritive value of Celery cabbage (Brassica chinensis var), Chinese cabbage (Brassica pekinensis), Mustard green (Brassica juncea) and Water spinach (Ipomoea aquatica). http://www.lrrd.org/lrrd25/1/chha25008.htm

Yamato M, Okimori Y, Wibowo IF, Anshori S, Ogawa M. (2006). Effects of the

application of charred bark in Acacia mangium on the yield of maize, cowpea, peanut and soil chemical properties in south Sumatra, Indonesia. Soil Sci. Plant Nutr, 52, 489–495.

Yin DW, Meng J, Zheng GP, Zhong XM, Yu L, Gao JP, Chen WF (2012). Effects of biochar

on acid black soil nutrient, soybean root and yield, Adv. Mater. Res., 524: 2278–2289.

121

INFLUENCE OF CASHEW APPLE (ANACARDIUM OCCIDENTALE) ON THE

STRESS LEVEL, PRODUCTIVITY, ORGANOLEPTIC PROPERTY AND

PROFITABILITY OF BROILER CHICKENS

Noel S. Tumbagahon Nora C. Cabaral


ABSTRACT

The study aimed to determine how feeding dried ground cashew apple pulp (DGCAP) and fermented cashew apple juice (FCAJ) affect the stress level, productivity, organoleptic property and profitability of broiler chickens. A total of 240 day old chicks were used and data were analyzed following 2x4 factorial CRD and significant differences between treatments were analyzed using Scheffe’s Test and Friedman’s Test. Broilers fed with 50 grams DGCAP significantly reduced the blood cortisol, lipid profile, enhanced the organoleptic property of cooked broiler meat in terms of texture, flavor, tenderness and general acceptability, improved the ADG, weight gain and FCR, and increase net income, income per bird and ROI. Fermented cashew apple showed significant effects on the blood cortisol, blood lipid profile, enhanced all the organoleptic property of cooked meat, increase dressing percentage and reduced abdominal fat pad. Moreover, FCA improved the growth rate and feed efficiency, net income, income per bird and ROI. Providing DGCAP and FCAJ significantly improved the blood cortisol and blood lipid profile, ADG, abdominal fat pad, net income, income per bird and ROI. Results suggested that feeding DGCAP and 30ml FCAJ were potential CP, energy and Vitamin supplement and potential alternative and natural feedstuff to reduce feed cost and

consequently to maximize profit in broiler production. Keywords: Fermented and dried ground cashew apple, cortisol, ADG, abdominal fat pad, economics

122

Introduction roiler is the fastest growing meat type chicken with a body weight of 1.5 – 1.8 kg in 4 weeks and more than 1.9 kg in 5 weeks (BAI, 2017; Tanod et al., 2015). However, such growth can only be achieved when quality diet was provided fulfilled the nutrient content (BAI, 2017; PSA,

2016) that can support rapid growth which is the inherent genetic potential of modern broiler (Murwani, 2010).

In addition, important factor is the implemented feeding

practices due to incorporation of various higher input costs of protein source feedstuff like soybean in feeds that has great impacts on animal growth and profitability (Cagauan et al., 2000). Moreover, extreme temperature brought about by climate change is known to have adverse impacts on egg and meat production and quality (Lara and Rostagno, 2013; Mashaly et al., 2004), animal metabolism and behavior (Mashaly et al., 2004; Quinteiro-Filho et al., 2010) leading to lower feed intake and productivity that can be attributed to heat stress. Problems associated with heat stress could be devastating particularly to smallholders having no access to temperature-controlled housing facilities.

The severity of response of the animal to heat stress may vary depending on its breed, species, physiological and nutritional status, and genetic potential (Devendra, 2012). Though poultry (i.e., chickens) undergo thermoregulatory adaptations during periods of heat stress (Lara and Rostagno, 2013), studies showed that exposure to high ambient temperature could suppress immune system of birds and may lead to death and high mortality rates if coupled with high relative humidity (Butcher and Miles, 2015; Lambio 2010). The strategy used by some broiler raisers to reduce the negative economic impacts of heat stress is by raising heat stress tolerant breeds and are well-adapted to Philippine climate and inclusion of cashew apple in the feeds that is well-known for its high CP content and other nutrients particularly high ascorbic acid (Vitamin C) of 200mg/100g and glumatic acid (28%) that can combat heat stress and had favorable immune-modulatory effect in poultry without any toxicity (Langhout, 2000; Blokhuis et al., 2018; Virden &

B

123

Kidd, 2009; Lopez, et al., 2012; Murwani and Bayuardhi, 2007; Nagaraja, 2008).

Various attempts are continuously being carried out to

improve the utilization of the existing commercial diets in the market. The most widely used additives in poultry feed are the antibiotic growth promoters (AGP), which act in the intestine of birds reducing the population of certain types of commensal bacteria, promoting better growth performance which is the standard additive in commercial broiler diets (Langhout, 2000; Blokhuis et al., 2018; Virden & Kidd, 2009; Lopez et al., 2012; Murwani and Bayuardhi, 2007). However, the use of AGP is being banned in animal feed due to the possibility of the emergence of resistant microorganisms.

Therefore, it is necessary to study in vivo various natural additives that have similar characteristics to the growth promoters, in order for them to be used in poultry feeding in the future (Langhout, 2000; Blokhuis et al., 2018; Virden & Kidd, 2009; Lopez et al., 2012). Several natural feed additives were developed and have become commercially available for efficient animal production such as probiotics, prebiotics, and enzymes, nutrient supplements such as minerals, amino acids and vitamins. Other naturally occurring additives are extracts from fruits, herbs and botanical (Murwani, 2008; Murwani et al., 2011, Bentoli, 2018, Murray, 2018). The cashew (Anacardium occidentale L.) is a tropical plant, scattered in almost all geographical area of MIMAROPA Region especially in Palawan and Occidental Mindoro (DA-RFU IVB). The fruit of the tree consists of an outer shell (epicarp), a tight-fitting inner shell (endocarp) and a strongly vesicant cashew nut that contains amounts of nutrients that can be utilized as probiotic and nature feed additives to enhance the performance, carcass yield, relative weight of internal organs and intestine microbiology of broiler chickens fed diets containing different inclusion levels of cashew apple (Lopez et al., 2012; Murwani, 2008; Murwani et al., 2011, Bentoli, 2018, Murray, 2018; Langhout, 2000; Blokhuis et al., 2018; Virden & Kidd, 2009; Murwani and Bayuardhi, 2007). Several studies had been conducted on cashew apple mixed with other feeds which were used for feeding different species of

124

animals in many parts of the world, like rabbits, pigs and layer and broiler chickens (Fanimo et al., 2003; Oddoye et al., 2017; Tanod et al., 2015; Nagaraha, 2008; Lopez et al., 2012; Swain et al., 2007; Oyewole et al., 2017; Armah, 2008) resulting to improved feed intake, weight gain, and feed conversion ratio can be utilized as probiotic and nature feed additives to enhance the performance, carcass yield, relative weight of internal organs and intestine microbiology of broiler chickens. However, studies with application on how feeding cashew apple influences the stress level, productivity (growth performance, feed efficiency, dressing percentage, abdominal fat pad, weight of giblets), organoleptic property and/or meat quality (cooked and freshly dressed) and economics in raising broiler chickens are limited hence, this study was conducted. If proven effective, broiler raisers could now engage in this kind of venture. Likewise, this will also contribute to the advocacy of implementing organic farming (i.e. cashew apple as potential feed additive and/or probiotics) that is becoming a popular practice in the country as stipulated in RA 10068 known as Organic Agricultural Act 2010.

Objectives The following are the objectives of the study: to determine the influence of cashew apple on the productivity, stress level, organoleptic property and profitability of broiler chickens specifically as follows: determine how dried ground cashew apple (DGCA) pulp influences the productivity (final body weight, ADG and weight gain, FCR, dressing percentage, weight of giblets and AFP); stress level (blood cortisol, LDL, HDL, triglycerides and cholesterol); organoleptic property (color, texture, flavor, tenderness, juiciness and general acceptability); and profitability (net income, income per bird and ROI) of broilers; determine how fermented cashew apple (FCA) juice influences the productivity (final body weight, ADG and weight gain, FCR, dressing percentage, weight of giblets and AFP); stress level (blood cortisol, LDL, HDL, triglycerides and cholesterol); organoleptic property (color, texture, flavor, tenderness, juiciness and general acceptability); and profitability (net income, income per bird and ROI) of broilers; and determine the influence of interaction of feeding dried ground cashew apple (DGCA) pulp and different levels of

125

fermented cashew apple (FCA) juice on the productivity, stress level, organoleptic property and profitability of broiler chickens.

Materials and Methods Materials The following are the materials that were used in conducting this study: broiler chicks (240 heads); fermented cashew apple juice (40 liters); dried ground cashew apple pulp (50 kg); commercial feeds (12 bags); disinfectant (creoline 1000 ml); commercial antibiotics, vitamins and minerals supplements (1 bottle); equipment and supply; experimental-brooder and grower cages (2 units); feeding trough-medium size (24 pcs); watering trough- 2 litres capacity (24 pcs); 10-watt bulbs (24 pcs); kerosene lamps (24 pcs); digital camera (1-unit); beaker-1000 ml capacity (1 pc); recording material (1 pc); newspaper (2 kgs); broom and dust pan (1 pc); syringes (24 pcs); and test tubes (24 pcs). Methods

To evaluate the influence of cashew apple on the stress level, productivity, organoleptic property and profitability of broiler chickens, the following were the methods followed by the researcher in the conduct of experiment. Experimental Design and Treatment

This study was experimental in nature, specifically following the 2x4 factorial experiment of the Completely Randomized Design (CRD). A total of 240 chicks were randomly distributed to different treatments and were replicated with ten (10) birds per replication. Factor A was the addition of ground cashew apple while Factor B was the different levels of fermented cashew apple juice. The various treatment combinations are presented in Table 1.

126

Table 1 Treatment Combinations Following a 2x4 Dactorial CRD that was Used in the Study

FACTOR A

(Dried Ground

Cashew Apple Pulp)

FACTOR B (Level of Fermented Cashiew Apple Juice)

B1 –

0 ml

B2 –

10 ml

B3 –

20 ml

B4 –

35 ml

A1 – Without A1B1 A1B2 A1B3 A1B4

A2 – With A2B1 A2B2 A2B3 A2B4

Legend: A1B1 – without supplementation of ground and fermented cashew

apple juice; A1B2 – without supplementation of ground with 10ml fermented cashew apple juice; A1B3 – without supplementation of ground with 20ml fermented cashew apple juice; A1B4 – without supplementation of ground with 30ml fermented cashew apple juice; A2B1 – with supplementation of ground but no fermented cashew apple juice; A2B2 – with supplementation of ground with 10ml fermented cashew apple juice; A2B3 – with supplementation of ground with 20ml fermented cashew apple juice; A2B4 – with supplementation of ground with 30ml fermented cashew apple juice.

Preparation and Construction of Experimental Pen There were two experimental pens and each pen was divided into twelve cages measuring 5 feet long, 3 feet wide, 3 feet high and the pens were elevated 3 feet from the ground. The pens were constructed using Bamboo slats that served as flooring and sliding door while good lumber for the structure of cages. The buri leaves were used as roofing materials that served as shed to provide cooler condition that is needed for growth and development of birds. Each pen was constructed a month before the actual study and was cleaned and disinfected using 3% Creoline solution. Moreover, the pens were arranged perpendicular to sunlight following east-west orientation. Acquisition of Raw Materials

The fermented and dried ground cashew apple pulps were acquired from the nearest cashew farm in Bulalacao, Oriental Mindoro.

127

Care and Management of the Broilers

1. Procurement of Stocks

Two hundred forty heads day old broiler chicks were procured from reliable poultry supplier at Roxas, Oriental Mindoro. To ensure better performance of chicks, the behavior (activity), conformation or appearance especially the eyes, feather and feet were considered.

2. Brooding Management

A total of 24 light bulbs (10 watts/cage) were installed

three (3) days before the arrival of the stocks. Pens were pre-heated before the arrival of the chicks. The behavior of the chicks was used as basis in determining the level of temperature inside the brooder cage. If the birds went nearer or far from the incandescent bulb adjustment was done immediately. Meanwhile, during power interruptions kerosene lamps were used to provide light and heat needed by birds. Heat in the brooder cage was conserved by providing old clean sacks and used magazines or newspapers as litter materials.

3. Feeding Management

After one week of feeding chick booster ration, the

stocks were fed with commercial broiler starter followed by broiler finisher. Birds in Factor B Treatments A2B1, A2B2, A2B3 and A2B4 received 50 grams of dried ground cashew apple pulp mixed in every kilogram of commercial ration. Gradual shifting of ration was done. Ad libitum was the feeding system employed.

4. Lighting Management

Trial and error experiment of the temperature was done

to make sure that it is above the comfort zone of chicken which was between 25-27oC using a thermometer. All cages were provided with similar light bulb in terms of watts based on the trial and error experiment prior to the conduct of the study.

128

5. Water Management

Pure water was given to the control group, while water with various proportions of fermented cashew apple juice was supplied to the test birds. This was supplied twice a day, once in the morning and once in the afternoon. During the last week of the experiment, water was supplied frequently to make the birds hydrated at all times due to warm environmental condition. All watering trough were cleaned with soap and water regularly.

6. Sanitation and Waste Management

The experimental area was cleaned regularly. In order

to obtain the good health of the birds, chicken dung was collected regularly once in the morning and once in the afternoon from each respective pen and was placed in old used sacks, hence the poultry house and its premises was free from house flies. These would make sure that the experimental area is free from any contamination brought by the flies. In addition, footbath was provided for strict implementation of biosecurity.

7. Blood Collection

Blood was collected after the duration of the study early

in the morning using six (6) mL capacity syringe. The blood samples were collected on the jugular vein of the chicken of about five (5) mL each sample of bird. Blood samples were stored using an ice box to prevent contamination during the transportation and immediately brought to Luna Goco Medical Hospital for cortisol analysis.

8. Marketing

After 35 days of rearing, with an approximately 1.5 to 1.8

kg body weight, broilers were harvested and marketed (dressed weight).

129

Data Gathering

The following were carefully observed and recorded to serve as basis for the analysis and evaluation on the influence of cashew apple on the productivity, stress level, organoleptic property and profitability of broiler chickens. This was done before, during and after 35±5 days of rearing period of birds. Stress Level Blood cortisol and Blood lipid profile. Blood samples were collected through jugular vein before harvesting the chicken at 35 days of rearing period. This was brought immediately at Luna Goco Hospital to analyze the Blood cortisol, LDL, HDL, Triglycerides and Cholesterol. Productivity Initial weight. This was obtained by weighing the chicks on the day of arrival using the standard weighing scale and was recorded in grams. Final live weight. This was determined by weighing the birds on the last day (35 days) of rearing period using the standard weighing scale and was recorded in grams. Average daily gain. This was obtained by dividing the final live weight to the number of days of rearing period. Gain in weight. This was determined by subtracting the initial weight from the final weight of the birds after 35 days of growing period. Feed consumption. This was obtained by getting the difference of the amount of feeds given to the birds from the left over feeds. Feed Conversion Ratio. This was determined by dividing the final gain in weight with the total amount of feeds consumed in kilograms. This was done to all treatments of the study.

130

Dressing Percentage. This was obtained by dividing the dressed weight of the birds by final weight x 100%. Abdominal Fat Pad. This was measured using the Vernier calliper.

Weight of Giblets. This was obtained after dressing, and the

heart, gizzard and liver were weighed separately using a digital weighing scale and were recorded for analysis. Organoleptic Property This was evaluated with 40 evaluators and was obtained using the five (5) hedonic scales mentioned by Cabaral et al., (2017) and Rieta & Cabaral, (2018) as follows: Color 5 Very acceptable 4 – Slightly acceptable 3 – Neither acceptable nor unacceptable 2 – Slightly unacceptable 1 – Very unacceptable Texture 5 – Very fine 4 – Fine 3 – Neither fine nor coarse 2 – Coarse 1 – Very coarse Juiciness 5 – Very juicy 4 – Juicy 3 – Neither juicy nor dry 2 – Dry 1 – Very dry Flavor 5 – Very rich meat flavor 4 – Rich meat flavor 3 – Neither rich nor bland

131

2 – Bland 1 – Very bland Tenderness 5 – Very tender 4 – Tender 3 – Neither tender nor tough 2 – Tough 1 – Very tough General acceptability 5 – Very acceptable 4 – Slightly acceptable 3 – Neither acceptable nor unacceptable 2 – Slightly unacceptable 1 – Very unacceptable Profitability

Net income. This was computed by subtracting total cost from total sales.

Income/bird. This was obtained by dividing total number of birds harvested from the total sales.

Return of Investment. This was obtained by dividing the total cost from net income. Statistical Analysis The various data gathered were analyzed and interpreted using the analysis of variance (ANOVA) following the 2x4 factorial experiment in Completely Randomized Design (CRD). This was set at 5% and 1% level of significance. Differences between and among treatments were analyzed using Scheffe’s Test.

132

Results and Discussion A. Stress Level

Dried Ground Cashew Apple Pulp. The analysis shows significant (p<0.01) differences on the blood cortisol level and blood lipid profile of broilers fed with dried ground cashew apple pulp (DGCAP) raised under induced heat stress (AET±3oC). Broilers fed with 50 grams DGCAP in the dietary ration has significantly (p<0.01) lower blood cortisol level, LDL (bad cholesterol), triglycerides, cholesterol, and higher HDL (good cholesterol) compared to the cortisol level and blood lipid profile of broilers fed without any inclusion of DGCAP in the dietary ration (Table 1).

Results in the lower cortisol level can be associated to the

higher Vitamin C, niacin, riboflavin and thiamine content and essential amino acids particularly glutamic acid which enhanced performance of broilers exposed to different concurrent stressors found in the environment that significantly (p<0.01) lower cortisol level, thus has the potential to combat heat stress through efficient feed utilization that consequently enhance nutrient absorption and had favorable immune-modulatory effect in poultry without any toxicity due to moderation of cortisol level in blood and urine (Mckee and Harrison, 1995; Okpanachi et al., 2016; Bhat and Nagarala, 2008; Oyewole et al., 2018) that reduce stress and anxiety (Oliveira, 2015), thus relaxes the animals which consequently reduces the incidence of stress. Furthermore, lower level of stress hormone (blood cortisol) can be correlated to the lower LDL, triglycerides, and total cholesterol which consequently enhanced the good cholesterol (Oyewole et al., 2018).

Results are in line with the findings reported by Perai, et. al. (2014) and Seyrek et. al. (2004) that Vitamin C in cashew apple significantly lowers the blood triglycerides of broiler. Likewise, decreased triglyceride levels, decreased low-density lipoprotein, and cholesterol levels were observed in broilers treated with Vitamin C. On the other hand, nutrient composition of cashew apple, such as Vitamin C, niacin, riboflavin and thiamine content and essential amino acids particularly glutamic acid content significantly (p<0.01) reduced blood triglycerides of broilers even under heat stress due to its favorable immune-modulatory effects to combat heat stress without any toxicity or adverse effects (Perai, et. al., 2014; Okpanachi et al.,

133

2016; Bhat and Nagarala, 2008). In contrast, Famino et al. (2003) reported that feeding cashew apple either fresh or dried have comparable effects (p>0.05) on the blood profile and cortisol level. Table 1 Stress Level in Terms of Blood Cortisol and Blood Lipid Profile (mg/dL) of Broilers Fed with or without Dried Ground Cashew Apple Pulp

FACTOR A (dried ground cashew apple)

CORTISOL LDL HDL TRIG CHOL

Without DGCAP 126.625a 68.975a 35.750b 261.413a 152.180a

With 50 grams DGCAP 118.583b 66.243b 34.750a 198.968b 140.785b

Legend: DGCAP – dried ground cashew apple pulp; TRIG – triglycerides; CHOL – cholesterol; Means within column having different superscripts are significantly different (p<0.01).

Fermented Cashew Apple Juice. Findings on the blood

cortisol and blood lipid profile of broilers raised under induced heat stress (AET±3oC) and fed with fermented cashew apple juice (FCAJ) regardless of level have significant (p<0.01) effects (Table 2).

In general, analysis reveals that providing 35ml FCAJ in broiler’s ration significantly (p<0.01) lowered the blood cortisol and blood lipid profile (i.e. triglycerides and cholesterol). In addition, birds provided with 35ml FCAJ had the significantly higher LDL (good cholesterol). On the other hand, provision of FCAJ on the dietary ration of broilers did not trigger changes in blood HDL (bad cholesterol).

Findings can be associated with the fact that heat-stressed broilers supplemented with various fermented feedstuff which contained several nutrients in the drinking water and diet showed improved performance (Kamalasana et al., 2002; Vierden and Kidd, 2009) due to enhance effect of lactic acid in the fermented cashew apple that improved the villi in the intestine hence improve nutrient digestibility and absorption (Langhout, 2000; Blokhuis et al., 2018; Virden & Kidd, 2009; Lopez et al., 2012; Murwani and Bayuardhi, 2007; Murwani, 2008; Murwani et al., 2011, Bentoli, 2018, Murray, 2018).

134

In addition, providing comfort and reduced stress due to lower cortisol, bad cholesterol, triglycerides, cholesterol and moderate range of good cholesterol can be attributed to the vitamin contents and essential amino acid contents of cashew apple that might have help the broilers cope with stress by reducing electrolytes excretion while improving electrolytes absorption during heat-stress condition, thus relaxes the animals which consequently reduces the incidence of stress (Oyewole et al., 2018).

The results are supported by the finding of Rafiee et al., (2016); Oyewole et al. (2018); Seyrek et al. (2004) who reported decreased in LDL fed in animals (broilers, quails) with feedstuff containing vitamin C could suppressed the negative effects of heat stress that significantly (p<0.01) lower the LDL of broilers even under heat stress due to it had favorable immune-modulatory effects to combat heat stress without any toxicity or adverse effects (Okpanachi et al., 2016; Bhat and Nagarala, 2008). Table 2 Stress Level in Terms of Blood Cortisol and Blood Lipid Profile (mg/dL) of Broilers Provided with Different Levels of Fermented Cashew Apple Juice

FACTOR B (Fermented Cashew Apple Juice)

CORT LDL HDL TRIG CHOL

Pure Potable Water 134.750a 63.190b 34.550a 254.835a 158.835a

10ml FCAJ + 990ml water 120.833b 67.345b 33.250a 234.880b 145.370b

20ml FCAJ + 980ml water 117.833b 65.285b 32.500a 219.885c 143.810b

35ml FCAJ + 970ml water 117.000b 74.615a 31.000a 211.160d 137.920c

Legend: TRIG – triglycerides; CHOL – cholesterol; CORT- cortisol;. Means within column having similar superscripts are significantly different (p<0.01).

B. Productivity b.1. Growth Performance and Feed Efficiency

Dried Ground Cashew Apple Pulp. The final body weight among broilers used in the experiment after 35 days of rearing raised under induced heat stress (AET±3oC) fed with dried ground cashew

135

apple pulp (DGCAP) are comparable (p>0.05). However, analysis on the average daily gain, weight gain and feed conversion ratio (FCR) showed highly significant different (p<0.01).

Moreover, broilers fed with 50 grams DGCAP had significantly heavier (p<0.01) average daily gain with 52.083 grams per day, weight gain of 1.572 kg after 35 days and were more efficient in converting feeds into meat with an FCR of 1.338 (Table 3).

These results can be associated with the higher digestibility rate of cashew apple, high protein but low fiber content, essential minerals, appreciable quantities of vitamins A and high content of ascorbic acid and glutamic acid (Morton, 2018; Oliveira, 2015; Campbell, 2018) that may enhance feed intake that consequently improve the growth rate and feed efficiency of animals through improve nutrient digestion and absorption (Fanimo et al., 2003; Oddoye et al., 2017; Liwayway, 2013; Song and Seng, 2008; Okpanachi et al., 2016).

Results were in line with the findings reported by several researchers (Fanimo et al., 2003; Tanod et al., 2015; Nagaraha, 2008; Lopez et al., 2012; Swain et al., 2007; Oyewole et al., 2018; Armah, 2008) who found out that cashew apple indeed improved growth performance (i.e., body weight, weight gain, and ADG) and enhanced nutrient digestibility, that consequently enhanced the feed efficiency through efficient feed utilization that also consequently enhanced nutrient absorption. On the contrary, Oddoye et al., (2017) reported that feeding cashew apple in the dietary ration have comparable (p>0.05) growth performance and feed efficiency but mentioned that no detrimental effects or adverse effects was observed in animals fed with cashew apple.

136

Table 3 Growth Rate and Feed Efficiency Fed with or without Dried Ground Cashew Apple Pulp

FACTOR A (dried ground cashew apple pulp)

FWT(kg) ADG(g/day) WTG(kg) FCR

Without DGCAP 1.592a 49.667b 1.502b 1.401a

With 50 grams DGCAP 1.644a 52.083a 1.572a 1.338b

Legend: FWT – final body weight; ADG – average daily gain; WTG – weight gain; FCR – feed conversion ratio; Means within column having different superscripts are significantly different (p<0.01).

Fermented Cashew Apple Juice. Generally, findings on the growth rate and feed efficiency of broilers raised under induced heat stress (AET±3oC) and fed with fermented cashew apple juice (FCAJ) regardless of level had significant (p<0.01) effects (Table 4).

Moreover, analysis reveals that providing 35ml FCAJ in

broiler’s ration significantly (p<0.01) enhanced the final body weight, average daily gain, weight gain and were more efficient in converting feeds into meat.


rate of fermented cashew apple, high protein but low fiber content, essential minerals, had appreciable quantities of vitamins A and high content of ascorbic acid (Morton, 2018; Oliveira, 2015; Campbell, 2018; Famino et al., 2003) that may enhances feed intake that consequently improved the growth performance, nutrient digestibility and carcass characteristics.

The results can be attributed to the high crude protein

content of cashew apple that are highly digestible (Fernandez, 2001; Vaidehi et al., 2000; Nagarala, 2007) and other nutrients like iron, probiotics (lactic acid through fermentation), lysine (essential amino acid) that enhance nutrient absorption, its high glutamic acid (28%) content that has favorable immune-modulatory effect to combat heat stress on poultry without any toxicity (Bhat and Nagarala, 2008), hence improve the growth performance and feed efficiency of animals. In addition, it contains various essential amino acid Met, Thr, Arg, Val, Cys, Gly, Ser, Tyr, Phe, Ala, His, Pro, and Aspartic acid, Valine

137

which contain glucogenic compound that could be converted to glucose as energy source by the animals that consequently improves feed intake and growth performance and feed efficiency (Huggins, 2007; Leterme et al., 2009; Ly et al., 2002; Malek et al., 2008; Murthy et al., 2013; Parashuramulu et al., 2013; Vierden and Kidd, 2009; Song and Seng, 2008; Armah, 2015; Okpanachi et al., 2016; Oyewole et al., 2018; Tanod et al., 2015; Famino et al., 2003).

In contrast, Oddoye et al. (2017) reported that supplementing cashew apple in the dietary ration have comparable (p>0.05) growth performance and feed efficiency but mentioned that no detrimental effects or adverse effects was observed in animals fed with cashew apple. Differences in results can be attributed to the variety of cashew apple, how, when, and where cashew apple is produced.

Table 4 Growth Rate and Feed Efficiency Provided with Fermented Cashew Apple Juice

FACTOR B (Fermented Cashew Apple Juice) FWT ADG WTG FCR

Pure Potable Water 1.453b 46.333c 1.445b 1.438a

10ml FCAJ + 990ml water 1.588ab 51.333b 1.528ab 1.382ab

20ml FCAJ + 980ml water 1.623ab 52.000b 1.563ab 1.347b

35ml FCAJ + 970ml water 1.807a 53.833a 1.610a 1.312b

Legend: FWT – final body weight; ADG – average daily gain; WTG – weight gain; FCR – feed conversion ratio; Means within column having different superscripts are significantly different (p<0.01).

b.2. Dressing percentage, abdominal fat pad and weight of giblets

Dried Ground Cashew Apple Pulp. The broilers used in the experiment after 35 days of rearing raised under induced heat stress (AET±3oC) fed with dried ground cashew apple pulp (DGCAP) had significantly higher (p<0.01) dressing percentage of 77% compared to broilers fed with pure commercial feeds with 74%. On the other hand, broilers fed with dried ground cashew apple pulp (DGCAP) has significantly lower (p<0.01) abdominal fat pad (AFP) with 6.283mm compared to broilers fed with pure commercial feeds with 7.610mm

138

AFP. In terms of weight of giblets, analysis revealed comparable (p>0.05) weights of heart, liver and gizzard (Table 5).


rate of cashew apple, high protein but low fiber content, essential minerals like iron, calcium, magnesium, phosphorus, appreciable quantities of vitamins A and high content of ascorbic acid (Morton, 2018; Oliveira, 2015; Campbell, 2018) that may enhance feed intake that consequently improves the growth rate and feed efficiency of animals through improve nutrient digestion and absorption (Fanimo et al., n.d.; Oddoye et al., 2017; Liwayway, 2013; Song and Seng, 2008; Okpanachi et al., 2016), hence increases the dressing percentage while reducing the abdominal fat pad. Table 5 Dressing Percentage, Abdominal Fat Pad and Weight of Giblets of Broilers Fed with or without Dried Ground Cashew Apple Pulp


DP

AFP(mm)

WEIGHT OF GIBLETS (grams)

HEART LIVER GIZZARD

Without DGCAP 74.186b 7.610a 0.013a 0.558a 0.519a

With 50 grams DGCAP 77.090a 6.283b 0.010a 0.575a 0.537a

Legend: DP– dressing percentage; AFP – abdominal fat pad Means within column having different superscripts are significantly different (p<0.01).

Fermented Cashew Apple Juice. The broilers used in the experiment after 35 days of rearing raised under induced heat stress (AET±3oC) fed with fermented cashew apple juice (FCAJ) had significantly higher (p<0.01) dressing percentage compared to broilers fed with pure potable water. On the other hand, broilers fed with fermented cashew apple juice (FCAJ) had significantly lower (p<0.01) abdominal fat pad (AFP) compared to broilers fed with pure commercial feeds. Analysis on the weight of giblets revealed comparable (p>0.05) weights of heart, liver and gizzard (Table 14).

139

Moreover, analysis reveals that providing 35ml FCAJ in broiler’s ration significantly (p<0.01) enhanced the dressing percentage of 77% which can be associated with the significant (p<0.01) final body weight, average daily gain, weight gain and are more efficient in converting feeds into meat. This result was attributed to the fermentation process which helps improve its enzyme content, increasing its levels and makes the food more digestible through lactic acid production which enhances the villi in the animal’s intestine to absorb and digest feed more efficiently, and thus boosts the usable (amino acids) protein level and more palatable and digestible feed, which improves the overall animal performance (da Silva, 2017) in terms of higher dressing percentage and lower abdominal fat pad.


rate of fermented cashew apple, high protein (Fernandez, 2001; Vaidehi et al., 2000; Nagarala, 2007) but low fiber content, essential minerals like iron, calcium, magnesium, phosphorus, has appreciable quantities of vitamins A and high content of ascorbic acid (Morton, 2018; Oliveira, 2015; Campbell, 2018; Nagarala, 2008; Armah, 2015; Lopez et al., 2012; Tanod et al., 2015) that may enhance feed intake that consequently improve the dressing percentage and reduces abdominal fat pad of broilers fed with cashew apple.

In addition, cashew apple had higher amount of glutamic

acid (28%) content that has favorable immune-modulatory effect to combat heat stress on poultry without any toxicity (Bhat and Nagarala, 2008), hence improve the growth performance and feed efficiency of animals that consequently increases the dressing percentage and enhances the quality of the meat by reducing the abdominal fat pad.

Results implies that feeding cashew apple produces a healthy broiler chickens due to the significant increase (p<0.01) in growth performance but significantly lower (p<0.01) blood cortisol and blood lipid in general as well as reduced (p<0.01) abdominal fat pad.

These findings are similar to the reported effects of cashew apple of several researchers (Huggins, 2007; Leterme et al., 2009; Ly et al., 2002; Malek et al., 2008; Murthy et al., 2013; Parashuramulu et

140

al., 2013; Vierden and Kidd, 2009; Song and Seng, 2008; Armah, 2015; Okpanachi et al., 2016; Oyewole et al., 2018; Tanod et al., 2015; Famino et al., 2003) in animal feeding and nutrition who discussed and mentioned through research results that cashew apple (either ground or fermented) had significant (p<0.01) effects on the growth performance in terms of increase dressing percentage and AFP reduction.

On the other hand, Tanod et al., (2015) reported that feeding

cashew apple had significant (p<0.05) effects on the giblets weight. Differences in results can be attributed to the variety of cashew apple, how, when, and where (geographical location) cashew apple is produced. Table 6 Dressing Percentage, Abdominal Fat Pad and Weight of Giblets of Broilers Fed with Different Levels of Fermented Cashew Apple Juice

FACTOR B (Fermented Cashew Apple Juice)

DP AFP

(mm) WEIGHT OF GIBLETS(grams)

HEART LIVER GIZZARD

Pure Potable Water 73.865b 8.065a 0.010a 0.456a 0.533a

10ml FCAJ+ 990ml water 75.202ab 7.812b 0.012a 0.584a 0.508a

20ml FCAJ + 980ml water 77.672a 7.725c 0.012a 0.603a 0.492a

35ml FCAJ + 970ml water 77.817a 5.585d 0.012a 0.623a 0.578a

Legend: DP– dressing percentage; AFP – abdominal fat pad Means within column

having different superscripts are significantly different (p<0.01).

C. Organoleptic Property

Dried Ground Cashew Apple Pulp. In general, results reveal

significant (p<0.01) differences on the organoleptic property of broilers fed with dried ground cashew apple pulp (DGCAP) raised under induced heat stress (AET±3oC) in terms of texture, flavor, tenderness, juiciness and general acceptability. On the other hand,

141

findings showed that provision of DGCAP has comparable effects in cooked broiler meat color (Table 7).

Results can be attributed to the fact that heat-stressed

broilers supplemented with various vitamins and nutrients needed in nutrient absorption (i.e. Vitamin C, niacin, riboflavin and thiamine, higher CP and energy) in the drinking water and diet showed improved performance (Kamalasana et al., 2002; Vierden and Kidd, 2009). In addition, providing comfort and reduced stress and vitamin contents of cashew apple might help the broilers cope with stress by reducing electrolytes excretion while improving electrolytes absorption during heat-stress condition, thus relaxes the animals which consequently reduces the incidence of stress, thus enhances the texture, flavor, tenderness, juiciness and general acceptability of the meat produced.

Results in the enhanced texture, flavor, tenderness, juiciness

and general acceptability of broiler meat provided with cashew apple can be associated with the higher Vitamin C and glumatic acid which enhanced the overall meat quality of the cooked broiler meat (Mckee and Harrison, 2019).

In addition glutamic acid is an essential amino acids coupled

with the higher amount of Vitamin C that significantly (p<0.01) lowers cortisol level and blood lipid profile, thus has the potential to combat heat stress through efficient feed utilization that consequently enhances nutrient absorption (Okpanachi et al., 2016; Bhat and Nagarala, 2008; Oyewole et al., 2018) and thus relaxes the animals which consequently reduces the incidence of stress and improves the meat quality (Oyewole et al., 2018).

Results are in line with the findings reported by Perai, et al.

(2014) and Seyrek et al. (2004) that high amount of Vitamin C and glutamic acid in cashew apple significantly enhances the broiler meat. Moreover, Famino et al., (2003) reported that feeding cashew apple either fresh or dried have significant effects (p<0.05) on the blood profile and cortisol level that consequently produces a quality, healthy and nutritious meat.

142

Table 7 Organoleptic Property of Broilers Fed with or without Dried Ground Cashew Apple Pulp

FACTOR A (Dried Ground Cashew Apple Pulp)

COL TEX FLV TEN JUI GEN. ACC

Without DGCAP 4.124a 3.890b 3.909b 3.917b 3.890b 4.161b

With 50 grams DGCAP 4.208a 4.161a 4.054a 4.243a 4.063a 4.320a

Legend: COL – color; TEX – texture; FLV – flavor; TEN – tenderness; JUI-juiciness; GEN.ACC- general acceptability; Means within column having different superscripts are significantly different (p<0.01).

Fermented Cashew Apple Juice. Findings on the organoleptic

property of broilers raised under induced heat stress (AET±3oC) and fed with fermented cashew apple juice (FCAJ) regardless of level has significant (p<0.01) effects (Table 8).

In general, analysis on the 5-hedonic scale (Cabaral et al.,

2017 and Rieta & Cabaral, 2018) reveal that providing 35ml FCAJ in broiler’s ration significantly (p<0.01) enhanced the texture, flavor, tenderness and juiciness of cooked broiler meat. On the other hand, provision of fermented cashew apple in the ration did not cause any chances in cooked meat color and general acceptability.

These results can be associated with the higher digestibility rate of fermented cashew apple, high protein but low fiber content, essential minerals like iron, calcium, magnesium, phosphorus, has appreciable quantities of vitamins A and high content of ascorbic acid (Morton, 2018; Oliveira, 2015; Campbell, 2018) that may enhance feed intake that consequently improves the meat quality in terms of the color, flavor, juiciness and general acceptability of broilers fed with cashew apple. These results are in line with the findings reported by several researchers (Mckee and Oyewole et al., 2018; Harrison, 2019; Okpanachi et al., 2016; Bhat and Nagarala, 2008; Oyewole et al., 2018; Okpanachi et al., 2016; Bhat and Nagarala, 2008; Perai, et. al., 2014; and Seyrek et. al., 2004; Famino et al., 2003) who found out and reported that inclusion of cashew apple in the diet indeed enhance the organoleptic property of the meat.

143

Moreover, more tender and juicy meat of broilers fed with cashew apple could be attributed to the fact that heat-stressed broilers when supplemented with various vitamins and nutrients needed in nutrient absorption (i.e., Vitamin C, niacin, riboflavin and thiamine, higher CP and energy) in the drinking water and diet showed improved meat quality due to high nutrient digestion and absorption (Kamalasana et al., 2002; Vierden and Kidd, 2009).

In addition, providing comfort and reduced stress and vitamin contents of cashew apple might help the broilers cope with stress by reducing electrolytes excretion while improving electrolytes absorption during heat-stress condition (Perai, et. al., 2014; Okpanachi et al., 2016; Bhat and Nagarala, 2008; Seyrek et. al., 2004; Oyewole et al., 2018; Okpanachi et al., 2016; Bhat and Nagarala, 2008; Oyewole et al., 2018), thus relaxes the animals which consequently reduces the incidence of stress, thus enhances the tenderness of the meat produced. Table 8 Organoleptic Property of Broilers of Broilers Provided with Different Levels of Fermented Cashew Apple Juice

FACTOR B (Fermented

Cashew Apple Juice)

COL TEX FLV TEN JUI GEN. ACC

Pure Potable Water 4.027a 3.848b 3.722b 3.875b 3.793b 4.098a 10ml FCAJ + 990ml water

4.178a 4.002ab 3.928ab 4.085ab 3.890ab 4.168a

20ml FCAJ + 980ml water

4.208a 4.042ab 4.055a 4.112a 4.083ab 4.335a

35ml FCAJ + 970ml water

4.250a 4.210a 4.221a 4.248a 4.140a 4.360a

Legend: COL – color; TEX – texture; FLV – flavor; TEN – tenderness; JUI-juiciness; GEN.ACC- general acceptability; Means within column having different superscripts are significantly different (p<0.01).

D. Profitability

Dried Ground Cashew Apple Pulp. In general, results (Table

9) revealed that raising broilers fed with 50 grams dried ground cashew apple pulp has significantly (p<0.01) higher net income, income per bird and return on investment even raised under induced

144

heat stress (AET±3oC). These results can be associated with the significantly (p<0.01) higher average daily gain, weight gain, and dressing percentage that consequently improved the final body weight of broilers that were used as the basis for marketing.

Results on the higher net income, income per bird and ROI are associated with the higher dressing percentage which could be correlated to the significantly higher (p<0.01) final body weight, ADG, weight gain and efficient FCR and growth performance (Tables 9 to 14) but significantly lower (p<0.01) blood cortisol and blood lipid (Tables 2 to 8) of broilers provided with dried ground cashew apple pulp in the dietary ration.

These results in economics and profitability of broiler raising are in line with the findings of several researchers (Huggins, 2007; Leterme et al., 2009; Ly et al., 2002; Malek et al., 2008; Murthy et al., 2013; Parashuramulu et al., 2013; Vierden and Kidd, 2009; Song and Seng, 2008; Armah, 2015; Okpanachi et al., 2016; Oyewole et al., 2018; Tanod et al., 2015; Famino et al., 2003; Tanod et al., 2015; Lopez et al., 2012;Oddoye et al., 2017) that inclusion of cashew apple indeed improved the profit due to lower production costs and higher body weight and dressing percentage owing to efficient feed conversion ratio. Table 9 Profitability of Raising Broilers in Terms of Net Income, Income/Bird and Return of Investment Fed with or without Dried Ground Cashew Apple Pulp


NET INCOME

INCOME PER BIRD

RETURN ON INVESTMENT

Without DGCAP 833.39b 83.338b 28.084b

With 50 grams DGCAP 967.28a 96.728a 32.591a

Means within column having different superscripts are significantly different (p<0.01).

Fermented Cashew Apple Juice. The economics of raising

broilers fed with different levels of fermented cashew apple juice (FCAJ) has significant (p<0.01) effects (Table 10) in the ration under induced heat (AET±3oC) stress which was recorded. Return on investment was also computed and analyzed to determine the

145

economic impact of the study for the dissemination of the results to different broiler raisers.

In general, analysis reveals that broilers provided with 35ml

FCAJ in the dietary ration has the highest incurred net income, income per bird and return on investment that was highly significant (p<0.01) from the income of raising broilers provided with 10ml, 20ml and broilers provided with pure potable water (Table 21).

Results can be attributed to the highly significant (p<0.01)

final body weight of broilers provided with 35ml FCAJ in the diet even under induced heat stress (AET±3oC) that acts as an alternative protein source that enhances nutrient digestion and absorption (Morton, 2018; Oliveira, 2015; Campbell, 2018), hence considered a low-cost of production input, therefore decreases the total costs that consequently improves the net income and ROI.

Findings are similar to the findings reported by Huggins,

2007; Leterme et al., 2009; Ly et al., 2002; Malek et al., 2008; Murthy et al., 2013; Parashuramulu et al., 2013; Vierden and Kidd, 2009; Song and Seng, 2008; Armah, 2015; Okpanachi et al., 2016; Oyewole et al., 2018; Tanod et al., 2015; Famino et al., 2003; Tanod et al., 2015; Lopez et al., 2012; and Oddoye et al., 2017 that inclusion of cashew apple indeed improved the profit due to lower production costs due to efficient feed conversion ratio and higher body weight and dressing percentage owing to increase total sales. Table 10 Productivity of Raising Broilers in Terms of Net Income, Income/Bird and Return of Investment Provided with Different Levels of Fermented Cashew Apple Juice

FACTOR B (fermented cashew apple juice)

NET INCOME

INCOME PER BIRD

RETURN ON INVESTMENT

Pure Potable Water 488.58c 48.857c 16.625c

10ml FCAJ + 990ml water 910.89b 91.085b 35.765b

20ml FCAJ + 980ml water 979.70b 97.972b 32.988b

35ml FCAJ + 970ml water 1222.20a 122.218a 40.972a

Means within column having different superscripts are significantly different (p<0.01).

146

Conclusions

The findings of the study led to the following conclusion:

1. Feeding dried ground cashew apple pulp reduced the blood cortisol and blood lipid profile, enhanced the organoleptic property of cooked broiler meat in terms of texture, flavor, tenderness and general acceptability, improved the ADG, weight gain and FCR, and increase the overall net income, income per bird and ROI.

2. Feeding FCAJ showed reduction in blood cortisol and blood lipid profile, enhanced all the organoleptic property of cooked meat as well as the meat quality in terms of improving the dressing percentage and reducing abdominal fat pad, improves the growth rate and feed efficiency, net income, income per bird and ROI.

3. Providing dried ground cashew apple pulp and fermented cashew apple juice improved the blood cortisol and blood lipid profile, ADG, abdominal fat pad, and profitability in terms of net income, income per bird and ROI.

Literatures Cited

Armah, I., & Adu, NII. (2015). The effect of starter-grower pigs fed diets containing varying levels of dried cashew (Anarcadium occidentale L.) Pulp (DCP). Retrieved from http://dspace.knust.edu.gh/handle/123456789/7011

Bentoli. (2018). Managing Symptoms of Poultry Stress in Broiler Chickens. Retrieved

October 15, 2018, from https://www.bentoli.com/broiler-chickens-stress-management/

Blokhuis, H., Hopster, H., Geverink, N., Korte, S. And Reenen, C. (2018). Studies of

StressiIn Farm Animals. Retrieved October 15, 2018, from https://link.springer.com/article/10.1007/BF02642498

Cabaral, N., Hugo U, & Rieta, P.G. (2017). Type of music on the growth and laying

performance, behavior and marketability of quails. Open Science Journal. DOI: 10.23954/osj.v2i4.1089. Retrieved from https://www.researchgate.net/publication/322240800_Type_of_Music_on_the_Growth_and_Laying_Performance_Behavior_and_Marketability_of_Quails.

147

Famino, A. Oduguwa, O., Alade, A., Ogunnaike, T., & Adesehinwa, A. (2003). Growth performance, nutrient digestibility and carcass characteristic of growing rabbits fed cashew apple waste. Retrieved July 14, 2017, from http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.514.1059&rep=rep1&type=pdf

Lara, L. (2013). Impact of heat stress on poultry production. Retrieved March 2, 2018,

fom https://www.dexmedica.com/s/stress-impact-on-health MCKee, J. S., & Harrison P. C. (1995). Effects of supplemental ascorbic acid on the

performance of broiler chickens exposed to multiple concurrent stressors. Retrieved February 25, 2019 from https://academic.oup.com/ps/article-abstract/74/11/1772/1574516

Murray, M. (2018). Reducing stress in your flock. Retrieved October, 15, 2015, from

https://blog.mcmurrayhatchery.com/2017/03/01/reducing-stress-flock/ Oddoye, E., Takrama, J., Anchirina, V., & Badu K. (2017). Effects on performance of

growing pigs fed diets containing different levels of dried cashew pulp. Retrieved July 14, 2017, from https://link.springer.com/article/10.1007/s11250-009-9349-0

Okpanachi, U., Ayoade, J., & Tuleun, C (2015). Carcass characteristics, internal organs

and profitability of feeding sun-dried yellow cashew pulp based diets to West African dwarf goats. Retrieved July 21, 2017, from http://article.sciencepublishinggroup.com/html/10.11648.j.avs.s.2016040351.11.html

Oliveira, A. (2015). Effects of oral vitamin C supplementation on anxiety in students: A

Double-Blind, Randomized, Placebo-Controlled Trial. Retrieved September 5, 2018, from https://www.ncbi.nlm.nih.gov/pubmed/26353411

Oyewole, B.O., Rotimi, E.A., Anthony, F.O. And Adewumi, J. (2018). Performance and

blood parameters of starter broilers fed diets containing cashew pulp meal. Fudma-journal of Agric. and agric. Tech. Vol. 3, no. 1, pp 87-92.

Rieta, P.G., & Cabaral, N.C., (2018). Acceptability, Marketability, and Economics of

Organically Grown Broiler Fed with Azolla. Asian Journal of Science and Technology: ISSN: 0976-3376; https://www.journalajst.com; Vol. 09, Issue 06, pp 8277-8282.

Song M., & Seng, M., (2008). Nutritive value of cashew apple for growing duck.

Retrieved March 2, 2018, from http://www.tropentag.de/2008/abstracts/posters/483.pdf

Swain, B.K., Sundaram R.N.S., & Barbuddhe R.N.S. (2007). Effect of feeding cashew apple waste replacing maize on the performance of broilers. Indian Journal of Poultry Science. 42, (2) 208-210.

Virden, S., & Kidd, T. (2009). Physiological stress in broilers: Ramifications on nutrient digestibility and responses. Retrieved October 15, 2018, from https://academic.oup.com/japr/article/18/2/338/705613.

148

PHENOTYPIC CHARACTERIZATION OF VARIOUS GOAT GENE POOL

(CAPRA HIRCUS) IN ORIENTAL MINDORO

Rosalie Malvaz Nora C. Cabaral


ABSTRACT

This study aimed to phenotypically characterize the Philippine Native, Upgraded, Anglo Nubian Boer, and Saamen goats. A total of 118 goats from 14 goat semi-intensive farms were used. Qualitative data were analyzed using descriptive analysis while the quantitative traits using Scheffe’s test. Results showed variations in the phenotypic characteristics of a goat gene pool. Saanen had longer body length significantly, and higher wither height. Saanen and Boer goats appeared to have higher heart girth. Saanen and Anglo-Nubian had significantly higher testicel circumference and tall length. Boer, Anglo Nubian, Upgraded and Philippine Native goats have predominantly mixed color, while Saanen goats have solid coat color. The nose bridge width and ear length (EL) of Anglo-Nubian goats were significantly more dense and longer. The EL of bucks were significantly longer than the EL of does. More than half of the Anglo-Nubian, Upgraded and Philippine Native Boer and Saanen buck have horn while the majority of the does are dehorned. Regardless of sex, the majority of the Boer and Upgraded goats have droopy ears while more than half of the Anglo-Nubian goats have droopy ears. All Saanen and Philippine native goats have erect ears. Findings can serve as a basis for the establishment of further goat characterization, conservation, improvement and specific trait selection strategies for future breeding programs.

Keywords: Heart girth, body length, face profile, color markings, testicle circumference

149

Introduction

Identification, characterization and documentation of goat breeds are important for any type of development or improvement of breed. Without such documentation, it would be difficult to know the animals and their potential (Kassahun, 2008). Appropriate design of breeding program is impossible for breeds/types that have not been adequately characterized either phenotypically or genetically (Mwacharo, 2006). Phenotypic characterizations are important in breed identification and classification.

Moreover, no morphological characterization of local genetic plays a very vital role in classification (i.e., size and shape) of animals which can be good indicator of economics (Okpeku, 2011). The economic values for different quantitative characteristics implied that genetic and phenotypic improvement of these traits would have a positive effect on the profitability and economic viability of production. The results from the data gathered may serve as basis in comparing the breeding efficiency of local goat breeds in Oriental Mindoro with other goat in neighboring provinces. Mindoro is the top goat producing area in the region, however, data are insufficient in the phenotypic characterization of goat breeds in the province. Phenotypic traits are important economically (PSA, 2016), which pose a bigger challenge for scientific researches on the identification of the local breed.

Phenotypic characterization of different goat breeds in

Oriental Mindoro is considered one of the primary requirements in the establishment of selection and breeding program. This study aimed to phenotypically distinguish and compare the difference of various goat breeds available in Oriental Mindoro. Regardless of production systems, goats were described according to coat color and markings, face profile and body measurements such as body lengths, wither height, heart girth, testicle circumference and tail length. Although weight is an important factor in selection, knowledge of the phenotype essential to growth trait (i.e., BL, WH, HG) is utmost important in selection (Mabuku, 2014) hence body measurement was part of the data gathered.

150

In addition, identification and characterization of different economic traits in goats served as springboard to develop breed that are locally adaptable which could provide high economic profit especially to small hold farmers. There are limited studies on the phenotypic characteristics, both qualitative and quantitative attributes of Philippine goat breed (Bondoc, 2002; Cruz, 2007). There is limited publication on the phenotypic characterization of goats that are reared in Oriental Mindoro hence the study was conducted.

Objectives

This study was conducted to phenotypically characterize the

various goat breeds in Oriental Mindoro. Specifically, the study aimed to determine the following:

1. Body measurements of various goat breeds in terms of body length, wither height, heart girth, testicle circumference and tail length;

2. Goat color and markings of various goat breeds; and 3. Face profile of various goat breeds in terms of nose bridge

width, horn type (i, e., polled, horned, dehorned), ear type (i. e., erect, droopy, long droopy) and ear length.

151

Table 1 Performance Standards for Different Goat Breed-Groups (Bondoc, 2008)

BREED CHARACTERISTICS

Philippine Native

Average mature weight – 20 kg Average body length, heart girth and wither height are 51, 64 and

55cm, respectively. Average birth and weaning weight are about 1.7kg and 6.6 kg,

respectively. ADG from irth to weaning is only 53g/day. Kidding rate is about 81% while twinning incidence is about 29%.

Anglo-Nubian

Average mature weight – 46 kg (buck), 35 kg (doe). Average body length, heart girth and wither height of 69, 85 and

74 for buck respectively whereas 64, 77 and 68 for does, respectively.

Average birth and weaning weight is about 2.7 and 13.0 kg, respectively.

Growth rate from birth to weaning is about 115 g/day. Average kidding rate is about 82% with 62% twinning incidence.

Boer Boer

Average mature weight - 47 kg (buck), 40 kg (doe). Average body length, heart girth and wither height is about 67,

82 and 70 cm for bucks whereas 62, 95 and 64 cm for does, respectively.

Largest midriff girth (95cm), flank girth (86cm), head length (19cm) and head width (8.5cm) but shorter in wither height (66cm) compared to Anglo-Nubian (69cm) and Saanen (72cm).

Saanen Average mature weight - 44 kg. Bucks and does weigh about 50 and 26 kg, respectively. Average body length, heart girth and wither height is about 71, 83

and 72 cm, respectively. Largest in terms of body length, heart girth, flank girth and

wither height.

Materials and Methods Source of Data

Different municipalities in Oriental Mindoro with goat farms were identified based on records reported by PSA (2016), Goat Farms Directory of the Livestock Research Division, Philippine Council for Aquaculture and Agriculture Research and Development (LRD-PCAARRD), the Goat Population Inventory of the Federation of Goat and Sheep Performance Association in the Philippines, Inc.

152

(FGASPAPI), and Municipal Agriculture Officer (MAO) in Oriental Mindoro. Farm Selection

The different Municipalities in Oriental Mindoro had been considered in this study. The top goat producing municipalities with the highest goat density was used as focal farms (BAS, 2012; PSA, 2016). A total of 14 goat farms were visited in Oriental Mindoro, which composed of seven municipalities for District I and seven municipalities for District II. The specific municipalities (Table 2) had been identified based on Goat Farms Directory of the Livestock Research Division, Philippine Council for Aquaculture and Agriculture Research and Development (LRD-PCAARRD), Goat Population Inventory of the Federation of Goat and Sheep Performance Association in the Philippines, Inc. (FGASPAPI), the National Goat Farm Production Performance in the Philippines (NGFPP) Directory, and data from Municipal Agriculture Officer (MAO) in Oriental Mindoro.

Table 2 Different Municipalities of Oriental Mindoro as Focal Farm During the Conduct of the Study

PROVINCE DISTRICT MUNICIPALITY

Oriental Mindoro

District I

Baco, San Teodoro, Naujan, Puerto Galera, Victoria, Pola,

Oriental Mindoro

District II

Soccoro, Bansud, Pinamalayan, Gloria, Bongabong, Roxas, Mansalay, Bulalacao.

Phenotypic Characterization The phenotypic traits used in the study were based on phenotypic characterization of Animal Genetic Resources of FAO (2012) in goats. These include sex (female and male), estimated age (year by age) or dentition class (kid, grower, adult), coat color, facial

153

(nose bridge width), horn type, ear type, ear length, body lengths, wither height and heart girth and other body measurements such as testicle circumference and tail length. Visual observation was made and morphological features were recorded based on breed morphological characteristics described list of FAO (2012) for phenotypic characterization of goat.

Different body measurements were taken when animals were in pens or barns and not when the animals were nervous to prevent stress in the part of the animals that may affect their performance (FAO, 2012). Data were obtained early in the morning between 6 – 7 am, before feeding the goats to avoid the effect of feeds and water on animal’s size and conformation (FAO, 2012). A tape measure was used to obtain various body measurements. Aside from the terminologies described and suggested by FAO (2012) in characterizing goats, the terminologies used by the local goat raisers to describe specific traits of their goats and as described by Bondoc (2002) were also noted.

Data on the phenotypic characteristics were collected

separately among the bucks and does. Pictures were captured for further description and documentation and to have justifications on various phenotypic traits (coat color, horn and ear type, dentition, body measurements, etc.). Morphological characteristics and morphometric measurements of the goats were based on the FAO Animal Production and Health Guidelines: Phenotypic Characterization of Animal Genetic Resources (FAO, 2012). Morphological or qualitative characteristics include goat characteristics covering only coat color (solid or mixed color), and head profile which includes nose bridge width, ear length, ear type (erect, droopy and long droopy) and horn type (horned, polled and dehorned). On the other hand, the quantitative measurements that were considered include the body length, heart girth, wither height, tail length and testicle circumference. Coat Color and Color Markings. Coat characteristics include only the

coat color either having solid or mixed coat color. Photographs were

taken for further description and documentation.

154

Head and Face Profile. Head and face profile include nose bridge width, ear length, ear type (erect, droopy and long droopy) and horn type (horned and polled). Nose Bridge Width. It is measured as the bridge (end to end) of the nose in the middle part, in centimeter. Ear Length. This is the distance from the point of attachment to the tip of the ear, in centimeter. Ear Type. This can be categorized into erect, droopy and long droopy based on length (Animal Genetic Resources of FAO, 2012). Horn Type. It can be categorized into horned which include the dehorned animals, and naturally polled (Animal Genetic Resources of FAO, 2012). Body Measurements. Different body measurements were obtained when animals were in pens or barns but not when the animals were nervous to prevent stress in the part of the animals that may affect their performance (FAO, 2012). Data were also obtained early in the morning between 6 – 7 am, before feeding the goats to avoid the effect of feeds and water on animal’s size and conformation (FAO, 2012). A tape measure was used to obtain various body measurements (cm). Aside from the terminologies described and suggested by FAO (2012) in characterizing goats, the terminologies used by the local goat raisers to describe specific traits of their goats and as described by Bondoc (2002) was also taken into consideration.

The quantitative measurements, including body length,

heart girth, wither height, tail length and testicle circumferences were obtained as follows: Body Length. This is measured through the curve of the back from the poll, which is the midway from between the ears up to the base of the tail, in centimeter (Yakubu et al., 2010 and FAO, 2012). Heart Girth. This is the circumference of the animal’s chest just behind the elbow, in centimeter (Yakubu et al., 2010 and FAO, 2012).

155

Wither Height. It is taken through the curve of the back from the front of the hip down to the hoof of the animal, in centimeter (Yakubu et al., 2010 and FAO, 2012). Testicle Circumference. This is the circumference of the animal’s testicles, in centimeter (Yakubu et al., 2010 and FAO, 2012).Tail length. Measured from the base of the tail to the end of the coccygeal vertebrae, in centimeter (Yakubu et al., 2010; Bondoc, 2002). Tail Length. It is measured from the base of the tail to the end of the coccygeal vertebrae, in centimeter (Yakubu et al., 2010; Bondoc, 2002). Statistical Analysis

All data on phenotypic characteristics gathered were consolidated, organized, encoded and tabulated and analyzed using descriptive analysis in terms of frequency counts, percentage distributions and averages (means) using PROC FREQ and PROC MEANS of the SAS System. In addition, analyses of variance were used for numerical traits and were further analyzed using Scheffe’s Test. Ethics Statement

This study managed reasonable efforts that minimize the stress and discomfort of animal and all methods during handling and gathering of data related to phenotypic characterization that was permitted by the Ethics Committee on the Animal Welfare Act (RA 8485 as amended by RA 10631).


In general, based on record and dentition that was done on the different breeds of goats within Oriental Mindoro, and because of the limitations given by the goat raisers, only breeder bucks and does (i.e., 1 pair – 2 pairs of teeth which is equivalent to 1.5 to 2.5 years of age) were allowed to be phenotypically observed and measured.

156

Body Measurements In general, findings revealed that regardless of sex, Saanen

have significantly (p<0.01) longer body length and higher wither height compared to other breeds (Appendix Tables 1 – 6). Likewise, Saanen goats had significantly (p<0.01) higher heart girth over the other goat genotypes but were comparable (p>0.05) with the heart girth of Boer goats. However, Philippine native goats had the least body measurements and were significantly lower (p<0.01) from the rest of the gene pool (Table 3). Table 3 Body Measurements of Goats, Regardless of Sex, by Breed, Oriental Mindoro, Philippines

BREED

BODY MEASUREMENTS (cm) Body length Wither height Heart girth

Boer (n=23) 55.615c 53.538c 75.435a Anglo nubian (n=23) 61.571b 61.478b 70.321b

Upgraded (n=28) 60.783b 54.750c 61.913c

Native (n=28) 50.739d 47.609d 60.885c

Saanen (n=16) 69.000a 65.063 a 78.375a

Legend: Means within column with different superscripts are significantly different (p<0).

It is also prominent that the body measurements of

Upgraded had significantly (p<0.01) longer BL than Boer but comparable (p>0.05) to BL of Anglo-Nubian, comparable WH and HG with that of Boer and native goats, respectively. Results can be attributed to the combination of the desirable characteristics of BOR for higher growth rate while NUB was known for its milk production and longer body conformation (Cruz et al., 2007; Mwacharo et al., 2006).

These results were similar to the range values reported by

Mwacharo et al. (2006) and Bondoc et al. (2001, 2002, 2005c, 2008c) in the National Goat Registry in the Philippines, the National (Philippines) Goat Breeders’ Catalogue, and in the “Animal breeding: Principles and Practice in the Philippine Context”. Based on the actual

157

visitation in the various goat farms, the production and management system of the goat raisers were almost similar in terms of feeding, breeding, and overall production management systems. However, though same production system was employed by the focal farms, differences in the values can also be attributed to the varied vegetation with different crude protein contents (i.e. forage and pasture area), breeding management and selection procedure (Manzi et al., 2011; Wilson, 1987; Devendra, 1983).

Table 4 Body Measurements of Goats, Regardless of Breed, by Sex, Oriental Mindoro, Philippines

SEX BODY MEASUREMENTS (cm)

Body length Wither height Heart girth

Male (n=49) 59.716a 55.821a 69.448a Female (n=69) 57.918a 55.816a 67.592a

Legend: Means within rows with similar superscripts are significantly different (p<0.05).

In addition, results showed that the body length (BL) of the

buck was found to be numerically higher than that of the doe (Table 4). Similar trend was noted on wither height (WH) and heart girth (HG). These differences could be due to sex dimorphisms where buck is phenotypically bigger than does at the same physiological age and stage (Mwacharo et al., 2006; Manzi et al., 2011). Testicle Circumference

Differences in testicle circumference (TC) were observed and measured in bucks available in the farm considering the variations within gene pool (Table 5; Appendix Table 7). Findings revealed that breeds of Saanen, Anglo-Nubian, and Boer goats had significantly higher (p<0.01) TC than the rest of the gene pools with 20.33, 20.30, and 19.67 cm, respectively, compared to the TC of upgraded and Philippine native goats.

Results can be associated with the findings reported by

several researchers (Cruz et al., 2007; Bondoc, 2008) who mentioned

158

that differences in size of testicle could be attributed to genetics and environmental factors such as nutrition, age and weather condition, and the interaction of genotype and environment. Furthermore, TC is a good indication of reproduction rate, since it is highly correlated to sperm production, thus the higher the sperm production the higher is the probability of fertilization and reproductive efficiency (Cochon, 2010).

Table 5 Testicle Circumference of Bucks, by Breed, Oriental Mindoro, Philippines

BREED TESTICLE CIRCUMFERENCE

Boer (n=11) 19.667a Anglo nubian (n=10) 20.300a

Upgraded (n=12) 18.500b

Native (n=10) 17.271b

Saanen (n=6) 20.333a

Legend: Means in column with different superscripts are significantly different (p<0.05).

Tail Length

Analysis revealed significant differences in tail length (TL) that were measured and observed among gene pool (Table 6; Appendix Tables 8 and 9). Results showed that breeds of Anglo-Nubian and Saanen were significantly higher (p<0.01) than the rest of the gene pool with TL of 15.435 and 14.438 cm, respectively. However, results showed that TL among goat gene pools are comparable (p>0.05) regardless of sex (Table 5).

These results can be associated with the findings reported

by several researchers (Cruz et al., 2007; Bondoc, 2008c; Yakubu et al., 2010) who mentioned that differences in TL could be attributed to genetics and environmental factors such as nutrition, age, and weather and health condition. In addition, the TL results were higher than the findings reported by Yakubu et al. (2010) in West African

159

Dwarf and Red Sokoto goats with a TL of 11.22 cm and 10.34 cm respectively. Table 6 Tail Length of Goats, Regardless of Sex, by Breed, Oriental Mindoro, Philippines

BREED TAIL LENGTH (cm)

Boer (n=23) 12.357b Anglo nubian (n=23) 15.435a

Upgraded (n=28) 11.192bc

Native (n=28) 10.783c

Saanen (n=16) 14.438a


Table 7 Tail Length of Goats, Regardless of Breed, by Sex, Oriental Mindoro, Philippines

SEX TAIL LENGTH (cm)

Male (n=49) 12.552a Female (n=69) 12.857a

Legend: Means in column with similar superscripts are not significantly different(p>0.05).

Coat Color and Color Markings

In general, Boer, Anglo Nubian, Upgraded and Philippine Native goats have predominantly mixed color while all Saanen goats have solid coat color (Table 6).

All Boer goats characterized in this study had mixed coat

colors and were all brown head to shoulder and white body. Likewise, Anglo-Nubian goats have predominantly mixed colors consisting of black backline with brown to reddish brown body that ranges from 50.00% (bucks) to 61.54% (does), brown-white (10.00%), and brown-

160

black-white (38.46– 40.00%). Moreover, upgraded goats have predominantly mixed colors which is generally a combination of brown-black that ranges from 43.75% in does and 75.00% in bucks. In general, these results confirmed the findings of Bondoc et al. (2001, 2002, 2005c, 2008c) that Anglo-Nubian, Boer and Upgraded gene pool indeed exists in mixture of various colors but differ in color marking distributions.

The Philippine Native goats exist in a variety of colors and

were mainly black-brown and some have mixed color of brown, black, reddish brown and have a solid color of white (11.11–20.00%). These results confirmed the findings of Bondoc et al. (2001, 2002, 2005c, 2008c) that NA gene pool indeed exist in variety of coat colors.

These findings can be associated with differences in country

of origins of the purebred NUB and BOR used in mating both in buck and doe. NUB goats (Pieters, 2007) may either be brown-black that originated from South Africa or NUB goats with pure black or pure brown or mixture of brown-black-white colors that originated from the United States of America. While, BOR goats (Pieters, 2007) may either be white-brown or white-light brown that originated from South Africa or white-black BOR that originated from Australia and United States of America.

On the other hand, all Saanen goats had solid (creamy white

or white) coat color which is similar with the coat color of purebred Saanen (Pieters, 2007) that originated in Australia, United States of America and in South Africa. Available publication or earlier report in the phenotypic characterization of Saanen is very limited because of the sensitivity of the “queen of dairy goat” that may affect its milk production, hence this study was conducted.

161

Table 8 Coat Color of Goats, by Sex, by Breed, Oriental Mindoro, Philippines

SEX BREED COAT COLOR (%)

BW BB BBW W

MALE

Boer (n=11) 100.000 0.000 0.000 0.000 Anglo nubian (n=10)

10.000 50.000 40.000 0.000 Upgraded (n=12)

25.000 75.000 0.000 0.000 Native (n=10)

30.000 50.000 0.000 20.000 Saanen (n=6) 0.000 0.000 0.000 100.000

FEMALE

Boer (n=12) 100.000 0.000 0.000 0.000 Anglo nubian (n=13)

0.000 61.538 38.462 0.000 Upgraded (n=16)

43.750 43.750 12.500 0.000 Native (n=18)

38.889 44.444 5.556 11.111 Saanen (n=10) 0.000 0.000 0.000 100.000

Legend: BW – brown white; BB – brown black; BBW –brown black white; W – white. Head and Face Profile Nose Bridge Width and Ear Length. Findings revealed that the nose bridge width (NBW) and ear length (EL) of Anglo-Nubian goats were significantly (p<0.01) more dense and longer with 14.391 and 19.870 cm, respectively (Table 9; Appendix Tables 10 - 13). Likewise, the EL of bucks were significantly longer (p<0.01) than the EL of does (Table 10). On the other hand, analysis revealed that regardless of breed, the NBW of goats are comparable (p>0.05) among bucks and does.

Analysis also reveals that EL was higher than the findings reported values by Yakubu et al., (2010) in West African Dwarf and Red Sokoto goats with an EL of 10.85 cm and 14.52 cm., respectively. Moreover, Pieters (2007) mentioned that differences in the width of nose and length of the ears could be attributed both to genetic (heritable) and environmental factors such as plane of nutrition, age and weather condition (Yakubu et al., 2010).

162

Table 9 Nose Bridge Width and Ear Length of Goats, Regardless of Sex, by Breed, Oriental Mindoro, Philippines

BREED NOSE BRIDGE WIDTH (cm) EAR LENGTH (cm)

Boer (n=23) 10.478c 17.957b

Anglo nubian (n=23) 14.391a 19.870a

Upgraded (n=28) 12.036b 16.643c

Native (n=28) 8.846d 11.269e

Saanen (n=16) 10.875bc 13.687d


Table 10 Nose Bridge Width and Ear Length of goats, Rgardless of Breed, by Sex, Oriental Mindoro, Philippines

SEX NOSE BRIDGE WIDTH (cm) EAR LENGTH (cm)

Male (n=49) 11.030a 16.898a

Female (n=69) 11.714a 15.298b


Horn Type. More than half (66.67 – 70%) of the Anglo-Nubian,

Upgraded and Philipine Native buck have horn while all Boer and Saanen goats are horned. On the other hand, majority of the does are dehorned (Table 11). These results can be associated to the management practices of the goat raisers that bucks were not usually dehorned to maintained their aggressiveness, libido and masculinity. Furthermore, the presence of horn in male animals is a good indication of higher reproductive efficiency since it is considered a factor in successful mating due to detection of does that are in estrus period, thus the higher probability of conception (Manzi, 2011; Devendra, 1983).

Ear Type. Results showed that regardless of sex, majority of

the Boer and Upgraded goats have droopy ears while more than half (53-60%) of the Anglo-Nubian goats have long droopy ears. On the

163

other hand, findings revealed that all Saanen and Philippine native goats have erect ears. These results can be associated with the conclusions of Pieters (2007) and Yakubu et al. (2010), who mentioned that differences in the ear type can be directly correlated to ear length that could be attributed both to genetic (heritable) and environmental factors such as plane of nutrition, age and weather condition. Table 11 Horn and Ear Type of Goats, by Sex, by Breed, Oriental Mindoro, Philippines

Sex Breed Horn Type (%) Ear Type (%)

H DE LD DR Erect

Male

Boer (n=11) 100.00 0.000 0.000 100.00 0.000

Anglo nubian (n=10) 70.000 30.000 60.000 40.000 0.000

Upgraded (n=12) 66.667 33.333 0.000 100.00 0.000 Native (n=10)

70.000 30.000 0.000 0.000 100.00 Saanen (n=6)

100.00 0.000 0.000 0.000 100.00

Female

Boer (n=12) 36.363 63.636 16.667 83.333 0.000 Anglo nubian (n=13)

15.385 84.615 53.846 46.154 0.000 Upgraded (n=16)

37.500 62.500 0.000 100.000 0.000 Native (n=18)

16.667 83.333 0.000 0.000 100.00 Saanen (n=10)

0.000 100.00 0.000 0.000 100.00

Legend: H – horned; DE – dehorned; LD – long droopy; DR – droopy

Conclusions

The findings of the study led to the following conclusions: 1. Findings reveal variations in the phenotypic characteristics of

goat gene pool. Generally, regardless of sex, Saanen goats had significantly longer body length and higher wither height compared to other breeds. Likewise, they had significantly higher heart girth over the other goat genotypes but were comparable with the heart girth of Boer goats. However, Philippine native goats had the least body measurements and were significantly lower from the rest of the gene pool. In

164

addition, results showed that the body length of the buck was found numerically higher than that of the doe. Similar trend was noted on wither height and heart girth.

2. The breeds of Saanen, Anglo-Nubian, and Boer goats have

significantly higher testicle circumference than the rest of the goats in the gene pools.

3. Anglo-Nubian and Saanen have significantly longer tails length than the rest of the gene pool. However, results showed that tail length among goat gene pools are comparable regardless of sex.

4. Boer, Anglo Nubian, Upgraded and Philippine Native goats have

predominantly mixed color while all Saanen goats had solid coat color.

5. The nose bridge width and ear length of Anglo-Nubian goats are

significantly (p<0.01) more dense and longer. Likewise, the ear lengths of bucks were significantly longer than that of the does. On the other hand, analysis reveals that regardless of breed, the nose bridge width of goats are comparable among bucks and does.

6. More than half of the Anglo-Nubian, Upgraded and Philippine

Native buck had horn while all Boer and Saanen goats were horned. On the other hand, majority of the does were dehorned. Results showed that regardless of sex, majority of the Boer and Upgraded goats had droopy ears while more than half of the Anglo-Nubian goats had long droopy ears. On the other hand, findings revealed that all Saanen and Philippine native goats have erect ears.

For future goat breeding program, results suggest to include or cross Saanen, Anglo-Nubian and Boer to other goat breed groups to improve the growth performance of goat. In addition, goat enthusiasts, geneticist and breeder may include Anglo-Nubian in their breeding and selection program if they want to have long droopy ears and denser nose (nose bridge width). Likewise, Anglo-Nubian And Saanen goats can be included in improving reproductive efficiency (i.e. testicle circumference).

165

APPENDIX 1

LIST OF TABLES Table 1 Analysis of Variance of the BODY LENGTH of Goats as Affected by Sex and Breed in Oriental Mindoro

SOURCE OF VARIANCE

DF SUM OF

SQUARE

MEAN SUM OF

SQUARE F VALUE P VALUE

Sex 1 6.339213 6.339213 0.15ns 0.6953

Breed 4 6.339213 893.137878 21.73** <.0001

Sex*Breed 4 1735.787520 433.946880 10.56** <.0001

Error 106 4357.028293 41.104040

Corrected Total 115 9866.784483

CV = 10.07%, p<0.01 – highly significant; p<0.05 –significant; p>0.05 – not significant.

Table 2 Interaction Effect of Sex and Breed in the BODY LENGTH of goats in Oriental Mindoro

BREED BODY LENGTH (cm)

MALE (A1) FEMALE (A2)

B1 - Boer (n=23) 55.187±4.415 56.300±8.577 B2 - Anglo nubian (n=23) 58.846±4.469 63.300±11.785

B3 - Upgraded (n=28) 68.000±7.005 53.000±7.862

B4 - Native (n=28) 48.917±2.575 52.727±2.723

B5 - Saanen (n=16) 67.800±5.921 71.000±2.608

166

Table 3 Analysis of Variance of the WITHER HEIGHT of Goats as Affected by Sex and Breed in Oriental Mindoro

SOURCE OF VARIANCE

DF SUM OF SQUARE

MEAN SUM OF SQUARE

F VALUE

P VALUE

Sex 1 65.556288 65.556288 1.91ns 0.1699

Breed 4 4341.898350 1085.474588 31.63** <.0001

Sex*Breed 4 1247.240771 311.810193 9.09** <.0001

Error 106 3637.898106 34.319793

Corrected Total

115 8713.198276


Table 4 Interaction Effect of Sex and Breed in the WITHER HEIGHT of Goats in Oriental Mindoro

BREED WITHER HEIGHT (cm)

MALE (A1) FEMALE(A2)


B3 - Upgraded (n=28) 56.687±3.978 52.167±3.215

B4 - Native (n=28) 45.917±2.575 48.600±3.949

B5 - Saanen (n=16) 60.900±7.415 72.000±0.000

Table 5 Analysis of Variance of the HEART GIRTH of Goats as Affected by Sex and Breed in Oriental Mindoro

SOURCE OF VARIANCE

DF SUM OF SQUARE

MEAN SUM OF SQUARE

F VALUE P VALUE

Sex 1 23.096772 23.096772 0.41ns 0.5254

Breed 4 5298.339935 1324.584984 23.28** <.0001

Sex*Breed 4 580.881392 145.220348 2.55* 0.0432

Error 106 6030.81489 56.89448 Corrected Total 115 11949.88793


167

Table 6 Interaction Effect of Sex and Breed in the HEART GIRTH of Goats in Oriental Mindoro

BREED HEART GIRTH (cm)



B3 - Upgraded (n=28) 62.250±7.335 63.818±4.812

B4 - Native (n=28) 60.167±3.460 58.700±7.227

B5 - Saanen (n=16) 76.200±3.120 82.000±2.280

Table 7 Analysis of Variance of the TESTICLE CIRCUMFERENCE of Bucks as Affected Breed in Oriental Mindoro

SOURCE OF VARIANCE

DF SUM OF SQUARE

MEAN SUM OF SQUARE

F VALUE P

VALUE

Model 4 1178.3202226 294.5800560 145.99** <.0001



Table 8 Analysis of Variance of the TAIL LENGTH of goats as affected by Sex and Breed in Oriental Mindoro

SOURCE OF VARIANCE

DF SUM OF SQUARE

MEAN SUM OF SQUARE

F VALUE P VALUE

Sex 1 10.0661828 10.0661828 2.17ns 0.1434

Breed 4 438.2513269 109.5628317 23.65** <.0001

Sex*Breed 4 223.2085183 55.8021296 12.05** <.0001

Error 106 491.058596 4.632628

Corrected Total

115 1085.198276


168

Table 9 Interaction effect of Sex and Breed in the TAIL LENGTH of Goats in Oriental Mindoro

BREED TAIL LENGTH (cm)



B3 - Upgraded (n=28) 12.875±1.586 10.400±1.713

B4 - Native (n=28) 11.687±1.662 10.636±1.567

B5 - Baanen (n=16) 13.500±2.121 16.000±1.414

Table 10 Analysis of Variance of the NOSE BRIDGE WIDTH of Goats as Affected by Sex and Breed in Oriental Mindoro

SOURCE OF VARIANCE

DF SUM OF SQUARE

MEAN SUM OF SQUARE

F VALUE P VALUE

Sex 1 11.5782059 11.5782059 2.48ns 0.1180

Breed 4 385.7681446 96.4420362 20.69** <.0001 Sex*Breed 4 15.4465518 3.8616380 0.83ns 0.5098 Error 106 493.9798951 4.6601877 Corrected Total 115 929.1982759


Table 11 Interaction Effect of Sex and Breed in the NOSE BRIDGE WIDTH of Goats in Oriental Mindoro

BREED NOSE BRIDGE WIDTH (cm)



B3 - Upgraded (n=28) 16.063±1.289 16.000±3.015

B4 - Native (n=28) 12.312±2.937 13.700±0.483

B5 - Saanen (n=16) 14.400±1.578 15.667±1.505

169

Table 12 Analysis of Variance of the EAR LENGTH of Goats as Affected by Sex and Breed in Oriental Mindoro

SOURCE OF VARIANCE

DF SUM OF SQUARE

MEAN SUM OF SQUARE

F VALUE P VALUE

Sex 1 0.046483 0.046483 0.02ns 0.1180 Breed 4 1158.828450 289.707112 150.36** <.0001 Sex*Breed 4 48.921064 12.230266 6.35** 0.0001



Table 13 Interaction Effect of Sex and Breed in the EAR LENGTH of Goats in Oriental Mindoro

BREED EAR LENGTH (cm)



B3 - Upgraded (n=28) 16.875±1.088 14.667±1.557

B4 - Native (n=28) 11.187±0.750 11.400±1.713

B5 - Saanen (n=16) 13.700±0.483 12.000±1.265

170

APPENDIX 2 Photo Documentation

Measuring Wither Height (cm)

Nose Bridge Width (cm)

Measuring Body Length (cm)

171

Measuring Ear Length (cm)

Measuring Wither Height (cm)

Measuring Testicle Circumference (cm)

172

Literatures Cited

Bondoc, O.L. (2001). Characteristics of Philippine native goats Capra hircus. ChevonPH.

Retrieved from https://chevonph.wordpress.com/ Bondoc, O. L. (2002). The Philippine goat breed registry. National Goat Breeder’s

Catalogue. University of the Philippines, Los Bańos. Retrieved from http://agris.fao.org/agris-search/ search.do? recordID=PH2003000720

Bondoc, O. L. (2005c). The Philippine goat breed registry. National Goat Breeder’s

Catalogue. University of the Philippines, Los Bańos. Bondoc, O. L. (2008c). Animal breeding: principles and practice in the Philippine context.

The University of the Philippines Press, Quezon City. 386 p. Cruz , E.M. (2007). Goat Production Performance. Small Ruminant Center, Central Luzon

State University. Science City of Munoz, Nueva Ecija, Philippines. Devendra, C., Burns, M. (1983). Goat production in the Tropics. Commonwealth

Agriculture Bureaux, U.K. Kassahun A., & Abegaz, S. (2008). Breeds of sheep and goats. pp 5-26. In: Alemu Yami

and R.C. Merkel (eds.). Sheep and goat productivity improvement program, USAID

Manzi, M., T. Rutagwenda, N. Kanuya, P. Chatikobo. (2011). Phenotypical

characterization of goats raised under traditional husbandry systems in Bugesera and Nyagatare Distriscts of Dwanda. J. of Anim. and Vet. Adv. 2397–2398.

Mwacharo J.M., Okeyo AM, Kamande GK, Rege JEO. (2006). Linear body

measurements. Trop. Anim. Health Prod. J. 38:65–76. Okpeku, M. Yakubu, A. Peters, S. O. Ozoje, M. O. Ikeobi, C. O. N. Adebambo, O. A. and

Imumorin, I. G. (2011). Application of multivariate principal component analysis to morphological characterization of indigenous goats in Southern Nigeria. Acta Agriculturae Slovenica, 98,101-109.

Pieters, A. (2007). General characterization of commercial goat populations in South

Africa. University of Pretoria. 5-40. Retrieved from http://www.fao.org/3/a-i0831t/i0831t02.pdf

PSA. (2016). Goat Industry. Retrieved from https://psa.gov.ph/livestock-poultry-

iprs/goat/inventory,\

173

Wilson, R.T. (1987). Livestock production in Central Mali: Environmental factors affecting weight in traditionally managed goats and sheep. Anim. Prod. 45:223-232. Retrieved from https://www.cambridge.org/core/journals/animal-science/article/livestock-production-in-central-mali-environmental-factors-affecting-weight-in-traditionally-managed-goats-and sheep/06516AD22AEEFA8EE479E6BF98ABC1CE

Yakubu, A., A.E. Salako, I.G. Imumorin, A.O. Ige and M.O. Akinyemi. (2010). Discriminant

analysis of morphometric differentiation in the West African Dwarf and Red Sokoto goats. South African Journal of Animal Science, 40(4), 381.

174

EVALUATION OF PUBLISHED LAMP PRIMERS FOR AMPLIFYING blaCTX-M9 GENE EXPRESSING

THE EXTENDED SPECTRUM BETA LACTAMASE (ESBL) OF E. COLI

Dorothy Joy S. Noble

Pangasinan State University-Infanta Campus

ABSTRACT

The study generally aimed to evaluate a Loop-mediated Isothermal Amplification (LAMP) technique in amplifying the gene expressing the ESBL of E. coli. Specifically, it aimed to optimize the protocol of LAMP assay for the detection ESBL-producing Escherichia coli and to compare diagnostic validity and level of agreement with PCR. A total of 106 DNA samples were used in the study. For the optimization of LAMP protocol, 12 tubes with ESBL E. coli and 12 tubes with nuclease-free water were incubated at a thermal cycler in temperatures ranging from 60-63ºC for 30-90 minutes. Validation of results was based on the ability of the positive controls to change in color by adding a SYBR dye, fluorescence under ultraviolet light and the presence of marker in gel electrophoresis upon query. The agreement using Kappa statistics between LAMP and PCR was used to determine the level of agreement of the two methods. For LAMP assay amplification, amplification of the target gene was observed at 63ºC for 60 minutes while the Kappa coefficient was only 0.205, which means that there was a slight agreement between the LAMP and PCR.

Keywords: ESBL, E. coli, loop-mediated isothermal amplification (LAMP)

175

Introduction scherichia coli are gram-negative, facultatively anaerobic, peritrichously flagellated rods that are classified with the family Enterobacteriaceae. It is a normal inhabitant of the gastrointestinal tract and is the most important cause of neonatal and postweaning diarrhea in pigs (Fairbrother

and Gyles, 2006), and colisepticemia in poultry (Quinn et al., 1994). Diseases caused by Escherichia coli have been a recognized problem for as long as animals such as pigs and poultry have been raised. Infections caused by these bacteria are widespread which occurs in both industrialized and developing countries and in temperate, subtropical, and tropical climates. Diseases in pigs include neonatal diarrhea, postweaning diarrhea (PWD), edema disease (ED), septicemia, polyserositis, coliform mastitis (CM), and urinary tract infection (UTI) (Fairbrother and Gyles, 2006). Diseases in poultry include omphalitis, colisepticemia and coligranuloma (Quinn et al., 1994).

Antibiotic use in veterinary community is a concern due to

antibiotic residue and the development of antimicrobial resistance (Romich, 2004). Antimicrobial resistance is a problem worldwide with serious consequences on the treatment of infectious diseases (Shaikh et al., 2015). Antimicrobial resistance happens when a bacterium has the ability to inactivate or disregard antibiotics, or it has a mechanism that blocks the inhibitory or killing effects of antibiotics, which enables them to survive regardless of exposure to antimicrobials (Harrison and Lederberg, 1998), and is now a major concern both in human and veterinary medicine (Brander and Pugh, 1977).

Antimicrobial resistance has been detected since the use of

prolonged administration of high levels of chemotherapeutics which kills microorganisms (Jones, 1957) and the unreasonable use of antibiotics has given rise to a fear of the development and overgrowth of resistant bacteria (Aarestrup et al., 1998) which may lead to a public health concern because of the transfer of resistant bacteria and its resistant factors from animals to humans (Stanton, 2013).

E

176

Currently, antimicrobial resistance and ESBL-producing E. coli is now a global threat because of limited treatment options and an increased public health danger due to potential transfer of drug resistance genes into the food chain (Fairbrother and Gyles, 2006).The rapid and economical detection of these ESBL-producing E. coli isolated from farms in Central Luzon is necessary since improving overall herd health and public safety is our responsibility. This study which was a continuation of preceding research used an amplified gene from a former study which was then conceptualized for the design and optimization of a rapid method for the detection of ESBL-producing E. coli.

Objectives

Generally, the study aimed to evaluate a published LAMP

technique in amplifying the gene expressing the ESBL of E. coli. Specifically, it aimed to: (1) optimize LAMP protocol for blaCTX-M9 gene; (2) evaluate the analytical sensitivity and specificity of the LAMP primers; and (3) evaluate the diagnostic validity and level of agreement with PCR.

Materials and Methods Preparation of DNA Sample

Preserved samples (fecal and foot swabs from swine and poultry) used in PCR study and registered positive for blaCTX-M9 gene were cultured in 5-ml broth media in culture tubes for 24 hours at 37 degrees Celsius with agitation at 100 rpm. The next day, cell suspensions were transferred in 1.5-ml centrifuge tube at 12,000 rpm for five minutes at 4 degrees Celsius and the supernatant was decanted. After it has been decanted, the pellet was resuspended in 100µL of 100 mM Tris-Cl pH 8.0 and was mixed by tapping. The product was boiled at 97 to 100 degrees Celsius in a heat block for 10 minutes. Then it was cooled in crushed ice for two minutes and was macerated. It was then centrifuged at 1000 rpm for five minutes. The samples for sensitivity test were quantified using UV/VIS spectrophotometer (Implen, Nanophotometer) then stored at -20 degrees Celsius until amplification. Aliquot of 2µL of DNA template was used for LAMP Assay.

177

Primer Design of the blaCTX-M9 Gene for LAMP Method

Published protocols of the LAMP assay was developed for blaCTX-M9 of ESBL-producing gene optimized in the local laboratory. A set of 4 LAMP primers were adopted from Thuergern et al.,(2014) as shown in Table3 which follows. Table 3 LAMP primers for blaCTX-M9 Gene

Primer Sequence (5’ to 3’)

F3 GAGTGAAACGCAAAAGCAGC

B3 CCAGACGAAACGTCTCATCG

FIP GCCGTTGACGTGTTTTTCGGC

TTTTCAGCCTGTCGAGATCAAGC

BIP CGCGTTGCAGTACAGCGACA

TTTTAAAAGCCGTCACGCCTC (Adapted from Thirapanmethee et al., 2014)

Optimization of Loop-mediated Isothermal Amplification (LAMP) Protocol

The LAMP reaction was performed in a total of 12.5 μl reaction mixture containing 3.55 μl of Nuclease- Free Water, 1.25 μl of 10x Thermopol Buffer, 0.2 μl of 100 mM MgSO4, 3 μl of 5M Betaine, 1 μl of 10 mM dNTP Mix (Intron), 1 μl of primer mix, 0.5 μl of 8U Bst DNA polymerase and 2 μl of DNA template. The reaction was run using different temperatures ranging from 60-63 degree Celsius and incubation time from 30, 60, and 90 minutes and terminated for 2 minutes at 85ºC. Nuclease-free water was used as negative controls. After amplification, the tubes were inspected of a color change by addition of 1 μl of 1:10 diluted SYBR Green I to the LAMP products and fluorescence under UV light. The LAMP products were analyzed by electrophoresis on agarose gel.

In the optimization of LAMP protocol, 24 tubes were

prepared for the incubation temperature and time. Each time (30 minutes, 60 minutes, and 90 minutes) consisted of 12 tubes each which corresponded to the different incubation temperatures (60ºC,

178

61ºC, 62ºC, and 63ºC) with two (2) tubes each for the DNA sample and nuclease-free water. SYBR green was added to all tubes after incubation. The incubation temperature and time that produced the expected positive results such as change in color, fluorescence under UV light and the presence of multiple-ladder like bands in gel electrophoresis were labeled as the amplification profile. Analytical Validation of Optimized LAMP Protocol Sensitivity Test through Serial Dilution

To determine the LAMP’s sensitivity, serial dilution of the DNA concentration from the original stock of DNA extract was diluted up to 1/10,000 in order to detect the lowest DNA concentration that the LAMP assay can amplify. Four 1.5 MCT were prepared with 9 ul Tris-HCl each. Then, from the original DNA stock of E. coli, 1 ul of DNA extract was transferred to 1.5 microcentrifuge tube with 9 ul Tris-HCl of producing 1/100, then, another 1 ul from the first diluted tube was transferred to a new tube yielding 1/1000 ratio; continuous dilution was done until 1/10,000 ratio. Successively, using nano-spectrophotometer (IMPLEN) DNA concentration was checked. The DNA samples with the highest DNA concentration (samples number 3, 23 and 103) was used. Afterwards, the diluted samples were assessed using LAMP assay. Amplification was done in 63 degree Celsius for 60 minutes, and termination at 85 degrees Celsius for 2 minutes using mini dry bath (Pilare, 2015). After amplification, the tubes were inspected of a color change by addition of 0.5 μl of 1:10 diluted SYBR Green I to the LAMP products and fluorescence under UV light. The LAMP products were analyzed by electrophoresis on agarose gel. Specificity Test Using Non-Target Genes

Upon identification of the optimum incubation temperature based on the fluorescence test and electrophoresis results, specificity of the LAMP assay profile was examined. With every run, a positive control coming from PCR products from a prior study and a non-target DNA were prepared. One tube contained the E. coli DNA that served as the positive control while the rest of the tubes served as the negative controls. The negative controls were composed of the following: one tube containing nuclease-free water while the rest were DNA of non-target organisms such as Lawsonia intracellure,

179

Salmonella cholerasuis, and Hog cholera. Amplification was done in 63 degree Celsius for 60 minutes, and termination at 85 degrees Celsius for 2 minutes using mini dry bath. Data Analysis

The quality of visible reactions which was seen on naked eye, under UV light (fluorescence), and gel electrophoresis was scored in the following manner: 0= absence and 1=presence. Evaluation of the results was based on the ability of the positive controls to produce color change from orange to green, to fluoresce under UV and to produce multiple ladder-like bands under gel electrophoresis. The amount of DNA per tube was quantified using a nanospectrophotometer. PCR Method

The extracted DNA samples were used in PCR before it was used in LAMP to determine the agreement of these two methods using the same published M9 primer set. PCR amplifications were done with BioRad T100 thermal cycler with a total volume of 20 μl containing 20 pmol of each primer, 25 μl each deoxynucleoside triphosphate, 1.5 mM MgCl2, and 1 U of Taq polymerase ( Promega, Madison, Wis.). One microliter was used for the PCR. The amplification products were run in a 1.5% agarose gel. Diagnostic Validation of Optimized LAMP Protocol

The positive control that came from PCR products of a prior study was subjected to LAMP to compare the diagnostic validity of LAMP with PCR. Kappa method was used as a test of agreement between the two diagnostic test, the LAMP and PCR. Test of Agreement with PCR using Field Samples

Test for agreement between LAMP and PCR was analyzed. (a) and (d) represent the number of times the two results agreed while (b) and (c) represent the number of times the two tests disagree. If there were no disagreements, (b) and (c) would be zero, and the test of agreement (Po) is 0.

180

Table 4 Comparison between LAMP and PCR

PCR

LAMP Positive Negative TOTAL

Positive A C m1

Negative B D m0

TOTAL n1 n0 N

Test of Agreement Formula Calculations: Observed agreement Po=a+d /n

Calculations: Expected agreement Pe= [(n1/n) *(m1/n)] + [(n0/n) *(m0/n)] Calculations: Kappa, ĸ

K= (Po-Pe)/ (1-Pe) Results of LAMP were expressed as positivity rate (%). It was

determined by the total number of positive samples divided by the total samples multiplied by 100.

Kappa coefficient of LAMP results in DNA extract was

determined by statistical software STATA v8.0 (Stata Corp). The interpretation of ĸ coefficient in this study followed the approach of Vierra and Garrett (2005) : <0=less than chance agreement, 0.01-0.20= slight agreement, 0.21-0.40=fair agreement, 0.41-0.60= moderate agreement, 0.61-0.80= substantial agreement, and 0.81-0.99= almost perfect agreement (Cacayan, 2015).

181

Formula for Diagnostic Sensitivity and Specificity Table 5 Comparison between LAMP and PCR

Disease Non-Disease

LAMP Positive (number)

Negative (number)

TOTAL (number)

Positive A (True Positive)

B (False Positive)

Negative C (False Negative)

D (True Negative)

PCR Positive (number)

Negative (number)

TOTAL (number)

Positive A (True Positive)

B (False Positive)

Negative C (False Negative)

D (True Negative)

TOTAL

Sensitivity Test Formula

Sensitivity (%) =A/ (A+C) *100

Sensitivity is the probability that a test indicated “positive” among those with the disease and expressed in percentage (%). Specificity Test Formula

Specificity (%) = D/ (D+B) *100

Specificity is the fraction of those without disease would have a negative test result.

182


According to Notomi et al., (2000), LAMP method employed a DNA polymerase and a set of four specially designed primers that recognize a total of six distinct sequences on the target DNA. An inner primer containing sequences of the sense and anti-sense strands of the target DNA initiates LAMP. The following strand displacement DNA synthesis primed by an outer primer releases a single-stranded DNA. This served as a template for DNA synthesis primed by the second inner and outer primers that hybridize to the other end of the target, which produces a stem-loop DNA structure. In subsequent LAMP cycling one inner primer hybridizes to the loop on the product and initiates displacement DNA synthesis, yielding the original stem-loop DNA and a new stem-loop DNA with a stem twice as long. The cycling reaction continues with accumulation of 10ᵡ9 copies of target in less than an hour. The final products are stem-loop DNAs with several inverted repeats of the target and cauliflower-like structures with multiple loops formed by annealing between alternately inverted repeats of the target in the same strand. Because LAMP recognizes the target by six distinct sequences initially and by four distinct sequences afterwards; it is expected to amplify the target sequence with high specificity. The essential components include the following: the primers, polymerase enzymes, betaine, dNTP, MgSO4, buffer and a fluorescent dye.

According to Karlesan and his colleagues, (1995), one way to

detect positive LAMP reaction was through agarose gel electrophoresis which is the most common method with the gel stained by an intercalating agent such as gel red. The gel shows a ladder like structure from the minimum length of target DNA up to the loading well, which were the various length stem-loop products of the LAMP reaction under. Another way to detect is through the incorporation of SYBR Green I stain. This has high binding affinity to DNA given the large amount of LAMP product generated which will then be visualize by the naked eye.

According to Imai et al. (2007), another way to detect

positive LAMP reaction is under UV illumination. In this method, calcein in the FDR combines initially with manganese ions and remains quenched. As pyrophosphate ion is produced as a by-product of the LAMP reaction, it binds and removes manganese from

183

the calcein, which resulted in detectable fluorescence which indicated the presence of the target gene.

According to Marayuma et al. (2003), LAMP method has

been used to detect various microorganisms and was first used to detect stxA2 in E. coli O157: H7. However, the use of LAMP to detect ESBL-producing E. coli had only been applied in human patients, supported by the study conducted by Thirapanmethee and his colleagues, (2014) for the detection ESBL- producing bacteria by a LAMP technique in a hospital in Bangkok, Thailand wherein they detected the most prominent CTX-M subtype, blaCTX-M9 genes in 35 ESBL-producing Enterobacteriaceae isolates including 27 isolates of E. coli and 8 K. pneumoniae from patients who received treatment at a hospital. This extended-spectrum beta-lactamases (ESBLs) produced by Enterobacteriaceae was one of the common resistant mechanisms to most beta-lactam antibiotics such as penicillin and cephalosporin. Optimization of Loop-mediated Isothermal Amplification (LAMP) Protocol

Results of the LAMP assay optimization showed that the tube incubated at 61-63ºC for 30-60 minutes produced more evident green coloration and fluorescence for the positive sample and orange coloration and did not fluoresced for the negative sample after the addition of SYBR green dye for the naked eye and UV respectively were seen (Plates 1 and 2). Visual detection was achieved due to the presence of calcein in the SYBR green dye that combined with magnesium ions in the reaction showed bright luminescence under UV light which indicates the presence of amplified DNA products.

Thirapanmethee and his colleagues (2014), used incubation

temperature (60ºC-65 ºC) and incubation time (30-60 minutes). According to their experiment, the optimal conditions for blaCTX-M9 gene amplification were 63 ºC for 60 minutes.

184

Plate 1 Results for dye color change (A) of DNA sample showed positive (green) and negative (orange),fluorescence test showed positive (fluoresced) and negative (did not fluoresced) and gel (C) shown from temperatures of 61- 63ºC at 30 minutes

Plate 2 Results for dye color change (A) of DNA sample showed positive (green) and negative (orange),fluorescence test showed positive (fluoresced) and negative (did not fluoresced) and gel (C) shown from temperatures of 61- 63ºC at 60 minutes

185

Plate 3 Results for dye color change (A) of DNA sample showed positive (green) and negative (orange),fluorescence test showed positive (fluoresced) and negative (did not fluoresced) and gel (C) shown from temperatures of 60- 63ºC at 90 minutes.

However, positive results were seen in the naked eye, UV

and gel in both the positive and negative controls seen in Plate 3. LAMP products were subjected to gel electrophoresis as a gold standard in the evaluation of true positive LAMP assay result. Positive result showed a multiple bands formation compared to negative result where it showed the absence of bands. However, seen in Plate 4, it showed no formation of multiple bands which are confirmatory of the amplified DNA products. Upon query of the gel products, positive controls showed markers in contrast with the negative controls which has no markers due to the absence of amplified genes.

186

Plate 4 Gel electrophoresis using Gel red (Biotium) at 1000 kbp marker

Table 6 Optimization of LAMP Protocol

Time/Parameters Temperature (degrees Celsius)

60 61 62 63

30 minutes

Naked Eye 0 1 1 0

UV 0 1 1 1

Gel 0 1 1 1

60 minutes

Naked Eye 0 1 1 1

UV 0 1 1 1

Gel 1 1 1 1

90 minutes

Naked Eye 1 1 1 1

UV 1 1 1 1

Gel 1 1 1 1

Table 6 shows that the temperatures ranging from 61-63ºC

at 30-60 minutes shows the best time and temperature to incubate

187

the samples. After identifying the incubation temperature and time which were 61ºC to 63ºC for 30 to 60 minutes, 106 positive ESBL- E. coli DNA samples were subjected to LAMP assay. A total of 45 DNA samples were positive and the remaining 61 samples tested negative in the chosen temperature and time which was 63 ºC for 60 minutes as shown in the table below.

Table 7 Summary of LAMP Amplification Process of Target Genes

Positive Negative

Target Gene 45 61

Total 45 61

Plate 5 Representative samples showing dye color change in samples 90-109 and 4 negative controls; sample no. 90-95, 97 at the bottom, sample no.100, 102,103 at the middle and 107 at the top showing positive result due to green coloration

188

Plate 6 Representative samples for fluorescence test of DNA samples under UV light; 107 showed positive result

Plate 7 Gel electrophoresis positive and negative results of DNA extracted samples showing multiple bands. M= ladder used; 1000 kbp, W, IBZ, IV and H20=negative control

189

Inter-observer Agreement of LAMP and PCR on DNA Extracted Samples

Using Kappa coefficient, there was a slight agreement between the results of LAMP and PCR (Table 8) where a Kappa of 1 means there was a perfect agreement and < 0 meant less chance of agreement. The Kappa coefficient between the two tests was 0.205 (Approx. sig: 0.034).

Table 8 Diagnostic Validation of LAMP with PCR

Positive Negative Total

LAMP 45 61 106

PCR 36 70 106

Kappa coefficient=0.205(Approx. sig: 0.034)

Sensitivity and Specificity Test of LAMP Profile

Before doing the LAMP assay, the DNA samples were

quantified. The negative controls that were used include Lawsonia intracellulare, Salmonella cholerasuis, PRRS, and nuclease- free water against the target organism which was ESBL-producing E. coli.

Table 9 Sensitivity and Specifity Test for LAMP and PCR

LAMP PCR Total

Positive Negative

Positive 21 25 46

Negative 25 44 69

Total

46

69

115

Table 9 shows that a test indicated “positive” for the

sensitivity and the fraction of those without disease who will have a “negative” result for specificity. In this study, LAMP has 46% sensitivity and 36% specificity.

190

Table 10 Analytical Sensitivity

Bacterial Isolates Dilution

1:10 1:100 1:1000 1:10000 2 1 0 0 0

23 1 0 0 0 103 0 0 0 0

Score: 0=absent 1=present

Table 10 shows that 1: 10 serial dilution of the DNA

concentration from the original stock of the target DNA of the three (3) bacterial isolates was the lowest concentration that the LAMP assay can amplify using naked eye, UV and gel electrophoresis.

Table 11 Analytical Specificity using Non- Target Genes

LAMP Dye Test Gel

ESBL- producing E. coli 1 1 Lawsonia intracellulare 0 0 Salmonella cholerasuis 0 0 CSF 0 0 H2O 0 0 B 0 0

Table 11 shows that the LAMP assay had proven its ability to detect only the target genes it was specific to. It was further supported by the picture below wherein only the target DNA showed multiple bands as shown by the DNA sample number 103.

Specificity test was also done in the study of

Thirapanmethee and his colleagues and the result shows that the primers of LAMP amplified only E. coli which have blaCTX-M9 gene but not with other bacterial strains.

191

Plate 8 Gel electrophoresis showing the 1:10 serial dilution in which the LAMP assay could amplify; M= ladder used; 2, 23, 103=original stock; W, IV, IBZ, CSF, H2O, B=negative controls

Shown in Plate 8 are the results for sensitivity and specificity

of the LAMP assay. Both tests were done at the same run in dye, fluorescence and in gel electrophoresis.

Literatures Cited Aarestrup, F. M., Bager, F., Jensen, N.E., Madsen, M., Meyling, A., & Wegener, H.C.

(1998). Surveillance of Antimicrobial Resistance in Bacteria Isolated from Food Animals to Antimicrobial Growth Promoters and Related Therapeutic Reagents in Denmark. APMIS 106, 606-622. doi: 10.1111/ j. 1699-0463. 1998. Tb01391.x Medical Microbiology, 2, 75–77.

Brander, G.C., & Pugh D.M. (1977). Veterinary Applied Pharmacology and Therapeutics.

3rd ed. London: Bailliere Tindale. pp 308-317. Cacayan, A.B. (2015). Prevalence of Caprine Arthritis Encephalitis (CAE) Among Goats

(Capra hircus) in Lupao, Nueva Ecija. College of Veterinary Science and

192

Medicine Central Luzon State University.Science City of Muńoz Nueva Ecija April 2015.

Fairbrother, J.M., &, C.L. Gyles. (2006). Colibacillosis. In Diseases of Swine. 10th edition.

Edited by Zimmerman JJ, Karriker LA, Ramirez A, Schwartz KJ, Stevenson GW. John Wiley and Sons, Inc. pp 723–747.

Harrison, P.F., & Lederberg, J. (1998). Institute of Medicine. Antimicrobial Resistance:

Issues and Options. Washington, D.C.: National Academy Press; 1998. Imai, M., Ninomiya, A., Minekawa, H., Notomi, T., Ishizaki, T., TU, P. V., … & T. Odagiri.

(2007). Rapid Diagnosis H5N1 Avian Influenza Virus Infection by Newly Developed Influenza H5 Hemagglutinin Gene-Specific Loop- mediated Isothermal Amplification Method. J. Virol. Methods 141: 173-180.

Jones, L.M. (1957). Veterinary pharmacology and therapeutics. 2nd ed. Ames Iowa, USA:

The Iowa State College Press. Karlesan, F., Steen, H., & Nesland, J. (1995). SYBR Green I DNA staining increases the

detection sensitivity of viruses by polymerase chain reaction. J. Virol. Methods 55: 153-156.

NAGAMINE, K., K. WATANABE, K. OHTSUKA, T. HASE, T. NOTOMI. (2001). Loop-

Mediated Isothermal Amplification Reaction Using a Non-denaturated Template. Clin. Chem. 47: 1742-1743.

Pilare, R.S. (2015). Field validation of LAMP assay on the detection of salmonella

cholerasuis in swine fecal sample. College of Arts and Sciences Central Luzon State University.Science City of Muńoz Nueva Ecija April 2012.

Quinn, P.J., M.E. Carter. & G.R. Carter. (1994). Clinical Veterinary Microbiology. Wolfe

Publishing, Spain. Romich, J.A. (2004). Fundamentals of Pharmacology for Veterinary Technicians. 2nd ed. Shaikh, S., Fatima, J., Shakil, S., Rizvi, S. M. D., & M. A. Kamal. (2014). Antibiotic

resistance and extended spectrum beta-lactamases: Types, Epidemiology and Treatment. Saudi J Biol Sci, 22(1), 90-101.

Stanton, T.B. (2013). A aall for antibiotic alternatives research. ATrends Microbiol 21, 111-113. doi: 10.1016/j. tim. 2012.11.002.

193

HYDRO VORTEX FREE ENERGY GENERATOR (HVFEG)

Aldwin Yves M. Oyao

Jon Alvin Macariola Samar State University

ABSTRACT Burning of fossil fuels is over reaching the countries pollution, heat generated by the large power plant is a big contributor of global warming and the global demand of alternative renewable energy source is increased. One solution is awakening the new generation design of free energy. The researchers discovered the old sleeping circular motion of water which is called the hydro vortex. This vortex motion extracts the small to large scale of energy. Through the means of water medium inside the conical cylindrical container/tank which is about 75% filled, the system is equipped with pressurize centrifugal pump 0.25 horsepower, the water recirculates thru the hydro vortex system by pumping pressurized water and increased water velocity by means of nozzle and sprayed directly into the water vortex turbine which is directly coupled with the shaft and pulleys. Also, the embedded stationary pump helps the system build-up pressure and directly sprays the turbine. The system produces the circular motion called water vortex, this vortex initially and finally rotates the water turbine inside the tank compartment that results to torsional motion of turbine shaft attached to the pulleys and connected at the main electric generator. It provides 30% of generated power for the whole system operation such us, auxiliary devices, pumps and controls, and 70% of generated power output that are met for providing power source to the connected load. One of the features of this free energy device is portable generator that can easily install and energize the power to supply electrical load demand. And this system is fuel less, emission less, environmental friendly device and cost less operation.

Keywords: Hydro vortex, water vortex, free energy generator, fuel less

194

Introduction he demands on energy source have always played an important role in the development of humanity in any society. Every year the need for electricity increases to meet this growing need. More fossil fuel coming from

industrial plants are generated. This increases the warmth of our planet, dole out higher and higher pollutants dispensed into the environment and are the main cause of the so called “Global Warming”. The demand to develop and retrofit current technologies that can produce clean energy that is comparable or has better performance as fossil fuel plants that doesn’t expend carbon emission must be implemented to decrease the effect of global warming.

According to the Southeast Asia Energy Outlook 2015 the

primary energy demand grows by 80% increasing from 594 Mtoe (Million Tonnes of Oil Equivalent) in 2013, 1070 Mtoe in 2040 (Figure 1.0 & Table 1.0). Figure 1.0 Primary energy demand by Fuel in Southeast Asia (Source: International Energy Agency, Southeast Asia Energy Outlook 2015)

T

195

Table 1.1 Primary Energy Demand in Southeast Asia Source: (International Energy Agency, Southeast Asia Energy Outlook 2015)

Base on World Energy Council 2013 the general message from the 2013 survey confirms that the main fossil fuels: coal, oil and gas are plentiful and will last for decades (Figure 1).

Figure 2

Total Primary Energy Supply by Resource (Source: International Energy Agency, Southeast Asia Energy Outlook 2015)

196

Despite its poor environmental credentials, coal remains a crucial contributor to energy supply in many countries. Coal is the most wide-spread fossil fuel around the world, and more than 75 countries have coal deposits. The current share of coal in global power generation is over 40%, but it is expected to decrease in the coming years, while the actual coal consumption in absolute terms would grow. Although countries in Europe, and to some extent North America, are trying to shift their consumption to alternatives sources of energy, any reduction are more than offset by the large developing economies.

Primarily in Asia, which were powered by coal and have

significant coal reserves. China alone now uses as much coal as the rest of the world. (World Energy Resources 2013 survey, World Energy Council).The UNEP (United Nations Environment Program) had stated that the governments need to intervene and implement alternative energy sources to achieve sustainable development and further diversify their economies. If not, fossil fuel would continue to be the world’s chief energy supply which later affect energy and security. Sustainable energy organizations and authors alike are aware that energy is essential as it underpins the three dimensions of sustainable development, of environment, society and economy. It has been further expressed that the main objective of a sustainable energy is its system. The energy system should provide energy service that is socially acceptable, economically viable and environmentally sound. As such emphasis is placed on an improved energy system that is efficient throughout especially at the end use.

It was in this regard that the researchers decided to design a

fuel-less alternative source of power or free energy generator, which would generate power source whenever there is a demand for electricity, and a self-running generator without a need of external supply. The researchers discovered the old sleeping circular motion of water which is called the vortex motion of water, where from this motion, we can extract the small to large scale of energy. This vortex initially and finally rotates the turbine inside the tank compartment which results to the torsional motion of turbine shaft attached to the pulleys and connected at the main electric generator. It provides 25% of generated power for the whole system operation such us, auxiliary devices, pumps and controls, and 70% of generated power are suitable for providing a power source to the connected load also. In

197

addition the intention of the design is to minimize the concern about the rising global temperature, reducing greenhouse-gas emission that contribute to climate change which was proven to be a source of environmental and health effects and to provide economically viable alternative clean energy supply.

Framework of the Study

The researcher focused on the development of the system

itself and follow a straight forward approach in designing the hydro vortex free generator (HVFG). The design is a concept based on the part of the component construction of devices, the turbine set-up, the blade configuration to harness such energy in term of vortex motion, the velocity of the water while rotating the turbine, the nozzle jetting the water vortex to continuously rotate the blade, RPM of the generator rotor to achieve the constant voltage output while the variable load are considered. The control system monitors the system design. Turbine blade is the most crucial part of the system, it lays rotation and power transmission of connecting shaft going to pinions. Hallet (2009) said that the vortex hydro turbine water takes an inlet from the current in which it is submerged. The water inlet reduces the cross sectional area for the water that flows into the vortex specially and thus increases the velocity of the water into the special designed cylindrical chamber. This study is dependent on the current inputted chamber design.

The conceptual scheme is used to determine settings of the development destination and it is presented in Figure 1.3 for feedback contribution, conclusion and recommendations are important in this study and to find the loopholes that the researcher and developer failed to see yet.

198

Figure 3 Conceptual Framework of the Study

Figure 4 Conceptual design of HVFEG (Hydro Vortex Free Energy Generator)

199

Objectives The main objective of this study was to develop a free energy

generator made by the hydro vortex energy. Particularly, it requires to:

1. develop the mechanical design concept of hydro vortex generator.

2. extract free energy from hydro vortex motion. 3. determine the energy analysis.


To meet the objectives of this study the following materials and methods were used to design, develop and test a HVFEG. The system is designed for alternative energy source of renewable energy, from the conservation of mechanical energy. The potential energy is converted into kinetic energy by means of circulating water called the water vortex. It comprises the system main conical vortex chamber and embedded pressured pump, electric pressurized pump, electric generator, vortex turbine and accessories. Research Materials

The HVFEG system composed of mechanical system that needs the strength of materials capable to with stand the mechanical properties, especially the torsional stress and vibration, every component and part was needed to evaluate to uphold the operation of the system. Since the system aimed to operate in 24 hours, seven days a week and 360 days a year by proactive approach of maintenance. It needed the materials that have standard capabilities and available in local areas. Developing the HVFEG system requires the following components:

1. Complete set of pressurized water pump ¼ HP 2. Conical vortex container made by galvanized plain sheets 3. Angular bar support for the system 4. Vortex turbine blades 5. Turbine shaft 6. Shafts bearings

200

7. Pulley and pinion 8. Low RPM vertical mounted generator capable of generating

1Kw power 9. Pipes and fitting accessories 10. Electrical and electronic control mechanism of the system

Research Methods and Design

The researchers focused on the development of the system itself and follow a straight forward approach in designing. The current hydro vortex generator built by Korean inventor which the power generating unit generates electricity by the vortex produced the fluid flowing into the storage space. The fluid inlet is formed at one side of the vortex generating unit according to the height of the vortex generating unit, Woo (2011). The energy is fed into the vortex by the prevailing fluid flow. The amount depends on many factors n amely, fluid density, speed, the degrees shear and temperature near the ground, the electrical power generation using the rotary motion of a wind or water which connected to the turbine producing energy from a rotational force developed by the vertical effect causing a partial vacuum to occur directly above said apparatus thus creating an intensified regenerated spiralling water motion Esnster (1994). Other research focuses on the diffusers of turbine which can improve efficiency, radial mass flow redistribution under different NGV (nozzle guide vane) lean and twist is demonstrated as an addition key factor influencing row efficiency Shaowen et al. (2016).

A prototyping of the system commenced constant evaluations and at the same time needs to be documented wherein a log sheet builds and testing procedures has to be developed for proper monitoring. A continuous design on system to bring out optimum reliability on each functionality and to be able to minimize the production and material cost. All of this needs appropriate tools, materials and equipment to be able to realize the systems with maximum potential.

One of the challenges in designing the system is on the fabrication of the components and installation design wherein the researchers specified the manufacturing process for the manufacture for the designed component of the machine or the

201

whole machine. From time to time, the researcher needed to double check and validate each mechanical design to make it sure that nothing is missed. Steps in Developing the Hydro Vortex Free Energy Generator: 1. Hydro vortex free energy generator (HVFEG): Designing and

modelling a) CAD design and Modelling of the system b) Turbine design comparison c) Selection for appropriate materials d) Fabrication and prototyping of the system

2. Calculation of mechanical parameters

a. The hydraulic tank pressure to supply into nozzle.

Energy Equation (Bernoulli’s Equation). Capote et al. (2004), Cutnell and Johnson (2012).

V1² + P1 + Z1= V2² + P2 + Z2 + H(1-2) 2g γ 2g γ

Where: V = Velocity of water, G = Gravitational Constant = 9.81 m/s² = 32.2 ft/s², P = Pressure (Pa), γ = Specific Weight of substance = 9.81KN/m³, Z = Elevation (m), H = Friction Head Loss (m).

The Bernoulli’s equation was simplified by solving the total dynamic head (TDH) of the pump which results to: H = (Zd-Zs) + (Hpd-Hps) + (Hvd-Hvs) + (Hfd-Hfs), where the value of the pressure head is the quotient of pressure and specific weight constant of 9.81 KN/Cu.M. in both discharge and suction, Hp = (Pd-Ps)/γ. The velocity head is calculated by Hv = (Vd²-Vs²)/2g. And the friction of head of the pipe is also calculated by using the Darcy –Weishbach Equation where the Hf = fLV²/2gD.Capote (2004).

b. The hydraulic velocity of the nozzle or spray.

The continuity Equation is presented by the formula of volume flow rate in cubic meter per second, where the discharge is equal to suction of the system; Q1 = Q2, and equivalent to A1V1 = A2V2.

202

The legends used in the formula are Q = volume flow rate in m³/sec, A = Cross sectional area of the flow in square meter, V = Mean Velocity in meter per second, Ρ = Density in kilogram per cubic meter, and the M = Mass in kilogram., Capote R.S., Duaso C.G., Mandawe J.A. (2004).

c. Hydro vortex angular velocity and turbine velocity of the system and rotational kinematic of turbine

The following figures show the analysis of the turbine, conical chamber for hydro vortex which was able to figure the behaviour of the water inside the chamber with regards to the rotation of the hydro vortex turbine.

Figure 5 Figure 6 HVFEG Conical Chamber view The HVFEG top view Velocity Analysis

Figure 7 Figure 8 The HVFEG Acceleration analysis The HVFEG Equivalent forces

and components

203

Based on Figure 6, the velocity of the turbine versus the velocity of water from vortex motion is assumed 80% slippage, where: Slip (%) = Vt / Vw or Vt = 0.80 Vw (Eqn.1). Since the Vt = r x ω (Eqn.2) and the angular speed of the turbine is ω²=ω0 + αt, the initial angular speed is zero (ωo = 0). Results with the angular speed is ω = αt and the angular acceleration is α = ω / t. from the newton’s second law of motion, which states that when a net force acts on an objects of mass, the acceleration of the object can be obtained, Cutnell (2012), See figure 7 and 8, where the equation is the summation of forces which is equal to the mass multiplied by the acceleration; F= m x a, and transformed into the mass of the turbine is mt = F / at (Eqn 4). a) Torsional moment of turbine shaft

The calculation of the shaft or turbine torque is: т= I x α(Eqn.5), where the moment of inertia in the shaft is I = (1/12) mt x L² (Eqn.6), M is mass of the turbine and L is the length of the plates across the tip of the turbine length.

The derivation of the torque from where the equating the equation 5 to the equation (6 & 3), T = (1/12) x m x L² x (ω/t) becomes equation 7. The turbine is design with six (6) cross sectional blade with baffle to increase speed and efficiency, T = (6/12) x (mt xL²) x (ω / t) is equation 7’. Equating the 7’ to equation 4 and the Pythagorean Theorem application of the acceleration in the figure 3 is analysed in the system, where; a² = ac + at, and F² = Fc + Ft. And results with the formula of: T = (6/12) x [(√ (Fc² + Ft²) / √ (ac² + at²)] x (L²) x (ω/t). Since, the equation of centripetal acceleration is аc = Vt / r, and tangential acceleration is аt = r x α. The centripetal force is Fc = (m x V²) / rt and the tangential force is equivalent to the principle of banked curve that assume the object is assume to be turbine and water, respectively.

204

Figure 9a & 9b The HVFEG Water Vortex and Turbine Analysis.

Conical Chamber Conical Chamber

The point of contact from where the velocity is assumed to

be 80 percent slippage from the turbine and water while in vortex motion. The point of contact from turbine blade at any point is equal with applicable theorem based on the analysis from the system. Note: The tangential force (Ft) is assume to be the same or approximately equal to kinetic frictional force (Fk) between water and conical container wall. Figure 5a shows the tangential forces that act on the turbine wall or plate, and forces represent the analysis where the system is assumed to be the point of contact. Figure 5b side view of HVFEG indicate the upward force assume the normal force react of the wall and turbine with respect the weight of the turbine body. In analysis the Tangential Force of turbine (Ftt) is equal to the Tangential force of water (Ftw), where, summation of forces along horizontal the tangential force of water is equal to frictional force that is equal to Frictional coefficient of kinetic energy multiplied by normal force act on the wall, therefore: Ftt = Fk = µ x FN. Normal force is equal to the summation of forces along vertical equal to zero with references to rotational axis because there is no movement along vertical, and FN Sin θ – mg = 0, where FN = mg / Sin θ, and therefore; Ft = Fk = µ x (mg / Sin θ); where (mw) mass of water and g = 9.81 m/s².

The simplified equation through the analysis of the HVFEG system of Torsional moment of the turbine shaft before the kinetic

205

energy was transfered to the pulley and flexible transmission and generator windings is:

Tmax = (0.5) x { √ { [ (Mt²Vt⁴ Sin θ) + (µg)² (Mw²) (r²) ] / [ Sin² θ (Vt⁴ + r⁴ α²) ] } } x (L²) x ( ω / t ).

3. Energy Analysis of the System

a) Power developed. The power analysis can be calculated by the system in terms of given parameters of the system where the power general output of the system is 80% of indicated power output therefore; Pg.o. = Ƞi X BP, and the 80% of the power transmitted by the shaft is converted into brake power going into the generator output, therefore, BP = Ƞt X Pt, and 80% of the water power in transmitted into the turbine power via vortex motion.

b) Turbine efficiency can be calculated by using the formula: Ƞt = P / (ρ x g x H x Q), where the Pw is the power generated by the water, ρ is the density of the water which about a constant value of 1000 kg/m³, g is the universal gravitational constant of 9.81 m/s², the Total Dynamic Head (TDH) can be solved of given formula from bernoulli’s equation and the Q is volume flow rate of water coming from the pumping system with two sources of pressurized water, Wichian (2016).

c) Turbine efficiency can be calculated by using the formula: Ƞt = P / (ρ x g x H x Q). where the Pw is the power generated by the water, ρ is the density of the water which about a constant value of 1000 kg/m³, g is the universal gravitational constant of 9.81 m/s², the Total Dynamic Head (TDH) can be solved of given formula from bernoulli’s equation and the Q is volume flow rate of water coming from the pumping system with two sources of pressurized water, Wichian (2016).

System Testing and Evaluation

Throughout the design process the researchers allocated ample amount of time in testing and debugging.

206


The results of the development, experiments and testing on HVFEG system are as follows

1. The system design was based on the conceptualization and framework of the study, the computerized aided design (CAD) of hydro vortex free energy generator is initiated thru its components configuration by the researchers, which started with pressurized pumps with tanks at the specified dimension of the system, the vortex turbine as per selected data from the references which produced more efficiency designed of turbine. Aconical shape container was design for fabrication of HVFEG system for better efficiency of hydro vortex, Dhakal (2015), and equipped with embedded centrifugal pump and piping system including the electrical and electronic system.

The system was designed based on the capacity developed

by the shape of the tank or container what the best size of the system with regards to velocity of the nozzle.

Chart 1 indicated the different sizes and dimensions of the conical tank used in hydro vortex generator, the chart showed the height and the area 2 or the top most part of the conical tank plays the role in the design of the container to

0.00

5.00

10.00

15.00

Vc (m³) h (m) r1 (m) r2 (m) A1 A2

Chart 1: The Volumetric Capacity with Regard to Different Sizes and Dimension

Series1 Series2 Series3

Series4 Series5 Series6

207

harness the best size of the generator. Therefore, the higher and larger area 2 results the bigger volumetric capacity of the container which a potential higher capacity of water power with respect to turbine power at 80%.

2. To extract free energy from hydro vortex motion was very

tedious section it emphasized the how the system work with regard the various formula involved, a series of simplification of the principle to meet the exact and right integration of idea or concept in accordance to the objective of the study. This part showed the comparison of the maximum torque of the turbine shaft versus the speed of shaft. Some properties of circular motion may change in terms of free load, actual load and full load demand of operation.

The chart 2 shows that the turbine angular speed and

shaft torque relation and nozzle area from large to smallest opening and water speed: 0.000314 sq.m; 0.000254 sq.m; 0.0002101 sq.m; 0.000153 sq.m; 0.000113; 0.0000785 sq.m. and 1.85 m/s; 2.29 m/s; 2.9 m/s; 3.79 m/s; 5.15 m/s; 7.4 m/s, respectively. The results in reciprocal value from the calculation, the n = 594.1 rad/min and 790.2 N-m when the nozzle area sets at the highest area of opening at about 0.0031 square meter. And when the speed reach its maximum value of 2376.6 rad/min the torque reduces to 219.4 N-m with the nozzle opening of 0.0000785 square meter that the maximum speed of water versus the speed of turbine. It means that if the system reached

0.0

50.0

100.0

150.0

0.0

500.0

1000.0

1500.0

2000.0

1 2 3 4 5 6

Chart 2: Comparison of Turbine Angular Speed and Torque with Respect to Nozzle Area

N (Rad/Min) T (N.m)

208

it maximum value that is four times from the initial speed the torque decreased by 27.78 percent. The system shows the reaction of load from the generator is increased.

3. Energy analysis of the HVFEG system with the relation of the

parameters, the system efficiency, with certain rotational speed or angular speed, versus the mass rate of the system made by the pressurized and embedded pump.

The chart 3 shows the speed of the turbine and

developed power with respect to the nozzle area, a lower value of speed provided the highest power value of the system and when the system achieved the maximum value of speed the power value normalized and balance with regards to nozzle area. The data calculation gathered from the angular speed of shaft turbine was increased four times from its initial speed which the turbine power also increased by 9.98 percent in kilowatt unit.

0.0

2.0

4.0

6.0

0.0

500.0

1000.0

1500.0

2000.0

1 2 3 4 5 6

Chart 3: Comparison of Turbine Angular Speed and Turbine Power Developed with Respect to Nozzle

Area

N (Rad/Min) P (Kw)

209

The chart 4 shows turbine angular speed and turbine

efficiency relation, which is the speed of turbine at initial value at maximum opening of nozzle the turbine efficiency was 71.3 percent and full load operation the turbine efficiency meets at 90.3 percent capacity.

The chart 5 shows the relation of water mass and turbine

power developed. It means that a higher volumetric capacity of HVFEG system produced a higher capacity of power, therefore the

0.0

20.0

40.0

60.0

80.0

100.0

0.0

500.0

1,000.0

1,500.0

2,000.0

2,500.0

1 2 3 4 5 6

effi

cien

cy in

per

cen

t

angu

lar

spee

d in

rad

/sec

Chart 4: Comparison of Turbine Angular Speed and Efficiency with Respect to Nozzle Area

N (Rad/Min) Ƞt

0.00

20.00

40.00

60.00

0.00

500.00

1000.00

1500.00

1 2 3 4 5 6

Po

wer

in K

W

Mas

s o

f w

ater

in K

G

Chart 5: Relation of Mass of Water (Kg) and Turbine Power Developed (Kw)

Mw(kg) Pt (Kw)

210

turbine power developed is directly proportional to the given mass of water.

Chart 6 indicates the generating capacity of the Hydro

Vortex Free Energy Generator (HVFEG) with regards the calculated efficiency of the system. Note that it does not mean it decreased the capacity it indicated the carrying volumetric capacity of the system. Theoretically, the system that holds from smallest volume of water produces small amount generating power and larger volume capacity produces more generating output power. In relation of 70% generating output, the 149.74 gal of water is the best size for the portable and mobile generator in terms of free energy that can produce 5.12 KW of power in terms also the capacity of pump power

of 0.5 horse power of 0.37 KW and other accessories.

1 2 3 4 5 6

Vc (gal) 290.3212.4149.7100.563.3336.29

Pt (Kw) 50.1727.4214.24 7.09 3.54 1.98

BP(Kw) 35.7719.5810.20 5.14 2.68 1.79

Pg.o.(Kw) 25.5013.97 7.31 3.73 2.03 1.61

at 70% G.O. 17.85 9.78 5.12 2.61 1.42 1.13

0.00

5.00

10.00

15.00

20.00

25.00

30.00

0.00

50.00

100.00

150.00

200.00

250.00

300.00

350.00

Po

wer

in K

W

Vo

lum

e in

Gal

lon

Chart 6: Relation of Turbine Power, Brake Power and Generating Ouput Power in Kw

211

Conclusions

This study presents the development of the new system harnessing the kinetic energy from the water which passes through the process of engineering principles. The hydro vortex free generator used the best performance of vortex container with a conical shape which is being introduced by Dhakal (2015) and re-calculated to come up with the best size and dimension according to purpose results height at 0.6 meter, base radius r1 = 0.25 meter, upper part radius r2 = 0.8 meter, or Area 1 =0.2 square meter and Area 2 is 2.1 square meter and volumetric capacity is 0.57 cubic meter or 149.74 gallons of water which water weighs 566.77 kilograms. The performance from theoretical hydro vortex design calculation the angular speed of shaft turbine was increased four times from its initial speed which the turbine power also increased by 9.98 percent in kilowatt unit. The angular speed versus the torque decreased by 27.78 percent and turbine efficiency meets at 90.3 percent capacity. Therefore, the turbine power developed is directly proportional to the given mass of water which about 5.12kw at the given volumetric capacity of water.

212

Literatures Cited Capote R.S., Duaso C.G., Mandawe J.A. (2004). From Mechanical Engineering Formulas

and Principle, pg.420. Cutnell J.D. and JohnSon K.W. (2012). Physics 9th Edition. Newton’s Second Law of

Motion Chapter 4, Page 87. Bernoullis Equation. Dhakal R., Bajraccharya T. R., Chaulagain R.K., Shretha S. H.(2015). Economic feasibility

study of gravitational water vortex power plant for the rural electrification of low head region of Nepal and its comparative study with other low head power plant. Volume Number 1, Research Gate. Retrieved on July 22, 2018 from https://www.researchgate.net/publication/297945398_Economic_Feasibility_Study_of_Gravitational_Water_Vortex_Power_Plant_for_the_Rural_Electrification_of_Low_Head_Region_of_Nepal_and_Its_Comparative_Study_with_Other_Low_Head_Power_Plant?enrichId=rgreq33869afc6db1dc0fca6486a95e3e481aXXX&enrichSource=Y292ZXJQYWdlOzI5Nzk0NTM5ODtBUzozNTQ2MTg1NTYwNzYwMzNAMTQ2MTU1OTA2MDYwMg%3D%3D&el=1_x_2&_esc=publicationCoverPdf or DOI: 10.13140/RG.2.1.4383.4483

Southeast Asia Energy Outlook. (2015), 9 rue de la Fédération, 75739 PARIS CEDEX 15,

International Energy Agency (2015). Retrieved from https://www.iea.org/publications/freepublications/publication/WEO2015.pdf, on december 02, 2017

World Energy Resources. (2013). Survey, ISBN: 978 0 946121 29 8, World Energy Council

2013. Wichian P., & Suntivarakorn R. (2016). The effecys of turbine baffles plates on the

efficiency of water free vortex turbines, Science Direct, Energy Procedia 100 (2016) 198 -202, 3rd International conference on the Power and Energy System engineering, CPESE 2016, 8-12 September 2016, Kitakyushu, Japan.

213

ARCProS: A DECISION SUPPORT SYSTEM FOR ACADEMIC RANKING, CLASSIFICATION AND PROMOTION SYSTEM FOR THE FACULTY OF

UNIVERSIDAD DE ZAMBOANGA

Neil Mark Z. Bacasong Dante D. Dinawanao

Universidad De Zamboanga Mindanao State University-Iligan Institute of Technology

ABSTRACT This study focused on the development of a Decision Support System (DSS) for Universidad de Zamboanga in faculty ranking in its aim of promoting quality educators. Since faculty ranking appointment is a position based on hierarchy, there were four phases that were considered in the development of the project: first is modeling of the academic problem; the second is translating the modelled academic problem to prolog notations for generating facts, rules, and queries for the ranking process; third is developing a system through prototyping; and fourth is the testing and evaluation of the DSS. The DSS uses the technique of First Order Predicate Logic (FOPL) which is translated to Prolog rules, facts, and queries as a knowledge base in generating academic rank of a specific faculty based on the academic minimum requirements or points acquired. These rules, facts and queries are created through web-based interface by user inputs that are stored in a database using MySQL. Prolog was used as an inference engine to give the actual result wherein a set of data fields is asked by the system to be filled by the user. The DSS handles in the creation of academic ranks and points that makes it dynamic. The DSS generates reports as the actual rank of a faculty member based on minimum requirements or points as accumulated from the score sheet which had ranking criteria and percentage weights.

Keywords: Ranking, first order predicate logic (FOPL), prototyping, decision support system (DSS)

214

Introduction

ny organization, particularly academic institution that gives premium to its employees’ promotion and career advancement instills in its employees a sense of being cared for and the employees in return, perform better and gain confidence in their daily tasks, as shown by a

compelling evidence in a number of research. Needless to say, employee promotion is vital for an organization to function efficiently and to achieve its mission, goals and objectives. But not all employees can be promoted at once. According to Heathfield (2015), it is the responsibility of the organization to come up with a decision in the employee promotion.

Decision making, is the concept of identifying and choosing alternatives based on the values and preferences of the decision maker. Making a decision implied that there were alternative choices to be considered and does not only identify as many of these alternatives as possible, but choose the one that best fits with the goals, objectives, desires and values set by the organization (Harris, 2012). Thus, making a good decision will help the organization face the challenges and focus on the future demands. The organization then has to utilize an established method in decision making.

A Decision Support System (DSS) is one effective method that

helps the organization in decision making. A DSS was specifically designed to allow end-users to perform their own computer-generated data analyses (Pondal and Tucker 2002). Therefore DSS generates decision in an instant based on the given data, an intelligent system like DSS would help provide rapid support in the decision making of an organization.

In the Manual of Regulations for Private Higher Education

(MORPHE), the Article VIII, Section 38, for faculty classification and ranking states that “Academic teaching positions shall be classified in accordance with academic qualifications, training and scholarship, preferably into Professor, Associate Professor, Assistant Professor, and Instructor, without prejudice to a more simplified or expanded system of faculty ranking, at the option of the institution. An academic teaching personnel, who does not fall under any of the classes or ranks indicated in the preceding paragraph shall be

A

215

classified preferably as professorial lecturer, guest lecturer, or any other similar academic designation on the basis of his qualifications.” (MORPHE 2008). With that, the Universidad de Zamboanga (UZ) established a policy regarding the said regulation as mandated by the Commission on Higher Education (CHED) for private institutions as well as the Technical Education and Skills Development Authority (TESDA).

Faculty appointments are classified according to rank.

Ranking is a position in a hierarchy. This rank is stated on MORPHE 2008 in Article VIII, Section 38 for faculty classification and ranking. The importance of having the rank is for a faculty to be classified and be granted tenure. The parameters of ranking, classification and promotion of faculty members are the following: Educational Qualification and Professional License, Scholarly Achievements and Research, Teaching Effectiveness, Work Experiences and Trainings Attended, and lastly, Professional Affiliations, Community Extension Services and Awards.

The importance of ranking, promotion and classification is to

maintain the university status and at the same time it would help the institution to promote quality education through quality educators and boost the teacher’s morale (ARCPG 2014).

At present, the University comprises of two (2) high schools,

the Arturo Eustaquio Memorial Science High School (AEMSHS), and UZ-Technical High School (UZ-THS); six (6) colleges, Including School of Allied Medicine (SAM), School of Education, Arts and Sciences (SEAS), School of Business and Management (SBM), School of Criminal Justice, School of Engineering and Information, Communication and Technology (SEICT), Graduate School and the Institute of Technical Education (ITE). The total population of faculty for the school year 2015-2016 is about 220. The Universidad de Zamboanga processes academic ranking, promotion and classification based on the manual system.

Every faculty member must submit documents through the

Academic Ranking, Classification and Promotion Committee (ARCPC). Hence, the manual computation of weights for each faculty member for classification, ranking and promotion may lead to error and as the desired ranks getting higher the ranking process gets

216

longer due to the bulk of credentials to be verified as the basis for the ranking process. According to the ARCPC chairman, it takes a minute to an hour to evaluate a faculty member with the bulk of credentials submitted and sometimes it leads to human error if not verified during the ranking process.

To eradicate the observed problem, the advancement in

technologies was seen to be of help. The machine can solve the problem or carry out processes that were time consuming or repetitive enough, which may lead to errors; humans are prone to error due to fatigue that humans may suffer (Bourbakis, N. G. 1992).

Framework of the Study Figure 1.1 Conceptual Framework of the Study

Figure 1.1 defines how the development process of the

prototype, each process representing the flow on the development of the prototype. In every layer of the process requires inputs to proceed to the next process, from modeling to testing and evaluation that resulted to an academic rank of the faculty members.

217

Objectives of the Study General Objective

To develop a decision support system for academic ranking, classification and promotion for the faculty members of Universidad de Zamboanga based on academic classification and promotion guidelines 2014.

Specific Objectives

The specific objectives of the study include the following: 1. To understand the existing policies for academic ranking,

classification and promotion of faculty members.

2. To express the academic ranking, classification and promotion problem in First-Order Predicate Logic and to create a translator for its corresponding facts, rules and queries in a logic programming language.

3. To design the system architecture of the proposed decision

support system.

4. To implement the different subsystems of the proposed Decision Support System using web and database technologies and logic programming.

5. To test and validate the Decision Support System using

synthetic employee data.

Methodology

This includes four different phases. Phase I was the

Modeling Phase which includes the data gathering, data analysis and modeling the academic rank; Phase II was the Translation Phase which includes the translation of the modeled academic rank to logic programming language; Phase III was the Development Phase which follows the software methodology prototyping; and Phase IV is the Testing and Evaluation of the prototype which includes initialization of the system and use case scenario testing.

218

Figure 1.2 Project Methodology

Phase 1: Modeling This phase discussed the process of acquiring information through data gathering followed by data analysis in modeling the academic ranking problem. An actual oral interview with the ARCPC, was conducted in order to gather information. There was brainstorming among the interviewer, ARCPC chairman and the staff for clarification on how the project would run for development. As part of the data gathering process, documents were requested for analysis concerning academic ranking and promotion of the faculty members.

Document analysis was performed for the ranking process in the Universidad de Zamboanga for School of Engineering and Information Communications Technology following the ARCP Guidelines 2014 that was forwarded to the researcher for modeling the academic problem. Modeling Academic Problem to FOPL

First-Order Predicate Logic (FOPL) is a set of rules which can be applied as an aid in decision making (Chen 2000). FOPL is a predicate logic, which takes only one individual as arguments and

219

quantifiers only bind individual variables (Lu and Mead, 2013). First-order Predicate logic models the world in terms of Objects, Properties, Relations and Functions (Russell & Norvig 1995). In modelling an academic problem, consider an example of academic rank University Professor 3, equation 1 is the conversion from English to FOPL Model. English

University Professor 3 who has the minimum requirements of the Relevant Doctorate degree and published book or acquired points range from 98 to 100.

FOPL

Phase 2: Rules Translation This phase described the way how to translate the academic problem from FOPL model to logic programming syntax. Expressing the Academic Problem in FOPL

The decision support system model was expressed in the form of first order predicate logic notation. As mentioned by McCluskey, L. (1997), in an online lecture, a set of rules applying the concept of First Order Predicate Logic can be converted to Prolog rules since the syntax is quite similar.

Academic problem can be a model in FOPL and FOPL can be

converted to prolog syntax which served as an introductory approach in expressing academic ranking, classification and promotion problem to FOPL. The Syntax in equation 2 showed the model for University Professor 3 who has the minimum requirements of the Relevant Doctorate degree and published book or acquired points range from 98 to 100 in FOPL and express in Prolog as shown in equation 3.

∃x∃y[(universityprofessor3(x,y)⇒(has(x,relevantdoctorate) ∧has(x,publishedbook))∨(y≥98∧y≤100))].

(1)

220

FOPL ∃x∃y[(universityprofessor3(x,y)⇒ (has(x,relevantdoctorate)∧ (has(x,publishedbook))∨(y≥98∧y≤100))].

(2)

PROLOG

universityprofessor3(Faculty,Points):- has(Faculty,relevantdoctorate), has(Faculty,publishedbook); Points 98, Points =<100.

(3)

Phase 3: System Development This phase describes the process on the development of the system following the software methodology prototyping. Prototyping

The project was developed with the use of prototyping as one of the methodologies in the application development. Prototyping performs planning, analysis, design and implementation as phases can perform concurrently upon development. The Figure 3.2 showed how prototyping works (Turban, Aronson, & Liang, 2005). The researcher decided to use this model due to its advantages in terms of phases that can be performed concurrently.

221

Figure 1.3 Prototyping (Turban Aronson, & Liang, 2005)

Planning and Analysis

In these phases, the ideas were scrutinized based on the project that was developed. Gathering of information was followed to determine the functional and non-functional requirements and user requirements of the project. Design

This phase discussed the system architecture, database design and the prototype design. System Architecture

The Server Architecture of ARCProS composed of three main servers, namely; SWI-Prolog, XAMPP, and MySQL database server. The major functions of ARCProS is to interact with these servers, the three main modules are considered: Requirement Manager, Data Manager and Account Manager.

222

Figure 1.4

ARCProS Server Diagram

Account Manager

This controls the different users of the system. The Admin and staff are the two user checklists for users’ privileges. The Admin account had the power to control the overall functionalities of the system while the staff account may have the same access with the admin account but it cannot create user accounts. These accounts are responsible for the creation of the major data input for the system to generate output. Data Manager

This module provides interaction between the user and the system to access the database. It had the capability of data management through the account manager’s request of data for requirements in translation of rules, facts and queries for academic ranking process as well as storing important data from the account manager. All data are saved to the database.

223

Requirement Manager

This module manipulated the translation of minimum requirements and points of an academic rank. The requirements are requested through data manager which is involved in getting important data in the generation of rules, facts and queries, and these data are created and saved through a prolog (.pl) file. Once the user requests for the translation of the minimum requirements and points of the academic rank, the requirement manager generated facts, rules and queries for SWI-Prolog and vice versa capture the actual result that would be generated. The prolog (.pl) file is not saved to the database and deleted after the academic rank was determined.

SWI-Prolog

The facts, rules and queries were organized through Requirement Manager that analyzed by SWI-Prolog to perform decision making that would satisfy the user’s needs.

Web Server (XAMPP)

XAMPP was used as its web server in the system, where it supported PHP programming language that handled connections on SWI-Prolog as well as phpMyAdmin for the database.

MySQL Database Server

PhpMyAdmin as bundled on the webserver stores important data in the system like user accounts, ranks, minimum requirements and points. In the translation of facts, rules and queries, data are captured in the database. Database Design

Database and tables were available from the Human Resources Department which were taken for the creation of points, minimum requirements, score sheet points and translation of facts, rules and queries for ranking a faculty member.

224

Prototype Design

A web-based prototype was developed using PHP: Hypertext Preprocessor. HIPO represents the hierarchy of modules in the software system; it is a tool for planning and/or documenting a computer program (Rodney, 2012).

Implementation

The system was developed using Hypertext Preprocessor (PHP), JavaScript, Cascading Style Sheet (CSS), Notepad++, Apache, and SWI-Prolog. The mention tools are open source.

Results and Discussion Modeling

In this phase general policies and guidelines for academic ranking, classification and promotion system were identified and modeling the academic guidelines into a notation. General Policies and Guidelines (ARCPG, 2014)

A newly appointed faculty member is required to accomplish an application form for ranking or classification form immediately upon receiving the job offer. The classification happens every first semester and second semester and re-classification happened yearly. The newly appointed faculty member or a faculty member for classification submits credentials as part of the process in ranking and classification. A faculty member may qualify for a higher position if the educational requirement corresponding to the ranks is complied with, and he/she has earned the total points needed for the next higher rank as referred to the Conversion Table. Ranking a Faculty Member

The conversion table was provided by the ARCP Guidelines 2014. The minimum requirements or points of the specific academic rank were then used for initialization of the system, which means a

225

faculty member may have an academic rank based on the minimum requirements or points acquired. Table 1 ARCP Guidelines 2014 Conversion Table

Academic Rank Minimum Requirements Points

University Professor 3 Relevant Doctorate degree with book published

98-100

University Professor 2 Relevant Doctorate degree with book 95-97

University Professor 1 Relevant Doctorate degree with book 92-94

Professor 4 Relevant Doctorate with research published in accredited/ referred journals

88-91

Professor 3 Relevant Doctorate with research 86-87

Professor 2 Relevant Doctorate with research 83-85

Professor 1 Relevant Doctorate degree Full-fledged 80-82

Associate Professor 5 Passed comprehensive exams (Relevant Doctorate Degree)

76-79

Associate Professor 4 Complete Academic Requirements (Relevant Doctorate Degree)

72-75

Associate Professor 3 Complete Academic Requirements (Non-relevant Doctorate Degree)

68-71

Associate Professor 2 Relevant Master’s Degree earned with research

64-67

Associate Professor 1 Non- Relevant Master’s Degree earned with research

60-63

Assistant Professor 5 Relevant Master’s Degree Full-fledged 55-59

Assistant Professor 4 Relevant Master’s Degree (Comprehensive Exam Passed)

50-54

Assistant Professor 3 Relevant Master’s Degree (CAR) 45-49

Assistant Professor 2 Non- Relevant Master’s Degree Full-fledged 40-44

Assistant Professor 1 Non- Relevant Master’s Degree (Comprehensive Exam Passed)

35-59

Instructor 4 Non- Relevant Master’s Degree (CAR) 30-34

Instructor 3 With MA/MS units (at least 15 units) 25-29

Instructor 2 Bachelor’s with license 20-24

Instructor 1 Bachelor’s degree 15-19

226

Acquisition of Points

Table 1.2 presents the percentage weights in acquiring points for each faculty member. This weight percentage was computed based on the credentials submitted. A breakdown of points for each item (ranking criteria) was computed via summary score sheet where a maximum of 100 points was multiplied on the percentage weights of each item to determine the total points of all the items acquired by the faculty member. Table 1.2 ARCP Guidelines Ranking Criteria and Percentage Weights

Ranking Criteria Percentage Weights

Educational Qualification and Professional License 35%

Scholarly Achievements and Research 20%

Teaching Effectiveness 15%

Work Experiences and Training Attended 20%

Professional Affiliations, Community Extension Services and Awards

10%

Total 100%

First-Order Predicate Logic (FOPL) is a set of rules that can be applied as an aid in decision making (Chen 2000). FOPL is a predicate logic which takes only one individual as arguments and quantifiers that only bind individual variables (Lu and Mead 2013). First-order Predicate logic models the world in terms of Objects, Properties, Relations and Functions (Russell & Norvig 1995).

The solution was to define the rank as a problem that needs a certain minimum requirements or points. The rank was then expressed to FOPL:

FOPL:∃x∃z[(rank(x)⇒(has(x,z)] (4)

This means that for every employee x, x has z.

FOPL:∃x∃y[(rank(x,y)⇒y≥to some positive INTEGER(a)∧y≤to some positive INTEGER(b))],a≤b.

(5)

227

This means that for every employee x and points y, y has a value ranges a to b for some positive integer.

FOPL:∃x∃y∃w∃m[(parameterpoints(x,y,w)⇒ (m*0.35,has(x,y,w),m)∧ w=sum_of_all(m))].

(6)

This means that parameterpoints w is obtained by the

summation of m and multiplied by 0.35 for parameter 1.


(7)




(8)




(9)

This means that parameterpoints w is obtained by the summation of m and multiplied by 0.15 for parameter 4.


(10)

228

This means that parameterpoints w is obtained by the summation of m and multiplied by 0.10 for parameter 5. Translating

The bases in the creation of rules in SWI-Prolog were from the representation of FOPL, as mentioned by McCluskey, L. (1997). First Order Predicate Logic is a generalisation of Propositional Logic and Logic program is written into a sub-language of FOPL. Prolog as described by Endriss (2013) defines the world by simply stating the facts.

FOPL:∃x∃z[(rank(x)⇒(has(x,z)] (11)

PROLOG: instructor1(Faculty):- has(Faculty,bachelors).

This means that a faculty is instructor 1 in rank if he has

bachelor’s degree.

FOPL: ∃x∃y[(rank(x,y)⇒y≥to some positive INTEGER(a)∧y≤to some positive INTEGER(b))],a≤b.

(12)

PROLOG: instructor1(Faculty,Points):- Points>=15,Points =<19.

This means that a faculty is instructor 1 in rank if he has acquired points from the range of 15 to 19.

FOPL: ∃x∃y∃w∃m[(parameterpoints(x,y,w) ⇒(m*0.35,has(x,y,w),m)∧ w=sum_of_all(m))]. PROLOG:pointsA1(Idfaculty,Parameter,P):- findall(Points*0.35,has(Idfaculty,Parameter,Points),Points),total_points(Points,P).

(13)

229

This means that parameterpoints A1 is obtained by the summation of Points and multiplied by 0.35 for parameter A1.

FOPL:∃x∃y∃w∃m[(parameterpoints(x,y,w) ⇒ (m*0.25,has(x,y,w),m)∧ w=sum_of_all(m))]. PROLOG:pointsB1(Idfaculty,Parameter,P):findall(Points*0.25,has(Idfaculty,Parameter,Points),Points),total_points(Points,P).

(14)

This means that parameterpoints B1 is obtained by the

summation of Points and multiplied by 0.25 for parameter B1.

FOPL:∃x∃y∃w∃m[(parameterpoints(x,y,w) ⇒(m*0.15,has(x,y,w),m)∧ w=sum_of_all(m))]. PROLOG:pointsC1(Idfaculty,Parameter,P):-findall(Points*0.15,has(Idfaculty,Parameter,Points),Points),total_points(Points,P).

(15)

FOPL :∃x∃y∃w∃m[(parameterpoints(x,y,w) ⇒(m*0.15, has(x,y,w),m)∧ w=sum_of_all(m))]. PROLOG:pointsD1(Idfaculty,Parameter,P):-findall(Points*0.15,has(Idfaculty,Parameter,Points),Points),total_points(Points,P). This means that parameterpoints D1 is obtained by the summation of Points and multiplied by 0.15 for parameter D1.

(16)

230

This means that parameterpoints C1 is obtained by the summation of Points and multiplied by 0.15 for parameter C1. Development

Prototyping performs planning, analysis, design and implementation as phases can perform concurrently upon development (Turban, Aronson, & Liang, 2005).

The system was developed using Hypertext Preprocessor (PHP), JavaScript, Cascading Style Sheet (CSS), Notepad++, Apache, and SWI-Prolog. The mention tools are open source. System Testing and Evaluation

Testing of the system was done locally by running the Apache web server (XAMPP) and accessing the url http://localhost/arcpros. The system underwent several testing to check the stability of actual output through observation. The ARCP Guidelines 2014 of Universidad de Zamboanga were initialized through a web-based interface for easy setup of facts, rules and queries for ranking process. A sample faculty member dummy data was evaluated to test how the academic rank was generated based on the minimum requirements or points acquired. Initialization of the System

ARCP Guidelines 2014 for the School of Engineering and Information Communications Technology of Universidad de Zamboanga was used as the basis for the creation of an academic

FOPL :∃x∃y∃w∃m[(parameterpoints(x,y,w) ⇒(m*0.10,has(x,y,w),m)∧ w=sum_of_all(m))]. PROLOG:pointsE1(Idfaculty,Parameter,P):- findall(Points*0.10,has(Idfaculty,Parameter,Points),Points),total_points(Points,P). This means that parameterpoints E1 is obtained by the summation of Points and multiplied by 0.15 for parameter E1.

(17)

231

rank with its minimum requirements or points and stored in the database (see Conversion Table 1.1.). Figure 1.5 Adding of Rank with its minimum requirements and points User Interface

Figure 1.6 Adding of Points User Interface

Figure 1.5 and Figure 1.6 showed the user interface for the data entry of the important information in ranking process. The user input the details on the fields and saved these to the database. Evaluating a Faculty Member (Academic Ranking)

A scenario test case was performed and testing was done using a dummy data of a faculty member with id number 34172890 which was loaded on the database for faculty ranking process.

232

Figure 1.7 Scenario test case for Employee ID 34172890

233

234

Back-end Result

A prolog file generated at the back-end for ranking a faculty member based on points acquired and minimum requirements. This is where the generation of rank based on the points acquired and based on the minimum requirements by the faculty member can be viewed. Figure 1.8 Facts, Rules and Queries Generated for Minimum Requirements Ranking

235

Figure 1.8 shows a prolog file generated at the back-end of the DSS for ranking a faculty member based on the minimum requirements.

Figure 1.9 Facts, Rules and Queries Generated for Points Ranking

Figure 1.9 showed a prolog file generated at the back-end for

ranking a faculty member based on points acquired. This is where the generation of rank based on the points acquired by the faculty member can be viewed.

236

Front-end Result Figure 1.10 Result of the Ranking Process Viewed in Front-end

Validation from the Generated Result

Ten (10) random samples of faculty dummy data (credentials) were used for testing on the DSS prototype to generate rank on different credentials as shown on the Table 1.3. The faculty credentials were inputted on the database such as Educational Qualification, Professional License, Scholarly Achievements and Research, Teaching Effectiveness, Work Experiences, Training Attended, Professional Affiliations, Community Extension Services and Awards. Table 1.3 Validation of the Results Based on Scenario Test

Faculty ID Points Acquired from Testing

Generated Rank from Test

Generated Rank from Prototype

34172890 98.39 University Professor 3 University Professor 3 29928401 92.6 University Professor 1 University Professor 1 42172342 88.07 Professor 4 Professor 4 39172603 80.48 Professor 1 Professor 1 20123594 76.04 Associate Professor 5 Associate Professor 5 28982005 62.49 Associate Professor 1 Associate Professor 1 23344206 58.59 Assistant Professor 5 Assistant Professor 5 29183007 38.66 Assistant Professor 1 Assistant Professor 1 20180208 31.24 Instructor 4 Instructor 4 20172009 18.75 Instructor 1 Instructor 1

237

The basis of validation of ranking process is in accordance with academic ranking, classification and promotion guidelines 2014. Each scenario test was checked manually and validated from the generated score sheet and academic rank.

Conclusions

The Academic Ranking Classification Guidelines 2014 of Universidad de Zamboanga was used as basis in the development of the ARCProS prototype. The academic rank of the faculty member was evaluated through its corresponding minimum requirements and points acquired from the ARCPG 2014.

The problem of academic ranking, classification and

promotion was modeled in First Order Predicate Logic and translated to logic programming language. The ARCProS can dynamically generate facts, rules and queries out of the data that were entered by its user. These rules correspond to the rank, its minimum requirements, and points which will then evaluate to an academic rank.

Based on the testing and evaluation, the system prototype was able to deliver the requirements of the ARCP Committee to generate the ranks of faculty members who would be subjected for evaluation. However, there were still areas of the prototype that needs improvement.

238

Literatures Cited Bourbakis, N. G. (1992). Artificial intelligence methods and applications. Singapore:

World Scientific. CHED-MORPHE. (2008). Manual of regulations private HEIs, published by Jyro Triviño

on www.srcibed.com, October 12, 2013. Chen, Z. (2000). Computational intelligence for decision support. Retrieved from

http://cdn.preterhuman.net/texts/science_and_technology/artificial_intelligence/ Computational Intelligence For Decision Support - Chen.pdf

Harris, R. (2012). Introduction to decision making.

http://www.virtualsalt.com/crebook5.htm Ponedal, S., & Tucker, M.(2002). Understanding decision support systems. https://www.researchgate.net/publication/240628976_Understanding_Decision_Support_Systems

Heathfield, S. M. (2015). A promotion rewards an employee for work contributions,

Retrieved May 14,2015, from http://humanresources.about.com/od/glossaryp/g/promotion.htm

Lu, J., & Mead, J. J. (2013). Prolog A Tutorial Introduction. Retrieved March 18, 2016,

from www.cs.ukzn.ac.za/~hughm/ai/readings/PrologIntro.pdf McCluskey, L. (November 1997). A brief look at First Order Predicate Logic and Prolog.

Retrieved March 25, 2016, from https://helios.hud.ac.uk/scomtlm/cam326/logic/node2.html#SECTION00020000000000000000

Russell S.J., & Norvig P. (1995). Artificial intelligence : a modern approach.

http://stpk.cs.rtu.lv/sites/all/files/stpk/materiali/mi/artificial%20intelligence%20a%20modern%20approach.pdf

Turban, E., Aronson, J. E., & Liang, T. (2005). Decision support systems and intelligent

systems. Retrieved from http://dl.lux.bookfi.org/genesis/785000/fddd23bb6a87e93be735921ca07d0512/_as/[Efraim_Turban_,Jay_E._Aronson_,Ting_Peng_Liang]_D(BookFi.org).pdf

239

Documents

International · Managing Editor Jona A. Aguilar Assistant Managing Editor Al-Fayed D. Paradji ... plagiarism/similarity Index within zero (0) to ten (10) % only, and (6) ... ranged