Embed Size (px)
Citation preview
INTERACTION BETWEEN PHYTOPHTHORA NICOTIANAE AND CANDIDATUS LIBERIBACTER ASIATICUS DAMAGE TO CITRUS FIBROUS ROOTS
By
JIAN WU
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2015
© 2015 Jian Wu
To my family, for their love To my advisors, for their spirits of passing on the knowledge
4
ACKNOWLEDGMENTS
To those who helped me through the 4 ½ years I stayed at the University of
Florida to finish the Ph. D. program.
First, I would like to thank my advisor James H. Graham, who supported me
during my whole doctoral study. He guided me when I first learned to work as a plant
pathologist. He helped me to build confidence by encouraging me when I made
progress. He instructed me by sharing his experience and wisdom. Without him, I would
not have had the precious opportunity to be around the best scientists and experience
the amazing foreign life.
I would also like to thank Evan Johnson, who guided me daily. I appreciated his
time and patience. He inspired me when I encountered problems. He was always the
first one I went to for help. Without his help and instruction, my project would have gone
very slowly.
I would like to thank Dr. Larry Duncan, Dr. Jude Grosser, Dr. Kelly Morgan and
Dr. Nian Wang for precious suggestions during the committee meeting. Their advice
made the project integrated.
I would like to thank all my lab mates, Diane Bright, Kayla Gerbrich and Tony
McIntosh who helped make this project practical to finish in 4 ½ years. They also offered
a friendly environment for me to learn, adjust and grow.
I would like to thank all my friends from different countries who accompanied me
during these years. Your friendships helped me to overcome the cultural crunch at the
beginning, and your different opinions and stories made me open minded.
My grateful heart is more than words.
5
TABLE OF CONTENTS page
ACKNOWLEDGMENTS .................................................................................................. 4
LIST OF TABLES ............................................................................................................ 8
LIST OF FIGURES .......................................................................................................... 9
LIST OF ABBREVIATIONS ........................................................................................... 11
ABSTRACT ................................................................................................................... 12
CHAPTER
1 LITERATURE REVIEW .......................................................................................... 14
1.1 Citrus Huanglongbing ....................................................................................... 14
1.1.1 HLB History ............................................................................................. 16 1.1.2 Geographic Distribution ........................................................................... 17 1.1.3 Causal Agent and Vectors ....................................................................... 17
1.1.4 Psyllid Biology ......................................................................................... 18 1.1.5 HLB Disease Development ..................................................................... 20
1.1.6 Rootstocks Susceptibility and Tolerance to Las Infection ........................ 24 1.1.7 HLB Detection ......................................................................................... 25
1.1.8 HLB Management.................................................................................... 26 1.2 Phytophthora spp. and Diseases ...................................................................... 28
1.2.1 Diseases of Citrus Caused by Phytophthora spp. ................................... 30
1.2.2 Phylogeny and Detection of P. nicotianae (Breda de Haan var. nicotianae Waterhouse) ................................................................................ 33
1.2.3 Life and Disease Cycle ............................................................................ 34 1.2.4 The Molecular Basis of Pathogenesis ..................................................... 37 1.2.5 Interaction with other Organisms ............................................................. 38 1.2.6 Phytophthora spp. Management ............................................................. 38
1.3 Interaction between P. nicotianae and Candidatus Liberibacter asiaticus ........ 39
1.4 Citrus Root Biology ........................................................................................... 40 1.4.1 Citrus Root Function and Growth Pattern ................................................ 40
1.4.2 Citrus Root Architecture .......................................................................... 41 1.4.3 Citrus Fibrous Root Anatomy .................................................................. 42
2 THE INTERACTION BETWEEN PHYTOPHTHORA NICOTIANAE AND CANDIDATUS LIBERIBACTER ASIATICUS DAMAGE TO CITRUS FIBROUS ROOTS ................................................................................................................... 43
2.1 Introduction ....................................................................................................... 43 2.2 Materials and Methods ...................................................................................... 45
6
2.2.1 Experimental Design and Inoculation with Candidatus Liberibacter asiaticus ........................................................................................................ 45
2.2.2 Inoculation with Phytophthora nicotianae ................................................ 46
2.2.3 Assessment of Phytophthora Root Infection and Collection of Exudates ....................................................................................................... 47
2.2.4 Candidatus Liberibacter asiaticus Detection ............................................ 47
2.2.5 Quantification of Starch in Fibrous Roots ................................................ 48 2.2.6 Quantification of Sucrose in Root Exudates and Fibrous Roots .............. 49
2.2.7 Statistical Analysis ................................................................................... 49 2.3 Results .............................................................................................................. 50
2.3.1 Las Effect on P.n. Infection Incidence ..................................................... 50 2.3.2 Relationship between Fibrous Root Damage and P.n. Infection
Incidence ....................................................................................................... 50
2.3.3 Effect of Las on Root Exudation of Sucrose ............................................ 53 2.3.4 Effect of Las and P.n. on Root Starch Concentration .............................. 53
2.3.5 Relationship between P.n. Infection Incidence and Total Sugar in Fibrous Roots ................................................................................................ 54
2.4 Discussion ........................................................................................................ 55
3 COMPARISON OF FIBROUS ROOT DAMAGE ON CITRUS ROOTSTOCKS CAUSED BY CANDIDATUS LIBERIBACTER ASIATICUS AND PHYTOPHTHORA NICOTIANAE ........................................................................... 79
3.1 Introduction ....................................................................................................... 79 3.2 Materials and Methods ...................................................................................... 81
3.2.1 Plant Materials and Inoculation with Candidatus Liberibacter asiaticus... 81 3.2.2 Phytophthora nicotianae – Candidatus Liberibacter asiaticus
interaction ...................................................................................................... 81
3.2.3 Root and Leaf Morphology Analysis ........................................................ 82 3.2.4 Candidatus Liberibacter asiaticus Detection ............................................ 83
3.2.5 Quantification of Sucrose in Fibrous Roots ............................................. 84 3.2.6 Statistical Analysis ................................................................................... 84
3.3 Results .............................................................................................................. 84
3.3.1 Total Root Length .................................................................................... 84 3.3.2 Root Length and Diameter Class ............................................................ 86 3.3.3 New Root Length ..................................................................................... 87 3.3.4 Fibrous Root Sucrose .............................................................................. 88
3.3.5 Total Leaf Area ........................................................................................ 89 3.3.6 Specific Leaf Area ................................................................................... 90
3.4 Discussion ........................................................................................................ 91
4 EXPRESSION OF SUCROSE METABOLISM GENES IN FIBROUS ROOTS INFECTED WITH CANDIDATUS LIBERIBACTER ASIATICUS AND PHYTOPHTHORA NICOTIANAE ......................................................................... 103
4.1 Introduction ..................................................................................................... 103
4.2 Materials and Methods .................................................................................... 106
7
4.2.1 Plant Materials ....................................................................................... 106 4.2.2. Phytophthora nicotianae – Candidatus Liberibacter asiaticus
Interaction ................................................................................................... 106 4.2.3. Candidatus Liberibacter asiaticus Detection ......................................... 107
4.2.4 Quantification of Sucrose and Glucose in Fibrous Roots Tissue ........... 108 4.2.5 RNA Extraction and qRT-PCR .............................................................. 109 4.2.6 Statistical Analysis ................................................................................. 109
4.3 Results ............................................................................................................ 110
4.3.1 Fibrous Root Glucose Content .............................................................. 110 4.3.2 Fibrous Root Sucrose Content .............................................................. 110 4.3.3 Relative Gene Expression of Sucrose Transporter 1 (SUT1) ................ 111 4.3.4 Relative Gene Expression of Acid Invertase- βFruct1 ........................... 112 4.3.5 Relative Gene Expression of Acid Invertase-βFruct2 ............................ 112
4.3.6 Relative Gene Expression of Neutral/alkaline Invertase-CitCNV1 ......... 113 4.3.7 Relative Gene Expression of Sucrose Synthase- CitSUSA ................... 113
4.3.8 Relative Gene Expression of Sucrose Synthase- CitSUS1 ................... 114
4.3.9 Relative Gene Expression of Sucrose-phosphate-synthase (SPS) ....... 114 4.4 Discussion ...................................................................................................... 115
5 SUMMARY ........................................................................................................... 127
APPENDIX
A: NEW ROOT LENGTH of CLEOPATRA MANDARIN .............................................. 130
B: FERTILIZER INGREDIENTS .................................................................................. 131
LIST OF REFERENCES ............................................................................................. 132
BIOGRAPHICAL SKETCH .......................................................................................... 151
8
LIST OF TABLES
Table page 4-1 Primer sets used to amplify specific regions of Citrus genes involved in
sucrose metabolism (5’-3’) ............................................................................... 126
9
LIST OF FIGURES
Figure page 2-1 P.n. infection incidence of Cleopatra mandarin .................................................. 59
2-2 P.n. infection incidence of Swingle citrumelo, X639 and sour orange ............... 60
2-3 Fibrous root biomass of Cleopatra mandarin ...................................................... 61
2-4 Fibrous root biomass of Swingle citrumelo, X639 and sour orange .................... 62
2-5 Linear regression of P.n. infection and fibrous root biomass (Cleopatra 2013). . 63
2-6 Linear regression of P.n. infection and fibrous root biomass (Cleopatra 2014) .. 64
2-7 Linear regression of P.n. infection and fibrous root biomass (Swingle). ............. 65
2-8 Linear regression of P.n. infection and fibrous root biomass (X639) ................. 66
2-9 Linear regression of P.n. infection and fibrous root biomass (sour orange) ........ 67
2-10 Sucrose exudation of Cleopatra mandarin.. ....................................................... 68
2-11 Sucrose exudation of Swingle citrumelo, X639 and sour orange........................ 69
2-12 Fibrous root starch concentration of Cleopatra mandarin. .................................. 70
2-13 Fibrous root starch concentration of Swingle citrumelo, X639 and sour orange ................................................................................................................ 71
2-14 Linear regression of P.n. infection and Total available sugar (Cleopatra 2013) . 72
2-15 Linear regression of P.n. infection and Total available sugar (Cleopatra 2014) . 73
2-16 Linear regression of P.n. infection and Total available sugar (Swingle). ............ 74
2-17 Linear regression of P.n. infection and Total available sugar (X639) .................. 75
2-18 Linear regression of P.n. infection and Total available sugar (sour orange). ...... 76
2-19 Model for the relationship between P.n. infection and root biomass.. ................. 77
2-20 Hypothesis of interaction between Las, P.n. and root. ........................................ 78
3-1 Total root length of Cleopatra mandarin, Swingle citrumelo and X639.. ............. 95
3-2 Root length by diameter size class of Cleopatra mandarin ................................. 96
10
3-3 Root length by diameter size class of Swingle citrumelo. ................................... 97
3-4 Root length by diameter size class of X639 ........................................................ 98
3-5 New root length of Cleopatra mandarin, Swingle citrumelo and X639 ................ 99
3-6 Fibrous root sucrose of Cleopatra mandarin, Swingle citrumelo and X639 ...... 100
3-7 Total leaf area of Cleopatra mandarin, Swingle citrumelo and X639.. .............. 101
3-8 Specific leaf area of Cleopatra mandarin, Swingle citrumelo and X639.. ......... 102
4-1 Fibrous root sucrose of Cleopatra mandarin and Swingle citrumelo................. 121
4-2 Fibrous root glucose of Cleopatra mandarin and Swingle citrumelo ................. 121
4-3 Relative gene expression of Sucrose transporter1 (SUT1) of Cleopatra mandarin and Swingle citrumelo. ...................................................................... 122
4-4 Relative gene expression of acid invertase-βFruct1of Cleopatra mandarin and Swingle citrumelo ...................................................................................... 122
4-5 Relative gene expression of acid invertase-βFruct2 of Cleopatra mandarin and Swingle citrumelo ...................................................................................... 123
4-6 Relative gene expression of Neutral/alkiline invertase-CitCNV1 of Cleopatra mandarin and Swingle citrumelo . ..................................................................... 123
4-7 Relative gene expression of sucrose synthase- CitSUSA of Cleopatra mandarin and Swingle citrumelo ....................................................................... 124
4-8 Relative gene expression of sucrose synthase- CitSUS1 of Cleopatra mansarin and Swingle citrumelo. ...................................................................... 124
4-9 Relative gene expression of sucrose-phosphate-synthase (SPS) of Cleopatra mandarin and Swingle citrumelo ....................................................................... 125
11
LIST OF ABBREVIATIONS
CitCINV Citrus Cytoplasmic invertase
CitSUS Citrus sucrose synthase
DNA Deoxyribonucleic acid
GAPDH Glyceraldehyde 3-phosphate dehydrogenase
HLB Huanglongbing
Laf Candidatus Liberibacter africanus
Lam Candidatus Liberibacter americanus
Las Candidatus Liberibacter asiaticus
P.n. Phytophthora nicotianae
qPCR Quantitative polymerase chain reactions
qRT-PCR Quantitative reverse transcription polymerase chain reaction
RNA Ribonucleic acid
SLA Specific leaf area
spp Species plural
SPS Sucrose-phosphate-synthase
SUT Sucrose transporter
wk Week
wpi Week post inoculation
βFruct Beta-fructosidase
12
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
INTERACTION BETWEEN PHYTOPHTHORA NICOTIANAE AND CANDIDATUS
LIBERIBACTER ASIATICUS DAMAGE TO CITRUS FIBROUS ROOTS
By
Jian Wu
December 2015
Chair: James H. Graham Major: Soil and Water Science
Huanglongbing (HLB) in Florida is caused by the phloem-limited bacterium,
Candidatus Liberibacter asiaticus (Las), which is transmitted by the psyllid vector,
Diaphorina citri, or by grafting infected tissue from hosts of the pathogen. Phytophthora
nicotianae (P.n.) incites soil-borne diseases of citrus worldwide which reduces water
and nutrient uptake and depletes carbohydrate reserves in citrus fibrous roots. Rapid
yield loss of sweet orange trees at a low level of HLB canopy symptom expression was
observed in Brazil. Meanwhile, unprecedented changes in population of the soil borne
pathogen Phytophthora in citrus groves were documented as HLB spread throughout
Florida. These findings led to the investigation and discovery that damage to fibrous
roots was occurring before or at the same time as canopy symptoms developed and the
root damage was caused by Las, and the interaction with soil-borne pathogen P.n.
In this study, the interaction between Las and P.n. was investigated.The results
showed that 1) Las infection of citrus rootstocks predisposes fibrous roots to P.n.
infection by increasing root leakage of exudates that attract zoospores and by disrupting
host physiology that mediates the plant response to P.n.; 2) the roots of HLB seedlings
13
were damaged by Las and the combination of Las and P.n., and the root damage
caused by co-inoculation was not greater than the damage from each pathogen alone.
Further investigation of root and shoot morphological changes caused by Las
and P.n. showed that: 1) Las damaged citrus roots by inducing faster root growth and
turnover; 2) P.n. damaged fibrous roots by causing rapid root collapse immediately after
infection; 3) canopy development was reduced after root damage by both pathogens.
To explore disease development from the perspective of root carbohydrate
metabolism responses to Las and P.n. infection, sucrose metabolism related gene
expression was investigated in two rootstocks (Cleopatra mandarin, susceptible to P.n.;
Swingle citrumelo, less susceptible to P.n.). The results showed that sucrose
metabolism was more disrupted by Las and P.n. in P.n. susceptible Cleopatra mandarin
than in P.n. tolerant Swingle citrumelo.
14
CHAPTER 1 LITERATURE REVIEW
1.1 Citrus Huanglongbing
Citrus is a worldwide fruit crop in tropical and subtropical regions, where
favorable climate promotes tree vigor and production. These regions range
approximately ±40°latitude of the equator in all six continents (Gottwald, 2010). The
main commercial varieties include sweet orange, tangerine/mandarin, lemon/lime and
grapefruit. Common varieties belong to three genera, Citrus, Poncirus and Fortunella,
of tribe Citreae, plant family Rutaceae comprising 140 genera and 1300 species
(Gottwald, 2010). In 2014, there were 515,147 grove acres, 68 million trees and 124
million boxes harvested in Florida, according to U.S. Department of Agriculture data.
Citrus production is influenced by weather, soil, water, pest, and disease.
Huanglongbing (HLB) is one of the most devastating diseases of citrus known
(Reinking, 1919), which causes catastrophic losses to affected citrus industries
(Bassanezi et al., 2011; Roistacher, 1996). Typical symptoms of HLB include pre-
symptomatic root decline, small and blotchy mottled leaves, dieback of shoots, uneven
colored, acidic, bitter fruit and premature fruit drop (Capoor, 1963; Johnson et al., 2014).
Candidatus Liberibacter spp. phloem-limited bacteria, which cause HLB (Jagoueix et al.,
1994; Teixeira et al., 2005), are transmitted from tree to tree over short distance by the
psyllid vector and over long distance by contaminated budwood and human activity
(Garnier and Bové, 1983; Gottwald, 2010; Halbert and Manjunath, 2004; Ramadugu et
al., 2008). The earliest record of HLB-like disease was in India in 1700 (Gottwald,
2010), followed by reports of HLB-like symptoms in other countries in Asia and Africa
(Bové, 2006; Gottwald, 2010). HLB was first reported in Brazil, Florida, and Cuba in
15
2004, 2005 and 2008 respectively (Halbert, 2005; Luis et al., 2009; Teixeira et al.,
2005). Since then HLB has spread to several other countries in the western
hemisphere.
The bacterium that causes HLB belong to the alpha-subdivision of Proteobacteria
based on their 16s rDNA sequence (Jagoueix et al., 1994). They are Candidatus
Liberibacter asiaticus (Las), Candidatus Liberibacter africanus (Laf), and Candidatus
Liberibacter americanus (Lam). Las is distributed throughout the humid subtropics in
Asia and the Americas area, Laf exists in Southern Africa and Lam is restricted to Sao
Paulo State, Brazil, but has recently been displaced by Las (Bové et al., 2008; Lopes et
al., 2009). The leaf-hopper vectors that feed on phloem and transmit Liberibacter spp.
are Asian Citrus Psyllid (ACP), Diaphorina citri, in Asia and the Americas, and African
Citrus Psyllid, Trioza erytreae, in Africa. Due to the inability to culture Liberibacter spp.,
disease etiology has not been completely demonstrated.
Based on the symptoms developmental status and plant growth situation, sweet
oranges, grapefruit, mandarins and tangelos are defined as susceptible, lemons and
limes are field tolerant, while citranges and Poncirus trifoliata are the most tolerant
(Folimonova et al., 2009). The variety’s susceptibility to HLB varies for different Las
strains (Tsai et al., 2008).
HLB management requires a three pronged program of vector control, scouting
and removal of diseased trees, and planting of pathogen-free nursery stock (Belasque
et al., 2010; Grafton-Cardwell et al., 2013).
16
1.1.1 HLB History
Huanglongbing (hung-黄long-龙bing-病) is the Chinese name for this disease
that means yellow dragon disease. HLB was named by a local grower and adopted by
Lin in his work (Bové, 2006). Before the official name for the disease was accepted at
the 13th Conference of the International Organization of Citrus Virologists (IOCV) in
Fuzhou, China, the disease was most often referred to as citrus greening (Bové, 2006).
The first description of the disease worldwide was in early 20th century with different
names in different countries without gaining much attention (Bové, 2006). In the mid-
20th century, the disease became a major problem in several Southeast Asian countries
and extensive research was conducted in different countries on identification of the
causal agent, potential vectors and comparison to diseases with similar symptoms
(Martinez and Wallace, 1967; McClean and Oberholzer, 1965a; Salibe and Cortez,
1968; Schneider, 1968; Schwarz et al., 1973). Without specific disease symptoms, the
disease was considered to be caused by mineral deficiency, soil disorders or virus
infection (Bové, 2006; Capoor, 1963). With well-designed experiments, Lin (1956)
proved the graft-transmissibility of the disease, which distinguished the cause of the
disease symptoms from abiotic factors. Likewise, McClean and Oberholzer (1965b)
demonstrated 10 years later that citrus greening is graft transmitted. Confirmation that
the disease symptoms were caused by an infectious agent led to acceptance by IOCV
of HLB as the official name for the disease. Another important finding by scientists in
mid-20th century was transmission of HLB by psyllid vectors. In the 1980s, Garnier et al.
(1984) demonstrated that the HLB causal agent is a Gram-negative bacterium, which
was further confirmed in the 1990s by 16S rDNA sequence analysis (Jagoueix et al.,
17
1994). After more extensive genome sequencing, two species Las and Laf were
classified. In 2004, a third species of Liberibacter infecting citrus and Murraya, Lam,
was identified in Brazil (Lopes et al., 2009b).
1.1.2 Geographic Distribution
There are very good reviews that identify all the countries and areas that are
infested by the psyllid and affected by HLB (Bové, 2014; Bové, 2006; Gottwald, 2010;
Halbert and Manjunath, 2004). It is noteworthy that the vector always spreads into a
new area before HLB is detected. In general, the areas that are still free of HLB are the
Mediterranean basin, most of Western Asia, Australia, and the North and South Pacific
islands. Psyllid management becomes an important step to control HLB spread. More
information is available in the cited reviews.
1.1.3 Causal Agent and Vectors
Las and Lam are naturally transmitted by D. citri in Asia and the Americas and
Laf is vectored by Trioza erytreae in Africa (Bové, 2006). Las and D. citri are both heat
tolerant, as indicated by the worldwide disease distribution (Bové, 2013). The same
vector distribution pattern as the disease indicates that the spread of Las is limited by
vector movement (Zhao, 1981). In Reunion Island, severe HLB and D. citri occur in hot
low altitude areas but not in high altitude locations (Bové, 2014). In contrast, Laf and T.
erytreae are heat sensitive and do not occur below an altitude of approximately 600m
(Bové, 2014). This finding was confirmed by a greenhouse study on the effect of
temperature on HLB symptom expression. Plants infected with Laf showed severe
symptoms below 27 °C at 30 weeks after inoculation, and symptomless growth was
obtained after plants were transferred to a warm chamber (27/32oC) (Bové, 2006). By
18
comparison, no significant difference in temperature effect on symptom expression was
detected for Las. Lam is also heat sensitive, but less so than Laf (Lopes et al., 2009b).
The inability to culture Las made obtaining the complete DNA genome sequence
challenging. Duan et al. (2009) were the first to report sequencing of Las (GenBank
NC_012985.2). Genes involved in cell motility and active transport account for 4.5% and
8.0% of the total genes respectively, which might contribute to its virulence. Genes
involved in pathogenicity, such as type III and type IV secretion system components
were not found in this pathogen. Duan et al. (2009) suggested Las is a parasite rather
than pathogen of citrus. Las is predicted to be able to metabolize sugars like glucose,
fructose, xylulose and amino acid as energy supply based on the key enzymes it
encodes (Duan et al., 2009). Furthermore, evidence for a near complete set of glycolytic
enzymes was found in the gene sequence, which suggests that the pathogen is likely to
utilize carbon-glucose for its energy supply (Wang and Trivedi, 2013). Subsequent
research revealed that Las carries an excision plasmid prophage and a chromosomally
integrated prophage that becomes lytic in periwinkle, but the lytic stage of the prophage
was not observed in citrus (Wang and Trivedi, 2013; Zhang et al., 2011).
1.1.4 Psyllid Biology
In total, there are 13 different psyllid species occurring on citrus and citrus
relatives (Halbert and Manjunath, 2004). Asian Citrus Psyllid (ACP) in Asia and
Americas, and African Citrus Psyllid in Africa are the two known vectors that transmit
HLB-associated pathogens. The biology of D. citri was recently reviewed (Grafton-
Cardwell et al., 2013; Halbert and Manjunath, 2004). Typically, the life cycle ranges
from 15 to 47 days, with 2 to 4 days of egg hatching and 11 to 15 days for completion of
five instar stages. The duration of the cycle is influenced by temperature and humidity.
19
The temperature that allows for oviposition was estimated to range from 16°C to 41.6°C
(Grafton-Cardwell et al., 2013), and temperature extreme for survival is -6°C. D. citri
dispersal and transmission efficiency are two crucial factors in HLB spread. The
investigations on D. citri flight showed that it is capable of moving 100 m within 3 days
(Boina et al., 2009), at some times up to 400 m within 4 days (Tiwari et al., 2010), with
the maximum dispersal distance of 2 km within 12 days (Lewis-Rosenblum, 2011),
which is similar to the maximal distance for movement of the Africa citrus psyllid
(Grafton-Cardwell et al., 2013). The peak of D. citri movement appears to occur after
citrus spring flush.
Knowledge of the location of Las in the psyllid is required to evaluate the
transmission efficiency of Las by D. citri (Grafton-Cardwell et al., 2013). A systemic
presence of the bacterium within psyllids was reported using qPCR (Inoue et al., 2009),
scanning electron microscopy, and fluorescence in situ hybridization techniques
(Ammar et al., 2011). The transmission process consists of three stages: acquisition
access period (AAP): acquiring the pathogen during feeding; period of latency: time for
bacteria to enter the salivary gland and multiply; inoculation access period (IAP):
introducing bacteria into the plant by feeding (Grafton-Cardwell et al., 2013). It was
reported that AAP and IAP occurred within 24 and 7 h respectively. Based on the
symptom development, the latency period ranged between 1 and 25 days. Molecular
investigation using conventional polymerase chain reaction (PCR) or real-time PCR
(qPCR) detected highly variable acquisition efficiencies for Las by adult D. citri, ranging
from 13% to 90% (Inoue et al., 2009; Pelz-Stelinski et al., 2010). Furthermore,
transovarial and sexual transmission were reported at a low rate of 3.6% (Pelz-Stelinski
20
et al., 2010) and 2–3% (Mann et al., 2011) respectively or as non-detectable (Hung et
al., 2004). Furthermore, persistence of Las in D. citri adults after acquisition declined if
there was no more pathogen supplied (Pelz-Stelinski et al., 2010). In conclusion,
transmission efficiency varies depending on life stage of pathogen acquisition, nymphs
versus adults, incidence of infected D. citri (Pelz-Stelinski et al., 2010), and distribution
of the bacterium in the tree (Grafton-Cardwell et al., 2013).
1.1.5 HLB Disease Development
Damage caused by Las to citrus leaves, fruit and phloem (Bassanezi et al., 2009;
Etxeberria et al., 2009; Fan, 2010; Schneider, 1968, 1967) has been widely reported
with respect to sampling and identification of visual symptoms. HLB cytopathology
studies carried out on severely infected field leaves identified necrotic phloem, phloem
sieve plate is blocked by callose deposition, and the phloem blockage is associated with
massive accumulation of starch in plastids and phloem proliferation (Achor et al., 2010;
Schneider, 1968, 1967). These combined effects account for the blotchy mottle
symptoms in fully expanded leaves and the gradual dieback of infected shoots (Achor et
al., 2010). Thus, phloem blockage induces imbalanced carbohydrate partitioning which
is considered as the major cause of the disease (Kim et al, 2009; Koh et al., 2012).
Schneider (1986) theorized that high starch accumulation in leaves of HLB-
infected trees is a secondary effect of phloem blockage by examining the correlation
between starch accumulations and yellowing mottle symptom on girdled branches. The
starch build-up can be up to 20 times higher in HLB leaves than in healthy (Takushi,
2007) and induce disintegration of the chloroplast thylakoid system which is the cause
of blotchy mottled leaf. In another work, starch accumulation was cited to be the cause
of tree decline instead of secondary damage from phloem blockage (Etxeberria et al.,
21
2009). Etxeberria et al. (2009) found in leaves and petioles of HLB positive trees that
photosynthetic cells, phloem elements, vascular parenchyma, xylem parenchyma, and
phelloderm all had excessive starch. In contrast, roots from HLB-positive trees were
depleted of starch compared to roots from control trees. Etxeberria (2009) hypothesized
that HLB systemically affects citrus tree carbohydrate metabolism and “root starch is
consumed to sustain root metabolic activities when little sugar is translocated down
from the leaves resulting in root death and eventually tree decline”. Etxeberria (2009)
qualified his findings by stating that this evaluation was carried out at advanced stage of
symptom development and that the examination of an early stage of HLB expression is
still needed.
Folimonova and Achor (2010) studied disease development in 8-month-old
seedlings in the greenhouse beginning one month after graft-inoculation to monitor the
progression of bacterial colonization, anatomical aberrations and their relationship with
symptom development for 1 year. They detected 71% of the asymptomatic leaves are
Las positive at 3 months after graft inoculation (presymptomatic stage) and observed
slight yellowing of leaves by 5 to 6 months. At 9 months after inoculation, mature
leaves were small, thickened and severely mottled. As symptoms developed, 60% of
the seedlings didn’t produce new shoots and, on the remaining seedlings, the new
shoots became chlorotic upon maturity. Most of the infected seedlings declined over
time. At the presymptomatic stage of young fully expanded leaves, no significant
phloem disruption occurred, but significant swelling of the middle lamella between cell
walls surrounding sieve elements and more extensive deposits of amorphous callose in
sieve element was observed. By 6 months after inoculation, severe collapse of sieve
22
elements and companion cells and, occasionally, cambium cells was observed in the
most mature symptomatic leaves. Surprisingly, the bacteria number was high in
asymptomatic young, fully developed leaves and low in the mature symptomatic leaf
which contradicted assessment of bacterial titer with PCR. It is noteworthy that, PCR
methods do not discriminate between viable and dead DNA (Josephson, 1993) and only
TEM can be used to observe live bacteria. Hence, Folimonova and Achor (2010)
hypothesized that the majority of the pathogen population in a newly growing shoot of
an infected tree is present as live bacteria for a short time. Later, most of the bacteria
are occluded in phloem and presumed to be dead in the symptomatic tissue. In their
studies, starch accumulation, which is widely accepted as the cause of blotchy mottle
leaves and damage from HLB, was not detected. Liao and Burns (2012) suggested that
development of HLB symptoms may directly result from the host response rather than
as a consequence of carbohydrate starvation, by comparing the symptoms of HLB
infected fruit and girdled fruit. The inconsistent finding about the relationship between
phloem condition and carbohydrate partitioning indicates another mechanism other than
disrupted phloem function is involved in disease development (Wang and Trivedi,
2013).
To get an integrated view of disease development, a few studies (Sagaram et al.,
2008; Tatineni et al., 2008) examined the bacterial location in symptomatic trees to track
bacteria movement. Bové (2006) stated that HLB symptom usually starts at one branch,
and progress to the rest of the canopy. This symptom development observation was
supported by bacteria movement (Johnson et al., 2014; Tatineni et al., 2008). With the
help of qPCR, Tatineni et al. (2008) found systemic movement of bacteria from the
23
infection site to the rest of the tree, which included bark tissue, leaf midrib, roots, and
different floral and fruit parts, but not in endosperm or embryo. Johnson et al. (2014)
monitored bacterial titer in leaves and roots of greenhouse trees after initial infection
and identified fibrous roots as the initial site for bacterial colonization which served as a
reservoir for subsequent Las movement by phloem up into the shoot coincident with
foliar flush. After initial infection by Las, root damage occurred before starch was
depleted in roots and symptoms developed above ground with the causal mechanism
unknown. Unprecedented Phytophthora population changes in Florida citrus groves
were first reported in 2011 (Graham et al., 2011) after survey and documentation of root
loss and Phytopthtora populations on mature trees, it was hypthesiszed that Las
damages root directly and interacts with other soil borne pathogens to cause additional
root damage (Graham et al., 2013).
In a susceptible host, symptom development is the result of molecular, cellular
and physiological changes (Albrecht and Bowman, 2008). To defend themselves, plants
activate a series of responses to pathogens, such as hypersensitive reaction, structural
alterations, and synthesis of pathogenesis-related proteins and phytoalexins
(Hammond-Kosack and Jones, 1996). The transcriptional response of citrus to Las
infection provides molecular information for the pathogenic process of HLB and the
interaction between plant and bacterial infection, which could aid development of novel
strategies for HLB management. Gene expression in leaves, fruit, stems and roots has
been reported (Albrecht and Bowman, 2008; Aritua et al., 2013; Kim et al., 2009;
Martinelli et al., 2012). Albrecht and Bowman (2008) reported a significant accumulation
of transcripts for a phloem-specific lectin PP2-like protein, which is responsible for
24
phloem blockage together with callose, 13–17 weeks after graft inoculation. The
blockage of phloem by PP2 and callose are consided as plant defense to inhibit
bacterium spread within plant. This was confirmed later by Kim et al. (2009). Kim also
found that expression of 624 genes in total was significantly influenced by Las infection.
Encoded proteins were grouped into 18 categories according to function, which included
sugar metabolism, plant defense, phytohormone, cell wall metabolism and 14 other
categories. Furthermore, the excessive starch accumulation was hypothesized to be
due in part to the up-regulation of starch synthesis genes, such as ADP-glucose
pyrophosphorylase (AGPase), starch synthase, granule-bound starch synthase (GBSS)
and the starch debranching enzyme (SDE) (Kim et al., 2009). The over 10% up-
regulation of plant defense (PR) genes in the host indicated an activation of the defense
mechanism. Another study in fruit gene expression (Martinelli, 2012) showed that
regulation of pathways involved in photosynthesis, source-sink communication, sucrose
and starch metabolism, hormone synthesis and signaling were affected by Las infection.
Aritua et al. (2013) reported the different gene expression in stem and roots of two-year-
old Valencia sweet orange (C. sinensis) on Swingle citrumelo (C. paradisi Macf. × P.
trifoliata) rootstock 16 months after graft inoculation. The transcription of genes
encoding an ADP-glucose pyrophosphorylase large subunit 3 (APL3) and a granule-
bound starch synthase (GBSS) was up-regulated in stem but not in root tissue.
Common genes and pathways were also up-regulated in roots 50 days post inoculation
with Las (Zhong et al., 2014).
1.1.6 Rootstocks Susceptibility and Tolerance to Las Infection
Based on detectable Las level, shoot mass reduction and symptom development,
trifoliate hybrid rootstocks are classified as tolerant and Cleopatra mandarin as
25
susceptible to Las in greenhouse study (Albrecht and Bowman, 2012a). However, no
difference of disease incidence among rootstocks was detected in field trials, and all
rootstocks are considerablely damaged (Albrecht et al., 2012). By comparing the
leaves, stems and roots anatomical response to Las infection between susceptible
(sweet orange) and tolerant (rough lemon) citrus species, Fan et al. (2013) observed
fewer anatomical changes in root of rough lemon than sweet orange. Transcriptional
and anatomical analysis of rough lemon and sweet orange leaves response to Las
infection revealed lower phloem transport activity and slower plant defense reaction in
Rough lemon (Fan et al., 2012).
1.1.7 HLB Detection
Historically, HLB was detected by field symptoms before the agent was
confirmed by electron microscopy and DNA-based molecular detection methods (Bové,
2006; Halbert and Manjunath, 2004; Villechanoux et al., 1993). Because of the similarity
between HLB symptom and disorders like zinc deficiency and other virus disease, and
the long period of latency, field symptom expression is challenging for disease detection
(Bové, 2006). Use of electron microscopy for detection was limited as it is time and
labor consuming. After the advent of PCR, primers were developed for both Las and Laf
(Hocquellet et al., 1997; Hocquellet et al., 1999; Hung et al., 2004; Hung et al., 1999;
Teixeira et al., 2005b). Real-time PCR application improved sensitivity and stability of
HLB detection compared to conventional PCR (Lin et al., 2010; Wang et al., 2006), and
can be applied to quantify the titer of Las. With these benefits, qPCR is routinely used to
detect Las, determine the disease status and pathogen distribution in trees and the
insect vector (Kim et al., 2009; Lopes et al., 2009a; Lopes et al., 2009b; Pelz-Stelinski et
al., 2010; Trivedi et al., 2009). The limitation of DNA-based methods is that they do not
26
distinguish live versus dead bacteria. To overcome this disadvantage, DNA-binding
dyes, which can penetrate through membranes of dead cells more easily than live cells,
was introduced into PCR protocols. Propidium iodide (PI), propidium monoazide (PMA)
(Nocker et al., 2006), and ethidium monoazide (EMA) are three popular DNA-binding
dyes. Compared to EMA, PMA is broadly used for its highly selective penetration of
dead cells and less partial DNA loss (Nocker et al., 2006). Besides molecular methods,
the iodine test has been used to detect starch accumulation in leaves for rapid detection
with iodine in water to produce a darkish reaction in tissue (Chamberlain and Irey,
2008).
1.1.8 HLB Management
Efficient disease management should involve (i) preventing introduction of vector
and pathogen; (ii) removing alternative hosts for the pathogen and vector; (iii) cultivation
of tolerant citrus varieties; (iv) vector controls; (v) maintaining HLB tree health by
providing good environmental condition for growth such as water and nutrient supply.
For HLB free areas, spread of ACP needs to be monitored since the vector establishes
in advance of the disease. Every effort needs to be taken to suppress the inoculum or
the disease will increase exponentially to 100% incidence in as little as 5 years (Bové,
2006). When HLB was first detected in a region, the extent of disease spread needs to
be surveyed. Usually, control of D. citri and T. erytreae are not well established since
the direct damage by their feedings are minor (Halbert and Manjunath, 2004), which
explained why HLB is spread so quickly after the first infected tree is found in the grove.
To keep disease incidence low, stringent vector control and removal of infected trees
are required using a 3 month tree inspection cycle to detect newly symptomatic trees
27
(Bové, 2006). These methods are proven to decrease HLB incidence in Brazil
(Belasque et al., 2010).
Environmental factors such as soil bicarbonate and high pH in irrigation water
were also reported to reduce stress tolerance by increasing root loss caused by Las
(Graham et al., 2014). A 20% reduction in root density was reported for a grove that
was suffering from high bicarbonate stress compared to the grove that has had less
bicarbonate stress. Acidification treatment of irrigation water or soil application of sulfur
in prilled form was recommended to reduce bicarbonates in the rhizosphere which
otherwise reduce uptake of Ca, Mg, and Fe. This acidification in the rhizosphere of soil
may restore vigor and productivity of HLB-affected trees (Graham et al., 2014).
To date, no therapies have proven effective and HLB resistant citrus genotypes
have not been found. Certain highly vigorous rootstocks, e.g. Volkamer lemon, may
prolong productivity of younger trees after they are infected (Albrecht et al., 2012;
Folimonova et al., 2009; Koizumi et al., 1993). Several disease control practices have
been investigated to control HLB (Bové, 2006). Antimicrobial molecules have been
screened to target the systemic Las (Zhang et al., 2012; Zhang et al., 2011a; Zhang et
al., 2010a; Zhang et al., 2010b;). Without a disease resistant variety or curative
methods available, vector control is the only short-term inoculum control option. A
number of biological controls against the psyllid vector have been reported, including
fungal entomopathogens, parasitoids and predators (Aubert et al., 1984; Aubert, 1990;
Grafton-Cardwell et al., 2013). Insecticides are more effective when applied to new
shoots in the winter when the population is low (Boina et al., 2010; Childers and Rogers,
28
2005; Grafton-Cardwell et al., 2013; Hall and Nguyen, 2010; Khangura, 1984; Rae et
al., 1997).
1.2 Phytophthora spp. and Diseases
Phytophthora, eukaryotic fungus-like organisms, is a genus of Oomycete which is
grouped with a variety of other protists within the Stramenopile cluster.They are
organisms that “possess evenly spaced tripartite tubular hairs attached to the flagellum
or other parts of the cell surface and species that have been derived from those
organisms” (Adl et al., 2005, Judelson, 2005; Van de Peer et al., 1996). Oomycetes
were classified with true fungi as they have similar morphology at several vegetative
stages: filamentous growth pattern (mycelium) and reproductive propagules (spores),
mode of nutrient acquisition and specialized infection structures (appressoria, infection
hyphae and haustoria). The unique morphological, physiological, biochemical and
genetic characteristics in Phytophthora that distinguishes it from true fungi include
diploid and nonseptate hyphae, composition of the cell wall consisting mainly of 1,3-ß-
glucans, some 1,6-ß-glucans and 1,4-ß-glucans, different from chitin in cell walls of
most fungi, the structure of zoospores, different elicitors and gene encoding, the
requirement for a source of sterols for sporulation and resistance to certain antibiotics,
which are effective against true fungi (Latijnhouwers et al., 2003). The major difference
between oomycetes and fungi is discussed in two good reviews (Judelson and Blanco,
2005; Latijnhouwers et al., 2003). This classification has been supported by several
molecular studies (Cook et. al., 2000; Feng et al., 2011; Förster et. al., 1990; Tylor,
2006). The genus is further divided into 6 clades by Waterhouse (Stamps et al., 1990)
which have been revised by Stamps et al. (1990), on the basis of host range, colony
morphology, optimal growth temperature and other criteria. Kroon et al. (2012) divided
29
116 Phytophthora species into 10 clades within the genus by using genus wide
phylogeny analysis.
As indicated by the name Phytophthora, plant destroyer, all the species in
Phytophthora are pathogens to agricultural crops and plants in natural ecosystems and
some cause great threats to human kind. A notable example is the Irish Potato Famine
in the 1840s, which was caused by Phytophthora infestans, and is still a difficult
pathogen to control (Haas et al., 2009). Some Phytophthora spp. can only attack a
limited range of plants, such as P. infestans the causal agent of late blight of potato and
P. sojae the causal agent of soybean root rot. Other Phytophthora spp. have a very
broad host range, such as P. nicotianae and P. cinnamomi which can infect over 1000
species (Hardham, 2005; Meng et al., 2014). Phytophthora spp. cause several diseases
of citrus worldwide, including damping-off of seedlings, root and crown rot in nurseries,
and brown rot of fruit in groves (Graham, 1995; Graham et al., 1998). Pathogenic
species on citrus worldwide are P. boehmeriae, P. cactorum, P. capsici, P. cinnamomi,
P. citricola, P.citrophthora, P. dreschleri, P. hibernalis, P. megasperma, P. nicotianae,
P. palmivora and P.syingae (Bawage et al., 2013; Erwin and Ribeiro, 1996). In Florida,
P. nicotianae causes fruit brown rot, foot rot and root rot, and P. palmivora causes fruit
brown rot and root rot (Graham et al., 1998; Graham and Feichtenberger, 2015; Widmer
et al., 1998; Zitko and Timmer, 1994).
Phytophthora is a hemibiotroph, which requires a living organism to infect and
reproduce but can survive for some time in the absence of the host on dead organic
matter. The life cycle of Phytophthora consists of sexual and asexual phases. The
sexual spore is called the oospore, which is produced by the fusion of antheridium and
30
oogonium. The oospores act like a resting structure, which can either produce hyphae
to infect the plant directly or produce a sporangium. Motile biflagellate asexual
zoospores are borne inside a multinucleate cell sporangium which is developed on the
tip of a specialized hyphal structure called a sporangiophore. Zoospores are wall-less
cells with the plasma membrane as the outer surface and they are instrumental in
initiating plant infection. Another asexual spore is the chlamydospore. It is a thick-walled
and multinucleated resting spore able to survive under unfavorable environment
conditions. In most cases, pathogen infection begins with initial contact of a potential
host by motile zoospores which are chemically attracted to the potential infection site,
followed by successful penetration of the host surface and development of hyphae that
penetrate cortical cells to absorb nutrition. These spores can be disseminated by water,
rain, soil and human activity.
1.2.1 Diseases of Citrus Caused by Phytophthora spp.
Foot rot, also know as gummosis, is the most severe disease caused by
Phytophthora spp. because it can lead to tree mortality. The typical symptoms of foot rot
include damaged cambium and inner bark at the ground level, which can develop into a
lesion that extends around the circumference of the trunk and girdles the tree cambium.
Young trees can be killed by foot rot rapidly, whereas adult trees might survive with thin
and weak canopy (Graham and Feichtenberger, 2015). Phytophthora spp. cause citrus
root rot by infecting fibrous roots. Root rot induces soft and discolored cortex, white
thread-like stele left without cortex, failure to form vigorous new growth and reduced
yields (Feichtenberger, 1997; Sandler et al., 1989). Root damage caused by
Phytophthora can be lethal on small seedlings as a result of large amount of fibrous root
loss, and can reduce yield of fruit-bearing trees in a grove due to loss of canopy
31
development (Feichtenberger, 1997; Sandler et al., 1989). Phytophthora spp. also
causes brown rot of fruit when soil borne spores are splashed on or directly contact fruit
near the soil surface under the tree. When rainfall coincides with early stages of fruit
maturity, brown rot develops rapidly, resulting in light brown and leathery lesions on
fruit.
Rootstock resistance/tolerance to Phytophthora spp. Rootstock’s
resistance/tolerance to Phytophthora spp. is useful to reduce the crop loss. Rootstocks
identified as tolerant to Phytophthora (Graham, 1995, 1990) are used for better
management of disease. Tolerant rootstocks were defined as those that quickly replace
roots at lower inoculum density to maintain tree health. Sour orange and Cleopatra
mandarin were defined as susceptible to P. nicotianae, whereas trifoliate orange and its
hybrids (Swingle citrumelo) were defined as resistant and tolerant of root rot,
respectively. Interestingly, the rootstocks that are tolerant to P. palmivora are the
opposite of those that are to P.nicotianae. Furthermore, rootstock tolerant to
Phytophthora spp. varies with root age (Graham, 1995, 1990) and environmental
conditions (Bright et al., 2004). For example, the lower rhizosphere population of P.
nicotianae on mix-aged roots of tolerant rootstocks than susceptible rootstocks was not
observed for newly regenerating roots (Graham, 1995). Furthermore, Swingle citrumelo
lacks resistance to Phytophthora spp. under poorly drained soil series. Lower saturated
hydraulic conductivity supported higher P. nicotianae populations in seasons when
annual rainfall were high, but not in relatively dry years (Bright et al., 2004).
Host Pathogen interactions. Various studies have been carried out to elucidate
the disease causal mechanism (Attard et al., Graham, 1995; Hardham, 2010, 2007;
32
2001; Kosola et al., 1995; Raftoyannis and Dick, 2005; Tippett et al., 1976). Pathogenic
effector molecules released by a pathogen into a plant cell play different roles in
susceptible and resistant hosts. In susceptible hosts, these factors help with successful
colonization such as cell wall degrading enzymes and proteins. In resistant hosts, these
factors can trigger the plant defense system.
Environmental interactions. Soil texture, which determines aeration, drainage and
nutrient availability, soil moisture and temperature, has major effects on Phytophthora
infection, conversion of mycelium to sporangia and release of zoospores, disease
development, and pathogen dissemination (Erwin and Ribeiro, 1956). Bright et al.
(2004) reported that P. nicotianae populations are positively and negatively corelated
with % clay and % of sand, respectively. Environmental conditions not only influence
Phytophthora populations but also the rootstocks performance (Bright et al. 2004;
Castle et al., 2004). The recommended management practices are use of disease free
nursery stock; choice of a tolerant rootstock, proper soil drainage, irrigation, and a well-
balanced soil applied fertilization program. In the event that cultural management
practices do not control Phytophthora damage, systemic fungicides are recommended
according to the Phytophthora propagule status of the grove (Graham, 2011; Graham,
2000; Graham and Menge, 1999).
Interactions with root pests. Besides impact of host performance, interaction with
other soil pest is a critical consideration for effective management of Phytophthora
diseases (Davis, 1981; Graham, 2002). The Phytophthora-Diaprepes abbreviatus
complex illustrates that the interaction between an insect pest and Phytophthora can be
mediated by increased plant exudation, as larvae feeding compromises rootstock’s
33
tolerance to Phytophthora spp. (Graham et al., 2002, 2003). In contrast, the antagonism
between the citrus nematode T. semipenetrans and P. nicotianae was described for
nematode susceptible citrus rootstocks (El-Borai et al., 2002). T. semipenetrans
significantly reduced P. nicotianae infection and the damage that leads to root loss.
1.2.2 Phylogeny and Detection of P. nicotianae (Breda de Haan var. nicotianae Waterhouse)
In 1896, Van Breda de Haan named the fungus that is the causal agent of
tobacco black shanck as Phytophthora nicotianae, and Phytophthora morphotype was
found in 1913 and named P. parasitica by Dastur. The name was further revised by
Tucker and Waterhouse in 1963, and the priority of the name P. nicotianae was
confirmed. Kroon et al. (2012) divided 116 Phytophthora species into 10 clades within
the genus by using genus wide phylogeny analysis (Kroon et al., 2012). P. nicotianae is
singularly classified in the clade 1, with P. infestans as its closest relative.
The isolation of P. nicotianae on citrus can be obtained from soil and plant
material by use of pimaricin-ampicillin-rifampcin-pentachloronitrobenzene-hymexazol
(PARPH) semi-selective agar medium or using leaf baiting procedures (Graham, 1998;
Grimm and Alexander, 1973).The growth of P. nicotianae can be observed within 2-4
days on the semi-selective medium. The culture can be identified based on the
morphology of the colony on the isolation medium, arachnoid branching of mycelium
and the shape of papillate sporangia (Bush and Stromberg, 2006). Other criteria widely
used to distinguish P. nicotianae from other species are cardinal growth temperature,
growth rate, sexual and asexual morphology and mating behavior (Ashby, 1928; Erwin
and Ribeiro, 1996). Molecular tools, isozyme analysis, serological techniques (Bonants
et al., 2000, Grote et al., 2002; Ippolito et al., 2004; Man In't Veld et al., 1998; Pettitta et
34
al., 2002) have been developed to increase the accuracy of identification and sensitivity
of detection and to reduce time and labor cost.
1.2.3 Life and Disease Cycle
P. nicotianae life cycle is comprised of sexual and asexual phases. Asexual
structure includes sporangia, zoospores (predominant) and chlamydospores. The
sexual structure is an oospore that requires mating of A1 and A2 type for the formation
after a phase of vegetative growth (Randall et.al, 2003). P. nicotianae prefers warm,
moist and well aerated soil to continue its life cycle (Erwin and Ribeiro, 1996).
Sporangia are formed from oospores, chlamydospores and mycelium, and zoospores
are released from sporangia into soil to infect and colonize fibrous roots. After mycelial
growth in the root, sporangia are formed under favorable condition (20-30oC, aboundant
moisture) (Matheron and Porchas, 1996). Under unfavorable conditions (i.e., nutrient
depletion, low oxygen levels and temperature below 15oC, oospore and
chlamydospores are formed to survive until conductive conditions resume (Graham and
Timmer, 1992).
Pre-penetration. Phytophthora spp. hyphae, sporangia and zoospores act to
reach the host over a short and long distance. Zoospores swim at the rate of 200μm/s,
and can diperse over a longer distance by water flow, rain splash or wind-blown rain
(Declercq et al., 2012). Zoospores are attracted to infection sites such as the zone of
root elongation and wounds by electrotaxis and chemotaxis (Tyler, 2002; Van West et
al., 2002). A variety of sugars, amino acids, alcohols and calcium nonspecifically attract
zoospores or isoflavones specifically attract zoospores (Tyler, 2002).
Penetration. After reaching the plant surface, zoospores encyst and adhere to
the plant surface before penetration. The process of encystment includes detachment of
35
the flagellum, secretion of adhesive material and formation of a cell wall (Hardham and
Shan, 2009). A number of physical and chemical factors, plant cell receptors, and the
phospholipase D signal transduction pathway are involved in this process (Litijnhouwers
et al., 2002). For example, an adhesion protein is secreted during zoospore encystment
to orient and firmly attach the zoospore to the plant surface (Gubler and Hardham,
1990). Plant cell receptors determine plant response to Phytophthora spp. infection
(Litijnhouwers et al., 2002). After adherence to the plant surface, an appressorium is
formed at the tip of germ tubes for penetration (Kebdani et al., 2010; Wang et al., 2011).
Appressoria penetrate the host cell wall by mechanical pressure or by cell wall
degrading enzymes (Škalamera et al., 2004). Two sites on roots were reported to be
preferred by Phythophthora pathogens, one is periclinal wall of the hypodermal cell and
the other one is the groove formed by anticlinal walls of epidermal cells (Hardham,
2001).
Colonization. After initial infection, hyphae grow intracellularly or intercellularly
inside the plant tissue to access resources (Enkerli, 1997; Widmer et al., 1998).
Haustoria are finger-like hyphal structures inside the plant cell that absorb nutrients. The
components that stimulate the formation of haustoria were reported to be an electron-
dense chemicals produced by leaf and root cell walls (Coffey, 1983; Enkerli, 1997).
Reproduction, dispersal and survival. After colonization, Phytophthora spp. begin
to produce spores, which may be sexual or asexual (Adrienne, 2001). Some
Phytophthora spp. spores are produced on the surface of the leaves and dispersed by
wind; some are produced inside the plant and can only be released when plant tissues
die (Judelson and Blanco, 2005). Different factors trigger the sporulation, like reduced
36
nutrient and high humidity. Spores can be disseminated by seedbeds, rootstocks,
nursery practices, irrigation water, and human activity, and can survive in soil, water and
diseased plant material.
According to historical survey data from citrus groves, populations of
Phytophthora are considered damaging to fibrous roots when counts exceed 10-15
propagules per cubic centimeter of rhizosphere soil (Graham, 2011). This threshold can
be influenced by the interaction with other pathogens and pests, soil texture, rootstock
resistance and/or tolerance to Phytophthora (Bright et al., 2004).
Genome sequencing. Genome sequencing provides information for pathogen
lifestyle, host range, evolution, physiology, phylogeny, virulence mechanisms,
identification and disease control. So far, sequences of six species Phytophthora spp.
are published. They are P. infestans (Haas et al., 2009), P.sojae (Tyler, 2006),
P.ramorum (Tyler, 2006), P. capsici (Lamou et. al, 2012), P.cinnamomi (Li et al., 2000)
and P. nicotianae (https://olive.broadinstitute.org/projects/phytophthora_parasitica). The
gene numbers range from 14,451(P.ramorum) to 26,131 (P.cinnamomi), with the
repetitive DNA sequence from 19% (P. capsici) to 74% ( P. infestans) and genome size
ranges from 64Mb (P. capsici) to 240Mb ( P. infestans). The genome size of P.
parasitica was estimated to be 95.5 Mb (Shan and Hardham, 2004), and includes about
23,121 predicted genes (Judelson, 2012). Study on interaction between P. nicotianae
and A. thaliana suggested that salicylic acid, jasmonic acid and ethylene signaling
pathways are involved in defense against P. nicotianae (Attard et al., 2010).
Gene numbers are implied to be the cause of variability of host range, which was
shown by 26,131 genes of P.cinnamomi with over 1000 hosts. Ontology mapping
37
indicates the relationship between species by identifying around 1000 shared core
genes (Seidl et al., 2011), which reveals the evolutionary relationships among
Phytophthora spp. With the help of DNA mapping, gene expression during different
stages of the life cycle, more information has been gained to understand physiology of
Phytophthora spp. (Kunjeti et al., 2012). Genes for protein families expressed during
adhesion, penetration and colonization help elucidate the mechanism of pathogenesis.
For example, hydrolytic enzymes that degrade host cell walls are secreted during host
penetration (Jiang and Tyler, 2012). The regulatory genes for the sterol pathway explain
the resistance of Phytophthora spp.to sterol-inhibiting fungicides (Madoui et al., 2009).
1.2.4 The Molecular Basis of Pathogenesis
In the 1990s, molecular tools were developed for Phytophthora pathogenesis
study, which also includes related pathogen biology. Such methods include DNA-
mediated transformation (Bottin et al. 1999; Cvitanich and Judelson, 2003), homology-
based gene-silencing strategies used to analyze gene function (Kamoun et al., 1998),
marker-based maps and chromosome-walking projects in bacterial artificial
chromosome (BAC) libraries (Randall et al., 2003). Expressed sequence tags (EST)
analysis was used to analyze gene expression at different stages of the life cycle to
understand pathogen’s biology and interaction with host, which includes vegetative
growth-mycelium (Panabières et al., 2005), germinated cysts zoospore (Shan et al.,
2004b; Škalamera et al., 2004), penetration and infection (Kebdani et al., 2010; Le
Berre et al., 2008).
Effectors are defined as molecules that are secreted by pathogen to interfere
with the host’s performance and physiology by formation of protein toxins, hydrolytic
enzymes, enzyme inhibitors and cell entering signal peptides (Jiang and Tyler, 2012).
38
Effectors can disarm plant defense enzymes, manipulate host structure and function
during infection and colonization process, kill host cells (Ali and Bakkeren, 2011;
Kamoun, 2006; Meng et al., 2014), and favor the pathogen by accumulating auxin
during penetration and inducing reactions that help the pathogen to attach to the plant
surface (Evangelisti et al., 2013; Khatib et al., 2004). Several hundred proteins were
estimated to manipulate host cell structure and function (Kamoun, 2006). Based on their
location in the host, the effectors are grouped onto two categories- apoplastic effectors
(located in plant extracellular space) and cytoplasmic effectors (inside the plant cell)
(Kamoun, 2006). Readers are referred to these reviews for details (Hardham and Shan,
2009; Jiang and Tyler, 2012; Kamoun, 2006).
1.2.5 Interaction with other Organisms
A wide diversity of carbon-based compounds are released into the rhizosphere
that mediate plant-microbe interaction (Bais et al., 2006). Sucrose is one of the
chemicals that attracts Phytophthora zoospores and enhances root infection (Graham et
al., 2003). In the Phytophthora-D. abbreviatus complex, larval damage to roots
increased exudation of reducing sugar and promoted Phytophthora population (Graham
et al., 2002, 2003). This damage broke the rootstock’s tolerance to Phytophthora spp.,
which increased Phytophthora spp. infection incidence and resulted in more severe
damage. Conversely, prior colonizaion of fibrous root by a hypovirulent P. nicotianae
isolate excluded the virulent insolate inoculated afterwards by out-competing the virulent
isolate for colonization sites.
1.2.6 Phytophthora spp. Management
Details of management of Phytophthora were recently reviewed by Graham and
Feichtenberger (2015). Management should be based on disease cycle and pathogen
39
physiology. Cultural management practices should strive to minimize as much as
possible the environmental conditions that are favorable for disease development. Soil
drainage and irrigation should be managed to reduce or eliminate conductive conditions
for Phytophthora activity and damage. The recommended management practices in
groves are use of disease-free nursery stock, choosing a resistant rootstock whenever
possible, proper irrigation scheduling and a well-balanced fertilization program. In the
case that cultural management does not control Phytophthora damage, systemic
fungicides, mefenoxam metalaxyl and fosetyl-Al (phosphite) are recommended
according to the Phytophthora propagule status of the grove (Feichtenberger, 1997;
Graham and Menge, 1999; Sandler et al., 1989; Timmer et al., 1998). Soil applied
mefenoxam and foliar-applied phosphites are rotated to reduce risk of fungicide
resistance development (Graham et al., 2011). Application of fungicide is timed after the
spring leaf flush and fall leaf flush coincident with root flushes. Use of registered
fungicides is favored over nematicide when nematodes are present in the grove.
Biological control was used to reduce the risk of ground water contamination and
fungicide resistance. However, the field studies showed little success as a high level of
the biocontrol agent is difficult to sustain (Nemec et al., 1996).
1.3 Interaction between P. nicotianae and Candidatus Liberibacter asiaticus
The interaction between Las and Phytophthora on citrus was first and only
reported by Ann (Ann et al., 2004). The damage on plant growth, 6 months after
inoculated with each pathogen or both was evaluated by measuring trees height and
biomass. Greater reduction of growth and symptom development was found for trees
infected with both pathogens than either one alone. Previous study in our lab showed
that 1) Las infection on citrus rootstocks predisposed Phytophthora infection on fibrous
40
root by attracting zoospore (more leakage from root), breaking down their resistance to
Phytophthora (sugar mediated plant response to P.n. infection) or both; 2) the
combination of Las and Phythophthora does not cause greater damage than either
alone; 3) the interaction between Phytophthora and Las on fibrous root damage over
time is mediated by available root biomass and their interaction.
1.4 Citrus Root Biology
1.4.1 Citrus Root Function and Growth Pattern
The citrus root system consists of primary roots and lateral roots (≤2mm
diameter). The fibrous root growth was believed to be periodic with 2-3 growth cycles
(Febarury to early April, May to June, and August to October) per year with alternating
growth of shoot and root (Bevington and Castle, 1985). Most citrus fibrous roots exist in
0-30cm depth in soil near the trunk (Castle, 1980; Mattos et al., 2003). The optimal
environment for healthy fibrous root growth is often associated with temperature above
27oC, high water potential in soil (>0.02MPa) and available carbohydrate (Bevington
and Castle, 1985; Mattos etal., 2003). Unfavorable conditions for citrus fibrous root
growth include high salinity (Ruiz et al., 1997), leaching loss of soluble nutrient through
irrigation (Mattos et al., 2003), unbalanced nutrient absorption caused by high
bicarbonate (HCO3-) at pH range from 6.5 to 8.5 (Graham et al., 2014).
Citrus trees absorb water and mineral nutrients in soil through fibrous roots
(diameter < 2mm). In addition to acquiring water and nutrients, fibrous roots store
carbohydrate and synthesize hormones and secondary metabolites (Flores et al., 1999;
Walker et al., 2003). Fibrous root bunches develop by branching, elongating and
maturation. As they age, citrus fibrous roots change color from white to brown (Fitter,
2002; Wells and Eissenstat, 2003). The median life span of fibrous roots can exceed
41
100 d (Eissenstat and Yanai, 1997), during which they change biochemically and
structurally in response to normal development and environmental conditions (Duncan
et al., 1993; Eissenstat and Achor, 1999). New root growth serves to extend the root
system and replace dead roots, and its life span is important for plant growth
(Eissenstat, 2000). Longevity of citrus fibrous roots results from management of the
tree’s root system to minimize cost (i.e. root construction and respiration) and maximize
benefit (i.e. nutrient and water absoption) (Eissenstat, 2000). Citrus species vary widely
in root longevity (Eissenstat and Yanai, 1997).
1.4.2 Citrus Root Architecture
Linkage of root traits to root functions has previously been used to predict plant
adaptation to environmental conditions (Eissenstat et al., 2000; Eissenstat and Achor,
1999). Specific root length (SRL) is defined as root length per unit root biomass. Higher
SRL is often associated with smaller root diameter, higher respiration and hydraulic
conductivity, and shorter lifespan (Eissenstat and Achor, 1999; Graham and Syvertsen,
1985). Citrus species vary widely in SRL (Graham and Syvertsen, 1985). Root color has
been used to predict root life span and provide the most current information about root
growth and viability (Eissenstat and Achor, 1999; Fitter, 2002).
Branch order (the most distal root without other root branching from it is order 1,
and the one has only one branching root is order 2…) is another trait used to link to root
functions. Lower root order is associated with smaller root diameter, higher SRL,
respiration and hydraulic conductivity, and shorter lifespan (Eissenstat and Achor, 1999;
Pregitzer et al., 1998; Wells and Lissenstat, 1997). Between different species, first order
diameters differ according to cell size rather than cell number (Eissenstat and Achor,
1999).
42
1.4.3 Citrus Fibrous Root Anatomy
Citrus fibrous root ultrastructure has been studied to assist explaining plant
resistance/tolerance to pathogen (i. e. oomycete and nematode) infection (Duncan et
al., 1993), extreme environmental conditions (i. e. high chloride) (Walker et al. 1984),
and relationship between root architecture and function (Eissenstat and Achor, 1999).
Citrus root anatomy plays an important role at different stages of root growth as
structure is connected with water, mineral elements and nutrient flow within roots
(Peterson and Enstone, 1996). Walker et al. (1984) reported that citrus fibrous root,
from outside to inside, consist of epidermis (single layer of cells), hypodermis (single
layer of cells), cortex (large thin-walled cells), endodermis (single layer of cells),
pericycle (single layer of cells), phloem, cambium and xylem. Single passage cells
occur in between hypodermal cells and cortex cells.
As roots age, plasmodesmata are blocked by suberin and lignin in the
hypodermis and endodermis, and a casparian strap forms in almost all endodermis cells
(Walker et al., 1984). The symplastic transport way is through passage cells, which
connect hypodermal, endodermal and cortex cell through plasmodesmata. Passage
cells have delyed in the development compared to other cell types (Peterson and
Enstone, 1996).
Though root can modify structure such as cell thickening by developing lignin and
suberin layer to provide protection from soil organism attack (Duncan et al., 1993), the
main resistance might be due to other mechanisms. Eissenstat and Achor (1999)
reported that the tolerant rootstock (trifoliate orange) to citrus nematode and P.
nicotianae has thinner exodermal walls than the susceptible rootstock (sour orange).
43
CHAPTER 2 THE INTERACTION BETWEEN PHYTOPHTHORA NICOTIANAE AND CANDIDATUS
LIBERIBACTER ASIATICUS DAMAGE TO CITRUS FIBROUS ROOTS
2.1 Introduction
Huanglongbing (HLB), also known as citrus greening (in Africa) or likubin (in
Taiwan) (Ann et al., 2004), is the most devastating disease of citrus known (Bové,
2006). HLB in Florida is caused by the phloem-limited bacterium, Candidatus
Liberibacter asiaticus (Las) (Jagoueix et al., 1994; Teixeira et al., 2005), which is
transmitted from tree to tree by the psyllid vector, Diaphorina citri, or by grafting infected
tissue from other hosts of the pathogen (Garnier and Bové, 1983; Halbert and
Manjunath, 2004).
Symptoms of HLB on leaves, fruits and in phloem have been widely reported in
previous studies (Bassanezi et al., 2009; Etxeberria et al., 2009). Root loss of HLB
trees was believed to be secondary damage after carbohydrate metabolism in canopy
and phloem was disrupted (Etxeberria et al., 2009). However, rapid yield loss of sweet
orange trees at a low level of canopy symptom expression was observed in Brazil
(Bassanezi et al., 2011). This finding indicated that unobserved damage was occurring
before or at the same time as canopy symptoms developed (Johnson et al., 2014).
Johnson et al. (2014) investigated roots as a site for Las multiplication at an early stage
of the infection process by tracking movement of the pathogen in graft-inoculated
greenhouse trees. Root infection and loss was detected before phloem was blocked
and leaf symptoms developed which led to the prediction that Las root infection may
directly damage root or interact with other soil borne pathogens to cause damage
(Graham et al., 2013; Johnson et al., 2014). Meanwhile, unprecedented changes in
population of the soil borne pathogen Phytophthora in citrus groves were documented
44
as HLB spread throughout Florida (Graham et al., 2011). These findings led to the
investigation of fibrous root status and the causal agents of root loss at the early stage
of HLB symptom development.
Phytophthora spp. cause soil-borne diseases of citrus worldwide by damaging
fibrous roots, which reduces water and nutrient uptake and depletes carbohydrate
reserves in roots (Graham, 1995). The interaction of Phytophthora with other root
pathogens and pests is important for developing the most effective management of
fibrous root health (Davis, 1981; Graham and Feichtenberger, 2015). In the study of the
complex between Phytophthora spp. and the root weevil Diaprepes abbreviatus, the
interaction between Phytophthora and root damage caused by larval feeding was
shown to be mediated by root exudates (Graham et al., 2003, 2002), because larval
damage increases leakage of sugars from wounds of fibrous roots. In addition, the
quantity of available carbohydrates for production of defense compounds is an
important determinant of host susceptibility or tolerance to Phytophthora (Angay et al.,
2014; Jönsson, 2006).
The interaction between Las and Phytophthora has been proposed to contribute
to pre-symptomatic root loss on HLB trees (Graham et al., 2013; Johnson et al., 2014).
The interaction was first recognized by Ann et al. (2004) who evaluated in the
greenhouse the effect on tree growth 6 months after inoculation with each pathogen
individually or together. HLB symptom development and reduction in citrus seedling
growth was greater on trees infected with Las and Phytophthora than with either
pathogen alone.
45
Greater understanding of the interaction between Las and Phytophthora will
provide insight into how roots are damaged at the early stage of HLB symptom
development. This knowledge will contribute to more effective management of root
health on HLB-affected trees. Based on preliminary studies, we hypothesize: 1) Las
infection of citrus rootstocks predisposes fibrous roots to Phytophthora infection by
increasing root leakage of exudates that attract zoospores or by breaking down host
resistance, or both mechanisms; 2) the combination of Las and Phytophthora causes
greater damage than each pathogen alone.
To test these hypotheses, greenhouse studies of the interaction between Las
and P. nicotianae (P.n.) were conducted with seedlings of the citrus rootstocks,
Cleopatra mandarin (Citrus reticulata), Swingle citrumelo (C. paradisi x Poncirus
trifoliata), sour orange (C. aurantium) and X639 (C. reticulata X P. trifoliata). Swingle
citrumelo is recognized as tolerant to P.n., while sour orange and Cleopatra mandarin
and X639 are considered to be susceptible (Graham, 1995). To quantify the interaction,
P.n. infection of roots, fibrous root biomass, root exudation of sucrose, starch and total
sugar (starch+sucrose) concentration in roots were evaluated for seedlings that were
non-inoculated, inoculated with Las, inoculated with P.n., or inoculated with Las and
P.n.
2.2 Materials and Methods
2.2.1 Experimental Design and Inoculation with Candidatus Liberibacter asiaticus
Seeds of Cleopatra mandarin were sown in Metro Mix 500 (Hummert
International, MO, USA) in 120 cm3 containers in the greenhouse. Seedlings were
fertilized with Jack’s Pro 20-20-20 (liquid) (A.M. Leonard, Inc., OH, USA) and Harrell’s
18-5-10 (Harrell’s, FL, USA) every other week and every 6 mo, respectively, and
46
watered three times per week. One hundred and twenty 6-mo-old seedlings were graft
inoculated with budwood from Las-infected trees. The budwood used for inoculation
was from a greenhouse grown ‘Madam Vinous’ sweet orange (C. sinensis) tree infected
with Las isolate FC6 as previously described (Folimonova et al., 2009). The bud was
inserted into the seedling approximately 12-17 cm above the soil line. Six months after
inoculation (trial 1: April 8, 2013; trial 2: May 13, 2014), 60 Las-infected seedlings (PCR
confirmed; see methods below) from 120 Las-inoculated seedlings, and 60 non-
inoculated seedlings were selected for uniform size, and transferred into autoclaved
Candler fine sand in 120 cm3 containers for four treatments P.n. +/- and Las+/- (10
replicates for each treatment) and 3 harvest times. In 2014, this protocol was repeated
for Swingle citrumelo (August 12, 2014), sour orange (March 15, 2014) and X639
(August 5, 2014).
2.2.2 Inoculation with Phytophthora nicotianae
P. nicotianae (P.n. 198) isolated from declining Cleopatra mandarin in the
greenhouse in 1999 was maintained on clarified V8 juice agar. Chlamydospores were
produced by the method of Tsao (1971) for inoculation. Chlamydospores harvested
from liquid culture were blended, added to Candler fine sand soil and mixed manually
for inoculum preparation. Soil inoculum was diluted 1:10 in water agar, incubated at
room temperature in dark for 2 d on pimaricin-ampicillin-rifampcin-
pentachloronitrobenzene-hymexazol (PARPH) semi-selective agar medium for assay of
propagule density. An inoculum density of 20 propagules/cm3 of soil was obtained by
mixing the inoculum concentrate with autoclaved Candler fine sand. Seedling roots
were pruned to a uniform length (8cm) to induce root growth. Thirty Las-infected and 30
non-inoculated seedlings were transplanted into soil infested with P.n. and 30 Las-
47
infected and 30 non-infected seedlings were transplanted into autoclaved soil.
Seedlings inoculated and non-inoculated with P.n. were located on different benches in
the greenhouse (27oC-32oC), watered 3 times a week and fertilized with Jack’s Pro 20-
20-20 every other wk.
2.2.3 Assessment of Phytophthora Root Infection and Collection of Exudates
At 5, 8 and 11 wk post inoculation with P.n. (wpi), seedlings roots were
thoroughly watered and harvested 24 h after irrigation. During harvest, seedlings from
each treatment were lifted out of the container and tapped 20 times in plastic bags. The
dead roots were separated from the rhizosphere soil, and the soil was dried for 48 h at
70 °C and stored at -20°C. Roots were washed free of soil and 20 fibrous root tips were
randomly selected from P.n. inoculated and non-inoculated seedlings and plated on
PARPH medium. Plated root tips were incubated in the dark for 3-4 d, and the
percentage of P.n. positive tips was recorded as infection incidence (%). Two leaves
from top and bottom position on the stem and 25-50 mg of fresh roots were collected
randomly for Las detection in roots and shoots. Fibrous roots (diameter ≤ 2mm) were
separated, dried and weighed (70°C for 48 h).
2.2.4 Candidatus Liberibacter asiaticus Detection
To detect Las in seedlings, leaf midribs were chopped into square segments,
placed in 2 mL screw cap tubes with one 5-mm stainless steel bead (Qiagen, Valencia,
CA, USA). The tubes were stored in a -80°C freezer for at least 2 h and after removal
from the freezer immediately ground twice at 30 revolutions per sec in a Tissuelyzer II
(Qiagen, Valencia, CA, USA). Ground midrib tissue was then processed for DNA
extraction using the Qiagen (Valencia, CA, USA) DNeasy Plant Mini kit according to the
manufacturer’s instructions, except that DNA was eluted twice with 50 μl AE buffer
48
instead of once by 100μl (Johnson et al., 2014). Randomly selected fibrous roots were
cut and ground as described above for the midrib tissue. Root DNA was extracted using
the Mo Bio PowerSoil DNA Isolation kit (Mo. Bio. Laboratories, Carlsbad, CA, USA) as
previously described (Johnson et al., 2014). The first step of the protocol was modified
as initial buffer, garnet and solution C1 was added into 2 ml screw cap tubes which
were used for grinding and then vortexed for 5 sec instead of 10 min (Johnson et al.,
2014). Purified DNA solution was stored at -20°C for later analysis.
Quantitative polymerase chain reactions (qPCR) were carried out using primers
and probes as previously described (Wang et al., 2006) on an Applied Biosystems 7500
Fast Real-Time PCR System. The master mix included Qiagen Hot Star Taq, ROX
passive reference dye (Bio-Rad), primers, probe and buffer in a concentration ratio as
described by the manufacturer’s protocol. 4 μL of template DNA and 16 μL master mix
were loaded into each well of a 96 well micro plate, and each sample was replicated.
Samples were run in triplicate if significant variation was found between 2 replicates in
the initial assay. The standard curve included concentrations of Las plasmids from
1×101 to 1×106 copies.
2.2.5 Quantification of Starch in Fibrous Roots
A 25 mg subsample of dried fibrous root was randomly selected for starch
analysis, and processed as previously described (Rosales and Burns, 2011) with
modifications. Fibrous roots were cut and ground in 2 ml tubes as described above for
DNA extraction. A 900 μl aliquot of DI water was mixed with the root powder. The
solution of ground roots or standard was vortexed and boiled for 10 min. Samples were
centrifuged for 2 min at 2500 x G. A 300 μl aliquot of supernatant was stored at -20°C
for sucrose assay. Another 300 μl aliquot of supernatant was transferred into a 2ml tube
49
and mixed with 900 μL ethanol. The mixture was vortexed for 5 sec, and centrifuged for
10 min at 10,000 x G. The supernatant was discarded and the pellet was suspended in
1.0 mL DI water by vortexing for 4 min. A 50 μl aliquot of KI: I2 solution (8 mM: 50 mM)
was added, vortexed for 5 sec and centrifuged for 2 min at 10,000 x G. The mixture was
transferred into a 96-well micro plate and the absorbance at 594 nm was measured.
Rice starch (Sigma- Aldrich) was used as the standard with a concentration range from
0 to1.0 mg/ml. Sample starch concentration was calculated from absorbance reading
according to the standard curve.
2.2.6 Quantification of Sucrose in Root Exudates and Fibrous Roots
A 50 mg sample of rhizosphere soil collected from Las (+) P.n. (-) and Las (-)
P.n. (-) seedlings above was suspended in 7.5 ml DI water to obtain a 15% soil moisture
concentration. The mixture was incubated at 4 °C for 2 h and centrifuged for 10 min at
2,700 x G in a filter bottle. The volume of filtrate was recorded and the filtrate was
stored at -20 °C. For sucrose assay, the root exudate was diluted 1:20, and centrifuged
at 10,000 x G for 2 min. A 4μl aliquot of supernatant from each sample was processed
according to the manufacturer’s protocol for the Glucose and Sucrose
Colorimetric/Fluormetric Assay (Sigma-Aldrich, St. Louis, MO, USA). Sucrose
concentration in fibrous root was expressed as µg sucrose per mg root dry weight.
2.2.7 Statistical Analysis
Fibrous root biomass, root starch, sucrose in root exudates and P.n. infection
incidence were analyzed by one-way ANOVA using PROC GLM (SAS v. 9.4). The
interaction between Las and P.n. was analyzed by two-way ANOVA using PROC GLM
(SAS v. 9.4). The significance level was set at P≤ 0.05. The relationship between
50
fibrous biomass and P.n. infection incidence, total sugar and P.n. infection incidence
was analyzed by linear regression.
2.3 Results
2.3.1 Las Effect on P.n. Infection Incidence
Significant increase (P≤0.05) in P.n. infection incidence of Cleopatra mandarin
seedlings inoculated with Las compared to seedlings not inoculated with Las was
detected at 11 wpi in the 2013 trial (Figure 2-1A) and at 5 wpi in the 2014 trial (Figure 2-
1B). In 2013, P.n. infection incidence was lower (P≤0.05) for Las-inoculated seedlings at
5 and 8 wpi (Figure 2-1A). In 2014, no significant effect of Las on P.n. infection
incidence was detected at 8 and 11 wpi (Figure 2-1B).
Similar to Cleopatra mandarin, temporal interactions of Las with P.n. infection
were observed for Swingle citrumelo, X639 and sour orange seedlings. Las increased
P.n. infection incidence at 5 wpi for Swingle citrumelo (P≤0.05) (Figure 2-2A), X639
(P≤0.05) (Figure 2-2B) and sour orange (P≤0.05) (Figure 2-2C), and at 11 wpi for X639
(Figure 2-2B). Seedlings of Swingle citrumelo (P≤0.05) and X639 (P≤0.05) inoculated
with Las exhibited lower P.n. infection incidence at 8 wpi compared to seedlings not
inoculated with Las (Figure 2-2A, B, C).
2.3.2 Relationship between Fibrous Root Damage and P.n. Infection Incidence
Cleopatra mandarin root damage due to Las, P.n. and their interaction was
assessed by measurement of fibrous root biomass at 5, 8 and 11 wpi. Non-inoculated
control seedlings continuously increased in root biomass in the 2013 and 2014 trials
(Figure 2-3A, B). A significant interaction between Las and P.n. for root biomass was
detected at 8 and 11 wpi in 2014 trial (P≤0.05). Overall, root biomass accumulation for
seedlings inoculated with Las, P.n. or both was lower by 11 wpi compared to the
51
controls (Figure 2-3A, B). In the 2013 trial, root biomass was 42% (P≤0.05), 19% and
46% (P≤0.05) lower for the seedlings inoculated with Las, P.n. or both, respectively
compared to non-inoculated controls at 11 wpi (Figure 2-3A). In the 2014 trial, root
biomass was 51% (P≤0.05), 29% (P≤0.05) and 39% (P≤0.05) lower for seedlings
inoculated with Las, P.n. or both, respectively compared to non-inoculated controls at
11 wpi (Figure 2-3B). Las infection, with or without P.n. inoculation, reduced greater root
biomass accumulation compared to P.n. infection in 2013 trial.
The temporal relationship between P.n. infection incidence and fibrous root
growth was evaluated by linear regression analysis. In the 2013 trial, for seedlings
inoculated with P.n. only, the slope of regression of fibrous root biomass on P.n.
infection incidence was negative (Figure 2-5B), whereas, for seedlings with Las infection
the slope was positive at 5 wpi (Figure 2-5A). At 8 wpi in 2013 trial, the relationship
between fibrous root biomass and P.n. infection incidence was positive for seedlings
with or without Las infection (Figure 2-5C, D). At 11 wpi in 2013 trial, the relationship
between fibrous root biomass and P.n. infection incidence was negative for seedlings
with or without Las infection (Figure 2-5E, F). In the 2014 trial, the slope of regression of
fibrous root biomass on P.n. infection incidence was negative (Figure 2-6A), whereas,
for seedlings with Las infection the slope was positive (Figure 2-6B). At 11 wpi in 2014
trial, the relationship between fibrous root biomass and P.n. infection incidence was
positive for seedlings with or without Las infection (Figure 2-6C, D).
Fibrous root biomass of non-inoculated control seedlings of Swingle citrumelo
and X639 increased from 5 to 11 wpi (Figure 2-4A, B). Unexpectedly, fibrous root
biomass of non-inoculated sour orange seedlings decreased at 8 wpi and then
52
increased at 11 wpi (Figure 2-4C). A significant interaction between Las and P.n. for
fibrous root biomass occurred at 8 wpi for sour orange (P≤0.05). Swingle citrumelo
infected with Las, P.n. or both pathogens had 47% (P≤0.05), 68% (P≤0.05) and 64%
(P≤0.05) lower fibrous root biomass compared to non-inoculated controls at 11 wpi,
respectively (Figure 2-4A). X639 seedlings infected with Las, P.n. or both pathogens
had a 6%, 88% (P≤0.05) and 90% (P≤0.05) lower root biomass compared to non-
inoculated controls at 11 wpi, respectively (Figure 2-4B). Sour orange infected with Las,
P.n. or both pathogens had a 67% (P≤0.05), 60% (P≤0.05) and 80% (P≤0.05) lower root
biomass compared to non-inoculated controls at 11 wpi, respectively (Figure 2-4C). Las,
P.n. or both pathogens reduced similar fibrous root accumulation on Swingle citrumelo
and sour orange at 11 wpi (Figure 2-4A, B).
For Swingle citrumelo, the relationship between root biomass and P.n. infection
incidence fluctuated over time. At 5 wpi for seedlings inoculated with P.n., the slope of
regression between fibrous root biomass and P.n. infection incidence was negative,
whereas, for seedlings with Las infection the slope was positive (Figure 2-7). At 8 wpi,
the relationship between fibrous root biomass and P.n. infection incidence was negative
for seedlings with Las infection and positive for seedlings without Las infection. At 11
wpi, the relationship between fibrous root biomass and P.n. infection incidence was
positive for seedlings with Las infection and negative for seedlings without Las infection.
In contrast to Swingle citrumelo, the relationship between fibrous root biomass
and P.n. infection incidence did not change over time for X639. At 5, 8 and 11 wpi, P.n.
infection and fibrous root biomass were negatively correlated with or without Las
53
infection (Figure 2-8). The relationship between Las and P.n. infection incidence for
sour orange was similar to X639, i.e., negative at 5 and 8 wpi (Figure 2-9)
2.3.3 Effect of Las on Root Exudation of Sucrose
Sucrose in root exudates collected from the rhizosphere soil was assayed to
determine why Las may have increased P.n. infection of fibrous roots. Cleopatra
mandarin seedlings showed the trend of higher sucrose concentration in root exudates
in Las-infected seedlings than in the non-inoculated controls at all three harvests in the
2013 and 2014 trials (Figure 2-10A, B).
For Swingle citrumelo, X639 and sour orange, sucrose concentration in root
exudates was higher in Las-infected seedlings than in non-inoculated controls at 8 wpi
for Swingle citrumelo (P≤0.05) (Figure 2-11A) and X639 (P≤0.05) (Figure 2-11B), and
11 wpi for Swingle citrumelo (Figure 2-11A).
2.3.4 Effect of Las and P.n. on Root Starch Concentration
Starch concentration in non-inoculated Cleopatra mandarin roots ranged from 34
to 40 mg/g in the 2013 trial and 9 to 26 mg/g in the 2014 trial. A significant interaction
between Las and P.n. for fibrous root starch was detected at 8 and 11 wpi in 2013 and
2014 trial respectively. Control seedlings showed higher starch concentration in fibrous
roots at 8 (P≤0.05) and 11 (P≤0.05) wpi than seedlings that were inoculated with each
pathogen or both (Figure 2-12A) in 2013. Continuous increase in starch concentration
from 5 wpi to 11 wpi was detected for non-inoculated Cleopatra roots in 2014 (Figure 2-
12B). Las roots with or without P.n. had lower starch than seedlings inoculated with P.n.
at 11 wpi in 2013 (P≤0.05) and 2014 trial (showed a trend) (Figure 2-12A, B). Each
pathogen alone significantly (P≤0.05) reduced starch concentration in fibrous roots
compared to non-inoculated controls in 2013 trial (Figure 2-12A).
54
Starch concentration of non-inoculated roots ranged from 10 to 115 mg/g for
Swingle citrumelo, 35 to 165 mg/g for X639 and 15 to 31 mg/g for sour orange up to 11
wpi. A significant interaction between Las and P.n. for fibrous root starch was detected
at 11 wpi for Swingle citrumelo (P≤0.05), at 8 wpi for sour orange (P≤0.05), and at 5 and
11 wpi for X639 (P≤0.05). By 11 wpi, Las reduced (P≤0.05) starch concentration
compared to controls for all rootstocks. (Figure 2-13A, B, C). Overall, X639 and Swingle
citrumelo showed higher starch concentration in P.n. infected seedlings compared to
non-inoculated seedlings (Figure 2-13A, B). Las infected sour orange seedlings with
and without P.n. had lower (P≤0.05) starch than seedlings inoculated with P.n. (Figure
2-13C).
2.3.5 Relationship between P.n. Infection Incidence and Total Sugar in Fibrous Roots
For Cleopatra mandarin at all harvest times in both trials, the linear regression
between P.n. infection incidence and total sugar concentration was positive for Las
infected roots and negative for seedlings not inoculated with Las at all harvest times in
both trials (Figure 2-14, 2-15). The exception was at 8 wpi in 2013 when seedlings
infected with Las showed a negative linear relationship between P.n. infection incidence
and total sugar concentration, whereas seedlings not inoculated with Las showed a
positive relationship between P.n. infection incidence and total sugar concentration
(Figure 2-14C,D).
For Swingle citrumelo, the opposite (positive and negative) linear relationship
between P.n. infection incidence and total sugar concentration caused by Las occurred
at 5 and 8 wpi (Figure 2-16A, B, C, D). For X639, the opposite linear regression
between P.n. infection incidence and total sugar concentration caused by Las occurred
55
at 5 wpi (Figure 2-17A, B). The opposite linear relationship between P.n. infection
incidence and total sugar concentration caused by Las occurred at 11 wpi for sour
orange (Figure 18C, D).
2.4 Discussion
As previously hypothesized in this study, Las significantly altered P.n. root
infection incidence. Moreover, Las increased P.n. root infection incidence at certain time
points after inoculation, but also significantly reduced infection incidence at other time
points after inoculation. Assessment of fibrous root biomass confirmed that each
pathogen reduced root biomass accumulation compared to non-inoculated controls, and
P.n. reduced root biomass faster than Las. Suprisingly, the combination of Las and P.n.
did not significantly reduce the fibrous root biomass more than each root pathogen
alone as hypothesized. The significant interaction of Las and P.n. on root biomass
shows that reduction in available roots was produced by each pathogen alone, no
additional root damage was observed after inoculation with both pathogens.
Linear regression between fibrous root biomass and P.n. infection incidence
revealed that these two parameters interacted in two ways. First, fibrous root biomass
decreased with increased P.n. infection as more damage was expressed. Second, P.n.
infection had a positive relationship with fibrous root growth as the reproduction of P.n.
depends on root availability. These relationships indicate P.n. infection either preceded
or lagged behind changes in root biomass depending on the timing of the infection
process (Figure 19).
To determine the basis for how Las increases P.n. infection incidence, root
exudation of sucrose and starch concentration in roots were assessed at each harvest.
Sucrose concentration in root exudates from Las-infected seedlings was always higher
56
than from non-inoculated controls. Greater sucrose exudation into the rhizosphere
enhances attraction of zoospores and promotes root penetration because this sugar is
the key carbohydrate source for P.n. (Duncan et al., 1993). Starch is the storage form of
non-structural carbohydrate in roots. Lower starch concentration in roots of Las-infected
seedlings indicates a loss of root vitality which increases susceptibility to P.n. infection.
Jonsson (2006) proposed that elevation of sugar concentration increases
Quercus robur tolerance to Phytophthora quercina, whereas Angay et al. (2014) found a
positive relationship between Phytophthora quercina infection and availability of non-
structural sugar in Quercus robur. Sucrose is the main form of transport sugar and
starch is the main carbohydrate reserve in roots. Therefore, these carbohydrates may
be used to evaluate the relationship between non-structural sugars and the
susceptibility to P.n. infection. In this study, the relationship changed over time,
indicating a complex interaction between the pathogens, alone or combined, and root
susceptibility to infection. Cleopatra mandarin seedlings inoculated with P.n. had a
higher sugar concentration with lower P.n. infection incidence, which is consistent with
Jonsson’s model that available sugar makes the host more tolerant to Phytophthora
infection. In contrast, when Las interacted with P.n. there was a positive relationship
between P.n. infection and total sugar in co-inoculated Cleopatra mandarin seedlings.
Higher sugar concentration was related with higher P.n. infection incidence in Las-
inoculated seedlings, which is consistent with the finding of Angay et al. (2014) that
higher sugar concentration is a benchmark for plant susceptibility to pathogen infection.
However, the relationship between P.n. infection and sugar concentration was not
always positive or negative when Las was or was not present. This indicates that the
57
sugar availability is too dynamic to be used as a predictor of plant tolerance to P.n.
infection at different disease development stages. Based on these results, we conclude
that Las increase of root susceptibility is attributed to the greater release of root
exudates that attract P.n. zoospores and/or to Las-mediated disruption of sugar
metabolism that interferes with plant response to P.n. infection.
Rootstocks are defined as tolerant or susceptible to P.n. based on whether their
root biomass is or is not maintained by replacement root growth in the presence of P.n.
(Graham, 1995). Four rootstocks that range from susceptible to tolerant to P.n. were
screened to determine the effect of Las on P.n. infection of citrus. P.n. infection
incidence for four rootstocks was around 60%. Slightly higher P.n. infection incidence
was detected for Cleopatra mandarin than Swingle citrumelo, X639 and sour orange,
but no significant difference was found among rootstocks. However, temporal changes
of P.n. infection incidence of Las-infected seedlings differed for Swingle citrumelo and
sour orange compared to Cleopatra mandarin and X639. P.n. infection incidence
rebounded at 11 wpi compared to 8 wpi for Cleopatra mandarin and X639. In contrast,
Swingle citrumelo and sour orange decreased in P.n. infection incidence by 11 wpi,
which suggests that these two rootstocks showed some tolerance to P.n. infection when
infected with Las. Cleopatra mandarin showed a steeper slope (Figure 2-14, 15) of the
linear regression between P.n. infection incidence and sugar concentration for seedlings
with and without Las compared to Swingle citrumelo (Figure 2-16), followed by X639
(Figure 2-17) and sour orange (Figure 2-18), which indicates that the P.n. infection is
more responsive to sugar concentration in roots for Cleopatra mandarin than for
Swingle citrumelo, X639 and sour range. Additionally, Las consistently altered the
58
relationship between P.n. infection incidence and sugar concentration for Cleopatra
mandarin seedlings. By comparison, this condition was not repeatedly observed in other
rootstocks, indicating the higher susceptibility of Cleopatra mandarin to Las and P.n.
Comparison of the four pathogen inoculation conditions, +/-P.n. or +/-Las,
demonstrated that the damage caused by the interaction of the two pathogens did not
exceed that of either Las or P.n. alone depending on the stages of disease
development. Greater P.n. infection incidence of Las-infected roots at 5 wpi suggests
that Las predisposes the roots to P.n. A decline in P.n. infection following reduction in
root biomass and root replacement indicates there is a lag between P.n. infection and
fibrous root loss. The contrasting relationship between sugar concentration and P.n.
infection for P.n.-infected and co-inoculation seedlings indicates that Las disrupts
carbohydrate metabolism in roots and increases root susceptibility to P.n.
Based on these results we hypothesize (Figure 20):
1) Early in disease development, Las increases susceptibility to P.n. infection by increasing zoospore attraction, facilitating penetration.
2) Las and its interaction with P.n. increases root loss resulting in a temporary drop in P.n. population by reducing available infection sites and/or available carbohydrate.
3) As new root flushes occur, Las moves down to the root tips with the phloem flow, P.n. repeats the infection cycle until there is a complete loss of fibrous root system.
59
Figure 2-1. Phytophthora nicotianae (P.n.) infection incidence of Cleopatra mandarin
seedlings at 5, 8 and 11 weeks post inoculation (wpi). A) 2013 trial, B) 2014 trial. Treatments: inoculation with P.n. (Las-Pn+); co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+). Different letters denote significant difference at P≤0.05. Bars represent the mean of 4-8 replicates.
60
Figure 2-2. Phytophthora nicotianae (P.n.) infection incidence of A) Swingle citrumelo,
B) X639 and C) sour orange seedlings at 5, 8 and 11 weeks post inoculation (wpi). Treatments: inoculation with P.n. (Las-Pn+); co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+). Different letters denote significant difference at P≤0.05. Bars represent the mean of 4-8 replicates.
61
Figure 2-3. Fibrous root biomass of Cleopatra mandarin seedlings at 5, 8 and 11 weeks
post inoculation (wpi). A) 2013 trial, B) 2014 trial. Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Different letters denote significant difference at P≤0.05. * Denotes significant interaction at P≤0.05. Bars represent the mean of 5-8 replicates.
62
Figure 2-4. Fibrous root biomass of A) Swingle citrumelo, B) X639 and C) sour orange
seedlings at 5, 8 and 11 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Different letters denote significant difference at P≤0.05. * Denotes significant interaction at P≤0.05. Bars represent the mean of 5-8 replicates.
63
Figure 2-5. Cleopatra mandarin 2013. Linear regression of Phytophthora nicotianae
(P.n.) infection incidence and fibrous root biomass at 5, 8 and 11 weeks post inoculation (wpi). Treatments: co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+); inoculation with P.n. (Las-Pn+). 5 wpi: A) Las+Pn+, B) Las-Pn+; 8 wpi: C) Las+Pn+, D) Las-Pn+; 11 wpi: E) Las+Pn+, F) Las-Pn+. Points represent the value of 6-9 replicates.
64
Figure 2-6. Cleopatra mandarin 2014. Linear regression of Phytophthora nicotianae
(P.n.) infection incidence and fibrous root biomass at 5 and 11 weeks post inoculation (wpi). Treatments: co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+); inoculation with P.n. (Las-Pn+). 5 wpi: A) Las+Pn+, B) Las-Pn+; 8 wpi: C) Las+Pn+, D) Las-Pn+. Points represent the value of 6-9 replicates.
65
Figure 2-7. Swingle citrumelo. Linear regression of Phytophthora nicotianae (P.n.)
infection incidence and fibrous root biomass at 5, 8 and 11 weeks post inoculation (wpi). Treatments: co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+); inoculation with P.n. (Las-Pn+). 5 wpi: A) Las+Pn+, B) Las-Pn+; 8 wpi: C) Las+Pn+, D) Las-Pn+; 11 wpi: E) Las+Pn+, F) Las-Pn+. Points represent the value of 6-9 replicates.
66
Figure 2-8. X639. Linear regression of Phytophthora nicotianae (P.n.) infection
incidence and fibrous root biomass at 5, 8 and 11 weeks post inoculation (wpi). Treatments: co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+); inoculation with P.n. (Las-Pn+). 5 wpi: A) Las+Pn+, B) Las-Pn+; 8 wpi: C) Las+Pn+, D) Las-Pn+; 11 wpi: E) Las+Pn+, F) Las-Pn+. Points represent the value of 4-6 replicates.
67
Figure 2-9. Sour orange. Linear regression of Phytophthora nicotianae (P.n.) infection incidence and fibrous root biomass at 5 and 8 weeks post inoculation (wpi). Treatments: co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+); inoculation with P.n. (Las-Pn+). 5 wpi: A) Las+Pn+, B) Las-Pn+; 8 wpi: C) Las+Pn+, D) Las-Pn+. Points represent the value of 5-7 replicates.
68
Figure 2-10. Sucrose exudation of Cleopatra mandarin seedlings at 5, 8 and 11 weeks
post inoculation (wpi). A) 2013 trial, B) 2014 trial. Treatments: inoculation with Candidatus Liberibacter asiaticus (Las+); non-inoculated (Las-). Different letters denote significant difference at P≤0.05. Bars represent the mean of 4-7 replicates.
69
Figure 2-11. Sucrose exudation of A) Swingle citrumelo, B) X639 and C) sour orange
seedlings at 5, 8 and 11 weeks post inoculation (wpi). Treatments: inoculation with Candidatus Liberibacter asiaticus (Las+); non-inoculated (Las-). Different letters denote significant difference at P≤0.05. Bars represent the mean of 4-7 replicates.
70
Figure 2-12. Fibrous root starch concentration of Cleopatra mandarin at 5, 8 and 11
weeks after inoculation with Phytophthora nicotianae (P.n.). A) 2013 trial, B) 2014 trial. Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with P.n. (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Different letters denote significant difference at P≤0.05. * Denotes significant interaction at P≤0.05. Bars represent the mean of 4-8 replicates.
71
Figure 2-13. Fibrous root starch concentration of A) Swingle citrumelo, B) X639 and C)
sour orange at 5, 8 and 11 weeks post inoculation with Phytophthora nicotianae (P.n.). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with P.n. (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Different letters denote significant difference at P≤0.05. * Denotes significant interaction at P≤0.05. Bars represent the mean of 4-8 replicates.
*
72
Figure 2-14. Cleopatra mandarin 2013. Linear regression of Phytophthora nicotianae
(P.n.) infection incidence and Total available sugar at 5, 8 and 11 weeks post inoculation (wpi). Treatments: co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+); inoculation with P.n. (Las-Pn+). 5 wpi: A) Las+Pn+, B) Las-Pn+; 8 wpi: C) Las+Pn+, D) Las-Pn+; 11 wpi: E) Las+Pn+, F) Las-Pn+. Points represent the value of 5-9 replicates.
73
Figure 2-15. Cleopatra mandarin 2014. Linear regression of Phytophthora nicotianae
(P.n.) infection incidence and Total available sugar at 5 and 11 weeks post inoculation (wpi). Treatments: co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+); inoculation with P.n. (Las-Pn+). 5 wpi: A) Las+Pn+, B) Las-Pn+; 8 wpi: C) Las+Pn+, D) Las-Pn+. Points represent the value of 5-7 replicates.
74
Figure 2-16. Swingle citrumelo. Linear regression of Phytophthora nicotianae (P.n.)
infection incidence and Total available sugar at 5, 8 and 11 weeks post inoculation (wpi). Treatments: co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+); inoculation with P.n. (Las-Pn+). 5 wpi: A) Las+Pn+, B) Las-Pn+; 8 wpi: C) Las+Pn+, D) Las-Pn+; 11 wpi: E) Las+Pn+, F) Las-Pn+. Points represent the value of 6-8 replicates.
75
Figure 2-17. X639. Linear regression of Phytophthora nicotianae (P.n.) infection
incidence and Total available sugar at 5, 8 and 11 weeks post inoculation (wpi). Treatments: co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+); inoculation with P.n. (Las-Pn+). 5 wpi: A) Las+Pn+, B) Las-Pn+; 8 wpi: C) Las+Pn+, D) Las-Pn+; 11 wpi: E) Las+Pn+, F) Las-Pn+. Points represent the value of 3-7 replicates.
76
Figure 2-18. Sour orange. Linear regression of Phytophthora nicotianae (P.n.) infection
incidence and Total available sugar at 5 and 8 weeks post inoculation (wpi). Treatments: co-inoculation of Candidatus Liberibacter asiaticus (Las) and P.n. (Las+Pn+); inoculation with P.n. (Las-Pn+). 5 wpi: A) Las+Pn+, B) Las-Pn+; 8 wpi: C) Las+Pn+, D) Las-Pn+. Points represent the value of 4-6 replicates.
77
Figure 2-19. Model for the relationship between Phytophthora nicotianae (P.n.) infection and root biomass. The dashed line represents fibrous root biomass, and the solid line represents P.n. infection incidence.
78
Figure 2-20. Hypothesis for the interaction between Candidatus Liberibacter asiaticus (Las), Phytophthora nicotianae (P.n.) and root. Blue dot represents Las; red dot represents P.n. in rhizosphere; red strap represents root. Step 1: Las moves down to the root, root structure and root exudation was changed, and P.n. was attracted to swim to root surface and penetrated through outer cortex. Step 2: P.n. infection increased because of enhanced penetration and decreased plant tolerance to P.n.; Step 3: Root decline out of damage caused by the interaction, both Las and P.n. population on root were decreased with root loss; Step 4: During root replacement, Las moves down to root with phloem sap and P.n. infection and interaction with Las cycle repeated; Step 5 and 6 repeated step 3 and 4, until there is a complete loss of fibrous root system.
79
CHAPTER 3 COMPARISON OF FIBROUS ROOT DAMAGE ON CITRUS ROOTSTOCKS CAUSED BY CANDIDATUS LIBERIBACTER ASIATICUS AND PHYTOPHTHORA NICOTIANAE
3.1 Introduction
Citrus trees absorb water and mineral nutrients in soil through fibrous roots
(diameter < 2mm). Fibrous root bunches develop by branching, elongating and
maturation. As they age, citrus fibrous roots change color from white to brown (Fitter,
2002; Wells and Eissenstat, 2003). Roots change biochemically and structurally in
response to normal development and environmental conditions (Duncan et al., 1993;
Eissenstat and Achor, 1999). Phytophthora spp. are rhizosphere-inhabiting pathogens
that can rapidly infect and kill citrus fibrous roots (Kosola et al., 1999). To maintain
water and mineral nutrients uptake, the tree produces new roots for replacement of
roots lost due to biotic and abotic stresses (Graham, 1995).
Whereas, root loss and replacement might cause lower fruit yield and quality as a
larger amounts of photoassimilate are allocated for root replacement (Eissenstat et al.,
2000). Hence, understanding the relationship between fibrous root damage and canopy
development in relation to pathogen infection may provide useful information for root
disease management and reduce fruit yield loss.
Huanglongbing (HLB), caused by the phloem-limited bacterium Candidatus
Liberibacter asiaticus (Las) (Jagoueix et al., 1994; Teixeira et al., 2005), is the most
devastating disease of citrus worldwide (Bové, 2006). The most interesting finding from
previous study of the root status of Las-infected seedlings is that Las not only causes
root damage, but also increases root production at certain times, which led to further
investigation of the mechanisms for these responses and the consequence of reduced
canopy development.
80
Linkages of root traits to root function, and leaf traits to leaf function have
previously been used to predict plant adaptation to environmental conditions (Eissenstat
et al., 2000; Eissenstat and Achor, 1999). Selection of the appropriate root and leaf
traits for evaluation is critical to obtain a reliable estimate of host response to pathogen
infection. Root length and root color provide the most current information about root
growth and viability (Fitter, 2002). These measures reveal how the pathogen reduces
root health, either by inhibiting new root growth, facilitating root collapse, or both. To
measure the influence of root damage on canopy development, characters like total leaf
area and specific leaf area (SLA) are used to estimate photosynthetic capacity and leaf
morphology response. SLA is defined as the leaf area divided by dry biomass (Wilson et
al., 1999). SLA represents a plant strategy to modulate the investment in leaf area per
unit biomass under different conditions (Evans and Poorter, 2001; Wilson et al., 1999).
Higher SLA represents greater leaf area per unit biomass to capture more light for
photosynthesis
Based on Chapter 2 results, we hypothesize that: 1) Las damages citrus root by
increasing carbohydrate allocation which induces faster root growth and turnover; 2)
P.n. damages fibrous roots by causing more rapid root collapse immediately after
infection, accelerating collapse compared to roots infected with Las; 3) canopy
development will be inhibited after root function is limited by both pathogens. To test
these hypothoses, we measured total root length, fibrous root length by diameter
(<2mm), new root length, fibrous root sucrose, total leaf area and specific leaf area after
inoculation with Las or P.n. The overall goal is to understand root disease development
81
from the whole plant perspective to improve management of root health on HLB-
affected trees.
3.2 Materials and Methods
3.2.1 Plant Materials and Inoculation with Candidatus Liberibacter asiaticus
Seeds of Cleopatra mandarin (C. reticulata) were sown in Metro Mix 500
(Hummert International, MO, USA) in 120 cm3 containers in the greenhouse. Seedlings
were fertilized with Jack’s Pro 20-20-20 (Liquid) (A.M. Leonard, Inc., OH, USA) and
Harrell’s 18-5-10 (Harrell’s, FL, USA) every other week and every 6 mo, respectively,
and watered 3 times per week. One hundred and twenty six-mo-old seedlings were graft
inoculated with budwood from Las-infected trees. The budwood was from greenhouse
grown ‘Madam Vinous’ sweet orange (Citrus sinensis) trees infected with Las isolate
FC6 as previously described (Folimonova et al., 2009). Six months after inoculation
(April 8, 2013; May 13, 2014), 60 Las-infected Cleopatra mandarin seedlings (PCR
confirmed) and 60 non-inoculated seedlings were selected for uniform size, and
transferred into autoclaved Candler fine sand in 120 cm3 containers for four treatments
P.n. +/- and Las+/- (10 replicates for each treatment) and 3 harvest times. In 2014, this
protocol was repeated for Swingle citrumelo (August 12, 2014) and X639 (August 5,
2014).
3.2.2 Phytophthora nicotianae – Candidatus Liberibacter asiaticus interaction
P. nicotianae (P.n. 198) isolated from declining Cleopatra mandarin in the
greenhouse in 1999 was maintained on clarified V8 juice agar. Chlamydospores were
produced for inoculum of P.n. by the method of Tsao (1971). For inoculum preparation,
chlamydospores were blended, added to Candler fine sand and mixed manually. Soil
inoculum was diluted 1:10 in water agar, incubated at room temperature in the dark for
82
2 days on pimaricin-ampicillin-rifampcin-pentachloronitrobenzene-hymexazol (PARPH)
semi-selective agar medium for assay of propagule density. An inoculum density of 20
propagules/cm3 of soil was obtained by mixing the inoculum concentrate with
autoclaved Candler fine sand. Seedling roots were pruned to a uniform length (8cm) to
induce root growth. 30 Las-infected and 30 non-inoculated seedlings were transplanted
into soil infested with P.n. and 30 Las-infected and 30 non-infected seedlings were
transplanted into autoclaved soil. Seedlings infected and non-infected with P.n. were
located on different benches in greenhouse (27oC-32oC), watered 3 times a week and
fertilized with Jack’s Pro 20-20-20 every other week.
At 5, 8 and 11 weeks post inoculation (wpi) with P.n., seedlings roots were
thoroughly watered and harvested 24 h after irrigation. During harvest, roots were
washed and 20 fibrous root tips were randomly selected from P.n. infected/non infected
seedlings and plated on PARPH medium. Plated root tips were incubated in dark for 3-4
d, and the number of P.n. positive tips of P.n. infected seedlings was recorded and
contamination was checked for non-inoculated seedlings. Roots and leaves detached
from the seedlings were evenly spread on the blue background of an Epson 37 scanner
(scale: 100%, dpi: 600, and Bit depth: 24) to obtain digital color photographs (TIFF
image) for each sample. Fibrous roots (diameter ≤ 2mm) and leaves were separated,
dried and weighed (70°C for 48 h).
3.2.3 Root and Leaf Morphology Analysis
The photographs were analyzed by WinRhizo Pro (Regent Instrument Inc,
Canada) to measure root length, root diameter and leaf area. Root diameter classes
were as follows: 0-0.2 mm, 0.2-0.4 mm, 0.4-0.6 mm, 0.6-0.8 mm, 0.8-1.0 mm, 1.0-1.2
mm, 1.2-1.4 mm, 1.4-1.6 mm, 1.6-1.8 mm and 1.8-2.0 mm. Color classes were set as
83
follows: white for new roots, green for leaves, and blue for background. Root length and
leaf area were calculated based on the sum of the pixels of each color. Specific leaf
area was expressed as the total leaf area divided by dry leaf weight.
3.2.4 Candidatus Liberibacter asiaticus Detection
To detect Las in leaves, midribs were chopped into cubic segments, placed in 2
mL screw cap tubes with one 5-mm stainless steel bead (Qiagen, Valencia, CA, USA).
The tubes were stored at -80°C for at least 2 h and after removal from the freezer
immediately ground twice at 30 revolutions per sec in a Tissuelyzer II (Qiagen,
Valencia, CA, USA). Ground midrib tissue was then processed for DNA extraction using
the Qiagen (Valencia, CA, USA ) DNeasy Plant Mini kit according to the manufacturer’s
instructions, except that DNA was eluted twice by 50 μl AE buffer instead of once by
100 μl at last step (Johnson et al., 2014). Randomly selected fibrous roots were cut and
ground as described above for the midrib tissue. Root DNA was extracted using the Mo
Bio PowerSoil DNA Isolation kit (Mo. Bio. Laboratories) as previously described
(Johnson et al., 2014). The first step of protocol was modified as initial buffer, garnet
and solution C1 was added into 2 ml screw cap tubes which were used for grinding and
then vortexed for 5 sec instead of 10 min (Johnson et al., 2014). Purified DNA was
stored at -20°C for later analysis.
qPCR for Las detection. qPCR was carried out using primers and probes as
previously described (Wang et al., 2006). qPCR reaction was run on 7500 Fast Real-
Time PCR System. The master mix included Qiagen HotStar Taq, ROX passive
reference dye (Bio-Rad), primers, probe and buffer in a concentration ratio as described
by the manufacturer’s protocol. 4 μL of template DNA and 16 μL master mix were
loaded into each well of a 96 micro-well plate, and each sample was replicated.
84
Samples were run in triplicate if significant variation was found between 2 replicates in
the initial assay. The standard curve included concentrations of las plasmids from 1×101
to 1×106 copies.
3.2.5 Quantification of Sucrose in Fibrous Roots
A 25 mg subsample of dried fibrous root was randomly selected for sucrose
analysis, and processed by a modified method previously described (Rosales and
Burns, 2011). Fibrous roots were cut and ground in 2 ml tubes as described above for
DNA extraction. A 900 μl aliquot of DI water was mixed with the root powder. The
solution of ground roots or standard was vortexed and boiled for 10 min. Samples were
centrifuged for 2 min at 2500 x G. A 300 μl aliquot of supernatant was stored at -20°C
for sucrose assay. A 4μl aliquot of supernatant from each sample was processed
according to the manufacturer’s protocol for the Glucose and Sucrose
Colorimetric/Fluormetric Assay (Sigma-Aldrich). Sucrose concentration in fibrous roots
was tested with the same kit.
3.2.6 Statistical Analysis
Total root length, root length by diameter, new root length, root sucrose, total leaf
area and SLA were analyzed by one-way ANOVA using PROC GLM (SAS v. 9.4). The
interaction between Las and P.n. was analyzed by two-way ANOVA using PROC GLM
(SAS v. 9.4). The significance level was set at P≤ 0.05.
3.3 Results
3.3.1 Total Root Length
Cleopatra mandarin rootstock. A significant interaction between Las and P.n. for
total root length occurred at 5 and 8 wpi (P ≤ 0.05). Total root length of non-inoculated
Cleopatra mandarin roots increased from 681 to 982 cm between 5 and 11 wpi (Fig 3-
85
1A). For Las-inoculated seedlings, total root length decreased 41% from 886 to 520 cm
between 5 and 11 wpi. At 5 wpi, P.n.-inoculated seedlings with or without Las had lower
total root length (P ≤ 0.05) than seedlings inoculated with Las only. Total root length for
Las-inoculated seedlings was 30% higher (P ≤ 0.05) than the non-inoculated controls at
5 wpi, but by 11 wpi total root length was 47% lower (P ≤ 0.05) than the non-inoculated
controls. Total root length of P.n.-inoculated seedlings by 11wpi was lower (P ≤ 0.05)
compared to non-inoculated controls. At 11 wpi, P.n.-inoculated seedlings were higher
(P ≤ 0.05) in total root length than Las-inoculated seedlings. Total root length of
seedlings inoculated with both Las and P.n. was lower compared to non-inoculated
seedlings at 11 wpi (P ≤ 0.05).
Swingle citrumelo rootstock. A significant interaction between Las and P.n. for
total root length occurred at 8 and 11 wpi (P ≤ 0.05). Total root length of non-inoculated
Swingle citrumelo roots increased from 345 to 608 cm between 5 and 11 wpi (Figure 3-
1B). For Las-inoculated seedlings total root length decreased 26% from 461 to 341 cm
between 5 and 11 wpi. Total root length of P.n.-infected seedlings increased 18%
between 5 and 11 wpi. Total root length for P.n.-inoculated seedlings with or without Las
infection was lower (P ≤ 0.05) than for seedlings inoculated with Las from 5 to 11 wpi.
Las-inoculated seedlings were 34% higher (P ≤ 0.05) in total root length than the
controls at 5 wpi, but 44% lower (P ≤ 0.05) by 11 wpi. The total root length of seedlings
inoculated with both Las and P.n. was comparable to seedlings inoculated with P.n., but
lower (P ≤ 0.05) than for Las-inoculated seedlings.
X639 rootstock. A significant interaction between Las and P.n. for total root
length occurred at 8 wpi (P ≤ 0.05). Total root length of non-inoculated X639 roots
86
increased from 617 to 921 cm between 5 and 11 wpi (Figure 3-1C). Total root length for
P.n.-inoculated seedlings was significantly (P ≤ 0.05) lower than for seedlings
inoculated with Las at all harvests. Total root length of Las-inoculated seedlings was
22% and 13% lower than non-inoculated seedlings at 8 (P ≤ 0.05) and 11 wpi (P ≤
0.05), respectively. The total root length of seedlings inoculated with both Las and P.n.
was significantly lower (P ≤ 0.05) at 11 wpi compared to seedlings inoculated with Las.
3.3.2 Root Length and Diameter Class
Cleopatra mandarin rootstock. The greatest root length fell into 0.6-0.8 mm
diameter class for all treatments (Figure 3-2A, B, C). Root length in all diameter classes
for non-inoculated seedlings increased from 5 to 11 wpi. Root length in 0.4-1.2 mm
diameter size class comprised 63%, 65% and 51% of the total fibrous root length at 5, 8
and 11 wpi, respectively. For Las-inoculated seedlings, length of roots for all diameter
classes was higher compared to non-inoculated seedlings at 5 wpi (significantly higher
for the 0.8-1.4 and 1.8-2 mm diameter size class) (Figure 3-2A) and lower at 8
(significantly lower for the 0.4-0.6mm diameter size class) (Figure 3-2B) and 11
(significantly lower for the 0.4-2 mm diameter size class) wpi (Figure 3-2C). Length of
roots for all diameter classes of P.n.-inoculated seedlings was lower than the non-
inoculated and Las-inoculated seedlings at 5 wpi (significantly lower in 0.2-1.0 mm
diameter size class) (Figure 3-2 A). By 11 wpi (Figure 3-2 C), non-inoculated seedlings
had the highest length of roots for all diameter classes followed by P.n.-inoculated
seedlings and Las-inoculated seedlings. Seedlings inoculated with both Las and P.n.
compared with seedlings inoculated with each pathogen alone had lower length of roots
in 0.8-2 mm (significant for the 0.8-1.0 and 1.2 -2mm diameter size classes) compared
to other treatments at 5 (Figure 3-2 A) and 11 wpi (Figure 3-2 C), respectively.
87
Swingle citrumelo rootstock. The greatest root length fell into the 0.4-0.6 and 0.6-
0.8 mm diameter classes for all treatments (Figure 3-3). Root length for non-inoculated
seedlings in the 0.2-1.4 mm diameter classes increased up to 11 wpi (Figure 3-3A, B,
C). Root length in the 0.4-0.8 mm diameter class for non-inoculated seedlings
represented almost 60% of total fibrous root length at 5, 8 and 11 wpi (Figure 3-3A, B,
C). Las-inoculated seedlings had a higher (P ≤ 0.05) and lower (P ≤ 0.05) root length for
all diameter classes than non-inoculated seedlings at 5 (Figure 3-3A) and 8 wpi
respectively (non significant lower root length in 1.2-1.4 mm diameter size class) (Figure
3-3B), respectively. P.n.-inoculated seedlings had a lower root length (P ≤ 0.05) of roots
for all diameter classes than non-inoculated seedlings for all harvest times (Figure 3-3A,
B, C). Seedlings inoculated with both Las and P.n. had a lower root length (P ≤ 0.05) for
all diameter classes compared with non-inoculated seedlings and seedlings inoculated
with Las at all three harvests. The difference in root length for all diameter classes
between co-inoculated seedlings and P.n.-inoculated seedlings was not significant.
X639 rootstock. The highest root length for X639 seedlings fell into the 0.4-0.6
and 0.6-0.8 mm diameter classes in all treatments (Figure 3-4). The length of roots in
the 0.4-0.6 mm diameter class for non-inoculated seedlings increased up to11 wpi. P.n.
inoculation reduced root length (P ≤ 0.05) for all diameter classes compared to non-
inoculated and Las-inoculated seedlings (Figure 3-4A, B, C). Seedlings inoculated with
both Las and P.n. had a similar root length for all diameter classes compared to
seedlings inoculated with P.n. alone.
3.3.3 New Root Length
Cleopatra mandarin rootstock. A significant interaction between Las and P.n. for
new root length occurred at 11 wpi (P ≤ 0.05). New root length for non-inoculated
88
seedlings of Cleopatra mandarin increased from 187 to 295 cm between 5 and 11 wpi
(Figure 3-5A). Las-inoculated seedlings produced more new root length (P ≤ 0.05) than
the non-inoculated controls at 5 wpi (Figure 3-5A). P.n.-inoculated seedlings produced
less (P ≤ 0.05) new root length compared to the non-inoculated controls at 8 and 11
wpi. Seedlings inoculated with both pathogens had similar new root length of P.n.-
inoculated seedlings at all three harvests.
Swingle citrumelo rootstock. A significant interaction between Las and P.n. for
new root length occurred at 8 and 11 wpi (P ≤ 0.05). New root length for non-inoculated
seedlings of Swingle citrumelo increased from 186 to 296 cm between 5 and 11 wpi
(Figure 3-5B). Las-inoculated seedlings produced less (P ≤ 0.05) new root length
compared to non-inoculated seedlings at 8 and 11 wpi. P.n.-inoculated seedlings
produced less new root length (P ≤ 0.05) compared to non-inoculated seedlings at all
three harvests. Seedlings inoculated with both pathogens had similar new root length of
P.n.-inoculated seedlings.
X639 rootstock. A significant interaction between Las and P.n. for new root
length occurred at 5 and 8 wpi (P ≤ 0.05). New root length for non-inoculated seedlings
of X639 increased from 228 to 305 cm between 5 and 11 wpi (Figure 3-5C). Las-
inoculated seedlings produced more (P ≤ 0.05) new root length than the non-inoculated
controls at 5 wpi. P.n.-inoculated seedlings had less new root length (P ≤ 0.05) than
Las-inoculated at all three harvests. Seedlings inoculated with both pathogens had
similar new root length of P.n.-inoculated seedlings.
3.3.4 Fibrous Root Sucrose
Cleopatra mandarin rootstock. A significant interaction between Las and P.n. for
fibrous root sucrose occurred at 5 and 8 wpi (P ≤ 0.05). Fibrous root sucrose of non-
89
inoculated Cleopatra mandarin ranged from 12 to 20 mg/g (Figure 3-6A). Las-infected
roots had lower sucrose (P ≤ 0.05) than non-inoculated roots at 5 and 8 wpi. P.n.-
infected roots had lower sucrose (P ≤ 0.05) than non-inoculated roots at 5 and 8 wpi.
Roots infected with Las and P.n. had comparable sucrose to roots infected with Las and
P.n. alone at all three harvests.
Swingle citrumelo rootstock. A significant interaction between Las and P.n. for
fibrous root sucrose occurred at 8 wpi (P ≤ 0.05). Fibrous root sucrose of non-inoculated
Swingle citrumelo ranged from 18 to 23 mg/g (Figure 3-6B). Las-infected roots had
lower sucrose (P ≤ 0.05) than non-inoculated roots at 8 wpi. P.n.-infected roots had
higher sucrose (P ≤ 0.05) than Las-infected roots at 8 wpi.
X639 rootstock. Fibrous root sucrose of non-inoculated X639 ranged from 14 to
20 mg/g (Figure 3-6C). Las-infected roots had higher sucrose (P ≤ 0.05) than non-
inoculated roots at 8 wpi. Fibrous root sucrose in P.n.-infected roots was lower (P ≤
0.05) than in non-inoculated roots at 5 and11 wpi. Roots infected with Las and P.n. had
lower (P ≤ 0.05) fibrous root sucrose compared to Las-inoculated and non-inoculated
roots at 11 wpi
3.3.5 Total Leaf Area
Cleopatra mandarin rootstock. Total leaf area for non-inoculated seedlings of
Cleopatra mandarin increased from 519 to 568 cm2 between 5 to 11 wpi (Figure 3-7A).
Total leaf area of Las-inoculated seedlings increased from 462 to 550 cm2 and P.n -
inoculated seedlings from 460 to 550 cm2 between 5 to 11 wpi. The difference of total
leaf area between Las-inoculated, P.n.-inoculated or co-inoculated seedlings was not
significant.
90
Swingle citrumelo rootstock. Total leaf area for non-inoculated seedlings of
Swingle citrumelo increased from 246 to 272 cm2 between 5 and 11 wpi (Figure 3-7B).
Total leaf area for Las-inoculated seedlings decreased from 254 to 216 cm2 and P.n.
inoculated seedlings decreased from 228 to 159 cm2 between 5 and 11 wpi. Seedlings
inoculated with both pathogens declined in total leaf area from 263 to 183 cm2 between
5 and 11 wpi. At 11 wpi, seedlings inoculated with each pathogen had lower total leaf
area (P ≤ 0.05) compared to non-inoculated seedlings. By 11 wpi, P.n.-inoculated
seedlings with and without Las had less total leaf area (P ≤ 0.05) than Las-inoculated
seedlings.
X639 rootstock. A significant interaction between Las and P.n. for total leaf area
occurred at 8 wpi (P ≤ 0.05). Total leaf area for non-inoculated seedlings of X639
increased from 273 to 351 cm2 between 5 and 11 wpi (Figure 3-7C). Total leaf area for
Las-inoculated seedlings decreased from 280 to 161 cm2 and P.n.-inoculated seedlings
decreased from 248 to 186 cm2 between 5 and 11 wpi. Seedlings inoculated with each
pathogen had lower total leaf area (P ≤ 0.05) compared to non-inoculated seedlings at
11 wpi. Seedlings inoculated with both pathogens had the lowest total leaf area
compared to all other treatments at 5 (P ≤ 0.05) and 8 wpi (not significant compared to
Las-inoculated seedlings).
3.3.6 Specific Leaf Area
Cleopatra mandarin rootstock. SLA for non-inoculated seedlings of Cleopatra
mandarin increased from 109 to 122cm2/g (Figure 3-8A). SLA of Las-inoculated
seedlings increased from 110 to 118cm2/g. SLA of P.n.-inoculated seedlings increased
from 107 to 109 cm2/g. Seedlings inoculated with either pathogen had a lower SLA
compared to non-inoculated seedlings at 8 wpi (P ≤ 0.05). The difference of SLA
91
between the non-inoculated control and Las-inoculated, P.n.-inoculated seedlings or co-
inoculated seedlings was not significant at 11 wpi.
Swingle citrumelo rootstock. SLA for non-inoculated seedlings of Swingle
citrumelo increased from 148 to 159cm2/g (Figure 3-8B). SLA for Las-inoculated
seedlings increased from 134 to 152cm2/g and for P.n.-inoculated seedlings increased
from 144 to 157 cm2/g. Seedlings inoculated with Las with or without P.n. infection had
a lower SLA (P ≤ 0.05) compared to non-inoculated controls at 5 wpi. Seedlings
inoculated with both pathogens had the least SLA compared to all other treatments at 5
(P ≤ 0.05) wpi.
X639 rootstock. SLA of non-inoculated seedlings of X639 increased from 127 to
136cm2/g (Figure 3-8C). SLA for Las-inoculated seedlings increased from 124 to
135cm2/g and for P.n.-inoculated seedlings from 115 to 120 cm2/g. Las and P.n.
inoculation did not significantly affect SLA compared to control seedlings.
3.4 Discussion
Kosola et al. (1999) used minirhizotrons to observe that P.n. caused higher root
mortality and reduced lifespan of fibrous roots within 6 weeks after P.n. was present. In
this study, we confirmed that P.n. damaged fibrous roots within 5 weeks. In contrast
with P.n., Las increased fibrous root length that was rapidly followed by root collapse.
For example at 5 wpi, Las induced greater total root length in Cleopatra mandarin and
Swingle citrumelo (Figure 3-1), indicating that Las increased carbohydrate allocation to
fibrous roots. However by 8 and 11 wpi, Las infection reduced total root length of these
two rootstocks compared to the control seedlings. P.n. did not increase root length. The
greater root growth, also called root replacement, was induced by P.n. at low (1-2
propagules/cm3) inoculum density, which is an explanation for tolerance of some
92
rootstocks (Graham, 1995). In this study, the lack of observation of P.n. induced root
replacement is probably because we waited too long to harvest the plant to detect
stimulation by P.n. or due to the rapid root decline caused by P.n. inhibited root
replacement.
To determine if the effect on root length caused by Las and P.n. is specific for
certain classes of root diameter size, we quantified root length by diameter class. Higher
root length for Las-inoculated seedlings than for non-inoculated controls was observed
for all root diameter classes for Cleopatra mandarin, Swingle citrumelo and X639. This
indicates that Las infection increased root length irrespective of diameter class and
rootstock. By comparison, P.n. with or without Las reduced length of all root diameter
classes for these rootstocks at 5 wpi, which confirms that P.n. damages all size roots
more rapidly and progressively than Las at this inoculum density (20 propagules/cm3).
Lower total root length of Las seedlings compared to P.n. seedlings of Cleopatra
mandarin at 11 wpi suggests that Las caused more root damage than P.n. by 11 wpi for
this rootstock. Greater total root length for Las-inoculated seedlings of X639 than for
P.n. inoculated seedlings by 11 wpi indicates slower development of root damage by
Las than by P.n. for this rootstock compared to Cleopatra mandarin.
New (white) root length of the three rootstocks seedlings was higher for Las-
infected roots and lower for P.n.-infected roots than for non-inoculated seedlings at 5
wpi. This finding further confirms that Las initially increased new root accumulation and
collapsed roots thereafter. Stimulation of root replacement by P.n. was not detected.
Sucrose was measured to evaluate the potential for Las to disrupt the phloem.
Fluctuation of sucrose levels between 5 and 11 wpi for Cleopatra mandarin, Swingle
93
citrumelo and X639 confirms that phloem was functional during the experimental period
in Las-infected seedlings. Lower sucrose content was detected in Cleopatra mandarin
and Swingle citrumelo seedlings inoculated with Las than in non-inoculated controls at 5
wpi when significantly greater root length was observed in Las-infected seedlings than
controls. This finding indicates that the bacterium interferes with sucrose metabolism of
these rootstocks either by consuming sucrose, stimulating sugar consumption for plant
defense, and/or increasing loss as root exudates.
Carbohydrate metabolism related gene expression in leaves, fruits, stems and
roots at advanced stage of disease development has been reported (Albrecht and
Bowman, 2008; Aritua et al., 2013; Kim et al., 2009; Martinelli et al., 2012). A large
number of genes’ expression was significantly influenced in leaves by Las infection,
indicating sugar metabolism was altered by Las (Kim et al. 2009). Different hypotheses
for disease causation were proposed concerning starch accumulation (Kim et al., 2009;
Liao and Burns, 2012). Liao and Burns (2012) suggested that development of HLB
symptoms may directly result from the host response rather than as a consequence of
carbohydrate starvation, by comparing the gene expression of HLB infected fruit and
girdled fruit. Unfortunately, not much information on gene expression at early stage of
HLB in roots is available. In this study, Las altered carbohydrate allocation to roots as
sucrose content fluctuated over time. Investigation of sucrose synthesis and
transportation and starch metabolism in roots at an early stage of HLB is required to
understand Las-induced root replacement and the competition between Las, root and
canopy for photoassimilates.
94
To assess the influence of root damage on canopy development, total leaf area
and specific leaf area were measured. For Swingle citrumelo and X639, significantly
less total leaf area compared to non-inoculated seedlings was detected at 11 wpi. This
showed that canopy development was reduced by root damage caused by Las, P.n.,
and the combination of both pathogens. Interestingly, less total leaf area caused by Las,
P.n. and both was not detected for Cleopatra mandarin. SLA in Cleopatra mandarin
seedlings was increased by the different pathogen treatments at 8 wpi, but not by 11
wpi. This indicated that leaf morphology was altered by the interaction between
pathogens and roots but more study is needed to elucidate the mechanisms. The non-
significant reduction in SLA of Swingle citrumelo and X639 suggest that more time may
be needed to detect changes in leaf traits after root damage.
Similar interaction between Las and P.n. as found in Chapter 2 confirmed that
P.n. causes root damage faster than Las, and that each pathogen reduces root length
but no more reduction occurs after inoculation with both pathogens. Based on these
findings, it is crucial to maintain root function for nutrient and water uptake and minimize
stress from pathogen interactions and bicarbonates in soil (Graham et al., 2014). If
damaging populations of Phytophthora are detected in groves, fungicide application
may be considered to reduce P.n. infection. However, since the root damage is also
caused by Las directly, reducing P.n. infection with fungicides may provide only
marginal benefit for maintaining fibrous root health.
95
Figure 3-1. Total root length of A) Cleopatra mandarin, B) Swingle citrumelo and C)
X639 seedlings at 5, 8 and 11 weeks post inoculation (wpi). Treatments: inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Different letters denote significant difference at P≤0.05. * Denotes significant interaction at P≤0.05. Bars represent the means of 5-8 replicates.
96
Figure 3-2. Root length by diameter size class of Cleopatra mandarin at A) 5, B) 8 and
C) 11 weeks post inoculation (wpi). Treatments: inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Bars represent standard error of the mean of 5-9 replicates.
97
Figure 3-3. Root length by diameter size class of Swingle citrumelo at A) 5, B) 8 and C)
11 weeks post inoculation (wpi). Treatments: inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Bars represent standard error of the mean of 5-9 replicates.
98
Figure 3-4. Root length by diameter size class of X639 at A) 5, B) 8 and C) 11 weeks
post inoculation (wpi). Treatments: inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Bars represent standard error the mean of 5-9 replicates.
99
Figure 3-5. New root length of A) Cleopatra mandarin, B) Swingle citrumelo and C)
X639 seedlings at 5, 8 and 11 weeks post inoculation (wpi). Treatments: inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Different letters denote significant difference at P≤0.05. * Denotes significant interaction at P≤0.05. Bars represent the means of 5-9 replicates.
100
Figure 3-6. Fibrous root sucrose of A) Cleopatra mandarin, B) Swingle citrumelo and C)
X639 seedlings at 5, 8 and 11 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Different letters denote significant difference at P≤0.05. * Denotes significant interaction at P≤0.05. Bars represent the means of 5-8 replicates.
101
Figure 3-7.Total leaf area of A) Cleopatra mandarin, B) Swingle citrumelo and C) X639
seedlings at 5, 8 and 11 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Different letters denote significant difference at P≤0.05. * Denotes significant interaction at P≤0.05. Bars represent the means of 5-8 replicates.
102
Figure 3-8. Specific leaf area of A) Cleopatra mandarin, B) Swingle citrumelo and C)
X639 seedlings at 5, 8 and 11 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Different letters denote significant difference at P≤0.05. Bars represent the means of 5-8 replicates.
103
CHAPTER 4 EXPRESSION OF SUCROSE METABOLISM GENES IN FIBROUS ROOTS
INFECTED WITH CANDIDATUS LIBERIBACTER ASIATICUS AND PHYTOPHTHORA NICOTIANAE
4.1 Introduction
Plants must maintain carbon assimilation, storage and usage to adjust to
different developmental and environmental conditions (Smith and Stitt, 2007). The
relationship of carbon assimilate, storage and usage has been studied in terms of a
source (i. e. storage organs and source leaves) - sink (i. e. fruits, roots, shoots, new
leaves, wounds and so on). Over allocation of carbon to one sink organ can reduce
other sink organ’s growth (Eissenstat, 2000; Goren et al., 2010). Sink strength is
believed to be the main factor that regulates carbon distribution within the plant (Kühn et
al., 1999). Carbon distribution involves phloem loading, sap movement and phloem
unloading (Koch, 2004). Citrus, like most other higher plants, uses sucrose as the main
sugar form for carbon transport due to sucrose’s stability and the few enzymes for
degradation (Sauer, 2007; Zimmermann and Ziegler, 1975). Therefore, sucrose
metabolism in sink organs is central to understanding carbohydrate transport and
utilization processes. Sucrose can exit from sieve element-companion cell complex to
nearby sink cells (phloem unloading) through symplastic (through plasmodesmata) and
apoplastic pathways (through cell wall space). Many genes and enzymes are involved
in this process (Koch, 2004; Sturm and Tang, 1999). In sink cells with intact
plasmodesmata, symplastic flow is predominant (Koch, 2004). Through the cell wall
space, sucrose may be transported into cytoplasm by sucrose transporters or cleaved
by invertase to hexoses and then exported by hexose transporters (Sturm and Tang,
1999). Furthermore, sucrose cleavage by invertase (catalyzes the reaction:
104
sucrose+H2O→fructose+ glucose) and sucrose synthase ( catalyzes the reverse
reaction: sucrose +H2O↔fructose+UDP-glucose) play pivotal roles in carbon
partitioning rate and plant growth as different sugar concentration creates an osmotic
pressure that further creates turgor pressure to drive phloem flow (Koch, 2004; Sturm
and Tang, 1999). Cleavage of sucrose by invertase (vacuole, cytoplasm and cell wall
invertase) is reported to be correlated with sink strength, growth and cell expansion as
two fold more hexoses are produced than are produced by sucrose synthase with the
product as glucose rather than UDP-glucose (Koch, 2004). Cleavage of sucrose by
sucrose synthase is more related with tissue maturation as one of its products, UDP-
glucose, is the precursor of starch and callose (Koch, 2004). Sucrose cleavage is not
only important in carbon partitioning, but also is vital in sugar sensing systems, which
alter plant development and stress acclimation (Koch, 2004; Sturm and Tang, 1999).
Pathogen infection is one such stress factor. Sucrose concentration is balanced by
sucrose cleavage and synthesis. Sucrose-phosphate-synthase which catalyzes the
reaction of UDP-glucose + Fru-6-P↔sucrose-6’-P + UDP + H+, is thought to mediate
plant growth, sugar storage and transport of carbon to other sink cells (Huber and
Huber, 1996).
Huanglongbing (HLB) (Jagoueix et al., 1994; Teixeira et al., 2005), is the most
devastating disease of citrus worldwide (Bové, 2006). Typical symptoms of HLB are
blotchy mottle on leaves, small leaves, yellow shoots, and reduced root density
(Johnson et al., 2014). Fibrous root loss has been considered a consequence of phloem
blockage and reduced carbohydrate allocation from leaves to roots (Etxeberria et al.,
2009). Johnson et al. (2014) recently discovered that root decline occurs before phloem
105
blockage and starch loss (Johnson et al., 2014). Since no toxins or specialized
secretion systems have been found in the Las genome, pathogen interruption of host
metabolic pathways is believed to cause HLB symptoms (Duan et al., 2009). So far, it
has been reported that carbohydrate metabolism genes are largely altered in leaves
and fruit of Las-infected trees (Albrecht and Bowman, 2008; Aritua et al., 2013; Fan et
al., 2010; Liao and Burns, 2012; Rosales and Burns, 2011). However, an extensive
analysis of carbohydrate status and related gene expression in roots at the early stage
of Las infection is still lacking. In Chapter 3, we found that root growth is stimulated by
Las and the sucrose content of Cleopatra mandarin and Swingle citrumelo fibrous roots
is differentialy alterd. The limitation on canopy development after root growth is
disrupted suggests that carbon partitioning is altered by Las before or at the same time
as phloem blockage occurs in the shoot, which is believed to cause the drop in root
sugar content.
Phytophthora nicotianae (P. n.) incites root rot which reduces water and nutrient
uptake and depletes carbohydrate reserves in citrus fibrous roots (Graham, 1995;
Graham and Feichtenberger, 2015). In Chapter 2, we found the higher root exudation of
sucrose in Las positive seedlings.To better understand the plant response to P.n. and
Las infection, the role of sucrose and gene expression of key enzymes involved in
sucrose metabolism at the early stage of disease development is useful to evaluate.
Albrecht et al. (2012) reported that Cleopatra mandarin is more susceptible to
Las compared to trifoliate hybrid rootstocks. Likewise, Cleopatra mandarin and Swingle
citrumelo are considered as susceptible and tolerant to Phytophthora nicotianae,
respectively, based on the rate of root replacement to maintain tree health (Graham,
106
1995). The objective of this study was to investigate sucrose metabolism related gene
expression in roots to Las, P.n. and the combination of both pathogens to explore
disease development from the perspective of root carbohydrate metabolism. The
response of Cleopatra mandarin and Swingle citrumelo will be compared by evaluating
fibrous root sucrose and glucose, and gene expression of acid invertase (βFruct1 and
βFruct2), netural/alkaline invertase (CitCNV1), sucrose transporter (SUST1), sucrose
synthase (CitSUSA, CirSUS1) and sucrose-phosphate-synthase (SPS).
4.2 Materials and Methods
4.2.1 Plant Materials
Seeds of Cleopatra mandarin (C. reticulata) were sown in Metro Mix 500
(Hummert international, MO, USA) in 120 cm3 containers in the greenhouse. Seedlings
were fertilized with Jack’s Pro 20-20-20 (A.M. Leonard, Inc., OH, USA) and Harrell’s 18-
5-10 (Harrell’s, FL, USA) every other week and every 6 mo, respectively, and watered 3
times per week. Twenty 6-mo-old seedlings were graft inoculated with budwood from
Las-infected trees. The budwood was from greenhouse grown ‘Madam Vinous’ sweet
orange (Citrus sinensis) trees infected with Las isolate FC6 as previously described
(Folimonova et al., 2009). Six months after inoculation (May 13, 2014), 10 Las-infected
Cleopatra mandarin seedlings (PCR confirmed) and 10 non-inoculated seedlings were
selected for uniform size, and transferred into autoclaved Candler fine sand in 120 cm3
containers for four treatments P.n. +/- and Las+/- (10 replicates for each treatment).
This protocol was repeated for Swingle citrumelo (August 12, 2014).
4.2.2. Phytophthora nicotianae – Candidatus Liberibacter asiaticus Interaction
P. nicotianae (P.n. 198) isolated from declining Cleopatra mandarin in the
greenhouse in 1999 was maintained on clarified V8 juice agar. Chlamydospores were
107
produced by the method of Tsao (1971) for inoculum. Chlamydospores were blended,
added to Candler fine sand and mixed manually for inoculum preparation. Soil inoculum
was diluted 1:10 in water agar, incubated at room temperature in the dark for 2 days on
pimaricin-ampicillin-rifampcin-pentachloronitrobenzene-hymexazol (PARPH) semi-
selective agar medium for assay of propagule density. An inoculum density of 20
propagules/cm3 of soil (threshold of density that causes root damage) was obtained by
mixing the inoculum concentrate with autoclaved Candler fine sand. Seedling roots
were pruned to a uniform length (8cm) to induce root growth. 5 Las-infected and 5 non-
inoculated seedlings were transplanted into soil infested with P.n. and 5 Las-infected
and 5 non-infected seedlings were transplanted into autoclaved soil. Seedlings infected
and non-infected with P.n. were located on different benches in greenhouse (27oC-
32oC), watered 3 times a week and fertilized with Jack’s Pro 20-20-20 every other week.
At 5 weeks post inoculation (wpi) with P.n., seedling roots were thoroughly
watered and harvested 24 h after irrigation. During harvest, roots were washed and 20
fibrous root tips were randomly selected from P.n. infected/non infected seedlings and
plated on PARPH medium. Plated root tips were incubated in dark for 3-4 d, and the
number of P.n. positive tips of P.n. infected seedlings was recorded and contamination
was checked for non-inoculated seedlings. Meanwhile, 0.1 gram of new white roots (for
Las-inoculated seedlings, Las was confirmed in roots by PCR) were sampled and put
into liquid nitrogen immediately. These roots were stored at -80oC for RNA extraction.
4.2.3. Candidatus Liberibacter asiaticus Detection
DNA extraction. To detect Las in roots, randomly selected fibrous root were
chopped into cubic segments, placed in 2 mL screw cap tubes with one 5-mm stainless
steel bead (Qiagen, Valencia, CA, USA). The tubes were stored at -80°C for at least 2 h
108
and after removal from the freezer immediately ground twice at 30 revolutions per sec in
a Tissuelyzer II (Qiagen, Valencia, CA, USA). Ground root tissue was then processed
for DNA extraction using the Mo Bio PowerSoil DNA Isolation kit (Mo. Bio. Laboratories)
as previously described (Johnson et al., 2014). The first step of protocol was modified
as initial buffer, garnet and solution C1 was added into 2 ml screw cap tubes which
were used for grinding and then vortexed for 5 sec instead of 10 min (Johnson et al.,
2014). Purified DNA was stored at -20°C for later analysis.
qPCR for Las detection. qPCR was carried out using primers and probes as
previously described (Wang et al., 2006). qPCR reaction was run on 7500 Fast Real-
Time PCR System (Applied Biosystems, Foster City, CA, USA.). The master mix
included Qiagen HotStar Taq, ROX passive reference dye (Bio-Rad), primers, probe
and buffer in a concentration ratio as described by the manufacturer’s protocol. 4 μL of
template DNA and 16 μL master mix were loaded into each well of a 96 micro-well
plate, and each sample was replicated. Samples were run in triplicate if significant
variation was found between 2 replicates in the initial assay. The standard curve
included concentrations of Las plasmids from 1×101 to 1×106 copies.
4.2.4 Quantification of Sucrose and Glucose in Fibrous Roots Tissue
A 25 mg subsample of dried new fibrous root was randomly selected for sucrose
analysis, and processed by a modified method previously described (Rosales & Burns,
2011). Fibrous roots were cut and ground in 2 ml tubes as described above for DNA
extraction. A 900 μl aliquot of DI water was mixed with the root powder. The solution of
ground roots or standard was vortexed and boiled for 10 min. Samples were centrifuged
for 2 min at 2500 x G. A 300 μl aliquot of supernatant was stored at -20°C for sucrose
assay. A 4μl aliquot of supernatant from each sample was processed according to the
109
manufacturer’s protocol for the Glucose and Sucrose Colorimetric/Fluormetric Assay
(Sigma-Aldrich). Sucrose and glucose concentration in fibrous roots was tested with the
same kit.
4.2.5 RNA Extraction and qRT-PCR
RNA was extracted from frozen roots of Cleopatra and Swingle citrumelo. The
frozen root tissue was ground as described above for DNA extraction, and RNA was
extracted using RNeasy Mini Kit (Qiagen, GmbH, Hilden, Germany) according to the
manufacturer’s instructions. The RNA concentration was obtained using a NanoDrop
ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA.). 1 µg of
total RNA was used for cDNA synthesis using QuantiTect Reverse Transcription Kit
(Qiagen, Valencia, CA, USA). qRT-PCR amplification was performed on 7500 Fast
Real-Time PCR System (Applied Biosystems, Foster City, CA, USA.) using QuantiTech
SYBR Green PCR Kit (Qiagen, Valencia, CA, USA) in 20-μl reactions according to the
manufacturer’s instruction. The reaction mix included 10 µl of 2x QuantiTech SYBR
Green PCR Master Mix, 2 µl of forward primer (0.5 µM), 2 µl of reverse primer (0.5 µM),
5 µl of RNase-free water and 1 µl of diluted cDNA (1:10) template.18S and GAPDH
were tested and used as the reference genes. Each sample was replicated and was run
in triplicate if significant variation was found between 2 replicates in the initial assay.
Sequences of the primer sets are listed in Table 4-1. The primer amplification efficiency
was tested and relative gene expression was calculated by 2-ΔΔCT method (Livak and
Schmittgen, 2001; Katz et al., 2011; Nebauer et al., 2010).
4.2.6 Statistical Analysis
Fibrous root sucrose and glucose content were analyzed by one-way ANOVA
using PROC GLM (SAS v. 9.4). The interaction between Las and P.n. was analyzed by
110
two-way ANOVA using PROC GLM (SAS v. 9.4). The significance level was set at
P≤0.05.
4.3 Results
4.3.1 Fibrous Root Glucose Content
Cleopatra mandarin rootstock. A significant interaction between Las and P.n. for
fibrous root glucose was detected (P≤ 0.05). The glucose content of new roots of non-
inoculated, Las-infected, P.n.-inoculated and co-inoculated Cleopatra mandarin
seedlings was 4.15, 0.63, 0.92 and 2.52 mg/g, respectively (Figure 4-1). For Las-
infected seedlings, glucose content was 85% lower (P≤ 0.05) than non-inoculated
seedlings. For P.n.-inoculated seedlings, glucose content was 78% lower (P≤ 0.05) than
non-inoculated seedlings. For seedlings inoculated with both Las and P.n., there was no
significant difference in glucose content compared to non-inoculated, Las-infected and
P.n.-inoculated seedlings.
Swingle citrumelo rootstock. The glucose content of new roots of non-inoculated,
Las-infected, P.n.-inoculated and co-inoculated Swingle citrumelo seedlings was 3.19,
8.42, 2.22 and 4.3 mg/g respectively (Figure 4-1). For Las-infected seedlings, glucose
content was 62% (P≤ 0.05), 76% (P≤ 0.05) and 49% (P≤ 0.05) higher than non-
inoculated, P.n.-inoculated and co-inoculated seedlings respectively.
4.3.2 Fibrous Root Sucrose Content
Cleopatra mandarin rootstock. A significant interaction between Las and P.n. for
fibrous root sucrose was detected (P≤ 0.05). The sucrose content of new roots of non-
inoculated, Las-infected, P.n.-inoculated and co-inoculated Cleopatra mandarin
seedlings was 18.1, 3.6, 7.3 and 13.9 mg/g respectively (Figure 4-2). For Las-infected
seedlings, sucrose content was 80% lower (P≤ 0.05) than non-inoculated seedlings. For
111
P.n.-inoculated seedlings, sucrose content was 60% lower (P≤ 0.05) than non-
inoculated seedlings. For seedlings inoculated with both Las and P.n., sucrose content
was 23% lower (not significant) than non-inoculated seedlings, but 74% and 45% (P≤
0.05) higher than Las-infected and P.n.-inoculated seedlings, respectively.
Swingle citrumelo rootstock. The sucrose content of new roots of non-inoculated,
Las-infected, P.n.-inoculated and co-inoculated Swingle citrumelo seedlings was 19.7,
26.5, 19.4 and 23.5 mg/g, respectively (Figure 4-2). There is no significant defference in
fibrous root sucrose between different treatments.
4.3.3 Relative Gene Expression of Sucrose Transporter 1 (SUT1)
Cleopatra mandarin rootstock. A significant interaction between Las and P.n. for
expression of SUT1 gene was detected (P≤ 0.05). The expression of SUT1, which is
involved in the apoplastic sucrose transport pathway was significantly changed in roots
of Las-infected, P.n.-inoculated and co-inoculated Cleopatra mandarin seedlings
compared to non-inoculated seedlings (P≤ 0.05) (Figure 4-3). The transcription of SUT1
was increased 6 fold by Las, 10 fold by P.n. and 4 fold by the combination of Las and
P.n. There were no significant differences for transcription of SUT1 in Cleopatra
mandarin roots with different pathogen treatments.
Swingle citrumelo rootstock. A significant interaction between Las and P.n. for
expression of SUT1 gene was detected (P≤ 0.05). The expression of SUT1 was only
significantly (P≤ 0.05) changed in roots of Las-infected seedlings compared to non-
inoculated seedlings (Figure 4-3). The transcription of SUT1 was increased 7 fold by
Las. A greater differential SUT1 expression in fibrous roots between Cleopatra
mandarin and Swingle citrumelo seedlings was caused by P.n.
112
4.3.4 Relative Gene Expression of Acid Invertase- βFruct1
Cleopatra mandarin rootstock. The expression of βFruct1, which is involved in
sucrose cleavage pathway in the vacuole, was significantly (P≤0.05) changed in roots of
Las-infected seedlings with and without P.n. compared to non-inoculated Cleopatra
mandarin seedlings (Figure 4-4). The transcription of βFruct1 was increased 18.5 fold
by Las, and 18.1 fold by the combination of Las and P.n.
Swingle citrumelo rootstock. A significant interaction between Las and P.n. for
expression of βFruct1 gene was detected (P≤ 0.05). The expression of βFruct1 was
only significantly (P≤0.05) changed in roots of Las-infected seedlings compared to non-
inoculated Swingle citrumelo seedlings (Figure 4-4). The transcription of βFruct1 was
increased 4.1 fold by Las (much less than 18 fold in Cleopatra mandarin). The
transcription of βFruct1 was repressed 9.6 fold by the combination of Las and P.n.
4.3.5 Relative Gene Expression of Acid Invertase-βFruct2
Cleopatra mandarin rootstock. A significant interaction between Las and P.n. for
expression of βFruct2 gene was detected (P≤ 0.05). The expression of βFruct2, another
isoform of vacuolar invertase, which is involved in sucrose cleavage pathway, was
significantly (P≤0.05) changed in roots of Las-infected and P.n.-inoculated Cleopatra
mandarin seedlings compared to non-inoculated seedlings (Figure 4-5). The
transcription of βFruct2 was increased 14.6 fold by Las, and 33.9 fold by P.n. There
were no significant differences for expression of βFruct2 between seedlings with
different pathogen treatments.
Swingle citrumelo rootstock. There was no significant change of βFruct2
expression among the different pathogen treatments. A marked difference for βFruct2
expression in fibrous roots between Cleopatra mandarin and Swingle citrumelo
113
seedlings was detected in all inoculated seedlings compared to non-inoculated
seedlings. Both Las and P.n. significantly (P≤ 0.05) increased expression of βFruct2 in
Cleopatra mandarin seedlings. Neither Las nor P.n. infection significantly altered
βFruct2 expression in fibrous roots of Swingle citrumelo seedlings, though expression
was slightly repressed.
4.3.6 Relative Gene Expression of Neutral/alkaline Invertase-CitCNV1
Cleopatra mandarin rootstock. A significant interaction between Las and P.n. for
expression of CitCNV1 gene was detected (P≤ 0.05). The expression of CitCNV1, which
is involved in sucrose cleavage pathway in cytoplasm, was significantly (P≤ 0.05)
changed in roots of Las-infected, P.n.-inoculated and co-inoculated Cleopatra mandarin
seedlings compared to non-inoculated seedlings (Figure 4-6). The transcription of
CitCNV1 was increased 5.5 fold by Las, 4.5 fold by P.n. and 5.6 fold by the combination
of Las and P.n. There was no significant difference in expression of CitCNV1 for
Cleopatra mandarin seedlings inoculated with the different pathogens.
Swingle citrumelo rootstock. None of the pathogen treatments significantly
changed the expression of CitCNV1 in Swingle citrumelo (Figure 4-6).
4.3.7 Relative Gene Expression of Sucrose Synthase- CitSUSA
Cleopatra mandarin rootstock. The expression of CitSUSA, which is involved in
the sucrose cleavage pathway in cytoplasm, was significantly (P≤0.05) changed in roots
of P.n.-inoculated Cleopatra mandarin seedlings with and without Las infection,
compared to non-inoculated seedlings (Figure 4-7). The expression of CitSUSA was
increased 4.8 fold by P.n. and 7.9 fold by the combination of Las and P.n. There was no
significant difference for transcription of CitSUSA for Cleopatra mandarin seedlings
inoculated with the different pathogens.
114
Swingle citrumelo rootstock. None of the pathogen treatments significantly
altered the expression of CitCNV1 in Swingle citrumelo seedlings (Figure 4-7).
4.3.8 Relative Gene Expression of Sucrose Synthase- CitSUS1
Cleopatra mandarin rootstock. The expression of CitSUS1, which is involved in
sucrose cleavage in cytoplasm, was significantly (P≤ 0.05) changed in roots of Las-
infected Cleopatra mandarin seedlings with and without P.n. inoculation, compared to
non-inoculated seedlings (Figure 4-8). The expression of CitSUS1 was increased 2.8
fold by Las, and 3 fold by the combination of Las and P.n. There was no significant
difference for transcription of CitSUS1 in Cleopatra mandarin seedlings inoculated with
the different pathogen treatments.
Swingle citrumelo rootstock. The expression of CitSUS1 was significantly (P≤
0.05) changed in P.n.-inoculated Swingle citrumelo seedlings with and without Las
infection, compared to non-inoculated seedlings (Figure 4-8). Las repressed CitSUS1
expression in Swingle citrumelo roots (P≤ 0.05). The different impact of Las on CitSUS1
expression between Cleopatra mandarin and Swingle citrumelo seedlings was that Las
increased CitSUS1 expression in fibrous roots of Cleopatra mandarin and reduced
CitSUS1 expression in fibrous roots of Swingle citrumelo.
4.3.9 Relative Gene Expression of Sucrose-phosphate-synthase (SPS)
Cleopatra mandarin rootstock. The expression of SPS, which is involved in
sucrose synthesis pathway in cytoplasm, was significantly (P≤ 0.05) changed in roots of
Las-infected Cleopatra mandarin seedlings with and without P.n. inoculation compared
to non-inoculated seedlings (Figure 4-9). The transcription of SPS was increased 2.2
fold by Las and 2.9 fold by the combination of Las and P.n. There was no significant
115
difference in transcription of SPS for Cleopatra mandarin seedlings inoculated with the
different pathogen treatments.
Swingle citrumelo rootstock. A significant interaction of Las and P.n. for
expression of SPS gene was detected. The expression of SPS was only significantly
(P≤ 0.05) changed in roots of Las-infected Swingle citrumelo seedlings compared to
non-inoculated seedlings (Figure 4-9). The transcription of SPS was increased 3.4 fold
by Las. There were no significant changes for SPS expression in Swingle citrumelo
seedlings inoculated with both pathogens compared to non-inoculated seedlings. The
differences in SPS expression in fibrous roots between Cleopatra mandarin and
Swingle citrumelo seedlings were due to infection by Las and P.n.
4.4 Discussion
Lower sucrose and glucose was found in Las, P.n. and Las and P.n. co-
inoculated fibrous roots of Cleopatra mandarin seedlings compared to non-inoculated
seedlings. Reduced sucrose and glucose could result from lower carbohydrate
availability in roots caused by partially blocked phloem in the shoot or higher
carbohydrate consumption by roots and pathogen infection, or both. Combined with the
results from Chapter 3 that root replacement was increased by Las, it is likely that more
sucrose is allocated to roots due to higher carbohydrate consumption in Las-infected
Cleopatra mandarin fibrous roots. For P.n.-infected Cleopatra mandarin seedlings,
higher sugar consumption is also an explanation for low sucrose and glucose content in
fibrous roots. Higher sucrose and glucose was found in Las-infected fibrous roots of
Swingle citrumelo seedlings with and without P.n. infection, which indicates that Las
induced more sugar allocation to roots than P.n. Furthermore, the significantly higher
glucose in Las-infected Swingle citrumelo seedlings compared to non-infected seedlings
116
suggests that Las induces higher sucrose cleavage. The comparison of sugar content in
fibrous root between Cleopatra mandarin and Swingle citrumelo seedlings indicates that
sucrose metabolism was more disrupted by Las and P.n. in Cleopatra mandarin than
Swingle citrumelo at 5 wk after inoculation.
As discussed above, sucrose partitioning within the plant is probably altered by
both pathogens in roots. The sucrose import into roots occurs through symplasmic and
apoplastic pathways. Plasmodesmatal movement is the predominant pathway for
sucrose in roots, whereas in the zone of root that plasmodesmata does not develop, the
apoplasmic transfer of sucrose is the pathway (Achor, 1999; Eissenstat and Koch,
2004). Sucrose import into roots requires several isoforms of transporters, invertase,
sucrose synthase and sucrose-phosphate-synthase that are localized in different
subcellular compartments. Sucrose transporter 1 (SUT1) in sieve tubes of potato,
tomato and tobacco (Kühn et al., 1997) maybe involved in the unloading of sucrose in
sinks including actively growing roots. In this study, SUT1 expression was significantly
up-regulated by Las infection in Cleopatra mandarin and Swingle citrumelo fibrous
roots, which indicates there is greater unloading of sucrose from the phloem. Once
sucrose is imported into sink cells, (through plasmodesmata, cell wall space or both),
with the low activity of cytoplasmic invertase, sucrose is usually transported into
vacuoles to be cleaved and the hexose transported back into cytoplasm for subsequent
cytoplasmic metabolism (Koch, 2004; Winter and Huber, 2000). Vacuolar invertases
generate abundant hexoses and hexose-based sugar signals (Herbers and Sonnewald,
1998; Sturm and Tang, 1999), and this process mediates sucrose partitioning (osmotic
and turgor pressure) and signaling. In this study, gene expression of two isoforms of
117
vacuolar invertase, βFruct1 and βFruct2, were 18 and 15 fold up- regulated by Las in
Cleopatra mandarin fibrous roots, respectively. These results are consistent with the
reduced sucrose content in fibrous roots of Las-infected Cleopatra mandarin seedlings.
Elevated expression of vacuolar invertase is an indication of greater sucrose allocation
to roots and greater sucrose consumption for growth and defense against Las infection,
and benefits the bacterium at the same time. For P.n.-infected Cleopatra mandarin
seedlings, only βFruct2 (34 fold) was significantly up-regulated, indicating that Las and
P.n. infection induce different isoforms of vacuolar invertase. In contrast, not much
change of expression of vacuolar invertase was detected in Swingle citrumelo, except
for the 4 fold up-regulation of βFruct1 expression in fibrous roots of Las-infected
seedlings. This suggests that for Swingle citrumelo, sucrose metabolism and
transportation was less disrupted by Las than for Cleopatra mandarin. Likewise,
compared with 34 fold increased expression for Cleopatra mandarin, βFruct2 in Swingle
citrumelo was slightly repressed by P.n. infection. Higher and lower upregulation of
cytoplasmic invertase (CitCNV1) was detected in pathogen-infected Cleopatra mandarin
and Swingle citrumelo seedling roots, respectively.
Different contributions of sucrose cleaving enzymes to sequential stages of sink
development: initiation, expansion, and storage/maturation have been extensively
examined (Koch, 2004; Sturm and Tang, 1999). Unlike invertase producing large
amounts of hexose, which upregulates genes for early developmental, sucrose
synthase is more important in the tissue maturation stage by directing UPD-glucose to
starch accumulation (Sturm and Tang, 1999). In this study, the different expression of
two isoforms of sucrose synthase was detected between Las and P.n.-infected
118
Cleopatra mandarin. Komatsu et al. (2002) reported different structure and physiological
roles for CitSUS1 and CitSUSA in citrus fruit. In this study, we detected altered
expression patterns of these two isoforms by Las in both rootstocks, which confirmed
their different functions in sucrose metabolism pathways. Sucrose synthase in sink
cells was not only found to mediate callose and starch and many other biosynthesis
pathways to maintain a steep sucrose gradient across the plasma membrane
cytoplasm, but also in sieve tubes to regulate phloem development (Winter and Huber,
2000). The lower response of sucrose synthase related gene expression compared to
other gene expression in Las and P.n. infected fibrous roots of Cleopatra mandarin
indicates less disruption of maturation and phloem development by Las and P.n. at 5 wk
after inoculation. Finally, sucrose-phosphate-synthase (SPS) was upregulated by Las
and P.n. in both Cleopatra mandarin and Swingle citrumelo fibrous roots. Additional
sucrose production might be used for transport to nearby sink cells or account for the
greater exudation of sucrose into the rhizosphere reported in Chapter 2.
Although reduced sucrose content in roots could be a consequence
of dysfunctional sieve elements at the late stage of disease development, disruption of
sucrose transport and cellular sucrose metabolic regulation could also contribute to a
carbohydrate imbalance within the plant. Such disruption may account for reduced
canopy and fruit growth and leading to small fruit size in HLB-affected trees (Liao and
Burns, 2012).
In Chapter 2, we detected the different relationship between P.n. infection
incidence and total sugar content, with and without Las, which suggested that Las-
induced plant response to P.n. was mediated by sugar allocation and consumption in
119
roots. Two out of 7 genes (SUT1and βFruct2) showed lesser gene expression in co-
inoculated Cleopatra mandarin seedlings than Las or P.n.-infected seedlings. Three out
of 7 genes (βFruct1, CitCVN1 and CitSUS1) showed similar gene expression in co-
inoculated Cleopatra mandarin seedlings as Las-infected seedlings than P.n.-infected
seedlings. Two out of 7 genes (CitSUSA and SPS) showed greater gene expression in
co-infected Cleopatra mandarin seedlings than Las or P.n.-infected seedlings. The
different gene expression of SUT1, βFruct2, CitSUSA and SPS in roots of co-inoculated
Cleopatra mandarin seedings compared to P.n.and Las-infected seedlings is indicative
of a complex interaction between Las and P.n. at the molecular level.
Taken together, we detected significant expression changes induced by Las and
P.n. The much higher rate of sucrose cleavage related gene expression compared to
sucrose transporter and sucrose phosphate-synthase related gene expression is
consistent with the lower sucrose and glucose content detected in fibrous roots, and
indicates greater sucrose allocation for root growth than for canopy growth. Higher
sucrose cleavage through the invertase pathway rather than the sucrose synthase
pathway suggests that a hexose-based signal might be initiated in response to
pathogen infection and root replacement. Swingle citrumelo was not influenced by Las
and P.n. as severely as in Cleopatra mandarin at least at this time point (5wk). This
might explain the different performance of these two rootstocks under field conditions
with the two pathogens (i. e. Lower P.n. infection incidence for Swingle citrumelo than
Cleopatra mandarin reported in Chapter 2).
A more in-depth investigation with labeled carbon of carbohydrate allocation in
response to pathogen infection is needed to precisely measure carbon partitioning to
120
different sinks. The analysis could provide better understanding of the basis for the
interactions of Las and P.n. and different carbon utilization between plant and Las as
the bacteria are restricted in phloem. Investigation of integrated gene expression, the
allocation of post-transcription product and pathogen regulated gene function will help to
elucidate disease causation mechanism and the physiology of this pathogen.
121
Figure 4-1. Fibrous root glucose of Cleopatra mandarin and Swingle citrumelo
seedlings at 5 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Different letters denote significant difference at P≤0.05. * Denotes significant interaction at P≤0.05. Bars represent the means of 3-5 replicates.
Figure 4-2. Fibrous root sucrose of Cleopatra mandarin and Swingle citrumelo seedlings
at 5 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). Different letters denote significant difference at P≤0.05. * Denotes significant interaction at P≤0.05. Bars represent the means of 3-5 replicates.
122
Figure 4-3. Relative gene expression of Sucrose transporter 1 (SUT 1) of Cleopatra
mandarin and Swingle citrumelo fibrous roots at 5 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). * Denotes significant interaction at P≤0.05. Bars represent standard error of 3-5 replicates.
Figure 4-4. Relative gene expression of acid invertase-βFruct1 of Cleopatra mandarin
and Swingle citrumelo fibrous roots at 5 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). * Denotes significant interaction at P≤0.05. Bars represent standard error of 3-5 replicates.
123
Figure 4-5. Relative gene expression of acid invertase-βFruct2 of Cleopatra mandarin
and Swingle citrumelo fibrous roots at 5 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). * Denotes significant interaction at P≤0.05. Bars represent standard error of 3-5 replicates.
Figure 4-6. Relative gene expression of Neutral/alkiline invertase-CitCNV1 of Cleopatra
mandarin and Swingle citrumelo fibrous roots at 5 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). * Denotes significant interaction at P≤0.05. Bars represent standard error of 3-5 replicates.
124
Figure 4-7. Relative gene expression of sucrose synthase- CitSUSA of Cleopatra
mandarin and Swingle citrumelo fibrous roots at 5 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn+); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). * Denotes significant interaction at P≤0.05. Bars represent standard error of 3-5 replicates.
Figure 4-8. Relative gene expression of sucrose synthase- CitSUS1 of Cleopatra
mandarin and Swingle citrumelo fibrous roots at 5 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn+); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). * Denotes significant interaction at P≤0.05. Bars represent standard error of 3-5 replicates.
125
Figure 4-9. Relative gene expression of sucrose-phosphate-synthase (SPS) of
Cleopatra mandarin and Swingle citrumelo fibrous roots at 5 weeks post inoculation (wpi). Treatments: Inoculation with Candidatus Liberibacter asiaticus (Las) (Las+Pn-), inoculation with Phytophthora nicotianae (P.n.) (Las-Pn +); co-inoculation of Las and P.n. (Las+Pn+); non-inoculated (Las-Pn-). * Denotes significant interaction at P≤0.05. Bars represent standard error of 3-5 replicates.
126
Table 4-1. Primer sets used to amplify specific regions of Citrus genes involved in
sucrose metabolism (5’-3’)
Gene Forward Reverse
SUT1 TTGCGGAGGTGGCAACAT CACTTAAGGCAGCCGCAACT βFruct1 AGGAGAGTGTTGTGGGGTTG TTTTGTATCAAGCGCCACTG βFruct2 GACGGGTATTTCGCTTGTGT CATTCCCACATACCCGTACC CitCNV1 CTGGCAGAGACACCTGAGTG CATTGAGCATCCATCAGCAC CitSUSA TTGTGGACTTCCGACATTCG TGACGCACCATGCTCGATAA CitSUS1 TGAGCCATTCAATGCCTCGT TGGATGCATGCTCTCCTTGTC SPS GTTAAGGCTCAAGCGACGAG CCCTCAAGCTGCTTTTTCTG GAPDH GGAAGGTCAAGATCGGAATCAA CGTCCCTCTGCAAGATGACTCT 18S GTGACGGAGAATTAGGGTTCG CTGCCTTCCTTGGATGTGGTA
127
CHAPTER 5 SUMMARY
Whole-plant carbohydrate partitioning is balanced by sink strength which is
defined as the ability of the sink organ to compete for carbohydrate. A stronger sink can
be created by increased sucrose usage in a sink organ affected by mechanical damage,
environmental stress or pathogen infection. The premature fruit drop at the early stage
of HLB symptom expression for trees in Florida citrus groves indicates that unobserved
root damage is occurring belowground. As the hidden part of the tree, root damage is
usually overlooked until significant symptoms are observed above ground. Root
damage could contribute to the premature fruit drop of HLB symptom trees by disrupting
carbohydrate availability and limiting water and nutrient supply required for healthy fruit
growth and development.
To investigate the causal mechanism for premature fruit drop of HLB
symptomless trees from carbohydrate partitioning perspective, experiments were
carried out as follows: 1) examination of root damage caused by Las, the soil borne
pathogen Phytophthora and the interaction of the two root pathogens; 2) investigation of
the relationship between root damage and canopy reduction; 3) exploration of root
damage’s contribution to premature fruit drop from the perspective of disruption of
carbohydrate metabolism.
The results showed that roots of HLB symptomless seedlings were damaged by
Las and the interaction of the two pathogens. The combination of Las and P.n. showed
the trend to reduce the fibrous root biomass more than each root pathogen alone at
some (not significant) but not all time periods after inoculation. P.n. infection incidence
of Las-infected seedlings was increased as the zoospores were more attracted to root
128
surface and host tolerance was broken down by Las. Under optimal conditions for
pathogen development in field, the increased P.n. infection incidence might play an
even more important role than in the greenhouse by accelerating P.n. population
development to the damaging level.
The further examination of total leaf area and sucrose metabolism related gene
expression in roots confirmed why canopy development was reduced after root decline.
This occurred because more carbohydrate was imported into roots as a result of greater
sink strength created by up-regulation of sucrose cleavage. Higher sucrose
consumption in Cleopatra mandarin could have resulted from the plant’s utilization for
defense, the pathogens’ utilization for sustenance, or both host and pathogen factors.
Interestingly, we detected very different responses of the susceptible rootstock
Cleopatra mandarin and less susceptible Swingle citrumelo to pathogen infection.
Cleopatra mandarin showed a steeper slope of the linear regression between P.n.
infection incidence and sugar concentration for seedlings with and without Las
compared to Swingle citrumelo, which indicates that the pathogens are more responsive
to sugar concentration in roots for Cleopatra mandarin than for Swingle citrumelo. This
result is consistent with the finding that sucrose metabolism is more disrupted by Las
and P.n. in Cleopatra mandarin than in Swingle ctrumelo. This might explain the
different susceptibility to these pathogens of trees on these two rootstocks under field
conditions.
Although reduced sucrose content in Las-infected roots occurs as a
consequence of dysfunctional sieve elements at the later stage of disease development,
disruption of sucrose transport and cellular sucrose metabolic regulation could also
129
contribute to a carbohydrate imbalance within the plant. Such disruption may account
for reduced canopy and fruit growth and leading to small fruit size in HLB-affected trees.
Based on these results, grove managers should consider practices that: 1)
minimize root damage caused by the combination of Las and P.n. (e.g. use of soil
fungicides); 2) reduce disruption of sucrose metabolism in rootstocks and scions
through balanced use of water and fertilizers to promote regular cycles of root and shoot
flushes and sustain fruit growth and maturation; 3) provide optimal growing conditions to
maintain tree growth by minimizing the effects of abiotic (e.g., drought, freezes) and
biotic stress (root pests and pathogens).
130
APPENDIX A NEW ROOT LENGTH OF CLEOPATRA MANDARIN AT 6 MO POST INOCULATION
131
APPENDIX B FERTILIZER INGREDIENTS
Harrell’s 18-5-10 Ingredients
Percentage by weight
Nitrogen Nitrate Nitrogen 6.0500% Ammonical Nitrogen 7.4000% Urea Nitrogen 4.5500% Phosphate 5.0000% Potash 10.0000% Magnessium 1.1190% Sulfur 0.2770% Copper 0.0660% Iron 0.2750% Manganese 0.1120% Molybdenum 0.0090% Zinc 0.0660%
Jack’s Pro 20-20-20 Ingredients
Percentage by weight
Nitrogen Nitrate Nitrogen 3.8300% Ammonical Nitrogen 6.0700% Urea Nitrogen 10.1000% Phosphate(P2O5) 20.0000% Potash 20.0000% Magnessium 0.0500% Boron 0.0068% Copper 0.0036% Iron 0.0500% Manganese 0.0250% Molybdenum 0.0009% Zinc 0.0025%
132
LIST OF REFERENCES
Achor, D.S., Etxeberria, E., Wang, N., Folimonova, S.Y., Chung, K.R., Albrigo, L.G., 2010. Sequence of anatomical symptom observations in citrus affected with huanglongbing disease. Plant Pathol. J., 9(2), 56-64.
Adl, S.M., Simpson, A.G.B., Farmer, M.A., Andersen, R.A., Anderson, O.R., Barta, J.R., Bowser, S.S., Brugerolle, G.U.Y., Fensome, R.A., Fredericq, S., 2005. The new higher level classification of eukaryotes with emphasis on the taxonomy of protists. J. Eukaryot. Microbiol. 52, 399–451.
Albrecht, U., Bowman, K.D., 2012a. Tolerance of trifoliate citrus rootstock hybrids to Candidatus Liberibacter asiaticus. Sci. Hortic. (Amsterdam). 147, 71–80.
Albrecht, U., Bowman, K.D., 2012b. Transcriptional response of susceptible and tolerant citrus to infection with Candidatus Liberibacter asiaticus. Plant Sci. 185, 118–130.
Albrecht, U., Bowman, K.D., 2009. Candidatus Liberibacter asiaticus and Huanglongbing effects on citrus seeds and seedlings. Hort. Science. 44, 1967–1973.
Albrecht, U., Bowman, K.D., 2008. Gene expression in Citrus sinensis (L.) Osbeck following infection with the bacterial pathogen Candidatus Liberibacter asiaticus causing Huanglongbing in Florida. Plant Sci. 175, 291–306.
Albrecht, U., McCollum, G., Bowman, K.D., 2012. Influence of rootstock variety on Huanglongbing disease development in field-grown sweet orange (Citrus sinensis [L.] Osbeck) trees. Sci. Hortic. (Amsterdam). 138, 210–220.
Ammar, E., Shatters, R.G., Hall, D.G., 2011. Localization of Candidatus Liberibacter asiaticus, associated with citrus huanglongbing disease, in its psyllid vector using fluorescence in situ hybridization. J. Phytopathol. 159, 726–734.
Angay, O., Fleischmann, F., Recht, S., Herrmann, S., Matyssek, R., Oßwald, W., Buscot, F., Grams, T.E.E., 2014. Sweets for the foe–effects of nonstructural carbohydrates on the susceptibility of Quercus robur against Phytophthora quercina. New Phytol. 203, 1282–1290.
Ann, P.J., Ko, W.H., Su, H.J., 2004. Interaction between Likubin bacterium and Phytophthora parasitica in citrus hosts. Eur. J. Plant Pathol. 110, 1–6.
Aritua, V., Achor, D., Gmitter, F.G., Albrigo, G., Wang, N., 2013. Transcriptional and microscopic analyses of citrus stem and root responses to Candidatus Liberibacter asiaticus infection. PLoS One. 8. doi: 10.1371/journal.pone.0073742. [doi]
133
Asana, R.D., 1958. The citrus dieback problem in relation to cultivation of citrus fruits in India. Indian J. Hortic. 15, 283–286.
Ashby, S.F., 1928. The oospores of Phytophthora nicotianae Br. de Haan, with notes on the taxonomy of P. parasitica Dastur. Trans. Br. Mycol. Soc. 13, 86–95.
Attard, A., Gourgues, M., Callemeyn‐Torre, N., Keller, H., 2010. The immediate activation of defense responses in Arabidopsis roots is not sufficient to prevent Phytophthora parasitica infection. New Phytol. 187, 449–460.
Aubert, B., 1990. Integrated activities for the control of huanglongbing-greening and its vector Diaphorina citri Kuwayama in Asia, in: Proc. of the Fourth FAO-UNDP International Asia Pacific Conference on Citrus Rehabilitation. Chiang Mai, Thailand, ed. B Aubert, S Tontyaporn, D Buangsuwon, pp. 133–144.
Aubert, B., Quilici, S., 1984. Biological control of the African and Asian citrus psyllids (Homoptera: Psylloidea), through eulophid and encyrtid parasites (Hymenoptera: Chalcidoidea) in Reunion Island, in: Proc. 9th Conference of the International Organization of Citrus Virologists. University of California, Riverside, CA. pp. 100–108.
Bais, H.P., Weir, T.L., Perry, L.G., Gilroy, S., Vivanco, J.M., 2006. The role of root exudates in rhizosphere interactions with plants and other organisms. Annu. Biol. 57, 233–266.
Bassanezi, R.B., Montesino, L.H., Gasparoto, M.C.G., Bergamin Filho, A., Amorim, L., 2011. Yield loss caused by huanglongbing in different sweet orange cultivars in São Paulo, Brazil. Eur. J. Plant Pathol. 130, 577–586.
Bassanezi, R.B., Montesino, L.H., Stuchi, E.S., 2009. Effects of huanglongbing on fruit quality of sweet orange cultivars in Brazil. Eur. J. Plant Pathol. 125, 565–572.
Bawage, S., Nerkar, S., Kumar, A., Das, A., 2013. Morphological and molecular description of Phytophthora insolita isolated from citrus orchard in India. J. Mycol. 2013.
Belasque Jr, J., Bassanezi, R.B., Yamamoto, P.T., Ayres, A.J., Tachibana, A., Violante, A.R., Tank Jr, A., Di Giorgi, F., Tersi, F.E.A., Menezes, G.M., 2010. Lessons from huanglongbing management in São Paulo state, Brazil. J. Plant Pathol. 285–302.
Bertaccini, A., Duduk, B., 2010. Phytoplasma and phytoplasma diseases: a review of recent research. Phytopathol. Mediterr. 48, 355–378.
Bevington, K.B., Castle, W.S., 1985. Annual root growth pattern of young citrus trees in relation to shoot growth, soil temperature, and soil water content. J. Am. Soc. Hortic. Sc. 110(6), 840-845.
134
Bircher, U., Hohl, H.R., 1997. Environmental signalling during induction of appressorium formation in Phytophthora. Mycol. Res. 101, 395–402.
Boina, D.R., Meyer, W.L., Onagbola, E.O., Stelinski, L.L., 2009. Quantifying dispersal of Diaphorina citri (Hemiptera: Psyllidae) by immunomarking and potential impact of unmanaged groves on commercial citrus management. Environ. Entomol. 38, 1250–1258.
Boina, D.R., Rogers, M.E., Wang, N., Stelinski, L.L., 2010. Effect of pyriproxyfen, a juvenile hormone mimic, on egg hatch, nymph development, adult emergence and reproduction of the Asian citrus psyllid, Diaphorina citri Kuwayama. Pest Manag. Sci. 66, 349–357.
Bonants, P.J.M., Hagenaar-de Weerdt, M., Man in’t Veld, W.A., Baayen, R.P., 2000. Molecular characterization of natural hybrids of Phytophthora nicotianae and P. cactorum. Phytopathology. 90, 867–874.
Bottin, A., Larche, L., Villalba, F., Gaulin, E., Esquerré-Tugayé, M.-T., Rickauer, M., 1999. Green fluorescent protein (GFP) as gene expression reporter and vital marker for studying development and microbe-plant interaction in the tobacco pathogen Phytophthora parasitica var. nicotianae. FEMS Microbiol. Lett. 176, 51–56.
Bové, J., 2014. Heat-tolerant Asian HLB meets heat-sensitive African HLB in the Arabian Peninsula! Why? J. Citrus Pathol. 1, 1.
Bové, J.M., 2006. Huanglongbing: a destructive, newly-emerging, century-old disease of citrus. J. Plant Pathol. 7–37.
Bové, J.M., Teixeira, D.C., Wulff, N.A., Eveillard, S., and Saillard, C., et al. Several Liberibacter and Phytoplasma Species are Individually Associated with HLB: towards a common denominator. In: Proc. Int. Res. Conf. Huanglongbing. pp. 152–155. http://www.plantmanagementnetwork.org/proceedings/irchlb/2008/
Bové, J.M., Erti Dwiastuti, M., Triviratno, A., Supriyanto, A., Nasli, E., Becu, P., Garnier, M., 2000. Incidence of huanglongbing and citrus rehabilitation in North Bali, Indonesia, in: Proc. 14th Conference of the International Organization of Citrus Virologists. JV Da Graca, RF Lee, and RK Yokomi, Eds. University of California. Riverside. pp. 378–380.
Bright, D.B., Graham, J.H., Irey, M.S., Baucum, L.E., 2004. Soil, rootstock and climatic factors affect populations of Phytophthora nicotianae in south Florida citrus plantings, in: Proc. of the Florida State Horticultural Society. pp. 148–151.
Bush, E.A., Stromberg, E.L., Hong, C.X., Richardson, P.A., Kong, P., 2006. Illustration of key morphological characteristics of Phytophthora species identified in Virginia nursery irrigation water. Plant Heal. Prog.doi 10, 1094.
135
Capoor, S.P., 1963. Decline of citrus in India. Bull. Natl. Inst. Sci. India. 24, 48–64.
Castle, W.S., 1980. Fibrous root distribution of ‘Pineapple’ orange trees on rough lemon rootstock at three tree spacings. J. Am. Soc. Hortic. Sci. 105, 478-480.
Chamberlain, H.L., Irey, M.S., 2008. Comparison of a starch-based field test for Huanglongbing to results from real-time PCR testing of field samples from symptomatic trees in Florida, in: Proc. of the International Research Conference on Huanglongbing (IRCHLB’08). pp.144. http://www.plantmanagementnetwork.org/proceedings/irchlb/2008/presentations/
Childers, C.C., Rogers, M.E., 2005. Chemical control and management approaches of the Asian citrus psyllid, Diaphorina citri Kuwayama (Homoptera: Psyllidae) in Florida citrus, in: Proc. of Florida State Horticultural Society. pp. 49–53.
Coffey, M.D., Wilson, U.E., 1983. An ultrastructural study of the late-blight fungus Phytophthora infestans and its interaction with the foliage of two potato cultivars possessing different levels of general (field) resistance. Can. J. Bot. 61, 2669–2685.
Cooke, D.E.L., Drenth, A., Duncan, J.M., Wagels, G., Brasier, C.M., 2000. A molecular phylogeny of Phytophthora and related oomycetes. Fungal Genet. Biol. 30, 17–32.
Cvitanich, C., Judelson, H.S., 2003. Stable transformation of the oomycete, Phytophthora infestans, using microprojectile bombardment. Curr. Genet. 42, 228–235.
Davis, R.M., Menge, J.A., 1981. Phytophthora parasitica inoculation and intensity of vesicular-arbuscular mycorrhizae in citrus. New Phytol. 87, 705–715.
Declercq, B., Devlamynck, J., De Vleesschauwer, D., Cap, N., De Nies, J., Pollet, S., Höfte, M., 2012. New insights in the life cycle and epidemics of Phytophthora porri on leek. J. Phytopathol. 160, 67–75.
Dick, M.W., 1997. Fungi, fagella and phylogeny. Mycol. Res. 101 (4), 389-394.
Duan, Y., Zhou, L., Hall, D.G., Li, W., Doddapaneni, H., Lin, H., Liu, L., Vahling, C.M., Gabriel, D.W., Williams, K.P., 2009. Complete genome sequence of citrus huanglongbing bacterium, ‘Candidatus Liberibacter asiaticus’ obtained through metagenomics. Mol. Plant-Microbe Interact. 22, 1011–1020.
Duncan, L.W., Graham, J.H., Timmer, L.W., 1993. Seasonal patterns associated with Tylenchulus semipenetrans and Phytophthora parasitica in the citrus rhizosphere. Phytopathology. 83, 573–581.
Eissenstat, D.M., Achor, D.S., 1999. Anatomical characteristics of roots of citrus rootstocks that vary in specific root length. New Phytol. 141, 309–321.
136
Eissenstat, D.M., Yanai, R.D., 1997. The ecology of root lifespan. Adv. Ecol. Res. 27, 60.
El Hadrami, A., El-Bebany, A.F., Yao, Z., Adam, L.R., El Hadrami, I., Daayf, F., 2012. Plants versus fungi and oomycetes: pathogenesis, defense and counter-defense in the proteomics era. Int. J. Mol. Sci. 13, 7237–7259.
Enkerli, K., Mims, C.W., Hahn, M.G., 1997. Ultrastructure of compatible and incompatible interactions of soybean roots infected with the plant pathogenic oomycete Phytophthora sojae. Can. J. Bot. 75, 1493–1508.
Erwin, D.C., Ribeiro, O.K., 1996. Phytophthora diseases worldwide, edit, St. Paul, MN, American Phytopathological Society (APS Press).
Espeleta, J.F., Eissenstat, D.M., 1998. Responses of citrus fine roots to localized soil drying: a comparison of seedlings with adult fruiting trees. Tree Physiol. 18, 113–119.
Evangelisti, E., Govetto, B., Minet‐Kebdani, N., Kuhn, M., Attard, A., Ponchet, M., Panabières, F., Gourgues, M., 2013. The Phytophthora parasitica RXLR effector
Penetration‐Specific Effector 1 favours Arabidopsis thaliana infection by interfering with auxin physiology. New Phytol. 199, 476–489.
Evans, J., Poorter, H., 2001. Photosynthetic acclimation of plants to growth irradiance: the relative importance of specific leaf area and nitrogen partitioning in maximizing carbon gain. Plant. Cell Environ. 24, 755–767.
Fan, J., Chen, C., Achor, D. S., Brlansky, R.H., Li, Z.G., Gmitter, F.G., 2013. Differential anatomical responses of tolerant and susceptible citrus species to the infection of ‘Candidatus Liberibacter asiaticus’. Physiol. Mol. Plant Path. 83, 69-74.
Fan, J., Chen, C., Brlansky, R.H., Gmitter Jr, F.G., Li, Z., 2010. Changes in carbohydrate metabolism in Citrus sinensis infected with “Candidatus Liberibacter asiaticus.” Plant Pathol. 59, 1037–1043.
Fan, J., Chen, C., Yu, Q., Khalaf, A., Achor, D.S., Brlansky, R.H., Moore, G.A., Li, Z.G., Gmitter Jr, F.G., 2012. Comparative transcriptional and anatomical analyses of tolerant rough lemon and susceptible sweet orange in response to ‘Candidatus Liberibacter asiaticus’ infection. Mol. Plant Microbe Interact. 25(11), 1396-1407.
Feichtenberger, E., 1997. Effect of systemic fungicides applications on growth responses and fruit yields of sweet orange trees in Phytophthora infested soil: gummosis of citrus with systemic fungicides in Brazil. In, in: World Congress of The International Society of Citrus Nurserymen. pp. 267–279.
Feldman, L.J., 1984. Regulation of root development. Annu. Rev. Plant Physiol. 35, 223–242.
137
Feng, B.Z., Li, P.Q., Fu, L., Sun, B.B., Zhang, X.G., 2011. Identification of 18 genes encoding necrosis-inducing proteins from the plant pathogen Phytophthora capsici (Pythiaceae: Oomycetes). Gen Mol Res. 10, 910–922.
Fitter, A.H., 2002. Characteristics and functions of root systems, in Waisel, Y., Eshel, A., Beeckman, T., Kafkafi, U. (Eds.), Plant roots: the hidden half. E-Publishing Inc., New York, pp. 2, 1–29.
Flores, H.E., Vivanco, J.M., Loyola-Vargas, V.M., 1999. “Radicle” biochemistry: the biology of root-specific metabolism. Trends Plant Sci. 4, 220–226.
Folimonova, S.Y., Achor, D.S., 2010. Early events of citrus greening (Huanglongbing) disease development at the ultrastructural level. Phytopathology. 100, 949–958.
Folimonova, S.Y., Robertson, C.J., Garnsey, S.M., Gowda, S., Dawson, W.O., 2009. Examination of the responses of different genotypes of citrus to Huanglongbing (citrus greening) under different conditions. Phytopathology. 99, 1346–1354.
Förster, H., Coffey, M.D., Elwood, H., Sogin, M.L., 1990. Sequence analysis of the small subunit ribosomal RNAs of three zoosporic fungi and implications for fungal evolution. Mycologia. 306–312.
Garnier, M., Bové, J.M., 1983. Transmission of the organism associated with citrus greening disease from sweet orange to periwinkle by dodder. Phytopathology. 73, 1358–1363.
Garnier, M., Danel, N., Bové, J.M., 1984. The greening organism is a gram negative bacterium, in: Proc. 9th Conference of the International Organization of Citrus Virologists. University of California, Riverside, CA. pp. 115–124.
Goren, R., Huberman, M., Goldschmidt, E.E., 2004. Girdling: physiological and horticultural aspects. Hortic. Rev. (Am. Soc. Hortic. Sci). 30, 1–36.
Gottwald, T.R., 2010. Current epidemiological understanding of citrus huanglongbing. Annu. Rev. Phytopathol. 48, 119–139.
Gottwald, T.R., Graham, J.H., Irey, M.S., McCollum, T.G., Wood, B.W., 2012. Inconsequential effect of nutritional treatments on huanglongbing control, fruit quality, bacterial titer and disease progress. Crop Prot. 36, 73–82.
Grafton-Cardwell, E.E., Stelinski, L.L., Stansly, P.A., 2013. Biology and management of Asian citrus psyllid, vector of the huanglongbing pathogens. Annu. Rev. Entomol. 58, 413–432.
Graham, J., Feichtenberger, E., 2015. Citrus Phytophthora diseases: Management challenges and successes. J. Citrus Pathol. 2(1).
138
Graham, J.H., 2011. Phosphite for control of Phytophthora diseases in citrus: model for management of Phytophthora species on forest trees? New Zealand Journal of Forestry Science. 41.
Graham, J.H., 2000. Larval feeding injury to citrus roots and its relationship to invasion by soil-borne plant pathogens. Diaprepes Short Course. 22, 51–56.
Graham, J.H., 1995. Root regeneration and tolerance of citrus rootstocks to root rot caused by Phytophthora nicotianae. Phytopathology. 85, 111–117.
Graham, J.H., 1990. Evaluation of tolerance of citrus rootstocks to Phytophthora root rot in chlamydospore-infested soil. Plant Dis. 74, 743–746.
Graham, J.H., Bright, D.B., McCoy, C.W., 2003. Phytophthora-Diaprepes weevil complex: Phytophthora spp. relationship with citrus rootstocks. Plant Dis. 87, 85–90.
Graham, J.H., Gerberich, K.M., Bright, D.B., Johnson, E.G., 2014. Excess bicarbonate in soil and irrigation water increases fibrous root loss and decline of Huanglongbing-affected citrus trees in Florida, in: Proc. 2014 American Phytopathological Society, pp. 329.
Graham, J.H., Irey, M., Taylor, J., 2011. Phytophthora damage to roots: A potential contributor to decline of HLB-affected trees. Citrus Industry, 92, 20-23
Graham, J.H., Johnson, E., Morgan, K., 2014. What growers need to know about bicarbonates and root health. Citrus Industry. 9, 6-9
Graham, J.H., Johnson, E.G., Gottwald, T.R., Irey, M.S., 2013. Presymptomatic Fibrous Root Decline in Citrus Trees Caused by Huanglongbing and Potential Interaction with Phytophthora spp. Plant Dis. 97, 1195–1199.
Graham, J.H., Menge, J.A., 1999. Root health: Fungal diseases. In: Timmer, L. W., Duncan, L. W.(eds.), Citrus Health Management. APS Press, St. Paul, MN, pp. 126-135.
Graham, J.H., Syvertsen, J.P., 1985. Host determinants of mycorrhizal dependency of citrus rootstock seedlings. New Phytol. 101, 667-676.
Graham, J.H., Timmer, L.W., Drouillard, D.L., Peever, T.L., 1998. Characterization of Phytophthora spp. causing outbreaks of citrus brown rot in Florida. Phytopathology. 88, 724–729.
Grimm, G.R., Alexander, A.F., 1973. Citrus leaf pieces as traps for Phytophthora parasitica from soil slurries. Phytopathology. 63, 540-541.
139
Grote, D., Olmos, A., Kofoet, A., Tuset, J.J., Bertolini, E., Cambra, M., 2002. Specific and sensitive detection of Phytophthora nicotianae by simple and nested-PCR. Eur. J. Plant Pathol. 108, 197–207.
Gubler, F., Hardham, A.R., 1988. Secretion of adhesive material during encystment of Phytophthora cinnamomi zoospores, characterized by immunogold labelling with monoclonal antibodies to components of peripheral vesicles. J. Cell Sci. 90, 225–235.
Guo, D.L., Mitchell, R.J., Hendricks, J.J., 2004. Fine root branch orders respond differentially to carbon source-sink manipulations in a longleaf pine forest. Oecologia. 140, 450–457.
Haas, B.J., Kamoun, S., Zody, M.C., Jiang, R.H.Y., Handsaker, R.E., Cano, L.M., Grabherr, M., Kodira, C.D., Raffaele, S., Torto-Alalibo, T., 2009. Genome sequence and analysis of the Irish potato famine pathogen Phytophthora infestans. Nature. 461, 393–398.
Hadrami, A.E.l., El-Bebany, A.F., Yao, Z., Adam, L.R., Hadrami, I.E.I., Daayf, F., 2012. Plants versus fungi and oomycetes: pathogenesis, defense and counter-defense in the proteomics era. Int. J. Mol. Sci. 13, 7237-7259.
Halbert, S.E., 2005. The discovery of huanglongbing in Florida, in: Proc. of the 2nd
International Citrus Canker and Huanglongbing Research Workshop. pp. 7–11.
Halbert, S.E., Manjunath, K.L., 2004. Asian citrus psyllids (Sternorrhyncha: Psyllidae) and greening disease of citrus: a literature review and assessment of risk in Florida. Fla. Entomol. 87, 330–353.
Hall, D.G., Nguyen, R., 2010. Toxicity of pesticides to Tamarixia radiata, a parasitoid of the Asian citrus psyllid. Biocontrol. 55, 601–611.
Hammond-Kosack, K.E., Jones, J.D., 1996. Resistance gene-dependent plant defense responses. Plant Cell. 8, 1773–1791.
Hardham, A.R., 2007. Cell biology of fungal and oomycete infection of plants, in: Brown, A. G. P., Esser, K. (Eds.), The Mycota. Springer, Berlin, pp. 251–289.
Hardham, A.R., 2005. Phytophthora cinnamomi. Mol. Plant Pathol. 6, 589–604.
Hardham, A.R., Hyde, G.J., 1997. Asexual sporulation in the oomycetes. Adv. Bot. Res. 24, 353–398.
Hemmes, D.E., Bartnicki-Garcia, S., 1975. Electron microscopy of gametangial interaction and oospore development in Phytophthora capsici. Arch. Microbiol. 103, 91–112.
140
Herbers, K., Sonnewald, U., 1998. Altered gene expression brought about by inter-and intracellularly formed hexoses and its possible implications for plant-pathogen interactions. J. Plant Res. 111, 323–328.
Hocquellet, A., Bové, J.M., Garnier, M., 1997. Production and evaluation of non-radioactive probes for the detection of the two ‘CandidatusLiberobacter’ species associated with citrus huanglongbing (greening). Mol. Cell. Probes. 11, 433–438.
Hocquellet, A., Toorawa, P., Bové, J.M., Garnier, M., 1999. Detection and identification of the two Candidatus Liberibacter species associated with citrus huanglongbing by PCR amplification of ribosomal protein genes of the β-operon. Mol. Cell. Probes. 13, 373–379.
Hung, T., Hung, S., Chen, C., Hsu, M., Su, H., 2004. Detection by PCR of Candidatus Liberibacter asiaticus, the bacterium causing citrus huanglongbing in vector psyllids: application to the study of vector–pathogen relationships. Plant Pathol. 53, 96–102.
Hung, T.H., Wu, n. M.L., Su, H.J., 1999. Development of a rapid method for the diagnosis of citrus greening disease using the polymerase chain reaction. J. Phytopathol. 147, 599–604.
Inoue, H., Ohnishi, J., Ito, T., Tomimura, K., Miyata, S., Iwanami, T., Ashihara, W., 2009. Enhanced proliferation and efficient transmission of Candidatus Liberibacter asiaticus by adult Diaphorina citri after acquisition feeding in the nymphal stage. Ann. Appl. Biol. 155, 29–36.
Ippolito, A., Schena, L., Nigro, F., Yaseen, T., 2004. Real-time detection of Phytophthora nicotianae and P. citrophthorain citrus roots and soil. Eur. J. Plant Pathol. 110, 833–843.
Jagoueix, S., Bové, J.M., Garnier, M., 1997. Comparison of the 16S/23S ribosomal intergenic regions of “Candidatus Liberobacter asiaticum” and “Candidatus Liberobacter africanum,” the two species associated with citrus huanglongbing (greening) disease. Int. J. Syst. Bacteriol. 47, 224–227.
Jagoueix, S., Bové, J.M., Garnier, M., 1994. The phloem-limited bacterium of greening disease of citrus is a member of the alpha subdivision of the Proteobacteria. Int. J. Syst. Bacteriol. 44, 379–386.
Jiang, R.H.Y., Tyler, B.M., 2012. Mechanisms and evolution of virulence in oomycetes. Annu. Rev. Phytopathol. 50, 295–318.
Johnson, E., Bright, D.B., Graham, J.H., 2012. Early root infection and damage in citrus huanglongbing disease development, in: Phytopathology. Amer. Phytopathological Soc., ST PAUL, MN 55121 USA, p. 59.
141
Johnson, E.G., Wu, J., Bright, D.B., Graham, J.H., 2014. Association of “Candidatus Liberibacter asiaticus” root infection, but not phloem plugging with root loss on
huanglongbing‐affected trees prior to appearance of foliar symptoms. Plant Pathol. 63, 290–298.
Jönsson, U., 2006. A conceptual model for the development of Phytophthora disease in Quercus robur. New Phytol. 171, 55–68.
Judelson, H.S., 2012. Dynamics and innovations within oomycete genomes: insights into biology, pathology, and evolution. Eukaryot. Cell. 11, 1304–1312.
Judelson, H.S., Blanco, F.A., 2005. The spores of Phytophthora: weapons of the plant destroyer. Nat. Rev. Microbiol. 3, 47–58.
Judelson, H.S., 2012. Dynamics and innovations within oomycete genomes: Insights into biology, pathology, and evolution. Eukaryotic Cell. 11(11), 1304-1312.
Kamoun, S., 2006. A catalogue of the effector secretome of plant pathogenic oomycetes. Annu.Rev.Phytopathol. 44, 41–60.
Kamoun, S., Klucher, K.M., Coffey, M.D., Tyler, B.M., 1993. A gene encoding a host-specific elicitor protein of Phytophthora parasitica. Mol. Plant Microbe Interact. 6, 573.
Kamoun, S., van West, P., Govers, F., 1998. Resistance of Nicotiana to Phytophthora infestans is mediated by the recognition of elicitor protein INF1. Plant Cell. 10, 1413-1425
Katz, E., Boo, K.H., Kim, H.Y., Eigenheer, R.A., Phinney, B.S., Shulaev, V., Negre-Zakharov, F., Sadka, A., Blumwald, E., 2011. Label-free shotgun proteomics and metabolite analysis reveal a significant metabolic shift during citrus fruit development. J. Exp. Bot. 62, 5367–5384.
Kebdani, N., Pieuchot, L., Deleury, E., Panabieres, F., Le Berre, J., Gourgues, M., 2010. Cellular and molecular characterization of Phytophthora parasitica
appressorium‐mediated penetration. New Phytol. 185, 248–257.
Khangura, J.S., Singh, H., 1984. Effect of sprayers on the effectiveness and persistence of LVC and EC formulations of dimethoate against Diaphorina citri Kuwayama on citrus. J. Entomol. Res. 8, 31–35.
Khatib, M., Lafitte, C., Esquerré‐Tugayé, M., Bottin, A., Rickauer, M., 2004. The CBEL elicitor of Phytophthora parasitica var. nicotianae activates defense in Arabidopsis thaliana via three different signalling pathways. New Phytol. 162, 501–510.
142
Kim, J.-S., Sagaram, U.S., Burns, J.K., Li, J.-L., Wang, N., 2009. Response of sweet orange (Citrus sinensis) to ‘Candidatus Liberibacter asiaticus’ infection: microscopy and microarray analyses. Phytopathology. 99, 50–57.
Koch, K., 2004. Sucrose metabolism: regulatory mechanisms and pivotal roles in sugar sensing and plant development. Curr. Opin. Plant Biol. 7, 235–246.
Koh, E. J., Zhou, L., Williams, D.S., Park, J., Ding, N., Duan, Y. P., Kang, B.H., 2012. Callose deposition in the phloem plasmodesmata and inhibition of phloem transport in citrus leaves infected with “Candidatus Liberibacter asiaticus”. Protoplasma. 249(3), 687-697.
Koizumi, M., Prommintara, M., Linwattana, G., Kaisuwan, T., 1993. Field evaluation of citrus cultivars for greening disease resistance in Thailand, in: Proc. of the 12th International Conference Organ Citrus Virology. New Delhi, India: International Organization of Citrus Virologists, University of California, Riverside. pp. 27.
Komatsu, A., Moriguchi, T., Koyama, K., Omura, M., Akihama, T., 2002. Analysis of sucrose synthase genes in citrus suggests different roles and phylogenetic relationships. J. Exp. Bot. 53, 61–71.
Kosola, K.R., Eissenstat, D.M., Graham, J.H., 1995. Root demography of mature citrus trees: the influence of Phytophthora nicotianae. Plant Soil. 171, 283–288.
Kroon, L.P.N.M., Brouwer, H., de Cock, A.W.A.M., Govers, F., 2012. The genus Phytophthora anno 2012. Phytopathology. 102, 348–364.
Kühn, C., Barker, L., Bürkle, L., Frommer, W.-B., 1999. Update on sucrose transport in higher plants. J. Exp. Bot. 50, 935–953.
Kuhn, C., Franceschi, V.R., Schulz, A., Lemoine, R., Frommer, W.B., 1997. Macromolecular trafficking indicated by localization and turnover of sucrose transporters in enucleate sieve elements. Science. 275, 1298–1300.
Kunjeti, S.G., Evans, T.A., Marsh, A.G., Gregory, N.F., Kunjeti, S., Meyers, B.C.,
Kalavacharla, V.S., Donofrio, N.M., 2012. RNA‐Seq reveals infection‐related global gene changes in Phytophthora phaseoli, the causal agent of lima bean downy mildew. Mol. Plant Pathol. 13, 454–466.
Lamour, K.H., Mudge, J., Gobena, D., Hurtado-Gonzales, O.P., Schmutz, J., Kuo, A., Miller, N.A., Rice, B.J., Raffaele, S., Cano, L.M., 2012. Genome sequencing and mapping reveal loss of heterozygosity as a mechanism for rapid adaptation in the vegetable pathogen Phytophthora capsici. Mol. Plant-Microbe Interact. 25, 1350–1360.
Latijnhouwers, M., de Wit, P.J.G.M., Govers, F., 2003. Oomycetes and fungi: similar weaponry to attack plants. Trends Microbiol. 11, 462–469.
143
Le Berre, J., Engler, G., Panabières, F., 2008. Exploration of the late stages of the tomato–Phytophthora parasitica interactions through histological analysis and generation of expressed sequence tags. New Phytol. 177, 480–492.
Lewis-Rosenblum, H., 2011. Seasonal and Long-Range Movement of Asian Citrus Psyllid, Diaphorina Citri. MS thesis. Univ. Florida, Gainesville. pp. 75.
Li, B., Qian, X., Caruso, F.L., Singh, B.R., Sarkar, H.K., 2000. Cloning and sequence analysis of a Phytophthora cinnamomi gene which encodes for cinnamomin, a toxin with implications in root rot of cranberry. J. Nat. Toxins. 9, 113–123.
Li, W., Hartung, J.S., Levy, L., 2006. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. J. Microbiol. Methods. 66, 104–115.
Li, W., Levy, L., Hartung, J.S., 2009. Quantitative distribution of ‘Candidatus Liberibacter asiaticus' in citrus plants with citrus Huanglongbing. Phytopathology. 99, 139–144.
Liao, H.L., Burns, J.K., 2012. Gene expression in Citrus sinensis fruit tissues harvested from huanglongbing-infected trees: comparison with girdled fruit. J. Exp. Bot. 63, 3307–3319.
Lin, H., Chen, C., Doddapaneni, H., Duan, Y., Civerolo, E.L., Bai, X., Zhao, X., 2010. A new diagnostic system for ultra-sensitive and specific detection and quantification of Candidatus Liberibacter asiaticus, the bacterium associated with citrus Huanglongbing. J. Microbiol. Methods. 81, 17–25.
Lir, K., et al. 2012. Genome sequencing and mapping reveal loss of heterozygosity as a mechanism for rapid adaptation in the vegetable pathogen Phytophthora capsici. Mol. Plant Microbe Interact. 25(10), 1350-1360.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 25, 402–408.
Lopes, S.A., Bertolini, E., Frare, G.F., Martins, E.C., Wulff, N.A., Teixeira, D.C., Fernandes, N.G., Cambra, M., 2009a. Graft Transmission Efficiencies and Multiplication of ‘Candidatus Liberibacter americanus’ and ‘Ca. Liberibacter asiaticus’ in Citrus Plants. Phytopathology. 99, 301–306.
Lopes, S.A., Frare, G.F., Bertolini, E., Cambra, M., Fernandes, N.G., Ayres, A.J., Marin, D.R., Bové, J.M., 2009b. Liberibacters associated with citrus huanglongbing in Brazil: ‘Candidatus Liberibacter asiaticus’ is heat tolerant, ‘Ca. L. americanus’ is heat sensitive. Plant Dis. 93, 257–262.
Luis, M., Collazo, C., Llauger, R., Blanco, E., Peña, I., López, D., González, C., Casín, J.C., Batista, L., Kitajima, E., 2009. Occurrence of citrus huanglongbing in Cuba
144
and association of the disease with Candidatus Liberibacter asiaticus. J. Plant Pathol. 709–712.
Madoui, M., Bertrand‐Michel, J., Gaulin, E., Dumas, B., 2009. Sterol metabolism in the oomycete Aphanomyces euteiches, a legume root pathogen. New Phytol. 183, 291–300.
Man in’t Veld, W.A., Veenbaas-Rijks, W.J., Ilieva, E., de Cock, A.W.A.M., Bonants, P.J.M., Pieters, R., 1998. Natural hybrids of Phytophthora nicotianae and Phytophthora cactorum demonstrated by isozyme analysis and random amplified polymorphic DNA. Phytopathology. 88, 922–929.
Mann, R.S., Pelz-Stelinski, K., Hermann, S.L., Tiwari, S., Stelinski, L.L., 2011. Sexual transmission of a plant pathogenic bacterium, Candidatus Liberibacter asiaticus, between conspecific insect vectors during mating. PLoS One. 6, e29197. doi:10.1371/journal.pone.0029197 [doi]
Martinelli, F., Uratsu, S.L., Albrecht, U., Reagan, R.L., Phu, M.L., Britton, M., Buffalo, V., Fass, J., Leicht, E., Zhao, W., 2012. Transcriptome profiling of citrus fruit response to huanglongbing disease. PLoS One. 7, e38039. doi: 10.1371/journal.pone.0038039 [doi]
Martinez, A.L., Wallace, J.M., 1967. Citrus leaf mottle-yellows disease in the Philippines and transmission of the causal virus by a psyllid, Diaphorina citri. Plant Dis.Rep. 51, 692–695.
Matheron, M.E., Porchas, M., 1996. Colonization of citrus roots by Phytophthora citrophthora and Phytophthora parasitica in daily soil temperature fluctuations between favorable and inhibitory levels. Plant disease. 80(10), 1135-1140.
Mattos, D., Graetz, D.A., Alva, A.K., 2003. Biomass distribution and nitrogen-15 partitioning in citrus trees on a sandy entisol. Soil Sci. Soc. Am. J., 67(2), 555-563.
McClean, A.P.D., Oberholzer, P.C.J., 1965a. Citrus psylla, a vector of the greening disease of sweet orange. South African J. Agric. Sci. 8, 297–298.
McClean, A.P.D., Oberholzer, P.C.J., 1965b. Greening disease of the sweet orange: evidence that it is caused by a transmissible virus. South African J. Agric. Sci. 8, 253–275.
Meng, Y., Zhang, Q., Ding, W., Shan, W., 2014. Phytophthora parasitica: a model oomycete plant pathogen. Mycology. 5, 43–51.
Nebauer, S.G., Renau-Morata, B., Guardiola, J.L., Molina, R. V, 2011. Photosynthesis down-regulation precedes carbohydrate accumulation under sink limitation in Citrus. Tree Physiol. 31, 169–177.
145
Nemec, S., Datnoff, L.E., Strandberg, J., 1996. Efficacy of biocontrol agents in planting mixes to colonize plant roots and control root diseases of vegetables and citrus. Crop Prot. 15, 735–742.
Nocker, A., Camper, A.K., 2006. Selective removal of DNA from dead cells of mixed bacterial communities by use of ethidium monoazide. Appl. Environ. Microbiol. 72, 1997–2004.
Nocker, A., Cheung, C.-Y., Camper, A.K., 2006. Comparison of propidium monoazide with ethidium monoazide for differentiation of live vs. dead bacteria by selective removal of DNA from dead cells. J. Microbiol. Methods. 67, 310–320.
Panabières, F., Amselem, J., Galiana, E., Le Berre, J.Y., 2005. Gene identification in the oomycete pathogen Phytophthora parasitica during in vitro vegetative growth through expressed sequence tags. Fungal Genet. Biol. 42, 611–623.
Pelz-Stelinski, K.S., Brlansky, R.H., Ebert, T.A., Rogers, M.E., 2010. Transmission parameters for Candidatus Liberibacter asiaticus by Asian citrus psyllid (Hemiptera: Psyllidae). J. Econ. Entomol. 103, 1531–1541.
Pettitt, T.R., Wakeham, A.J., Wainwright, M.F., White, J.G., 2002. Comparison of serological, culture, and bait methods for detection of Pythium and Phytophthora zoospores in water. Plant Pathol. 51, 720–727.
Peterson, C.A., Enstone, D.E., 1996. Functions of passage cells in the endodermis and exodermis of roots. Physiol. Plant. 97(3), 592-598.
Phillips, A.J., Anderson, V.L., Robertson, E.J., Secombes, C.J., van West, P., 2008. New insights into animal pathogenic oomycetes. Trends Microbiol. 16, 13–19.
Pregitzer, K.S., Laskowski, M.J., Burton, A.J., Lessard, V.C., Zak, D.R., 1998. Variation in sugar maple root respiration with root diameter and soil depth. Tree Physiol. 18, 665–670.
Rae, D.J., Liang, W.G., Watson, D.M., Beattie, G.A.C., Huang, M.D., 1997. Evaluation of petroleum spray oils for control of the Asian citrus psylla, Diaphorina citri (Kuwayama) (Hemiptera: Psyllidae), in China. Int. J. Pest Manag. 43, 71–75.
Raftoyannis, Y., Dick, M.W., 2006. Zoospore encystment and pathogenicity of Phytophthora and Pythium species on plant roots. Microbiol. Res. 161, 1–8.
Ramadugu, C., Manjunath, K.L., Ramos, C., Halbert, S., Webb, S., Lee, R.F., 2008. Role of garden centers and retail nurseries in spreading citrus huanglongbing disease, in: Phytopathology. Amer. Phytopathological Soc. ST PAUL, MN, USA. pp. S129–S130.
146
Randall, T.A., Fong, A.A., Judelson, H.S., 2003. Chromosomal heteromorphism and an apparent translocation detected using a BAC contig spanning the mating type locus of Phytophthora infestans. Fungal Genet. Biol. 38, 75–84.
Reinking, O.A., 1919. Diseases of Economic Plants in Southern China. Philipp. Agric. 8, 109–134.
Roistacher, C.N., 1996. The economics of living with citrus diseases: huanglongbing (greening) in Thailand, in: Proc. 13th Conference of the International Organization of Citrus Virologists (IOCV). University of California, Riverside. pp. 279–285.
Rosales, R., Burns, J.K., 2011. Phytohormone changes and carbohydrate status in sweet orange fruit from Huanglongbing-infected trees. J. Plant Growth Regul. 30, 312–321.
Ruiz, D., Martínez, V., Cerdá, A., 1997. Citrus response to salinity: growth and nutrient uptake. Tree Physiol. 17 (3), 141-150.
Ryan, P.R., Delhaize, E., Jones, D.L., 2001. Function and mechanism of organic anion exudation from plant roots. Annu. Rev. Plant Biol. 52, 527–560.
Salibe, A.A., Cortez, R.E., 1968. Leaf mottling, a serious virus disease of citrus in the Philippines, in: Proc. of 4th Conference IOCV, Gainesville. pp. 131–136.
Sandler, H.A., Timmer, L.W., Graham, J.H., Zitko, S.E., 1989. Effect of fungicide applications on populations of Phytophthora parasitica and on feeder root densities and fruit yields of citrus trees. Plant Dis. 73, 902–906.
Sauer, N., 2007. Molecular physiology of higher plant sucrose transporters. FEBS Lett. 581, 2309–2317.
Schaffer, A.A., Liu, K.-C., Goldschmidt, E.E., Boyer, C.D., Goren, R., 1986. Citrus leaf chlorosis induced by sink removal: starch, nitrogen, and chloroplast ultrastructure. J. Plant Physiol. 124, 111–121.
Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3, 1101–1108.
Schneider, H., 1968. Anatomy of greening-diseased sweet orange shoots. Phytopathology. 58, 1160–1555.
Schneider, H., 1967. Phloem necrosis associated With the greening disease of sweet orange (Citrux smens1S). Phytopathology. 57, 829.
Schwarz, R.E., Knorr, L.C., Prommintara, M., 1973. Presence of citrus greening and its psylla vector in Thailand. FAO Plant Prot. Bull. 21, 132–138.
147
Seidl, M.F., Van den Ackerveken, G., Govers, F., Snel, B., 2011. A domain-centric analysis of oomycete plant pathogen genomes reveals unique protein organization. Plant Physiol. 155, 628–644.
Shan, W., Hardham, A.R., 2004. Construction of a bacterial artificial chromosome library, determination of genome size, and characterization of an Hsp70 gene family in Phytophthora nicotianae. Fungal Genet. Biol. 41, 369–380.
Shan, W., Marshall, J.S., Hardham, A.R., 2004. Gene expression in germinated cysts of Phytophthora nicotianae. Mol. Plant Pathol. 5, 317–330.
Škalamera, D., Wasson, A.P., Hardham, A.R., 2004. Genes expressed in zoospores of Phytophthora nicotianae. Mol. Genet. Genomics. 270, 549–557.
Smith, A.M., Stitt, M., 2007. Coordination of carbon supply and plant growth. Plant Cell Environ. 30, 1126–1149.
Stamps, D.J., Waterhouse, G.M., Newhook, F.J., Hall, G.S., 1990. Revised tabular key to the species of Phytophthora. CAB-International. Mycology. 162, 1-28.
Sturm, A., Tang, G.Q., 1999. The sucrose-cleaving enzymes of plants are crucial for development, growth and carbon partitioning. Trends Plant Sci. 4, 401–407.
Takushi, T., Toyozato, T., Kawano, S., Taba, S., Taba, K., Ooshiro, A., Numazawa, M., Tokeshi, M., 2007. Scratch method for simple, rapid diagnosis of citrus huanglongbing using iodine to detect high accumulation of starch in the citrus leaves. Ann Phytopathol Soc. Jpn. 73, 3–8.
Tatineni, S., Sagaram, U.S., Gowda, S., Robertson, C.J., Dawson, W.O., Iwanami, T., Wang, N., 2008. In planta distribution of ‘Candidatus Liberibacter asiaticus’ as revealed by polymerase chain reaction (PCR) and real-time PCR. Phytopathology. 98, 592–599.
Teixeira, D. do C., Ayres, A.J., Kitajima, E.W., Tanaka, F.A.O., Danet, J.L., Jagoueix-Eveillard, S., Saillard, C., Bové, J.M., 2005. First report of a huanglongbing-like disease of citrus in Sao Paulo State, Brazil, and association of a new liberibacter species, Candidatus Liberibacter americanus, with the disease. Plant Dis. 89, 107.
Timmer, L.W., Graham, J.H., Zitko, S.E., 1998. Metalaxyl-resistant isolates of Phytophthora nicotianae: occurrence, sensitivity, and competitive parasitic ability on citrus. Plant Dis. 82, 254–261.
Tippett, J.T., Holland, A.A., Marks, G.C., O’brien, T.P., 1976. Penetration of Phytophthora cinnamomi into disease tolerant and susceptible eucalypts. Arch. Microbiol. 108, 231–242.
148
Tiwari, S., Lewis-Rosenblum, H., Pelz-Stelinski, K., Stelinski, L.L., 2010. Incidence of Candidatus Liberibacter asiaticus infection in abandoned citrus occurring in proximity to commercially managed groves. J. Econ. Entomol. 103, 1972–1978.
Trotta, A., Varese, G.C., Gnavi, E., Fusconi, A., Sampo, S., Berta, G., 1996. Interactions between the soilborne root pathogen Phytophthora nicotianae var. parasitica and the arbuscular mycorrhizal fungus Glomus mosseae in tomato plants. Plant Soil. 185, 199–209.
Tsai, C.H., Hung, T.H., Su, H.J. 2008. Strain identification and distribution of citrus Huanglongbing bacteria in Taiwan. Bot. Stud. 49, 49-56.
Tsao, P.H., 1971. Chlamydospore formation in sporangium-free liquid cultures of Phytophthora parasitica. Phytopathology. 88, 389-395.
Tyler, B.M., 2002. Molecular basis of recognition between Phytophthora pathogens and their hosts. Annu. Rev. Phytopathol. 40, 137–167.
Tyler, B.M., et al., 2006. Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science. 313, 1261–1266.
Van de Peer, Y., Van der Auwera, G., De Wachter, R., 1996. The evolution of stramenopiles and alveolates as derived by “substitution rate calibration” of small ribosomal subunit RNA. J. Mol. Evol. 42, 201–210.
Van West, P. van, Morris, B.M., Reid, B., Appiah, A.A., Osborne, M.C., Campbell, T.A., Shepherd, S.J., Gow, N.A.R., 2002. Oomycete plant pathogens use electric fields to target roots. Mol. Plant-Microbe Interact. 15, 790–798.
Villechanoux, S., Garnier, M., Laigret, F., Renaudin, J., Bové, J.M., 1993. The genome of the non-cultured, bacterial-like organism associated with citrus greening disease contains thenusG-rplKAJL-rpoBC gene cluster and the gene for a bacteriophage type DNA polymerase. Curr. Microbiol. 26, 161–166.
Villechanoux, S., Garnier, M., Renaudin, J., Bové, J.M., 1992. Detection of several strains of the bacterium-like organism of citrus greening disease by DNA probes. Curr. Microbiol. 24, 89–95.
Walker, T.S., Bais, H.P., Grotewold, E., Vivanco, J.M., 2003. Root exudation and rhizosphere biology. Plant Physiol. 132, 44–51.
Walker, R.R., Sedgley, M., Blesing, M.A., Douglas, T.J., 1984. Anatomy, ultrastructure and assimilate concentrations of roots of citrus genotypes differing in ability for salt exclusion. J. Exp. Bot. 35(10), 1481-1494.
Wang, N., Trivedi, P., 2013. Citrus huanglongbing: a newly relevant disease presents unprecedented challenges. Phytopathology. 103(7), 652-665.
149
Wang, Y., Meng, Y., Zhang, M., Tong, X., Wang, Q., Sun, Y., Quan, J., Govers, F., Shan, W., 2011. Infection of Arabidopsis thaliana by Phytophthora parasitica and identification of variation in host specificity. Mol. Plant Pathol. 12, 187–201.
Wang, Z., Guo, D., Wang, X., Gu, J., Mei, L., 2006. Fine root architecture, morphology, and biomass of different branch orders of two Chinese temperate tree species. Plant Soil. 288, 155–171.
Wang, Z., Yin, Y., Hu, H., Yuan, Q., Peng, G., Xia, Y., 2006. Development and application of molecular‐based diagnosis for ‘Candidatus Liberibacter asiaticus’, the causal pathogen of citrus huanglongbing. Plant Pathol. 55, 630–638.
Wells, C.E., Eissenstat, D.M., 2002. Beyond the roots of young seedlings: the influence of age and order on fine root physiology. J. Plant Growth Regul. 21, 324–334.
Wells, C.E., Eissenstat, D.M., 2001. Marked differences in survivorship among apple roots of different diameters. Ecology. 82(3), 882-892.
Widmer, T.L., Graham, J.H., Mitchell, D.J., 1998. Histological comparison of fibrous root infection of disease-tolerant and susceptible citrus hosts by Phytophthora nicotianae and P. palmivora. Phytopathology. 88, 389–395.
Wilson, P.J., Thompson, K.E.N., Hodgson, J.G., 1999. Specific leaf area and leaf dry matter content as alternative predictors of plant strategies. New Phytol. 143, 155–162.
Winter, H., Huber, S.C., 2000. Regulation of sucrose metabolism in higher plants: localization and regulation of activity of key enzymes.Crit. Rev. Biochem. Mol. Biol. 35, 253-28.
Zhang, M., Duan, Y., Powell, C.A., 2010. Bactericidal activities of antimicrobial molecules against huanglongbing-associated “Candidatus Liberibacter asiaticus” in the diseased periwinkle, in: Phytopathology. Amer. Phytopathological Soc. ST PAUL, MN, USA. pp. S145–S145.
Zhang, M., Duan, Y., Zhou, L., Turechek, W.W., Stover, E., Powell, C.A., 2010. Screening molecules for control of citrus huanglongbing using an optimized regeneration system for ‘Candidatus Liberibacter asiaticus'-infected periwinkle (Catharanthus roseus) cuttings. Phytopathology. 100, 239–245.
Zhang, M., Powell, C.A., Guo, Y., Doud, M.S., Duan, Y., 2012. A graft-based chemotherapy method for screening effective molecules and rescuing huanglongbing-affected citrus plants. Phytopathology. 102, 567–574.
Zhang, M., Powell, C.A., Zhou, L., He, Z., Stover, E., Duan, Y., 2011. Chemical compounds effective against the citrus huanglongbing bacterium’Candidatus Liberibacter asiaticus' in planta. Phytopathology. 101, 1097–1103.
150
Zhang, S., Flores-Cruz, Z., Zhou, L., Kang, B.H., Fleites, L.A., Gooch, M.D., Wulff, N.A., Davis, M.J., Duan, Y.P., Gabriel, D.W., 2011. “Ca. Liberibacter asiaticus” carries an excision plasmid prophage and a chromosomally integrated prophage that becomes lytic in plant infections. Mol. Plant-Microbe Interact. 24, 458–468.
Zhao, X.Y., 1982. Citrus yellow shoot disease (Huanglongbing) in China-a review in: Proc. of the International Society of Citriculture, Tokyo, Japan. International Society of Citriculture. 1, 466–469.
Zhong, Y., Cheng, C., Jiang, N., Jiang, B., Zhang, Y., Wu, B., Hu, M., Zeng, J., Yan, H., Yi, G., 2015. Comparative Transcriptome and iTRAQ Proteome Analyses of Citrus Root Responses to Candidatus Liberibacter asiaticus Infection. PLoS One. 10, e0126973. doi: 10.1371/journal.pone.0126973 [doi]
Zimmermann, M.H., Ziegler, H., 1975. List of sugars and sugar alcohols in sieve-tube exudates. In: Zimmermann, M.H., Milburn, J.A. (Eds.), Transport in Plants: Phloem Transport. Springer, New York. pp. 480-503
Zitko, S.E., Timmer, L.W., 1994. Competitive parasitic abilities of Phytophthora parasitica and P. palmivora on fibrous roots of citrus. Phytopathology. 84, 1000–1004.
151
BIOGRAPHICAL SKETCH
Jian Wu was born and raised in Tongliao, Inner Mongolia, China. She received
her bachelor’s degree majoring in forestry from Northeast Forestry University, Harbin,
China. She received her master’s degree majoring in turfgrass science from Beijing
Forestry University, Beijing, China. In 2011, Jian Wu joined the Department of Soil and
Water Science at the University of Florida for her Ph.D. and completed her program in
December 2015.
![Ã|Ì°q { Y Phytophthora nicotianae (=P. parasiticarpp.miau.ac.ir/article_2781_104f219488b598fd24c5322fbea... · 2020. 7. 21. · ½Zf ¸³½Zf Y {½ÂeÂeÃZÌ ©Z É Z¼Ì]Ä]ʳ{·MdÌ](https://img.dokumen.tips/doc/110x75/60780385c354e970887989db/foeq-y-phytophthora-nicotianae-p-2020-7-21-zf-zf-y-eefzoe.jpg)
