Interleukin 4 Receptor Expression and Growth Inhibition of ... · The expression of the interleukin 4 (IL-4) receptor (IL-4R) and ef facts of human recombinant IL-4 on human gastric

ICANCERRESEARCH52, 6059-6065, November1, 19921

ABSTRACT

The expression of the interleukin 4 (IL-4) receptor (IL-4R) and effacts of human recombinant IL-4 on human gastric carcinoma cell lineswerestudied. We demonstrated that 11-4 inhibited the growth of gastriccarcinoma cells in a dose dependent manner (0.1â€”100anita/mi) in aI3Hlthymldine incorporation proliferation assay. The gastric carcinomacells varied in sensitivity to treatment with low dose IL-4. Treatment ofcalls with IL-4 altered the morphology of the calls to a â€œflattenedâ€•morphological shape resembling differentiation. The IL-4-mediatedgrowth inhibition was significantly abrogated by neutralization of 11-4with specific anti-IL-4 antibody. IL-4R expression on the call surfacewas determined by assessing biotin-labeled IL-4 binding to cells usingflow cytometry. IL-4R expression ranged from 5 to 85% of total cellpopulation in the gastric carcinoma cell lines assessed. There was apositive correlation between the sensitivity to IL-4-mediated growthinhibition and IL-4R expression. By Northern blot analysis, we demonstrated that mRNA of IL-4R was expressed in the gastric carcinomacells. Using in situ hybridization, we confirmed that IL-4R mRNA wasexpressed in the gastric carcinoma cell at the single cell level. By usinga sensitive polymerase chain reaction technique, we demonstrated thatgastric carcinoma cells expressed IL-4 mRNA, suggesting a possibleautocrine loop. These studies indicate that IL-4 can significantly modulate gastric carcinoma cells that possess IL-4R. IL-4R on gastric carcinema cells may be a potential therapeutic target site for IL-4-directedtherapy.

INTRODUCTION

Despite such various therapeutic attempts as combined chemotherapy and radiation therapy, advanced gastric cancer isgenerally resistant. The overall 5-year survival rates of the cancer remain about 20% in the United States (1, 2). Currently,there is no effective adjuvant therapy for gastric carcinomabeyond elective surgery (3). Further knowledge of the biologicalproperties of this cancer is needed to develop successful postsurgical therapies.

Recently, various kinds of strategies using immune cytokinesto treat certain â€˜cancershave been investigated (4â€”10).Identification of cytokines with multiple pleiotropic effects, particularly augmentation of immune-cell activity and modulation ofthe growth of neoplastic cells, permits the development of important strategies for adjuvant immunotherapy against cancer.Several cytokines derived from immune cells, such as tumornecrosis factor-a and interferon--y, have multiple pleiotropiceffects, including the inhibition of tumor growth and modulation of cell surface Ag on tumor cells (6â€”10).

Received 5/13/92; accepted 8/21/92.The costs of publicationof this article weredefrayedin part by the paymentof

page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

I This study was supported by the Ben and Irene Eisenberg Fund and Public

ServiceGrantCA 12582.2 To whom requests for reprints should be addressed, at John Wayne Institute

For CancerTreatment and Research,2200 Santa Monica Boulevard,Santa Monice, CA 90404.

3 The abbreviations used are: IL-4, interleukin 4; IL-4R, interleukin 4 receptor,PCR, polymerasechain reaction; PHA, phytohemagglutinin;FITC, fluoresceinisothiocyanate;PBS,phosphate-bufferedsaline;SSC,standardsaline-citrate;SDS,sodium dodecyl sulfate.

IL-4,3 a cytokine derived primarily from CD4+ T-cells andmast cells, has recently been shown to possess a broad spectrumof biological activities on immune cells (1 1, 12). IL-4 is agrowth regulator and differentiation factor of human B-cellsand T-cells and can modulate functional activities of macrophages (13â€”17).This cytokine has strong immunotherapeuticactivity capable of inducing tumor regression in tumor-bearingmice (18, 19). Moreover, we have recently shown that IL-4alone has a direct inhibitory effect on the growth of humanmelanomas and renal cell carcinomas (20, 2 1). Recent studiessuggest that certain types of human carcinomas may expressIL-4R (21, 22), however the functional activity of these receptors is not clear. Little is known about the biological response ofgastric carcinoma to immune cytokines, particularly their response to IL-4. Gastric carcinoma cells have a high metastaticpotential and often are very aggressive neoplasms. In thepresent study, we sought to determine whether they were sensitive to IL-4.

The objective of this study was to determine whether gastriccarcinoma cells respond to IL-4 and express IL-4R. We demonstrate important findings on the growth-inhibitory effect ofIL-4, cell surface expression of IL-4R, IL-4 mRNA, and IL-4RmRNA expression in human gastric carcinoma cells.

MATERIALS AND METHODS

Tumor Cell Lines. Human gastric adenocarcinoma cell lines,HTB13S, CRL1863, CRL1739, and KATO III, were obtained from theAmerican Type Cell Culture Collection (Rockville, MD). JWGCA1, agastric carcinoma cell line derived from a gastric carcinoma lymph nodemetastasis, was established in our laboratory. In the early stage ofestablishment of this cell line, we used the HyMedium culture medium(Nipro, Tokyo, Japan). JWGCA1 was developed into an establishedcell line. All cell cultures were maintained in continuous exponentialgrowth by weeklypassage ofcells. Cells were routinely grown in RPMI1640 (Cellgro, Mediatech, Washington, DC), supplemented with 2 m@iglutamine, penicillin (100 units/mI), streptomycin (100 @g/ml), and10%heat-inactivated fetal bovine serum (Gemini Bioproducts, Calabasas, CA) (21).

Cytokine and Reagents. Human recombinant IL-4 was the kind giftof Sterling Drug, Inc. (Malvern, PA). Mouse IgGI anti-human IL-4antibody was kindly supplied by Immunex Research and DevelopmentCorp. (Seattle, WA).

Growth Inhibition Assay. To analyze growth ofcells in the presenceofcytokines, a standard [3Hjthymidine (New England Nuclear, Boston,MA) incorporation proliferation assay was set up in 96-well roundbottomed microplates (Costar, Cambridge, MA) as described previously (23). Cells were seeded in wells at I0@ calls/well in 200 @lofculture medium containing various concentrations of IL-4. Analysis ofcytokines at different dilutions was carried out in triplicate. Cells werecultured for 72 h and pulsed with [3H]thymidine6 h before harvesting.Microplate wells were harvested using a PHD harvester (CambridgeTechnology, Inc., Cambridge, MA), and scintillation fluid was added totubes and counted in a Beckman scintillation counter as described previously (23). Statistical evaluation was performed using the Student's ttest. To assess the specific inhibitory effect of IL-4, mouse IgGl antiIL-4 antibody was used in the proliferation assay. For the neutralizationof IL-4 activity, the medium containing IL-4 was preincubated with an

6059

Interleukin 4 Receptor Expression and Growth Inhibition of Gastric CarcinomaCells by Interleukin 4'

Takashi Morisaki, Dale H. Yuzuki, Robert T. Lin, Leland J. Foshag, Donald L. Morton, and Dave S. B. Hoon2

John Wayne institute For Cancer Treatment and Research, Santa Monica, California 90404

on March 5, 2021. © 1992 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

IL-4 EFFECF AND IL-4 RECEPTOR EXPRESSION ON GASTRIC CARCINOMAS

appropriate concentration of anti-IL-4 antibody for 2 h at room temperature and added to the calls. The proliferation assay was carried outas described above.

Effect of IL-4 on call growth was also determined by counting viablecells on day 0 and 24, 48, 72, and 96 h after culturing in 24-well cultureplates. Cultures with or without IL-4 were set up in triplicate in 1 mlculture medium for each time point. At each time point, cells fromindividual wells (triplicate) were harvested and counted under a microscope with a hemocytometer using a trypan blue viability assay.

IL-4 Receptor Assay. Examination of IL-4R expression on call starface by flow cytometry was carried out using biotin-labeled IL-4 asdescribed previously with some modification (24). Briefly, biotin-Nhydroxysuccinimide (Calbiochem, La Jolla, CA) and purified humanrecombinant IL-4 were mixed at a molar ratio of 12:1. One hundred Ml

of IL-4 (1 mg/ml) in 0.1 MNaHCO3, pH 8.5, were mixed with 10 ilbiotin-N-hydroxysuccinimide (1 mg/ml in dimethyl sulfoxide) for 30mm at room temperature, mixing every 10 mm. At the end of theincubation period, the reaction mixture was thoroughly dialyzed in PBSand adjusted to 10 ,Lg/mlin PBS plus 0.01% NaN3.

For IL-4R determination, 5 X 10' tumor callswere incubated with 50ng biotinylated IL-4 in a volume at 100 ILlPBS + 0.02% NaN3 + 2%heat-inactivated fetal calfserum for 30 mm at 4Â°C.After 3 washes withPBS + NaN3, cells were further incubated in 50 ILlofdilution of streptavidin-FITC for 30 mm at 4C. Cells were washed 3 times and analyzedby FACScan (Becton-Dickinson, Mountain View, CA). To control fornonspecific binding of streptavidin-FITC to cells, cells incubated withunlabeled IL-4 and FITC-streptavidin were assessed.

As a positive control for IL-4R, peripheral blood lymphocytes fromnormal donors were activated with phytohemagglutinin (Sigma, St.Louis, MO) at 0.5 gLg/ml+ IL-4 for 2 days. The RNA was then isolatedfrom these lymphocytes as described previously (25).

Northern Blot Analysis. The cDNA probes for human IL-4R andIL-4 were kindly provided by Immunex Corp. Total cellular RNA wasisolated by single-step method for RNA isolation as described previously (25). Briefly, call pellets were lysed with guanidine thiocyanate,including 0.1 M 2-mercaptoethanol and 0.5% N-lauroylsarcosine (sarkosyl), extracted with acid phenol and precipitated with isopropanol.RNA concentrations were measured spectrophotometrically. After denaturation at 65T, RNA (20 ag/lane) was electrophoresed in 2.2 Mformaldehyde + 0.8% agarose gel, transferred to nitrocellulose membranes (Micron Separations, Inc., Westborough, MA), and UV-crosslinked at 1200 mJ/cm2. After prehybridization, the membrane washybridized with IL-4R riboprobe, generated with the Gemini systemriboprobe (Promega, Madison, WI) according to manufacturer's protocol (Promega, Madison, WI), and Ia-32PICTP (New England Nuclear, Boston, MA). Unincorporated label was removed by running thesample through a nick column (Pharmacia, Piscataway, NJ). The riboprobe was added to the hybridization mix at 10@cpm/ml in 50% formamide at 42C for 16 h.

The filter was washed with 2x SSC (IX SSC = 0.15 MNaCl, 0.015M Na3C6H5O4) at 65C for 30 mm, 2x SSC + 0.1% SDS at 65C for 30

mm, and 0.1X SSC at 65C for 10 mm. The autoradiograms wereexposed with an intensifying screen at â€”70Cfor 3 days. As a controlfor specificity and RNA loading, the blots were hybridized with a a-actin cDNA probe. The blots were exposed to autoradiography film X-AR(Kodak X-AR, Rochester, NY) for 2 h.

Polymerase Chain Reaction. Total cellular RNA was prepared according to the single-step method described above. The integrity of theRNA was confirmed by electrophoresis under denaturing conditions ona 1% agarose gel. Avian myeloblastosis virus reverse transcriptase(Promega, Madison, WI) was used for cDNA synthesis with the 3' IL-4primer, and PCR conditions were used as described previously(26, 27).A 5' IL-4 primer + Taq polymerase (Promega) was then added and runfor 25 cycles in a thermocycler (Precision Scientific, Chicago, IL). Thedesign of IL-4 5' and 3' primers was based on the published sequence(28): IL-4 5' primer, ATGGGTCTCACCTCCCAACTG and IL-4 3'primer, CGAACACTFTGAATATTTCFCTCTCAT.

For detection ofIL-4 cDNA, PCR product was run on a 2% agarosegel, stained with ethidium bromide, and visualized by UV transillumi

nation. To determine the specificity and to identify the PCR product,the gel was Southern blotted to a Duraton-UV membrane (Stratagene,La Jolla, CA) for 6 h and cross-linked with 1200 mJ/cm2 UV light. Theprobes were random labeledwith [32PIdCTPusing a random primer kit(Boehringer Mannheim, Indianapolis, IN) as described above. The blotwas prehybridized and the labeled cDNA probe was added to the blot inhybridization solution (6x SSC + 0.5% SDS and 100 @gheat denaturedsheared herring sperm DNA) at a concantration of 10@ cpm/ml andhybridized overnight at 68C. After washing for 15 mm in 2x SSC at65C, the blot was washed 3x in 0.Ix SSC + 0.1% SDS at 65C for 15mm. The blots were then exposed to X-AR autoradiography film for 2h.

In Situ Hybridization. A synthetic oligodeoxynucleotide sequencecomplementary to the mRNA for the IL-4R was end-labeled withdigoxigenin(29) and used to detect the mRNA on the gastric carcinomacell lines. Tissue culture gastric carcinoma cells were first fixed in 4%paraformaldehyde in diethyl pyrocarbonate-PBS for 5 mm. Slides wereprepared with 5 Mlof concentrated calls (10'@cells/MI),air dried, andstored at â€”20Â°Cuntil used. They were then placed sequentially forpredigestion with proteinase K (Sigma) at 10 ,zg/ml in 0.1 M Tris buffer(pH 8) with 50 mMEDTA at 3TC for 30 mm, and prehybridized in asolution containing deionized formamide, 20X SSC, Denhardt's solution (Sigma), heat-denatured sheared herring sperm DNA, yeast tRNA,and dextran sulfate for 1 h at 42C.

Primers(3' end) ofIL-4R mRNA (GGG CIT GAA GGA GCC CTTCCA) synthesized for specific cytokine PCR were tail labeled withdigoxigenin-11-dUTP (Boehringer Mannheim) using the DNA TailingKit (Boehringer Mannheim). Tailing was allowed to continue at 3'FTfor 45 mm. A negative control was carried out by omitting the oligonucleotide in the reaction. Also a 5' oligonucleotide primer specific toIL-2 (GAATGGAATrAATAATrACAAGAATCCC) was end labeledthen used as a negative control.

After a briefwash in 2x SSC, labeled probe (diluted 1:100 in prehybridization solution) was placed on the calls and incubated at 42Tovernight. Slides were washed in 2x SSC for 10 mm at room temperature, lx SSC for 10 mm at room temperature, 0.5x SSC for 10 mmat room temperature, 0.1x SSC at 42C for 15 mm, and 0.lx SSC atroom temperature for 15 mm.

Cells were detected with the Genius Nonradioactive Nucleic AcidDetection Kit (Boehringer Mannheim). Briefly, slides were washed in100 mr@iTris-HC1, 150 mr@iNaCl, pH 7.5, and then incubated with 2%normal sheep serum and 0.3% Triton X-100 at room temperature for30 mm. Anti-digoxigenin antibody (diluted 1:500 with 1% normalsheep serum + 0.3% Triton X-100) was applied to the cells for 3 h atroom temperature. Afterwards, slides were washed in 100 mr@iTrisHC1,100 m@NaCl, 50 miiiMgC12,pH 9.5. Developingsolution contaming 70% nitroblue tetrazolium salt in dimethylformamide, X-phosphate solution (5-bromo-4-chloro-3-indolylphosphate, toluidinium saltin dimethylformamide), and levamisole (Sigma) was placed on the cellsat room temperature until it developeda satisfactory color (2â€”5h). Thereaction was terminated by washing in 10 mmwTris-HCI, I mr@iEDTA,pH 8.0. Slides were read and photographs were taken using a Nikonmicroscope equipped with a Nikon camera (Nikon, Melville, NY).

RESULTS

IL-4 Effect on Gastric Carcinoma Cell Growth. Gastric carcinoma cells were treated with several concentrations ofIL-4 todetermine its effect on cell growth. A standard 3-day [3HJthymidine proliferation assay was used to assess growth of thecells. Fig. 1A shows the 11-4-mediated growth inhibition ofgastric carcinoma cell lines at concentrations of 0.1â€”100units!ml. Inhibition of the cell growth was in a dose-dependent manner in this range. IL-4 treatment significantly inhibited growthof all the gastric carcinoma cell lines (Fig. 1A). Individual celllines showed a differential response to the different concentrations of IL-4. The growth of the 2 cell lines, HTB-135 andJWGCA1, was significantly (P < 0.01) inhibited by IL-4 at a

6060



IL-4 EFFECT AND IL-4 RECEPTOR EXPRESSION ON GASTRIC CARCINOMAS

added without IL-4. Also in this instance growth did not increase significantly.

To assess the specific effect of IL-4 on tumor cells, an antiIL-4 antibody neutralizing assay was carried out. Anti-IL-4antibody was added to the culture media containing IL-4 andincubated together before adding to the cells in a 3-day proliferation assay. Anti-IL-4 significantly reduced the IL-4-mediated growth-inhibitory effect (Table 1). Anti-IL-4 antibodyalone, as a control, had no significant effect on cell growth.These results confirm that IL-4 directly affected the gastriccarcinoma cells.

II@4 Receptor Expression on the Cell Surface. IL-4 affectsimmune cells by binding to IL-4R (24). The expression of theIL-4R on the cell surface of the gastric carcinoma cell lines was

400. â€”@ examinedby flow cytometry.Analysisof the cell linesshowedB that therewasspecificstainingin all the linesanalyzed;2 lines

had high density expression of IL-4R (HTB-1 35, JWGCA 1),and the other 2 celllines(CRL1739, CRL1863) had low density

300- expressionof IL-4R (Fig. 3). Fig. 3 showsthe representativeflow cytometry histogram ofthe IL-4 receptor expression of celllines with high and low density expression. As a positive control, comparisons were made to PHA plus IL-4-stimulated lymphocytes. The binding of IL-4 to activated lymphocytes wassimilar to that of the gastric carcinoma cell lines, but at a levelequivalent to HTB-135 (data not shown). The correlation between IL-4R expression and the effect of IL-4 on inhibiting thegrowth of gastric carcinoma cells was analyzed (Table 2). Wecompared the percentage of growth inhibition at 10 units/ml

0 - i , I I IL-4 with the level of IL-4R expression of the total cell popu0 24 48 72 96 lation for each of the 4 cell lines (Table 2). HTB-135 and

JWGCA1, whose expression of IL-4R was higher than that ofthe other 2 cell lines, were more sensitive to IL-4-mediatedgrowth inhibition than other 2 lines with low density expressionof IL-4R. These results suggest that the expression ofIL-4R onthe cell surface is directly correlated to the sensitivity of IL-4treatment.

Detection of IL-4R mRNA. To detect the expression ofIL-4R mRNA on tumor cells, Northern blot analysis was carned out. Five gastric carcinoma cell lines total RNA sampleswere probed with a IL-4R riboprobe. As a positive control forIL-4R mRNA expression, mRNA from PHA-activated lymphocytes was analyzed. All 5 samples expressed IL-4R mRNA(Fig. 4). The specific band bound by IL-4R riboprobe was thesame size (@4.0 kilobases) as IL-4R mRNA of PHA-activatedlymphocytes. To further confirm the expression ofIL-4R by thegastric carcinoma cells, a PCR analysis was carried out withspecific primers to the human IL-4R gene. The results of thisanalysis showed the presence of mRNAs for IL-4R in thesecells. Expression ofthe PCR IL-4R cDNA product using lL-4Rprimers was confirmed by Southern blot analysis with a specificradiolabeled IL-4R cDNA probe (data not shown).

IL-4 mRNA Expression in Gastric Carcinoma Cells. We assessed the gastric carcinoma cell lines to determine whetherIL-4 mRNA was expressed and whether there was a possibleautocrine loop mechanism. Initially, we carried out a PCR analysis using specific IL-4 primers, and the product run on the gelwith ethidium bromide was read by UV-transillumination. Using this procedure, occasionally only the HTB-135 showed aspecific faint band. This procedure was repeated on several lineswith various modifications of the PCR procedure, however nospecific cDNA product could be found. We then analyzed thegels by Southern blot analysis using a radiolabeled IL-4 cDNA

6061

JWGCO1 HTB@-135 CR1-i739 CRL-1863Gastric C@rinounaCell Lines

00

E 200-30U

00

100-

Hours of cultureFig. 1. A, IL-4 effect on gastric carcinoma cell growth measured by (3HJ

thymidine uptake. Cell lines were treated with 0 (S), 0.1 (s), 1 (U), 10 (D), and100 (0) units/mI IL-4. Growth of the cells was determined by a 3-day 13H1-thymidine uptake proliferation assay. These are representative experiments on theeffecton individualcelllinestreatedwithIL-4(0.lâ€”l00units/mI).Bars,meansÂ±SEM. Controls for each cell line are growth in culture mediumalone. Statistical(Student t tests) comparisons betweencontrol and treated cells were performed(5P< 0.05, 5@P< 0.01). B, IL-4 effect on gastric carcinoma cell growth measuredby trypan blue viability cell counting. The cell line HTB-135 was assessed aftertreatment with 100 units/ml IL-4 () and medium alone (A). Initial counts on day0 was 5 X 10g.Points, mean of triplicates bars, SD.

concentration of 10 units!ml or greater. The growth ofthe other2 cell lines, CRL1739 and CRL1863, was significantly (P <0.05) inhibited at 100 units!ml IL-4. When the concentration ofIL-4 was increased to 500 units/mi, the growth inhibitory effectplateaued and was not significantly enhanced (data not shown).These results indicate that there is a differential sensitivity to11-4 among the gastric carcinoma cell lines tested.

Cells treated with 11-4 at these concentrations did not significantly reduce cell viability as measured by the trypan blueexclusion test. To verify the growth inhibition, a viable cellcount was taken at various time points comparing IL-4-treatedand nontreated HTB-135 cells (representative example). Thecell count of controls versus IL-4-treated cells at @48h wassignificantly (P < 0.01) less (Fig. 1B).

Visual examination showed that cells that responded stronglyto treatment with IL-4 had a more â€œflattenedand enlargedâ€•morphology compared to untreated cells (Fig. 2). This dramaticmorphological change was observed when cells were treatedwith 11-4 at least twice every 2â€”3days. After 2 treatments withIL-4, tumor cells that responded did not revert back to themorphology of pretreated cells when new culture medium was



IL-4 (units/mI)Anti-IL-4antibody

(,@g/ml)%growth

inhibitionaMean cpm Â±SEMNoneNone04394

Â±168None53.3Â±0.34245Â±25None50â€”3.4Â±

1.04520Â±10910None46.0Â±1.42480Â±151105338@25b2906Â±1871050218@11b3435k

87100None54.5Â±3.51993Â±2621005411@37b2586Â±2821005029@18b3120Â±138

â€˜ A

I'll It

pp@@@@ i@@@@@@ i'@,,@@@@,@

:aa i'at :a@ :a@

Fig. 3. Representativeflowcytometryhistogramsof IL-4R on the cell surfaceofgastric carcinoma cells. Cells were incubated with biotinylated lL-4 followed bystaining with FITC-conjugated streptavidin (â€”). Control cells represent thebackground fluorescence of the cells stained with FITC-conjugated streptavidinand IL-4(- - - -).A representativeexampleofa high(A)and low(B)density IL-4Rexpressing cells are shown. A, HTB-l35 cell line; B, CRL-l739 cell line.

Table 2 Correlation between iL-4R expression and sensitivity to IL-4 -mediatedgrowth inhibition

Flow-cytometric analysis of biotinylated IL-4 binding was determined as described in â€œMaterialsand Methods.â€•Growth inhibition ofcells was determined bya 3-day (3Hjthymidineuptake proliferation assay. Cells were treated with 10units/mI IL-4. PHA-activated lymphocytes were generated from peripheral bloodlymphocytes stimulated with 0.5 @zg/mlPHA for 48 h. Growth inhibition wascalculated as: 100 x (cells in culture medium alone cpm â€”cells treated with IL-4cpm)/cells in culture medium alone cpm.

Cell linesIL-4Rexpression

(% positive cells)Growthinhibition

by IL-4(%)JWGCAI6450.8HTB-1358544.8CRL17393626.1CRL1863518.7PHA-activated

lymphocytes98None


BA

Fig. 2. Cell morphological changes afterIL-4 treatment. Shown is an example of HTB135 cells before and after treatment with IL-4(100 units/mI). Cells were treated with IL-4and assessed on day 4. A, control untreatedcells B, IL-4-treated cells (x 200).

â€˜a

1@

@;:1rJj@,@

@$l@1a@@@@

DISCUSSIONTable I inhibition ofiL-4 effect by anti-iL-4 antibody

A representativeexample of anti-IL-4 antibody neutralization of IL-4 effect.HTB-135 were seeded in at l0@/wellin 96-wellmicroplates in culture mediumcontaining antibody and/or IL-4. A standard 3-day proliferation assay was carriedout. For the neutralization of IL-4 activity, lL-4-containing medium was preincubated with anti-IL-4 antibody at room temperature for 2 h and then added tocells.

The studies presented here demonstrate that IL-4 can significantly inhibit the growth and morphology ofgastric carcinomacells. We have recently reported that IL-4 inhibits the growth ofhuman melanoma cells (20) and renal cell carcinomas (21).However, in this study we demonstrated that gastric carcinomasare more sensitive to low dose IL-4 in a dose-dependent manner

I_ - . . @2Qg. .@ .

iaa i@1@

B

a Percent growth inhibition mean of triplicates Â± SEM compared to controlnone treated.

b p < 0.05; comparison with corresponding control.

probe. We detected an IL-4 product corresponding to the location of the specific base pair marker size of the PCR product inall the cell lines (Fig. 5). The IL-4 PCR product of the gastriccarcinoma cells was the same as that of the PHA-activatedlymphocytes. As a control, hybridization with an actin cDNAprobe showed no binding.

In Situ Hybridization. We examined IL-4R mRNA on gastric carcinoma cells at a single cell level by in situ hybridizationusing digoxigenin-labeled IL-4R 3'-oligonucleotide-primerprobe. Fig. 6 shows a representative example of a cell line.Positive cells showed dense staining that varied among individual carcinoma cells. A negative control, consisting of labeledIL-2 5' primer probe that showed no staining, and a positivecontrol, consisting of PHA-activated lymphocytes stained withlabeled IL-4R 3' oligonucleotide primer probe, were used forcomparison (data not shown). These results indicate that thegastric carcinoma cells express IL-4R mRNA at different levelsamong the individual cells within the cell lines.

6062

@!@J? \@



IL-4 EFFECT AND lL-4 RECEPTOR EXPRESSION ON GASTRIC CARCINOMAS

compared to other neoplasms (20, 21). The concentrations ofIL-4 used were not inhibitory to lymphocytes (20). Anti-IL-4antibody blocking of IL-4 growth inhibition demonstrated thatthe IL-4 effect was a specific inhibition rather than a toxiceffect. Treatment of the cells produced a â€œflattenedtypeâ€•morphology resembling a differentiated epithelial shape, suggestingthat IL-4 may reverse the cells to a differentiated state. Afterseveral treatments of IL-4 followed by culturing in culture medium alone, cell growth was significantly slower compared to

28s>@*@@

iss@I I

ABCDEFig. 5. PCR mRNA amplification of gastric carcinoma cells using specific

primers to IL-4.Total RNA ofcells wasextracted and run in a PCR as describedin â€œMaterialsand Methods.â€•PCR product was analyzed by electrophoresis on a2% agarose gel followed by Southern blotting using a radiolabeled IL-4 cDNAprobe. Lane A, HTB-l35; Lane B, JWGCA1; Lane C, CRL1739; Lane D,CRL1863; Lane E, KATO III.

normal untreated cultures (data not shown). The growth inhibition and morphological changes induced by IL-4 suggested amodification of the cell phenotype to a more differentiatedform. This is a unique observation whereby a single type ofinterleukin can significantly modulate the growth and morphology of a human carcinoma cell.

One of the most important findings in this study was thedemonstration of IL-4R on the gastric carcinoma cells. IL-4mediates its effects through the cell surface receptor of a singleclass of high affinity receptors for IL-4, as has been detected onhematopoietic cells (30, 31). The most sensitive cell lines toIL-4, JWGCA1 and HTB-135, correlated to the highest level ofIL-4R expression. These studies demonstrate that the level ofresponsiveness of cells to IL-4 is related to IL-4R on the cellsurface. This indicates that IL-4 acts as a negative regulator of

0 B

â€¢6

ABCDEFFig. 4. Northern blot analysis of IL-4R mRNA expression in 5 gastric carci

noma cell lines. Total RNA gel blots containing approximately 20 @gof totalRNA per lane was hybridizedwith 32P-labeledIL-4R riboprobe.Cell lines RNArun were as follows: Lane A, HTB-I35; Lane B, JWGCAI; Lane C, CRL1739;Lane D, CRL1863; Lane E, KATO III; Lane F, PHA-activated lymphocytes(jositive control). The position of 28S and 18S ribosomal RNAs is indicated.

Fig. 6. Detection of IL-4R mRNA in gastric carcinoma cells by in situ hybridization using digoxigenin-labeledoligodeoxynucleotideprobe (@MateriaIsandMethodsâ€•).The representative cell line shown is HTB-135. The cells fixed on glass slides were photographed using a phase contrast microscope. A, control cells; B,IL-4R-stained cells.

,â€˜ /

.3 r@''@

,e@@c-'@

@@@ .

@:â€˜.J â€˜ â€¢@ .@ 0

I

@ @:

@-@--\

A

p

6063




the growth of gastric cancer cells that possess IL-4R. This is anovel effect of a cytokine compared to other cytokines releasedby immune cells such as IL-6, granulocyte macrophage-colonystimulating factor, and IL-i , which have recently been shown toaugment neoplastic cell growth (32â€”36).

Although receptor binding studies can demonstrate specificreceptor expression, there can still be cross-reactivity. A goodexample is the cross-reactivity of transforming growth factor-awith epidermal growth factor receptor (37). It is therefore alsoimportant to identify receptor expression by analysis with specific molecular probes that react with unique sequences of thegene encoding the receptor. Recently the human IL-4R cDNAwas isolated and sequenced (38, 39) and has been shown to bea member of the hemopoietin receptor superfamily, which hasextracellular homologous regions similar to other cytokine andgrowth factor receptors (40). By Northern blot analysis we demonstrated IL-4R mRNA expression in the gastric carcinomacells and showed that it was identical in size to that of IL-4RmRNA of human T cells. Moreover, we confirmed IL-4RmRNA expression by the gastric carcinoma cells using PCRand in situ hybridization.

The mechanism of IL-4-mediated growth inhibition of gastric carcinoma cells has remained unclear. Recently Okabe et a!.(41) demonstrated that the inhibitory effect of IL-4 on thegrowth ofPh'-positive leukemia cells is related to the inhibitionof tyrosine kinase activity in these cells. This possible mechanism of IL-4 effect on cells has to be further analyzed to determine its specificity.

We have demonstrated that IL-4 is produced in gastric carcinoma cells but at a low level, suggesting that there may be anautocrine loop effect. At this point IL-4 appears as a negativegrowth regulator, however, more studies remain to be carriedout to understand this mechanism. T-cells, such as helper cells,have been shown to release IL-4 and express IL-4R (i i, i 2),however, their autocrine role, if any, has not been determined.Contrarily, several cancers have been shown to express cytokinereceptors and the specific corresponding cytokine functions in apositive autocrine loop (34, 36). These specific autocrine cyto

kines have been suggested to promote tumor growth and pathogenesis.

Patients with advanced gastric carcinoma cells have a verypoor prognosis. The strong modulatory effect of IL-4 on cellgrowth and morphology suggests that it may be a good therapeutic candidate. Up to now, the main therapeutic use of IL-4is as a biological response modifier of immune cells, however,its property as an antitumor growth regulator provides an additional characteristic for its use. Cancer cells of epithelial origin appear to be very responsive to IL-4 treatment (21, 42). Itis clear that the level of IL-4R expression is important for theresponse of the cell to IL-4. IL-4R may be a potential markerfor the level of differentiation of epithelium-type cancers. Atpresent, there are limited number of good differentiation markers for epithelial cancers, particularly gastric cell carcinomas.This study is the first to demonstrate functional IL-4R andIL-4R mRNA in human gastric carcinomas.

The ability of IL-4 to significantly modulate the growth ofgastric carcinoma cells suggests that this cytokine may have animportant role in the natural tumor immune defense mechanism. Tumor-infiltrating lymphocytes have been shown to consist of of activated CD4+ T-cells (43). Cytokines such as IL-4released by the CD4+ T-cells when activated in the microenvi

6064

ronment of the tumor may have a significant direct effect ontumor progression. Studies in the treatment of gastric cancerutilizing IL-4R as a potential therapeutic target site need to bedeveloped.

ACKNOWLEDGMENTS

We wish to thank M. Hayashida and Y. Wang for their technicalassistance, and Dr. A. Walsh for her editorial assistance.

REFERENCES

1. Ajani, J. A., Ota, D. M., Jessup, J. M., Ames, F. C., McBride, C., Boddie, A.,Levin, B., Jackson, D. E., Roh, M., and Hohn, D. Resectable gastric carcinoma. An evaluation of preoperative and postoperative chemotherapy. Cancer (Phila.), 68: 1501â€”1506,1991.

2. Silverberg, E., Boring, C. C., and Squires, T. S. Cancer Statistics. CA CancerJ. Clin., 40: 9â€”26,1990.

3. Douglass, H. 0. Gastric cancer: current status ofadjuvant therapy. Oncology,3:61â€”77, 1989.

4. Garnick, M. B., Reich, S. D., Maxwell, B., Coval-Goldsmith, S., Richie, J. P.,and Rudnick, S. A. Phase I/I! study of recombinant interferon gamma inadvanced renal cell carcinoma. J. Urol., 139: 251â€”255,1988.

5. Kirkwood, J. M., and Ernstoff, M. S. Role of interferons in the therapy ofmelanoma. J. Invest. DermatoL, 95: 180S-184S, 1990.

6. Browning. J., and Ribolini. A. Studies on the differing effects of tumornecrosis factor and lymphotoxin on the growth ofseveral human tumor lines.J. Immunol., 143: 1859â€”1867,1989.

7. Weber, J. S., and Rosenberg, S. A. Modulation of murine tumor majorhistocompatibility antigens by cytokines in vivo and in vitro. Cancer Res., 48:5818â€”5824,1988.

8. Tran, R., Hand, P. H., Greiner, J. W., Pestka, S., and Schlom, J. Enhancement of surface antigen expression on human breast carcinoma cells byrecombinant human interferons. J. Interferon Res., 8: 75â€”88,1988.

9. Lewis, G. D., Aggarwal, B. B., Eessalu, T. E., Sugarman, B. J., and Shepard,H. M. Modulation of the growth of transformed cells by human tumornecrosis factor-a and â€˜y-interferon.Cancer Res., 47: 5382â€”5385,1987.

10. Maio, M., Gulwani, B., Morgano, A., and Ferrone, S. Differential modulation by tumor necrosis factor and immune interferon of HLA class-Il antigens expressed by melanoma cells. mt. J. Cancer, 44: 554â€”559,1989.

11. Banchereau, J., Defrance, T., GaIiZZi, J. P., Miossec, P., and Rousset, F.Human interleukin 4. Bull. Cancer, 78: 299â€”306,1991.

12. Street, N. E., and Mossmann, T. R. IL-4 and IL-5: the role of two multifunctional cytokines and their place in the network of cytokine interaction.Biotherapy, 2: 347â€”362,1990.

13. Essner, R., Rhoades, K., McBride, W. H., Morton, D. L., and Economou, J.S. IL-4 down-regulates lL-l and TNF gene expression in human monocytes.J. Immunol., 142: 3857â€”3861,1989.

14. Paul. W. E., and Ohara, J. B-cell stimulatory factor interleukin 4. Ann. Rev.Immunol., 5: 429â€”459,1987.

15. Kawakami, Y., Rosenberg, S. A., and Lotze, M, T. Interleukin 4 promotesthe growthoftumor-infiltrating lymphocytescytotoxicfor human autologousmelanoma.J.Exp.Med.,168:2183â€”2191,1988.

16. Widmer, M. B., and Grabstein, K. H. Regulationofcytotoxic T-lymphocytegeneration by B-cell stimulatory factor. Nature (Lond.), 326: 795â€”798,1987.

17. Mitchell, L. C., Davis, L. S., and Lipsky, P. E. Promotion of human Tlymphocyte proliferation by IL-4. J. Immunol., 142: 1548â€”1557,1989.

18. Tepper. R. I., Pattengale, P. K., and Leder, P. Murine interleukin-4 displayspotent anti-tumor activity in vivo. Cell 57: 503â€”512,1989.

19. Golumbek,P. T., Lazenby,A. J., Levitsky,H. I., Jaffee, L. M., Karasuyama,H., Baker, M., and Pardoll, D. M. Treatment of establishedrenal cancer bytumor cells engineered to secrete interleukin-4. Science (Washington DC),254:713â€”716,1991.

20. Hoon, D. S. B., Banez, M., Okun, E., Morton, D. L., and Inc., F. R. Modulation of human melanoma cells by interleukin-4 and in combination with-y-interferon or a-tumor necrosis factor. Cancer Res., 51: 2002â€”2008,1991.

21. Hoon. D. S. B., Edward. 0., Banez, M., Inc. F. R., and Morton, D. L.Interleukin 4 alone and with -y-interferon or tumor necrosis factor inhibitscell growth and modulates cell surface antigens on human renal cell carcinoma. Cancer Res., 51: 5687â€”5693,1991.

22. Jabaari, B. A., Ladyman, H. M., Larche, M., Sivolapenko, G. B., Epenetos,A. A., and Ritter, M. A. Elevatedexpressionof the interleukin4 receptor incarcinoma: a target for immunotherapy? Br. J. Cancer, 59: 910â€”914,1989.

23. Hoon, D. S. B., Korn, E. L., and Cochran, A. J. Variations in functionalimmunocompetence of individual tumor-draining lymph nodes in humans.Cancer Res., 47: 1740â€”1744,1987.

24. Arinitage, R. J., Beckmann, M. P., Idzerda, R. L., Alpert, A., and Fanslow,W. C. Regulationof interleukin4 receptorson human T cells.Int. Immunol.,2: 1039â€”1045,1990.

25. Chromczynski, P., and Sacchi, N. Single-step method of RNA isolation byacid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156â€”159,1987.

26. Wang, A. M., Doyle, M. V., and Mark, 0. F. Quantitation of mRNA by



lL-4 EFFEC1@AND IL-4 RECEPTOR EXPRESSION ON GASTRIC CARCINOMAS

polymerase chain reaction. Proc. NatI. Acad. Sci. USA, 86: 9717â€”9721,1989.

27. Kawasaki, E. S. Amplification of RNA. In.@M. A. Innis., M. A. Gelford., D.H. Shinsky,and T. J. White (eds.),PCR Protocols,A Guide to Methods andApplications,pp. 21â€”27.Boca Raton: AcademicPress, 1991.

28. Yokota, T., Otsuka, T., Mossmann, T., Banchereau, J., Defrance, T., Blanchard, D., DeVries,J. E., Lee, F., and Arai, K. Isolationand characterizationof a human interleukin cDNA clone, homologous to mouse B-cell stimulatory factor I that expresses B-cell and T-cell stimulating activities. Proc. NatI.Acad. Sci. USA, 83: 5894â€”5898,1986.

29. Farquharson, M., Harvie, R., and McNicol, A. M. Detection of messengerRNA using a digoxigeninend labelledoligodeoxynucleotideprobe. J. Clin.Pathol., 43: 424â€”428,1990.

30. Lowenthal, J. W., Catle, B. E., Christiansen, J., Schreurs, J., Rennick, D.,Arai, N., Hoy, P., Takabe, Y., and Howard, M. Expression of high affinityreceptors for murine interleukin 4 (BSF-I) on hemopoietic and non-hemopoietic cells. J. Immunol., 140: 456â€”464,1988.

31. Ohara, J., and Paul, W. E. Receptors for B-cell stimulatory factor-l cxpressed on cells of hematopoietic lineage. Nature (Lond.), 325: 537â€”540,1987.

32. Berdel, E., Danhauser-Riedl, S., Steihauser, G., and Winton, E. F. Varioushuman hematopoieticgrowthfactors(interleukin-3,GM-CSF,G-CSF)stimulate clonal growth of non-hematopoietic tumor cells. Blood, 73: 80â€”83,1989.

33. Dedhar, S., Gaboury, L., Galloway, P., and Evans, C. Human granulocytemacrophage colony-stimulating factor is a growth factor on a variety of celltypes of nonhematopoietic origin. Proc. Natl. Acad. Sci. USA, 83: 9253â€”9257, 1988.

34. Miles, S. A., Rezai, A. R., Salazar-Gonzalez, J. F., Meyden, M. V., Stevens,R. H., Logan, D. M., Mituyasu, R. T., Tags, T., Hirano, T., l(ishimoto, T.,and Martinez-Mara, 0. AIDS Kaposi sarcoma-derivedcells produce andrespond to interleukin 6. Proc. NatI. Acad. Sci. USA, 87: 4068â€”4072,1990.

35. Gaffney, E. V., Koch, G., Tsai, S-C., Loucks, T., and Lingenfelter, S. E.Correlation between human cell growth response to interleukin I and receptor binding. Cancer Res., 48: 5455â€”5459,1988.

36. Miki, S., Iwano, M., Miki, Y., Yamamoto, M., Tang, B., Yokokawa, K.,Sonoda,T., Hirano, T., and Kishimoto,T. Interleukin-6(IL-6)functionas anin vitro autocrine growth factor in renal cell carcinomas. FEBS Lett., 25:607â€”610,1989.

37. Korc, M., Chandrasekar, B., and Shah, G. N. Differential binding and biological activities of epidermal growth factor and transforming growth factora in a human pancreatic cancer cell line. Cancer Res., 51: 6243â€”6249, 1991.

38. Galizzi, J. P., Zuber, C. E., Harada, N., Gorman, D. M., Djossou, 0.,Kastelein, R., Banchereau, J., Howard, M., and Miyajima, A. Molecularcloning ofcDNA encoding the human interleukin 4 receptor. Int. Immunol.,2:669â€”675, 1990.

39. Idzerda, R. L., March, C. J., Mosley, B., Lyman, S. D., Bos, T. V., Gimpel,S. D., Din, W. S., Grabstein, K. H., Widmer, M. B., Park, L. S., Cosman, D.,and Beckmann, M. P. Human interleukin 4 receptor confers biological responsivenessand defines a novel receptor superfamily.J. Exp. Med., 171:861â€”873,1990.

40. Cosman, D., Lyman, S. D., Idzerda, R. L, Beckmann, M. P., Park, L. S.,Goodwin, R. L., and March, C. J. A new cytokine receptor superfamily.Trends Biochem. Sci., 15: 265â€”270,1990.

41. Okabe, M., Kunieda,Y., Sugiwura,T., Tanaka, M., Miyagishima,T., Saiki,I., Minagawa,T., Kurosawa,M., Itaya,T., and Miyazaki,T. Inhibitoryeffectof Interleukin-4 on the in vitro growth of Ph'-positive acute lymphoblasticleukemia cells. Blood, 6: 1574â€”1580,1991.

42. Toi, M., Bicknell, R., and Harris, A. L. Inhibition of colon and breast carcinoma cell growth by interleukin-4. Cancer Res., 52: 275â€”279,1992.

43. Belldegrun, A. L., Muul, L. M., and Rosenberg, S. A. Interleukin-2 expandedtumor infiltrating lymphocytes in human renal cell cancer: isolation, characterization and antitumor activity. Cancer Res., 48: 206â€”211,1988.

6065



1992;52:6059-6065. Cancer Res Takashi Morisaki, Dale H. Yuzuki, Robert T. Lin, et al. Gastric Carcinoma Cells by Interleukin 4Interleukin 4 Receptor Expression and Growth Inhibition of

Updated version

http://cancerres.aacrjournals.org/content/52/21/6059

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/52/21/6059To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



Documents

Interleukin 4 Receptor Expression and Growth Inhibition of ... · The expression of the interleukin 4 (IL-4) receptor (IL-4R) and ef facts of human recombinant IL-4 on human gastric