Upload
nguyenkhanh
View
223
Download
1
Embed Size (px)
Citation preview
Insight into the Cargo Recognition Mechanism of Kinesin Light Chain 1
by
Han Youl Lee
A thesis submitted in conformity with the requirements for the degree of Master of Science
Graduate Department of Pharmacology and Toxicology University of Toronto
© Copyright by Han Youl Lee 2011
ii
Insight into the Cargo Recognition Mechanism of Kinesin Light
Chain 1
Han Youl Lee
Master of Science
Graduate Department of Pharmacology and Toxicology
University of Toronto
2011
Abstract
Kinesin-1 transports various cargos along the axon, while the light chain subunits play a role in selecting
the types of cargos to transport. However, the mechanisms of cargo recognition and interaction have yet
to be characterized. Both c-Jun kinase-interacting protein-1 (JIP1) and alcadein-1 (ALC1) are kinesin-1
cargos and compete with each other for the axonal transport machinery. I identified two polar patches of
KLC1 that play a role in the interactions with JIP1 and ALC1, respectively. The main components of
these two polar patches are asparagine “clamps” surrounded by positively charged lysines. Consistent
with this finding, negatively charged residues of JIP1 and ALC1 are required to interact with KLC1. By
structural modeling, I narrowed down the possible key residues of KLC1 that are required for interaction
with c-Jun kinase interacting protein-3 (JIP3). Together, these findings reveal the versatility of KLC in
the mode of interaction with many different cargos.
iii
Acknowledgments
First and foremost, I would like to thank my supervisor, Dr. Hee-Won Park for his
dedication and understanding. I first came into the lab with very limited research experience and
understanding of science. Within two years, not only did you expand my knowledge in field of
science and research, but you helped me develop the tools to succeed in life. Thank you for
welcoming me to the lab and giving me such a great opportunity along with your endless support
for my work.
I would also like to thank everyone in our lab. I’ve been lucky to have worked with such
a talented group; you guys have shown me the “art of science”. I will never have been able to
accomplish anything that I have done without your help. Thank you for always greeting all the
good and bad times with a smile.
I would like to thank Dr. McPherson and Dr. Mitchell who without any hesitation were
willing to be my advisor and co-supervisor. Thank you for being a part of my graduate
experience. Also, I am grateful to Dr. Pai, Dr. Salahpour, and Dr. Wells for your dedication in
evaluating and greatly improving this thesis.
I owe the greatest appreciation to my family and friends, who have stuck by me to this
day. Thank you for your love, patience and understanding for all my life. I am honoured to call
you guys my family and friends. Thank You!
iv
Table of Contents
Acknowledgments ..................................................................................................................... iii
Table of Contents ...................................................................................................................... iv
List of Tables ........................................................................................................................... vii
List of Figures ......................................................................................................................... viii
List of Abbreviations ................................................................................................................. ix
1 Introduction ........................................................................................................................... 1
1.1 Intracellular Transport .................................................................................................... 1
1.2 Motor Proteins ................................................................................................................ 1
1.3 Kinesin ........................................................................................................................... 2
1.3.1 Kinesin Superfamily ............................................................................................ 2
1.3.2 Kinesin-1 ............................................................................................................ 3
1.3.3 Kinesin Heavy Chains ......................................................................................... 4
1.3.4 Kinesin Light Chains ........................................................................................... 6
1.4 TPR domains .................................................................................................................. 7
1.5 Introduction to Kinesin-1’s Cargo and Biological Relevance .........................................13
1.5.1 Alzheimer’s disease (AD) ..................................................................................13
1.5.2 Huntington’s Disease (HD) ................................................................................14
1.5.3 Mood Disorder ...................................................................................................15
1.5.4 Diabetes .............................................................................................................15
1.5.5 Axon Outgrowth ................................................................................................16
1.6 Clinical Relevance .........................................................................................................17
1.6.1 Kinesin Light Chain Single Nucleotide Polymorphisms .....................................17
1.6.2 Kinesin-1 as a Drug Target .................................................................................17
v
1.7 Macromolecular Crystallography ...................................................................................18
1.8 Hypothesis & Approach .................................................................................................19
1.8.1 X-ray Crystallography ........................................................................................20
1.8.2 Biochemical & Biophysical Assays ....................................................................20
1.8.3 Analysis of Structural Model ..............................................................................21
2 Materials and Methods ..........................................................................................................23
2.1 Cloning ..........................................................................................................................23
2.2 Site-directed Mutagenesis ..............................................................................................23
2.3 Solubility Test ...............................................................................................................24
2.4 Expression .....................................................................................................................26
2.5 Purification ....................................................................................................................26
2.5.1 Cell Lysis ...........................................................................................................26
2.5.2 Metal Ion Affinity Chromatography ...................................................................27
2.5.3 Size Exclusion Chromatography .........................................................................27
2.5.4 Ion Exchange Chromatography ..........................................................................27
2.6 Binding assay using size exclusion chromatography ......................................................28
2.7 Crystallization................................................................................................................28
2.8 Isothermal Titration Calorimetry (ITC) ..........................................................................29
2.9 Structural Analysis.........................................................................................................29
3 Results ..................................................................................................................................30
3.1 Crystallography .............................................................................................................30
3.1.1 Solubility & Expression of Constructs ................................................................30
3.1.2 Purification ........................................................................................................30
3.1.3 Detection of Protein-Protein Interaction by Size Exclusion Chromatography
(SEC) .................................................................................................................32
3.1.4 Crystallization ....................................................................................................33
vi
3.2 Mutagenesis Binding Studies .........................................................................................34
3.2.1 Mutagenesis of KLC1-TPR ................................................................................34
3.2.2 Mutagenesis of pJIP1 and pALC1 ......................................................................39
3.3 Structural Analysis.........................................................................................................42
3.3.1 Mapping of the JIP3 and JIP4 binding site ..........................................................42
4 Discussion ............................................................................................................................43
4.1 X-ray Crystallography ...................................................................................................43
4.1.1 Cloning, Expression & Purification of Proteins ..................................................43
4.1.2 KLC1-TPR interacts with ALC1 and S100A6 ....................................................43
4.2 Mechanism of Interaction by KLC1-TPR .......................................................................46
4.2.1 KLC1-TPR Interaction Interface ........................................................................46
4.2.2 Negatively Charged Residues in ALC1 and JIP1 are Essential in KLC1-TPR
Binding ..............................................................................................................49
4.2.3 N343 Polar Patch versus N301 Polar Patch .........................................................49
4.3 Structural Analysis.........................................................................................................50
4.3.1 Mapping of the JIP3 binding site – Putative Binding Site #3...............................50
4.4 Limitations ....................................................................................................................52
5 Summary ..............................................................................................................................53
References .................................................................................................................................54
vii
List of Tables
TABLE I List of known kinesin-1 binding proteins and the protein origin…………… 5
TABLE II All of the cargo proteins constructs with their specific start and end
positions, vectors, and their construct code…………………………………
25
TABLE III Themodynamic parameters of the respective TPR domains and cargo
Peptide……………………………………………………………………….
39
viii
List of Figures
FIGURE 1.1 Structures of KLC1 and KLC2 TPR domains…………………………… 8
FIGURE 1.2 Sequence alignment of KLC1 and KLC2 TPR domains………………… 9
FIGURE 1.3 KLC1-TPR structural alignment with other TPR domains……………… 11
FIGURE 1.4 Mechanism of interactions utilized by the TPR domain ………………... 12
FIGURE 1.5 Schematic showing the cargo proteins and their domain that interact
with KLC1.………………………………………………………………
22
FIGURE 3.1 Small Scale Solubility & Expression Test……………………………...... 31
FIGURE 3.2 Size Exclusion Chromatography Binding Assay ……………………….. 35
FIGURE 3.3 The crystallization drop of KLC1 and ALC1 complex………………...... 37
FIGURE 3.4 Crystals of KLC1 and pALC1 co-crystallizations……………………...... 38
FIGURE 3.5 Isothermal titration calorimetry data …………………………………… 40
FIGURE 4.1 The polyhistidine-tag linker blocking the groove of KLC1-TPR……….. 45
FIGURE 4.2 Structural insight into N343 of KLC1-TPR & S328 of KLC2-TPR ……. 47
FIGURE 4.3 The structure of S100A6 (PDB: 1K96) and the putative site of
interaction with KLC1-TPR……………………………………………...
48
FIGURE 4.4 Electrostatic potential of KLC1-TPR……………………………………. 49
FIGURE 4.5 Structural alignment of N301 polar patch to N343 polar patch…………. 51
ix
List of Abbreviations
A Alanine
Aβ -Amyloid
AD Alzheimer’s Disease
ALC1 Alcadein 1
AMPA -amino-3-hydroxy-6-methylisoxazole-4-propionate
APP Amyloid Precusor Protein
ARF6 ADP-ribosylation factor 6
BME -mercaptoethanol
CPP Conditioned Place Preference
CRMP2 Collapsin Response Mediator Protein 2
D Aspartic Acid
E Glutamic Acid
GRIP Glur2-interacting protein
GSK Glycogen Synthase Kinase
H Histidine
HAP1 Huntingtin-Associated Protein 1
HOP Heat Shock 70/90 Organizing Protein
HSC Heat Shock Protein
HSV Herpes Simplex Virus
IPTG Isopropyl β-D-1-thiogalactopyranoside
ITC Isothermal Titration Calorimetry
JIP JNK-interacting Protein
JNK c-Jun N-terminal Kinases
x
K Lysine
Kd Dissociation Constant
KHC Kinesin Heavy Chain
KIDINS220 Kinase D-interacting substrate of 220kDa
KIF Kinesin Superfamily of Proteins
KLC Kinesin Light Chain
KLCM1-TPR Kinesin Light Chain 1 TPR domain Mutant 1
KLCM2-TPR Kinesin Light Chain 1 TPR domain Mutant 2
LZD Leucine Zipper Domain
MAPK Mitogen-activated Protein Kinase
MBO Membrane Bound Organelle
MS Mass Spectrometry
N Asparagine
NFT Neurofibrillary Tangles
Ni-NTA Nickel nitrilotriacetic acid
p67phox 67kDa neutrophil oxidase factor
pALC1 Peptide Alcadein 1
pALCM1 Peptide Alcadein 1 mutant
PDB Protein Data Bank
PEX5p Peroxisomal targeting signal 1 receptor
pJIP1 Peptide JNK-interacting Protein 1
pJIPM1 Peptide JNK-interacting Protein 1 Mutant 1
pJIPM2 Peptide JNK-interacting Protein 1 Mutant 2
PP5 Protein Phosphatase 5
PTB Phosphotyrosinebinding
xi
Q Glutamine
RV Retention Volume
RW Red Wing
S Serine
SAD Selenium Anamalous X-ray Scattering
SEC Size Exclusion Chromatography
SGC Structural Genomics Consortium
SGT Small Glutamine-Rich Tetratricopeptide Repeat-Containing Protein
SLPM Standard Litres Per Minute
SNP Single Nucleotide Polymorphism
TEV Tobacco Etch Virus
TPR Tetratricopeptide Repeat
Trka Tyrosine Kinase Receptor
W Tryptophan
X11 Amyloid beta A4 precursor protein-binding family A member 2
1
1 Introduction
1.1 Intracellular Transport
Intracellular transport of proteins, lipids and organelles is vital for cell survival. In neurons,
protein synthesis machinery exists in the cell body, and synthesized proteins are transported to
their destinations via the axon which can exceed 1 metre in length. Therefore, neurons use an
intricate system of axonal and dendritic transport to traffic membranous organelles and protein
complexes along the cytoskeleton. Microtubules are the major cytoskeletal proteins located in
the axons and dendrites, whereas actin filaments are primarily located in the presynaptic
terminals and postsynaptic spines. The importance of proper intracellular transport is exemplified
by the fact that abnormal accumulation of organelles and proteins are the hallmark pathologies of
many human neurodegenerative diseases (De Vos et al., 2008).
1.2 Motor Proteins
Motor proteins travel on cytoskeletons in an ATP-dependent manner. Myosin proteins, which are
best known for their role in muscle contraction, bind to actin filaments. In comparison, kinesin
and dynein superfamily proteins move along the microtubules and constitute the majority of the
axonal transport system in neurons. Kinesins and dyneins have a common dimeric motor domain
(the ATPase domain) that moves by binding to and dissociating from microtubules. This
movement, powered by the hydrolysis of ATP, resembles “bipedal walking” (Verhey et al.,
2011). The microtubules are polarized into plus and minus ends, and kinesins and dyneins
cooperate to achieve bidirectional transports respectively. In neurons, the microtubule plus ends
point away from the cell body whereas the minus ends are towards the cell body from the cell
periphery. Kinesins transport cargos towards the plus end (known as anterograde transport) while
dyneins move towards the minus end (known as retrograde transport).
2
1.3 Kinesin
1.3.1 Kinesin Superfamily
The Kinesin superfamily (KIF) is composed of 15 families (Kinesin-1 to Kinesin-14 and orphan
kinesin), which are grouped into three different types depending on the location of the motor
domain. The motor domains are found in the N-terminal (N-KIFs) and, C-terminal (C-KIFs)
ends or in the middle (M-KIFs) (Miki et al., 2001). In humans, 45 genes encode for KIFs, with
39 N-KIF, 3 M-KIF and 3 C-KIF genes. Most of the KIFs retain a high level of sequence
homology of 30-60% among their motor domains, as they all utilize a similar mechanism to
move along the microtubule (Hirokawa & Noda, 2008). The rest of the protein is composed of a
coiled-coil stalk domain and unique regions for proper cargo recognition and transport
regulation.
The large number of KIFs reflects the multiple cellular functions that require the transport
system. Kinesins transport proteins, membrane bound organelles (Hirokawa & Noda, 2008),
synaptic vesicles (Hirokawa et al., 2009; Okada et al., 2005), mitochondria (Nangaku et al.,
1994), lysosomes (Nakata & Hirokawa, 1995), and are also involved in the recycling of
membranes between the golgi and endoplasmic reticulum (Lippincott-Schwartz et al., 1995).
KIFs participate in two forms of transport, fast and slow transport. Fast transport is associated
with membranous organelles that move at a rate of 50-400 mm/day whereas the slow transport
with the cytosolic and cytoskeletal proteins move at a rate of less than 8mm/day (Hirokawa,
1997). Interestingly, Kinesin-1(also known as KIF-5) is able to switch between fast and slow
transport, although the regulation of the switch between the two types of transport is not clear.
The functions of KIFs are not only limited to the aforementioned list of activities. Kinesin-13,
which is one of the few M-Kifs, is involved in cell division. Although the precise mechanisms
are not clearly understood, kinesin-13 is required for spindle assembly (Ganem & Compton,
2004), regulation of kinetochore-microtubule attachment during anaphase (Maney et al., 1998),
and chromosome segregation. With such functions, regulation of kinesin-13 has been a subject of
extensive research as a possible anti-carcinogenic target (Maney et al., 1998).
As every cell requires an intracellular transport system, KIFs are expressed ubiquitously in all
types of cells (Miki et al., 2003). However, due to greater dependence on the intracellular
transport machinery (Niclas et al., 1994), particularly high number of KIFs are present in
3
neurons. In the CA1 region of the hippocampus, as many as 19 different KIFs are expressed with
kinesin-1, kinesin-2, kinesin-3, and kinesin-4 having the highest level of expression.
1.3.2 Kinesin-1
The functional form of kinesin-1 is a heterotetramer of two kinesin heavy chains (KHCs) and
two kinesin light chains (KLCs) (DeBoer et al., 2008; Hirokawa, 1998). KHCs express the motor
domain that is required for cargo movement, while KLCs contain the tetratricopeptide repeat
(TPR) domain that interacts with kinesin-1 cargos.
Kinesin-1 is the major motor protein involved in anterograde transport, and currently 43 cargo
proteins are known to be transported by kinesin-1 (Gindhart, 2006). Of the 43 different cargos, it
is possible that the cargos do not interact directly with kinesin-1, but the interactions are
mediated by adaptor proteins. The cargos can be classified into five different groups: membrane
bound organelles (MBO), messenger RNAs (mRNAs), pathogens, cytoskeleton subunits, and
signaling proteins.
An example of kinesin-1 dependent MBO transport is the delivery of amyloid precursor protein
(APP) containing vesicles (Kamal et al., 2001). The transportation is mediated by an adaptor
protein, JNK-interacting protein-1 (JIP1), which interacts with both kinesin-1 and the APP
containing vesicle. A similar mechanism is involved in the transport of -amino-3-hydroxy-6-
methylisoxazole-4-propionate (AMPA) receptors to the plasma membranes via the Glur2-
interacting protein-1 (GRIP1) (Dong et al., 1997) (Wyszynski et al., 1999).
Proper transport of mRNAs is required for nervous system development and cell differentiation
during embryogenesis. This process involves large adaptor proteins such as fragile X mental
retardation protein and cytoplasmic polyadenylation element binding protein that mediate
complex formation between mRNAs and kinesin-1 (Ling et al., 2004; Tekotte & Davis, 2002).
Two known viruses that utilize the kinesin-1 transport machinery are herpes simplex virus
(HSV) and vaccinia virus (Diefenbach, Miranda-Saksena et al., 2002; Ward & Moss, 2004).
HSV infects neurons located at nerve terminals, by replicating in the nucleus and translocating to
the synapse. Kinesin-1 plays a role in the delivery of newly synthesized virus particles from the
nucleus to the synapse by interacting with US11 viral protein (Diefenbach, Miranda-Saksena et
4
al., 2002). Vaccinia virus produces a protein known as A36R, exclusively expressed in the
enveloped forms of virus, which mediates the interaction between the virus and kinesin-1 (Ward
& Moss, 2004).
Microtubules, which act as “road” for kinesins, are composed of - and -tubulins (Gindhart,
2006). The tubulin subunits are proteins that are transported by kinesin-1 to the dynamic ends of
microtubules, which are constantly in assembly and disassembly phases. Collapsin response
mediator protein 2 (CRMP2) is a tubulin binding protein that interacts with kinesin-1 to elongate
the microtubule (Kawano et al., 2005).
The Mitogen-activated protein kinase (MAPK)/c-jun N-terminal kinase (JNK) signaling pathway
is dependent on kinesin-1-mediated transport (Horiuchi et al., 2007). The MAPK/JNK signaling
pathway is primarily involved in stress response, as well as in nervous system development, cell
differentiation and apoptosis. JIPs act as a scaffold and bind to multiple subunits to amplify the
JNK signal. JIP, in turn binds to kinesin-1 to transport signaling proteins along the axon
(Whitmarsh et al., 2001). In conjunction with the dynein retrograde motor, kinesin-1 transports
signaling proteins to their destinations during stress response (Dong et al., 2005).
Kinesin-1 mediated transport is responsible for moving a diverse range of proteins, including
proteins known to perform important cellular functions and others with unknown functions.
Currently, the list of proteins that are transported by kinesin-1 is expanding.
1.3.3 Kinesin Heavy Chains
Kinesin heavy chains were the first identified components of kinesin protein and are the most
abundant of all motor proteins. In humans, there are three KHC isoforms (KIF5A, KIF5B, and
KIF5C), all of which are highly expressed in neurons within the CNS (Gindhart, 2006). KIF5A,
and KIF5C are neurospecific isoforms whereas KIF5B is ubiquitously expressed (Hirokawa &
Noda, 2008). KHC contains three domains: a motor domain that drives movement, an -helical
coiled-coil region that mediates dimerization of the two heavy chains, region that interacts with
KLCs (Diefenbach et al., 1998; J. G. Gindhart, Jr. et al., 1998). KHCs can form homo- and
heterodimers which in turn recruit KLCs. KHCs are widely recognized as the “engine” of
kinesin-1 as they contain the ATPase motor domain. However, in the absence of KLC, KHC has
5
6
the ability to bind to cargos directly and successfully transport them. Specifically, KHCs
transport SNARE (Diefenbach, Diefenbach et al., 2002), syntabulin (Su et al., 2004) and
syntaxins proteins directly via the C-terminal end.
To generate movement, one motor head of the KHC dimer uses hydrolysis of one ATP to swing
itself to the front of the second motor head that is not undergoing ATP hydrolysis. Subsequent
ATP hydrolysis in the second motor head moves the second motor head ahead of the first motor
head as the motor not undergoing ATP hydrolysis stays bound to the microtubule (Verhey et al.,
2011). This process generates a stepping motion of 8.3 nm along the microtubule per step.
Simultaneously, the C-terminal end is either bound to its cargo or the KLC-cargo complex.
1.3.4 Kinesin Light Chains
KLCs are important for cellular functions, and loss of KLCs leads to neuronal defects (Rahman
et al., 1999). KLCs are composed of three domains: the N-terminal heptad repeat, a TPR domain,
and a C-terminal domain. KLCs bind to KHCs through a coiled-coil motif in the heptad repeat.
The TPR domain is a well-known protein-protein interaction domain (Blatch & Lassle, 1999)
that mediates the interaction between kinesin-1 specific cargos with KHCs. In KLC1, the C-
terminal domain is responsible for the 19 alternatively spliced variants. It is believed that
different C-terminal lengths of the spliced variants may contribute to KLCs’ cargo specificity
(Wozniak & Allan, 2006).
Four KLC (KLC1-KLC4) isoforms exist in humans. With an exception to spermatids, all four
isoforms of KLC are expressed ubiquitously. KLC3 is the only isoform expressed in spermatids
while KLC1 and KLC2 are highly expressed in neurons (Junco et al., 2001). KLC1 is highly
expressed in the brain in a region-specific manner. The highest expression levels of KLC1 are
found in the hippocampus, striatum, amygdala, and frontal cortex (Bilecki et al., 2009).
Specifically, KLC1 is primarily localized in the cell bodies of neurons.
KLCs have been known to regulate KHC function by inhibiting the motor domain in the absence
of a cargo protein (Coy et al., 1999). This auto-inhibitory function helps the cells conserve
energy as ATP will not be wasted to move a kinesin that is cargo unbound.
7
Human KLC1 and KLC2 are composed of 573 and 622 amino acids respectively. KLC1 and
KLC2 share a high level of homology, with 69% identity throughout the whole protein. Most of
the variability arises within the C-terminal end of KLC2, which is 64 residues longer than KLC1.
This region allows KLC2 to interact with proteins such as Na-K-ATPase containing vesicles and
tyrosine 3-monooxygenase acting protein (Rong et al., 2007). Meanwhile, the TPR domains have
even higher homology with 87% identity (Fig 1.2). The variability arises mostly in the outer
helices and the non-TPR helix region. There is one difference that stands out between the helices
(helix-A) that form the groove of the KLC-TPRs at N343 of KLC1-TPR and S328 of KLC2-
TPR. Interestingly, the shorter KLC1 has specific cargos that KLC2 cannot bind, such as torsinA
and JIP1, which are two proteins implicated in the pathogenesis of torsion dystonia and
Alzheimer’s diseases (AD), respectively (Kamal et al., 2001; Kamm et al., 2004; King & Scott
Turner, 2004). In addition, both KLC isoforms can bind to common cargos such as alcadein-1
(ALC1) (Araki et al., 2007), JIP3 (Bowman et al., 2000), and CRMP2 (Araki et al., 2007;
Kawano et al., 2005). Due to the redundancy of the CRMP2 interaction between the KLC
isoforms, deletion of any one of the KLC genes does not result in any defects. Since the TPR
domains of KLC1 (KLC1-TPR) and KLC2 (KLC2-TPR) are highly homologous with different
cargo specificities, the mechanisms of interaction can be hypothesized by assessing their
differences.
1.4 TPR domains
TPR domains are characterized by 3-16 repeats of antiparallel -helices that generates a
right-handed super helix with a channel-forming groove. There are approximately 50 proteins
with the TPR domain that are involved in numerous cellular functions such as cell cycle control,
co-chaperone, and signal transduction (Blatch & Lassle, 1999; Lamb et al., 1995). The primary
function of this domain is to mediate protein-protein interactions. Sequence and structural
analysis of the TPR domain reveals conserved hydrophobic and small amino acids with a
modified loop region. This conservation gives the TPR domain the versatility to mediate protein-
protein interactions on several different proteins (D'Andrea & Regan, 2003). An interesting yet
common theme in -helical repeat protein structures such as the TPR domain structure is that
there are only small conformational changes upon binding to ligands or proteins (Grove et al.,
2008).
8
Figure 1.1 – Structures of KLC1 and KLC2 TPR domains. (A) KLC1-TPR domain indicating the
helix-A (Red) and helix-B (Blue). Every repeat is composed of one helix-A and one helix-B (B)
Structure of the KLC2-TPR domain (C) Structural alignment of KLC1-TPR (Orange) and
KLC2-TPR (Green) at a RMSD of 2.6 Å
9
KLC2 (KLC2-TPR) are highly homologous while having different cargos, this property can be
used to deduce the possible mechanisms of interaction.
The TPR domain of KLC1 and KLC2 have 13 -helices, 12 of which correspond to six TPR
repeats with one non-TPR helix in between repeats 5 and 6. The KLC TPR domain is larger,
with 42 amino acid repeats, compared to 34 residues of the consensus TPR domains (Fig 1.1).
This results in the lengthening of every helix in the KLC-TPR by one turn and may explain the
ability of KLCs to interact with a large number of proteins. Despite the addition of an extra turn,
the KLC TPR maintains the consensus TPR sequence within the 4th
and 37th
residues of its
repeat. Electrostatic charge calculations of KLC-TPR reveal a positively charged groove and a
negatively charged outer surface hot spots formed by inter-TPR loops.
The structural alignment of KLC TPR domains to the TPR domains of HSP70/HSP90 organizing
protein (HOP) (Scheufler et al., 2000), peroxisomal targeting signal receptor (PEX5p) (Gatto et
al., 2000), protein phosphatase 5 (PP5) (Das et al., 1998), p67phox (Lapouge et al., 2000) and
small glutamine-rich tetratricopeptide repeat containing protein (SGT) (Dutta & Tan, 2008)
demonstrates the high level of structural versatility of the KLC1 TPR domain (Fig 1.3).
Alignment of the KLC1-TPR with HOP, PEX5p, PP5, and SGT start from TPR2 or TPR3
onwards (Holm & Park, 2000). Moreover, a synthetic consensus TPR motif designed using
amino acids with the highest propensity at each position was aligned starting at TPR3 of the
KLC1 TPR domain (Kajander et al., 2007). In contrast, the TPR domain of p67phox is the only
Figure 1.2 – Sequence alignment of KLC1-TPR and KLC2-TPR. All of the helices are TPR helices
except for 11 and 10 for KLC1-TPR and KLC2-TPR, respectively
10
region of the protein that aligns with KLC1 from TPR1, which is the repeat with the greatest
variance. These two alignment characteristics may be indicative of the differences and
similarities with respect to the mechanism of interaction which will be discussed below.
Although primary sequence comparisons of the KLC TPR domains share a sequence identity of
less than 20% with other TPR domains, they show modest structural homology with Root-Mean-
Square-Deviation (RMSD), a measure of the average deviation of -carbons of the two proteins,
values below 3.0Ǻ. This structural conservation helps model the binding sites of the KLC TPR
domains for various cargos, as the binding sites of several TPR domains have already been
identified for their binding partners.
The structural alignment of the KLC1-TPR to the protein partner bound p67phox and HOP sheds
light on the possible mechanisms of interaction with cargos. P67phox is one of the cytosolic
subunits of NADPH oxidase. A crucial step in activating the NADPH oxidase is the binding of
p67phox to Rac (Lapouge et al., 2000). This interaction is mediated by a series of hydrogen
bonds formed by a network of polar residues on p67phox; serine, histidine, arginine, asparagine,
and two aspartic acids located on the outer surface of the TPR domain. Interestingly, the
corresponding residues of the KLC1-TPR conserve the polarity with its own polar residues such
as histidine and lysine, which are located within the inter-TPR loops (Fig 1.4A).
The second binding site is located within the concave groove formed by the superhelical turns of
the TPR domain. HOP acts as a co-chaperone to the Hsp70 and Hsp90 proteins and links the two
proteins together (Scheufler et al., 2000). To do so, HOP utilizes “asparagine clamp” formed by
a pair of aspartic acid residues located within the groove. This is aided by a series of polar
residues such as lysine and serines that are capable of forming hydrogen bonds. Hydrophobic
residues surrounding the clamp provide further specificity to bind to Hsp by providing
11
Figure 1.3 – KLC1-TPR structural alignment with other TPR domains. KLC1-TPR (green)
alignment with TPR domains (red); (A) SGT (RMSD: 2.6 Ǻ) (B) Consensus Sequence (RMSD:
2.1 Ǻ) (C) HOP (RMSD: 2.1 Ǻ), (D) p67phox (RMSD: 2.6 Ǻ), (E) Pex5P (RMSD: 3.2 Ǻ), (F) PP5
(RMSD: 2.8 Ǻ). The structural alignment was completed with DaliLite (Holm & Park, 2000).
12
Figure 1.4 – Mechanism of interactions utilized by the TPR domain. (A) Alignment of KLC1-
TPR (Orange) with p67phox (Marine) in complex with Rac1 (Yellow) (B) Alignment of KLC1-
TPR (Orange & PDB: 3NF1) with HOP1 (Marine) in complex with Hsc70 peptide (Yellow)
13
hydrophobic contacts. Again, the alignment of the KLC1-TPR to HOP conserves this similar
interface (Fig 1.4B). The corresponding residues in the KLC1-TPR form a similar “clamp” with
N259 and N302 and are supplemented by similar polar residues such as lysine in position 340
and 344.
1.5 Introduction to Kinesin-1’s Cargo and Biological Relevance
1.5.1 Alzheimer’s disease (AD)
Deficient or abnormal axonal transport in neurons is frequently observed in humans with
neurodegenerative diseases (Stokin et al., 2005). In particular, axonal swellings that are caused
by abnormal accumulation of cargo proteins are a common pathological characteristic of these
diseases (Coleman, 2005). Alzheimer’s disease (AD), the most common form of dementia, is
characterized by the presence of neurofibrillary tangles (NFTs) and senile plaques (Mountjoy et
al., 1983). NFTs are aggregates of helical filaments and hyperphosphorylated tau proteins that
disrupt microtubule-mediated axonal transport. Senile plaques are extracellular deposits
composed of -amyloid (A) that are concurrently found in dystrophic neurites and axonal
swellings. A is generated by proteolytic cleavage of APP. APP is a type 1 transmembrane
protein, and mutations in the gene encoding this protein are implicated in familial Alzheimer’s
disease (Ertekin-Taner, 2007). The role of this protein is still unclear, although the possible
functions include cell-cell interaction, cell adhesion, protease inhibition and neurite outgrowth
(Turner et al., 2003).
APP metabolism and its axonal transport are closely associated with AD. However the role of
APP in the pathogenesis of AD is complex and not fully understood. APP is cleaved by two
proteases, -secretase and -secretase to generate the most potent 42-residue -amyloid.
Temporal regulation of this cleavage is unclear, although APP is thought to be susceptible to
proteolytic cleavage during axonal transport, on the plasma membrane, and during endocytotic
cycles (Suzuki et al., 2006). APP is transported in the axon by kinesin-1 via JIP1. Alcadein-1
(ALC1) is another type 1 transmembrane protein that is transported by kinesin-1, albeit through a
direct interaction with kinesin-1. This interaction inhibits the transport of APP by inhibiting the
JIP1 and KLC1 interaction. ALC1 also inhibits the formation of the JIP1-APP complex by
forming a tripartite complex with APP through a neural-specific adaptor protein, X11 (Araki et
14
al., 2004; Konecna et al., 2006). This complex, which is formed exclusively in the plasma
membrane and the golgi apparatus and not during axonal transport, stabilizes and protects APP
from degradation (Suzuki et al., 2006). The suppression of APP transport by ALC1 has been
shown to facilitate A generation, which mimics the process of AD pathogenesis. Similar to
APP, ALC1 accumulates in dystrophic neuritis in AD brains, suggesting significant roles for
both JIP1 and ALC1 in the transport of APP and generation of A.
Kinesin-1 is involved in the alternative mechanism of neurodegeneration, tauopathies. Tau is a
microtubule-binding protein that stabilizes microtubules and regulates kinesin- and dynein-
mediated axonal transport (Dixit et al., 2008). Not only are hyperphosphorylated tau proteins a
component of the NFTs, overexpression of tau impairs kinesin-dependent transport of cargos
(Stamer et al., 2002). Hallmarks of transport defects such as axonal protein accumulation and
neuritic swelling are associated with the phenotypes caused by hyperphosphorylated tau proteins
(McGowan et al., 2006; Terwel et al., 2002). In mice models, these hallmark signs of
neurodegeneration have been shown to occur early and distant from A deposition sites. Not
only can abnormal tau seem to spark the cascade of neurotoxicity, but abnormal KLC1 can lead
to the same pathway. In Klc1-/-
mice, cargo and tau proteins were accumulated, causing
axonpathies (Falzone et al., 2009). The stress caused by axonpathy leads to increased JNK-
mediated stress response. Direct inhibition of KLC1-driven kinesin-1 transport demonstrates the
pathological consequences of misdirected cargo proteins.
1.5.2 Huntington’s Disease (HD)
Kinesin-1 cargo includes an adaptor protein known as huntingtin-associated protein-1 (HAP1)
(McGuire et al., 2006). This protein is implicated in neurite growth and in increasing synaptic
transmission and plasticity (Harjes & Wanker, 2003). HAP1 also interacts with the protein
responsible for Huntington’s disease, huntingtin (Htt). Normal Htt is involved in the transport of
neutrophin containing vesicles, whereas the polymorphic Htt which contains a glutamine residue
tail (polyQ) exceeding 36 residues, interferes with this transport (Caviston & Holzbaur, 2009).
At the same time, the length of the polyQ tail is directly correlated with the binding affinity with
HAP1. Htt mutants with polyQ tails that exceed 36 amino acids are toxic to neurons. One
possible mechanism of toxicity by the Htt mutant is the consequence of increased affinity for
15
HAP1. This interferes with HAP1’s cellular function as an adaptor protein in vesicle transport
(Gauthier et al., 2004) and decreases the trafficking of brain-derived neurotrophic factor (BDNF)
and receptor tyrosine kinase (TrkA) for which HAP1 is responsible for. Suppression of HAP1
also inhibits GABA-receptor trafficking which suggest that HD pathogenesis may be linked to
the inability of HAP1 and kinesin-1 to transport these cargos (Falzone et al., 2009).
1.5.3 Mood Disorder
Chronic consumption of opioids can lead to the impairment of axonal transport system (Beitner-
Johnson & Nestler, 1993). Klc1 is a candidate gene for opiod addiction, as KLC1 expression
levels directly correlate with opiod addiction levels (Kabbaj et al., 2004). Increased KLC1
expression in amygdala, frontal cortex and hippocampus had clear correlations with condition
place preference scores of morphine conditioned mice.
Although, glycogen synthase kinase 3 (GSK3) is a kinesin-1 cargo, it is able to regulate
kinesin-1 transport. GSK3 phosphorylates KLC1 at serine 460 (S460) and regulates the
transport of its cargos (Vagnoni et al., 2011). One notable example is the transport of AMPA
receptors through the interaction with GRIP1 (Dong et al., 1997). GSK3 phosphorylation
causes the dissociation of KLC from the GRIP1-AMPAR complex, which in turn brings the
trafficking of AMPA receptors to a halt (Du et al., 2010). Such changes lead to an anti-
depressant like effect in animal models and mimicked lithium’s effect. For this reason, this
transport mechanism has been a target for mood disorders as AMPA receptor trafficking is
important for synaptic plasticity.
1.5.4 Diabetes
The significance of kinesin-1 function is also evident in pancreatic -cells (McDonald et al.,
2009; Varadi et al., 2002). As an initial response to increased blood glucose levels, insulin is
released from insulin granules from the plasma membrane. The second phase requires the
mobilization of insulin granules to the periphery from intracellular storage pools to sustain high
insulin concentrations. Kinesin-1 takes part in the second phase of granule mobilization, as the
inactivation of kinesin-1 inhibits the granule mobilization (Varadi et al., 2002). Conditional
16
Kif5b knockout mice showed glucose intolerance due to insulin secretory defects (Cui et al.,
2011). The importance of kinesin-1 and insulin may also lie in the fact that kinesin-1 is involved
in the -cell development in addition to mobilizing the insulin granules.
1.5.5 Axon Outgrowth
Several kinesin-1 cargos are involved in axonal outgrowth and are required in the growing ends
of axons. One of the cargos that are upregulated during development is CRMP2. The upregulated
protein localizes in the distal parts of growing axons and is required for axonal outgrowth as the
knock down of CRMP2 suppresses axon formation (Byk et al., 1998; Inagaki et al., 2001).
Kinesin-1 is responsible for transporting CRMP2 to these distal ends of axons (Kawano et al.,
2005). Therefore the knockdown of KLC1 and KLC2 suppressed axonal outgrowth as CRMP2
could not be accumulated at the axon tips.
Another protein in the JIP family, JIP3, is exclusively expressed in the brain. JIP3 acts as an
adaptor protein, and mediates the transport of TrkB receptors that are used in signal transduction
(Huang et al., 2011). As such, the disruption of JIP3 halts the TrkB induced axonal filopodia
formation. In axon outgrowth, these filopodia are essential in proper growth cone extension
which is malformed in cells without JIP3 (Cavalli et al., 2005).
Early onset dystonia is a movement disorder caused by mutagenic torsinA protein (Kamm et al.,
2004). TorsinA interacts with KLC1 and is transported to the distal ends of axons where it
colocalizes with growth cones. Interestingly, the mutant form of torsinA does not get transported
and accumulates only in the cell body of the neuron (Granata et al., 2009). Although the function
of torsinA is not clearly understood, it’s speculated that, it functions in enhancing synaptic
plasticity, which is important for motor learning in the brain.
Kinase D-interacting substrate of 220 kDa (KIDINS220) is a membrane protein and a binding
partner of KLC1 (Bracale et al., 2007). KIDINS220 is a downstream target of neutrophins and is
transported to growing neurites where it interacts with Rho family proteins to regulate axon
growth. Therefore, the inhibition of this transport interferes with neurite outgrowth in PC12 cells
(Neubrand et al., 2010).
17
1.6 Clinical Relevance
1.6.1 Kinesin Light Chain Single Nucleotide Polymorphisms
Although the known single nucleotide polymorphisms (SNPs) of Klc1 are all in the introns or
transcription factor binding sites, several of the SNPs in the Klc1 gene have clinical relevance
(Andersson, Sjolander et al., 2007; Andersson, Zetterberg et al., 2007; Dhaenens et al., 2004;
Szolnoki et al., 2007a; von Otter et al., 2009). There are 668 known SNPs, two of which are
significantly associated with some form of degenerative disease. The most convincing evidence
comes from SNP rs8702 and the risk of leukoaraiosis. Hypertensive smokers with the rs8702
(G56836C) SNP showed a 7 fold increase in the risk of leukoaraiosis and showed markedly
increased cognitive disturbances and neurodegeneration (Szolnoki et al., 2007b). The same SNP
was associated with other forms of degenerative diseases, and increased risks for AD and
cataract by 1.7 fold (von Otter et al., 2009). These effects of rs8702 SNP are believed to be
caused by changes in mRNA splicing. Another SNP, rs8007903, also significantly increases AD
risk all the while decreasing the risk of cataract. Although the associations between Klc1
polymorphisms’ and disease risk are starting to emerge, no genome wide association studies
have been able to find the same association. As such, Klc1 polymorphisms require more
experimental studies to clarify the role of the Klc1 gene.
1.6.2 Kinesin-1 as a Drug Target
Currently there is no drug on the market to target the kinesin family of proteins for therapeutic
purposes. But as a side effect, there are drugs such as lidocaine that inhibits the transport system
by blocking the motor head and neck junction (Miyamoto et al., 2000). Furthermore, acrylamide
covalently binds to kinesin achieving 100% detachment of the protein from microtubules at
concentrations of 1 mM (Sickles et al., 1996). However, the kinesin family of proteins has not
been subjected to major drug development as a target for therapeutics. Primarily, diseases
associated with kinesin are caused by the obstruction and impairment of the kinesin transport
making it difficult as a therapeutic target. Kinesins could be a target when its normal function is
abused by the cellular system making it more disease prone in cases such as cancer. The KIF5B
mRNA is upregulated in cancer cells and tissues, and the depletion of KIF5B induces apoptosis
in HeLa cells, making it a possible target in anti-neoplastic treatment (Yu & Feng, 2010).
18
Kinesins in pathogens such as bacteria, virus, and parasites are also suitable targets (Dumont et
al., 2010; Ward & Moss, 2004). KIF5, kinesin-1 homologue in vaccinia virus, is responsible for
carrying the viral protein A36R. This protein also interacts with the TPR domain of KLC1, and
helps transport vaccinia viruses across the cell. Inhibitors of the interaction between the proteins
may serve as a target. A more difficult and unclear strategy of kinesin targeting is with respect to
neurodegenerative disease. Diseases such as, Alzheimer’s diseases, Huntington’s disease, torsion
dystonia are heavily interconnected and reliant on the transport system but are a good example of
the difficulty in targeting kinesins as all of these diseases are associated with the impairment of
kinesins.
1.7 Macromolecular Crystallography
There are several ways to obtain the structural model of macromolecules. Two of the most
prominent methods are Nuclear Magnetic Resonance (NMR) and X-ray crystallography. NMR
uses high frequency magnetic fields to stimulate and measure the resonances of nuclei to locate
protein atoms. X-ray crystallography uses the photon diffraction of electrons to obtain structural
models. NMR has its advantages in that the proteins are in solution which allows the capture of
kinetics, motion and the functional active sites, whereas, x-ray crystallography has limited
restriction in the size of the proteins.
Macromolecular crystallography is the method of choice for determining the 3D protein. As of
May 2011, crystallography accounts for more than 63900 structures out of 73300 in the Protein
Data Bank (PDB). Proteins naturally exist in aqueous conditions whereas the proteins solved by
crystallography are in the crystalline state. This has caused some differences in the crystal
structures compared to the solution structures, but these differences occur on rare occasions.
Evidence that proteins in the crystalline state retain their biologically important conformations is
that the proteins are able to interact with their substrates or catalyze a kinetic reaction within the
crystal.
For successful crystallization, the protein must be ordered and aligned into a crystal lattice
(Blundell & Johnson, 1976). Purity of the protein is a main determinant for growing crystals. In
the case of co-crystallization of a protein-protein complex, it would be ideal if the solution
contains only the complex without any un-bound individual proteins. Crystals form as a protein
19
drop, highly concentrated before equilibration (5-50 mg/mL), becomes supersaturated by
precipitants using the vapour diffusion method. Vapour diffusion is a technique used to slowly
increase the concentration of the protein drop by sealing the protein drop and a reservoir
containing precipitants in a chamber, which is separated by a vapor phase. In the sealed chamber,
water molecules of the protein drop, which also contains the same precipitant as the reservoir but
at a lower concentration, diffuse into the reservoir, hence slowly approaching the same
concentration of precipitant in the reservoir and the protein drop.
To build a structural model from the crystal, an x-ray beam is passed through the cryo-cooled
crystal, collecting the diffraction patterns by rotating the crystal. The diffraction represents the
amplitude of the structure factors, whereas the phase angles and the amplitudes of the structure
factors are required for calculating an interpretable electron density map. By using methods such
as isomorphous replacement, anomalous scattering, and molecular replacement, the phase angles
are estimated and optimized to yield an accurate electron-density map that can be used to create
the structural model.
Not only are we able to see the structural aspects of the macromolecule from the model, but more
information on how the molecule actually works can be acquired. The structural model can be a
powerful tool to gather information on how KLC binds to and disengage from its cargos, what
the mechanism of action KLC uses can be deduced.
1.8 Hypothesis & Approach
As outlined in the introduction, the importance and function of kinesin-1 are highly
interconnected to the cargos’ function. Since kinesin-1 transports over 40 different cargos, it
plays a role in a wide range of biological functions. The majority of research into kinesin-1
dependent axonal transport has focused on identifying cargos and the importance of cargo
transport. Meanwhile, understanding of the mechanism of cargo recognition by kinesin-1, and of
cargo dissociation from kinesin at the destination is limited. The mechanism of cargo recognition
is of special interest as KLC1 and its TPR domain are responsible for many different cargos.
Also, there has yet to be identified KLC1 binding motif that is conserved in the cargo proteins.
What allows the TPR domain to recognize so many binding partners? What are the binding sites
20
on the TPR domain to accomplish this and how many sites are there? How do the cargos share
the TPR domain to reach their own destinations?
For instance, no two of the same family of domains interact with KLC1-TPR. Although, JIP1,
ALC1, and torsinA use their C-terminus to interact with KLC1-TPR, no common KLC binding
site has been found. JIP3 uses its Leucine zipper domain (LZD) which is an -helix dimer,
which bears no resemblance to the other cargos (Fig 1.5A). For some cargos such as JIP1, ALC1,
and Daxx, the sequences involved in the interaction with KLCs’ are known. As mentioned, the
highly homologous KLC1-TPR and KLC2-TPR have differential binding properties towards
JIP1, even though little variability rises within the groove of the TPR domain. Together with the
known mechanism of HOP-TPR and HSc interaction which utilizes the groove, we hypothesize
that one way KLC1-TPR achieves its cargo recognition is through a “clamp” similar to that of
the HOP-Hsc70 interaction that will involve N343. Here we will investigate the mechanism of
the interaction between KLC and its cargos at the protein and peptide level by using X-ray
crystallography, biochemical assays, mutagenesis studies, and the analysis of the structural
models in order to explain the cargo interaction mechanism in molecular detail.
1.8.1 X-ray Crystallography
By using X-ray crystallography, it is our goal to obtain structural models for KLC and its cargo
proteins in their complex form. Also the obtained KLC structures will be the basis for
understanding the cargo recognition mechanism.
1.8.2 Biochemical & Biophysical Assays
By using the well established techniques such as isothermal titration calorimetry and size
exclusion chromatography, we will investigate the binding characteristics of KLCs and their
cargos. Site-directed mutagenesis will be used to investigate the importance of specific residues
of KLC and its cargos.
21
1.8.3 Analysis of Structural Model
There have been several mutational analyses of KLCs in the literature. By mapping these
mutants onto our KLC structure, we will deduce possible binding sites of KLCs and their
important regions for cargo interactions.
22
Figure 1.4 – Schematic showing the cargo proteins and their domain that interact with KLC1.
(A) Different types of domains binding to the TPR domain of KLC (B) Sequences that are
known to be important in the interaction with the cargo protein and KLC-TPR. The key residues
are highlighted in red.
23
2 Materials and Methods
2.1 Cloning
For the generation of the constructs: KLC1 (BC008881) and KLC2 (BC034373) TPR domains,
ALC1 (BC033902), CRMP2 (BC067109), DAXX (BC109074), HAP1 (BC034089)
JIP1(BC068470), JIP3(BC137124), KIDINS220 (BC130610), S100A2 (BC002829), and TorA
(BC000674), the cDNA templates were obtained from the Mammalian Gene Collection (MGC).
PCR was carried out using a Thermocycler (Eppendorf) and Pfu Ultra polymerase (Stratagene).
The PCR conditions were 95C for 2 min, then 20 cycles of 95
C for 30 seconds, and 5
C under
Tm of the primers for 30 seconds, and 72C for 1 minute for every kilobase. The PCR was
finished with 10 minute 72C annealing step. Using different primers, we made multiple
constructs of different lengths from the same template, resulting in three ALC1, four CRMP2,
five DAXX, eight KIDINS220, fifteen JIP1, six JIP3, two S100A2, and four TorA constructs
(Table II). There were also fourteen KLC1 constructs and six KLC2 constructs. The PCR
products were confirmed on 1.5% agarose gels and purified using a PCR purification kit
(Qiagen). Three different plasmids were used as cloning vectors, pET28-MHL (NCBI:
EF456735), pET28-GST (NCBI: EF456739) and pNIC-CH (NCBI: EF199843). Annealing of
the PCR products to the vectors was completed with the In-Fusion Dry-Down PCR Cloning Kit
(Clontech) and restriction enzymes BseRI (New England Biolab) for the pET28-MHL and
pET28-GST vectors and BfuAI (New England Biolab) for the pNICH-CH vector. 30ng of vector
was mixed with 25-50ng of the PCR product and half of an infusion pellet. The mixture was
incubated in 37C for 30 minutes. The annealed products were then transformed into DH5
(Stratagene) competent cells for plasmid propagation and the newly grown colonies were tested
with PCR to confirm the successful ligation of construct to the plasmid. Confirmed colonies
were grown in 5 mL of Lysogeny Broth (LB) and purified with MINIPREP (QIAGEN). Purified
plasmids were re-transformed into BL21(DE3)-p2RARE (Stratagene) competent cells.
2.2 Site-directed Mutagenesis
KLC1-TPR and KLC2-TPR mutants were prepared using QuickChange®
kits (Stratagene). Using
the cloned KLC1 construct with TPR-domain only (amino acids 205-497) and KLC2 construct
with TPR-domain only (amino acids 217-480) as a template and mutagenesis primers, 5’
24
GTTGCCAAGCAGTTAAGTAACTTGGCCTTACTGTGC 3’ and 5’
CAGTAAGGCCAAGTTACTTAACTGCTTGGCAACATC 3’, the KLC1 N343S mutation was
achieved with PCR. For the KLC2 S328N mutation, KLC2 construct was used as a template with
primers, 5’GTGGCCAAGCAGCTCAGCAATCTGGCCCTGCTG 3’ and 5’ CAGCAGG
GCCAGATTGCTGAGCTGCTTGGCCAC 3’. The PCR condition was similar to the condition
used for cloning. The PCR products were digested with Dpn1 for 100 minutes and purified with
MINIPREP (QIAGEN) and then were transformed into DH5 competent cells. Cells grown with
DH5 transformed KLC mutants were purified with MINIPREP (QIAGEN) then transformed
into BL21 (DE3)-p2RARE (Stratagene) competent cells. All cloned constructs were verified by
DNA sequencing prior to expression. The sequencing to confirm the site-directed mutagenesis
was done by ACGT DNA Technologies Corporation (Toronto).
2.3 Solubility Test
Constructs transformed into BL21 (DE3)-p2RARE cells were grown in 2 mL lysogeny broth
(LB) for 18 hours at 37C in a shaker. To prepare a 33% glycerol stock, 300 L of the culture
was removed and mixed with 65% glycerol, flash-frozen and stored in -80C. 50 l of the culture
was added into 3 mL of terrific broth (TB) and were grown further at 37C in a shaker until the
optical density at wavelength 600 nm (OD600) reached ~3.0. The shaker temperature was
reduced to 18C and isopropyl β-D-1-thiogalactopyranoside (IPTG) was introduced to a final
concentration of 1 mM. 18 hours after induction, the cultures were centrifuged, and the pellet
was suspended in 300 L of suspension buffer containing 30mM HEPES 7.4, 200 mM NaCl, 5%
glycerol, 5 mM imidazole, and 5 mM -mercaptoethanol (BME). 800 L of suspension buffer
containing 1% CHAPS, protease inhibitor cocktail (Sigma), 500 units of benzonase, and 5%
(w/v) lysozyme in addition to suspension buffer was added to the suspended cultures. To test the
expression, 10uL of the lysed samples were collected and analyzed on sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE). Mini-PROTEAN TGX gels (BioRad) was
used at 180 volts for 30 minutes. To test the solubility of the protein constructs, the lysed
samples were centrifuged and the supernatant was collected. 20 L of Nickel- nitrilotriacetic
acid (Ni-NTA) beads were incubated with the supernatant for 10 minutes and the protein was
25
26
eluted with 20 L of elution buffer (suspension buffer with an additional 300mM imidazole). 10
L of loading dye with 1:10 BME was added into the eluted protein. 10 L of eluted protein
solution was run on the same gel as the expression test samples and run on PAGE to assess the
expression and solubility of the protein constructs. The gels were stained with InstantBlue
(Expedon), a Coomassie based gel stain, for 20 minutes. The results of this solubility test were
used to select the most promising constructs to express and purify in large-scale quantities.
2.4 Expression
For every soluble construct, seed cultures were grown initially in 50 mL LB overnight at 37C in
a shaker. The overnight cultures were then transferred into 1.8L TB containing bottles. These
bottles were attached to the Liquid Expression Bubbling system at 1 standard litres per minute
(SLPM) per 1L of culture at 37C. The cell growth was continued until the OD600 of the culture
reached ~3.0, when IPTG was introduced to a concentration of 1 mM. Further cell growth was
carried out at 18C for 16-18 hours with 0.5 SLPM per 1L of culture. The cells were harvested
by centrifuging the samples at 12195 RCF for 10 minutes and the pellets flash frozen and stored
at -80C
for future use. To test the expression of each culture, 1 mL from each construct was
removed to test for protein expression on SDS-PAGE.
2.5 Purification
2.5.1 Cell Lysis
The frozen cell pellets were re-suspended in binding buffer containing 30mM HEPES 7.4, 200
mM NaCl, 5% glycerol, 5 mM imidazole, and 5 mM BME. Before cell lysis, 0.5% 3-[(3-
cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 500 units of benzonase
nuclease, 1 mM phenylmethanesulfonylfluoride (PMSF), 1 mM benzamidine was added. The
cells were lysed in a sonicator at 120W for 8 minutes with ON and OFF periods of 10 seconds
and 15 seconds, respectively on ice. Lysed cells were centrifuged for 80 minutes at 4C at 39000
RCF, the supernatants filtered with cheesecloth were incubated with 2-5 mL of Ni-NTA resins
suspended 50:50 in ethanol at 4C for 1 hour.
27
2.5.2 Metal Ion Affinity Chromatography
Metal ion affinity chromatography was carried out using open columns. The Ni-NTA resins were
washed with 50 mL of binding buffer, then 20-50 mL of washing buffer (30 mM HEPES 7.4,
200 mM NaCl, 5% glycerol, 30 mM imidazole, and 5 mM BME), and eluted with 10 mL of
elution buffer (30mM HEPES 7.4, 200mM NaCl, 5% glycerol, 300 mM imidazole, and 5 mM
BME). The polyhistidine-tags of KLC1 and KLC2 were cleaved using 1:50 tobacco etch virus
(TEV) protease at 4C while being dialyzed against the gel filtration buffer (30mM HEPES 7.4,
200 mM NaCl, 5% glycerol, 1 mM tris(2-carboxyethyl) phosphine (TCEP)) for 12 hours.
Cleaved polyhistidine-tags were removed with the second pass over a Ni-NTA column.
2.5.3 Size Exclusion Chromatography
Eluted proteins and polyhistidine-tag removed KLC1 and KLC2 were further purified using the
AKTAFPLCTM
(GE Healthcare). HiLoad SuperdexTM
75, and HiLoad SuperdexTM
200 26/60
columns were used to carry out size exclusion chromatography (SEC). Following columns
equilibration with the gel filtration buffer, protein samples were loaded onto the columns at 4
mL/min. The column was subsequently passed with 1.2 column volume and fractions of 2-4 mL
were collected from 0.3 to 0.8 column volume (CV). Fractions that corresponded to protein
peaks on the UV chromatograph (A280) were collected and concentrated with Amicon Ultra-15
centrifugal filter units (Milipore). 10-20 l of protein samples were removed from various
expression and purification steps including cell lysis, metal ion affinity chromatography, and
SEC to analyze on SDS-PAGE. Protein concentration was obtained by measuring A280 with
NanoDrop 1000 Spectrophotometer (Thermo Scientific).
2.5.4 Ion Exchange Chromatography
KLC1 samples that contained contaminants were further purified using a MonoS 10/100 column
(GE Healthcare). The column was equilibrated with Buffer A (30 mM Bis-Tris 6.5, 5% glycerol)
for 20 CV. The protein samples were loaded onto the column at 2 mL/min, and at 2 mL/min the
Buffer B (30 mM Bis-Tris 6.5, 5% glycerol, 1M NaCl) was added slowly as a gradient to 100%.
28
4 mL fractions were collected and the corresponding protein peaks were analyzed on SDS-
PAGE.
2.6 Binding assay using size exclusion chromatography
For the purification of protein complex, KLC1 was mixed with its cargo to follow the same
method as the size exclusion chromatography purification of the single protein (section 2.5.3).
0.5 mL of purified and concentrated protein samples were loaded onto the Superdex 10/300 GL
columns (GE Healthcare) manually with 1 mL syringe. With minimal tubing connection and at a
flow rate of 0.5 mL/min, samples of KLC1-TPR alone, cargo protein alone, and a mixture of
KLC1-TPR and cargo protein together were run separately. UV chromatograph of the SEC runs
was overlaid using the UNICORN System Control (GE Healthcare). The fractions of the newly
formed protein peaks were collected and analyzed on SDS-PAGE gel.
2.7 Crystallization
Crystallization trials were carried out using KLC1 with its cargo protein (ALC1, CRMP2, HAP1,
JIP1, JIP3, S100A6) and cargo peptides (pALC1, pJIP1). The proteins were concentrated to 10-
20 mg/mL by using Amicon Ultra-15 centrifugal filter units (Milipore) and the concentrations of
the cargo peptides were 1.5-2.0 times higher than that of KLC1. Initial crystallization trials were
performed by the sitting drop vapour-diffusion method. Structural Genomics Consortium (SGC),
and Red Wing (RW) buffer kits (96-well plate format) were used to set drops mixed from 0.5 L
each of protein and well solutions. These drops were placed automatically using the Phoenix
robot (Rigaku), an automated drop setter, from well solution reservoirs containing 100ul of the
buffer. The KLC1 and ALC1 co-crystallization trial was also conducted with a manual buffer
screen optimized for protein complex crystallization in addition to the SGC and RW buffer kits.
For the manual buffer screen, 24-well plates were used and equal drops of 1ul protein and well
solution were mixed manually. Optimization trials for crystals that had formed were set on both
24-well hanging drop and sitting drop plates. The crystallization plates were kept at 18C and
were checked with the help of a microscope at 2 days, 1 week, and 2 week time intervals.
29
Crystals were mounted in cryoloops (Hampton Research) and were immersed in either paratone
oil or the well solution containing an additional 10-15 % glycerol and were cryo-cooled in liquid
nitrogen for screening.
Structural figures were generated using PyMol (http://www.pymol.org) and sequence alignments
were performed with ClustalW and rendered using ESPript (Chenna et al., 2003; Gouet et al.,
1999). The structural alignments were performed using DaliLite (Holm & Park, 2000).
2.8 Isothermal Titration Calorimetry (ITC)
To prepare for ITC, purified KLC1 samples were concentrated to 80-120 M. The peptides:
JIP1(Ac-CPTEDIYLE-COOH), JIPM1 (Ac-CPTQNIYLE-COOH), JIPM2 (Ac- CPTEDIYLQ),
ALC1 (Ac-KESEMDWDDSA-COOH), and ALCM1 (Ac-SEMDWNNSA-COOH), were
synthesized by Tufts University Core Facility. The peptides were mixed with buffer to a
concentration of 1-3 mM. Both protein and peptides were dialyzed against the same buffer (20
mM Bis-Tris 6.5, 500mM NaCl, 0.5mM TCEP) for 18 hours using Spectra/Por cellulose ester
100-500 molecular weight cut off tubing (Spectrum Labs).
ITC was used to measure binding affinities using VP-ITC microcalorimeter (MicroCal Inc.) at
25C by injecting 5-10 L of peptide solution into the sample chamber containing the KLC. A
total of 25 injections were performed with an interval of 300 seconds and a reference power of
13 μcal/s. Thermodynamic parameters and Kd were calculated using Origin (MicroCal Inc.) and
the data were fit to a one-site binding model.
2.9 Structural Analysis
Visual analysis of the KLC1-TPR and KLC2-TPR structures and possible mechanism of
interaction deduction was carried out using PyMOL (Schrodinger LLC). Mutated residues
investigated were taken from a yeast-two hybrid study with an error prone PCR conducted by
Hammond et al., and a site-directed mutagenesis study by Nguyen et al., (Hammond et al., 2008;
Nguyen et al., 2005). The structural model of KLC1-TPR (PDB: 3NF1) was used for the
analysis.
30
3 Results
3.1 Crystallography
3.1.1 Solubility & Expression of Constructs
A total of 52 constructs were successfully cloned and preliminary experiments were conducted to
establish the best constructs for crystallization and binding experiments. Solubility and the
expression level were evaluated by small-scale solubility tests. The intensity of the supernatant
bands on the SDS-PAGE gel allowed us to assess the solubility whereas the intensity of the
whole cell lysate was used to assess total protein expression (Fig 3.1). ALC1 had two soluble
constructs (A1, A2) with both expressing the cytosolic domain (Fig 3.1A). CRMP2 had three
soluble constructs, two (C1, C4) of which were near full length proteins (Fig 3.1B). Interestingly,
all five Daxx constructs did not express any protein, whereas all four of the torsinA constructs
were insoluble (Fig 3.1C, I). All except one construct for KIDINS220 were soluble and highly
expressed (Fig 3.1E), while all of the constructs for HAP1 were highly soluble (Fig 3.1D). The
HAP1 bands on the SDS-PAGE did not represent the true size of the protein. While the
molecular weights of the constructs were 15-25 kDa, the bands on the SDS-PAGE gel indicated
the sizes of the protein to be 30-50 kDa. However, we were able to confirm the correct protein
sizes through mass-spectrometry (MS). JIP1 constructs expressing the SH2 and the PTB domain
were more soluble compared to those constructs with PTB alone (Fig 3.1F). Seven constructs
were soluble enough to be purified. Two of the JIP3 constructs expressing the LZD were
successfully cloned and expressed (Fig 3.1G). Finally, both full length S100A6 proteins were
highly expressed and soluble and contained two EF-hand motifs.
3.1.2 Purification
The constructs of CRMP2, HAP1, KIDINS220, S100A6 and JIP3, identified as candidate
constructs from the solubility test were expressed and purified. All of these purified proteins
were used for crystallization whereas only one construct for each protein was used for the
binding studies. If similar levels of solubility were shown by more than one construct of the
same protein, the construct selected for the binding studies were chosen using the following
criteria; the longer construct, the construct with the vector least likely to obstruct the interaction
31
Figure 3.1 – Small Scale Solubility & Expression Test. Conducted for (A) ALC1, (B) CRMP2,
(C) DAXX, (D) HAP1, (E) KIDINS220, (F) JIP1, (G) JIP3, (H) S100A6, (I) TorsinA. The
construct code is denoted in blue and soluble constructs are highlighted by the red box. Each
construct is composed of two lanes, the supernatant (“S” lane), and the whole cell lysate (“W”
lane).
32
with KLC, or the protein that exhibited the least chemical modification as assessed by MS. The
selected constructs were C4, H3, K2, M2, and S2 for the proteins CRMP2, HAP1, KIDINS220
JIP3, and S100A6 respectively.
The purification of ALC1 was difficult because a contaminant protein with a similar molecular
weight and multiple histidines was co-expressed. This posed a problem for the immobilized
metal affinity purification and size exclusion purifications. There were at least four histidines on
the contaminant protein as the MS data showed four sites of -N-6-phosphogluconoylation,
which is a modification that occurs in polyhistidine-tagged proteins. ALC1 also did not show
strong affinity to nickel columns. These problems were overcome by skipping the washing steps
of the nickel affinity column with imidazole and using a slow flow rate at 0.5 mL/min with a
fraction size of 2 mL compared to the 1-2 mL/min flow rate with a fraction size of 4 mL used in
the other protein purifications. The apparent molecular weight of ALC1 on the SEC was
estimated to be approximately 26 kDa suggesting that ALC1 was eluted as a dimer. The A2
construct was chosen for the subsequent studies as it was the construct with the better yield.
Seven JIP1 constructs, five consisting of the SH2 and PTB domains (J1-J5) and two with only
the PTB domain (J11, J12) were purified. Construct J2 in the pET28-MHL vectors showed signs
of protease activity leading to fragments of smaller proteins during purification. Constructs J3-J5
in the pNIC-CH vectors had low yield after the nickel affinity chromatography and further
purification was unsuccessful, even with increased amount of cell culture. Constructs J11 and
J12 did not encounter any protease activity and had of high yield. However, during nickel
affinity chromatography, the protein precipitated on the column when eluted. A small amount of
the J11 protein was recovered from the precipitant by centrifugation. Construct J1 was the only
construct with the pET28-GST vector which expresses a GST-tag, and did not have any apparent
problems with solubility, proteases, and stability. Construct J1 along with J11 were the JIP1
constructs used for subsequent binding assays.
3.1.3 Detection of Protein-Protein Interaction by Size Exclusion Chromatography (SEC)
SEC can be used to detect protein-protein interaction as it helps separate molecules by size. If
two proteins combined elute faster than they do alone indicating higher molecular mass, it would
33
be suggestive of a positive protein-protein interaction. Therefore, SEC was used to detect
interactions between KLC1 and its cargos.
Initially, KLC1 did not interact with any of the tested cargos, as the retention volume (RV) of the
KLC1-cargo protein samples were equivalent to the controls, KLC1 alone and cargo alone. With
the possibility that the polyhistidine tag of the TPR domain of KLC1 may affect its interaction
with cargo proteins, the polyhistidine tag was cleaved with TEV. Subsequent tests showed a
reduction in RV for the KLC1-ALC1 and KLC1-Sl00A6 samples. The RV for the KLC1-ALC1
sample was 14.5 mL an earlier RV compared to the KLC1 control (16 mL) and the ALC1 control
(15.5 mL) (Fig 3.2A). In the case of KLC1-S100A6, the KLC1 control eluted at 16.2 mL, and
S100A6 control at 17 mL (Fig 3.2B). The complex eluted faster with an RV of 13.3 mL. The two
interactions were also confirmed to contain both proteins by SDS-PAGE. An interesting pattern
also emerged from the tests with KLC1-TPR and CRMP2 where the complex showed an
increased RV compared to the CRMP2 control. Since it was possible the tetramer CRMP2 in the
CRMP2 alone control, dissociated to a smaller monomer or dimer to bind to KLC1-TPR, the
new peak was assessed by SDS-PAGE. The new peak consisted only of CRMP2, and did not
contain any KLC1-TPR. Interaction of KLC1-TPR with JIP1, JIP3, and HAP1 were not detected
(Fig 3.2C, D).
3.1.4 Crystallization
KLC1-TPR was set for co-crystallization trials with two synthesized peptides derived from the
kinesin binding sites of ALC1 (pALC1) and JIP1 (pJIP1). Co-crystallization trials of KLC1-TPR
and ALC1, CRMP2, HAP1, JIP1, and JIP3 proteins were also setup.
When a solution of KLC1-TPR with CRMP2 was set up for crystallizations, crystals were
obtained from four different conditions. These four different conditions share PEG3350 as the
primary precipitant, but were different in the secondary precipitants: potassium chloride (KCl),
ammonium phosphate (NH4PO4), sodium iodide (NaI), and succinic acid. The crystals diffracted
to 3.2 Å resolution. However, the electron density map corresponded to CRMP2 but not to
KLC1, proving that the CRMP2 was crystallized alone.
34
The KLC1-TPR and ALC1 complex was set in RW and SGC crystallization screens in addition
to a protein-complex optimized buffer screen. Crystallization trials of the KLC1-TPR and ALC1
complex produced crystals in the condition of 15% isopropyl alcohol, 0.2 M sodium citrate, and
0.1 M sodium cacodylate at pH 6.5. Upon screening, the diffraction pattern that of a salt.
Protein complex optimized buffer screen also did not produce high quality crystals although
nucleation was evident in the formation of spherulites and needle-like precipitation in the
condition 15% PEG3350, 0.1 M MgCl2, 0.1 M HEPES pH 7.0 buffer (Fig 3.2). The optimization
of this condition was conducted by modifying the concentrations of PEG3350, and MgCl2, but
did not yield any improvements in crystal quality.
The mixture of KLC1-TPR and pALC1 produced crystals from one condition of 20% PEG1500,
0.2 M NaCl, 0.1 M HEPES pH 7.5, and 5% glycerol. These initial crystals which were plate-like
crystals, diffracted to 8 Å resolutions (Fig 3.3A). To optimize the quality of these crystals, we
modified the concentrations of PEG1500 and NaCl, pH, storage temperature, protein
concentrations and the ratio between protein and the well solution. As well, dehydration of the
original crystals was tried to improve crystal quality. Lowering the storage temperature and
changes in protein drop to buffer ratio did not produce any crystals. Lowering the PEG1500 and
NaCl concentrations and a decrease in pH improved the crystal diffraction to 6.5 Å (Fig 3.3B). In
addition, dehydration of the original crystals was unsuccessful. Co-crystallization of KLC1 with
pJIP1 and all the cargos did not yield crystals.
3.2 Mutagenesis Binding Studies
3.2.1 Mutagenesis of KLC1-TPR
To identify key residues involved in KLC1-TPR’s interaction with its cargos, ITC was used to
derive the binding characteristics of wild-type KLC1-TPR and the mutants to its cargo peptides.
The binding of wild-type KLC1-TPR to pJIP1 was observed with a dissociation constant (Kd) of
32 Mol/L (Fig 3.4A). This exothermic reaction was mostly enthalpy driven as the latter
contributed -5302 cal/mol to the total change of Gibbs free energy of -5985 cal/mol. To confirm
that KLC2-TPR and pJIP1 do not interact, the same experiment was conducted for those two
molecules. It was evident, KLC2-TPR did not interact with pJIP1 (Fig 3.4B). To test our
35
sample 1 KLC control with 500ul001:10_UV sample 10 ALC and KLC001:10_UV sample 1 KLC control with 500ul001:10_Fractions sample 9 ALC control001:10_UV
0
100
200
300
400
500
mAU
0.0 5.0 10.0 15.0 20.0 ml
1D5 1D3 1D11E11E21E31E41E51E61E71E81E9 1E11 1F12 1F10 1F81F71F61F51F41F31F21F11G1 1G3 1G5 1G7 1G9 1G11 1H12 Waste
sample 8 KLC control with CaCl2001:10_UV sample 6 S100A6 control with CaCl2001:10_UV sample 6 S100A6 with KLC1 with CaCl2001:10_UV sample 8 KLC control with CaCl2001:10_Fractions
0
20
40
60
80
100
120
140
mAU
0.0 5.0 10.0 15.0 20.0 ml
1A1 1A31A41A51A61A71A81A9 1A11 1B12 1B10 1B81B71B61B51B41B31B21B11C1 1C3 1C5 1C7 1C9 1C11 1D12 1D10 1D8 1D6 1D4 Waste
A
B
A280
A280
Retention Volume
Retention Volume
36
sample 1 KLC control with 500ul001:10_UV sample 4 CRMP2 control001:10_UV sample 1 KLC control with 500ul001:10_Fractions sample 5 CRMP2 and KLC1001:10_UV
0
20
40
60
80
100
120
140
mAU
0.0 5.0 10.0 15.0 20.0 ml
1D5 1D3 1D11E11E21E31E41E51E61E71E81E9 1E11 1F12 1F10 1F81F71F61F51F41F31F21F11G1 1G3 1G5 1G7 1G9 1G11 1H12 Waste
sample 1 KLC control with 500ul001:10_UV sample 2 JIP3 control001:10_UV sample 1 KLC control with 500ul001:10_Fractions sample 3 JIP3 and KLC1001:10_UV
0
20
40
60
80
100
120
mAU
0.0 5.0 10.0 15.0 20.0 ml
1D5 1D3 1D11E11E21E31E41E51E61E71E81E9 1E11 1F12 1F10 1F81F71F61F51F41F31F21F11G1 1G3 1G5 1G7 1G9 1G11 1H12 Waste
C
D
A280
A280
Retention Volume
Retention Volume
37
Figure 3.2 – Size Exclusion Chromatography Binding Assay of KLC1-TPR (Blue) and cargos
(Red); (A) ALC1, (B) S100A6, (C) CRMP2, (D) JIP3,. The green peaks represent the mixture of
KLC1-TPR and the respective cargo. The arrows indicate positive interaction peaks.
hypothesis that asparagine 343 (N343) of KLC1-TPR and serine 328 (S328) of KLC2-TPR was
responsible for the discrepancy in the binding, N343 was mutated into a serine (KLC1M1), and
S328 was changed into an asparagine (KLC2M1) by site-directed mutagenesis. Upon testing the
binding properties of the two mutants, KLC1M1 was unable to interact with pJIP1, whereas
KLC2M1 gained the ability to interact with pJIP1 with a Kd of 12.5 Mol/L (Fig 3.4 C).
As the peptide ALC1 was thought to behave similar to pJIP1, the same set of assays was
conducted. KLC1-TPR, KLC2-TPR, and KLC1M1 proteins retained their ability to interact with
pALC1 (Fig 3.4D, E). The Kd values were similar to that of pJIP1 at the micromolar range with
42 Mol/L, 68 Mol/L, and 46 Mol/L for KLC1-TPR, KLC2-TPR, and KLC1M1,
respectively. Enthalpy was the driving factor for all of the reactions.
Figure 3.3 – The crystallization drop of the KLC1 and ALC1 mixture. Although no crystals were
produced, there were signs of nucleation indicated by the spherulites (red circles) and needle-like
precipitations (blue circle).
38
Figure 3.4 – Crystals of KLC1 and pALC1 co-crystallizations. (A) Initial crystals from screening
diffracting to 8Å (B) Crystals after optimization diffracting to 6.5 Å.
Since pALC1 resembles pJIP1 in terms of amino acid composition and was able to interact with
both KLC1-TPR and KLC2-TPR, it was possible that pALC1 would use a binding site on KLC1
similar to that of N343 polar patch and a region conserved between both KLC1 and KLC2-TPR
domains. Asparagine-301 (N301) of KLC1 is conserved in KLC2-TPR and its surrounding area
resembles the pJIP1 binding site. Therefore a mutant KLC1 with the asparagine to alanine
mutation at residue 301 (KLC1M2) was created by site directed mutagenesis. The mutation in
KLC1M2 decreased the binding affinity for pALC1 by 10 fold (Kd = 444 Mol/L) (Fig 3.4F).
Taken together, N343 and N301 of KLC1 are important residues on KLC1-TPR for the
interactions with pJIP1 and pALC1 respectively.
A B
39
3.2.2 Mutagenesis of pJIP1 and pALC1
To identify the key residues of pALC1 and pJIP1involved in the interaction with KLC1-
TPR, two mutants of pJIP1 and one mutant of pALC1 were studied by ITC. The pJIPM1
consisted of glutamine (Q) and asparagine mutations from the wildtype glutamic acid-706
(E706) and aspartic acid-707 (D707) respectively (703
CPTEDIYLE711
703
CPTQNIYLE711
) (Fig
3.4G). KLC1-TPR exhibited constant heat loss from each pJIPM1 injection, which represented a
loss of binding between the two molecules. pJIPM2 with the mutation of its E711 to Q711
(703
CPTEDIYLE711
703
CPTQNIYLQ711
) was also unable to interact with KLC1-TPR.
To study the role of the aspartic residues of ALC1 in KLC1-TPR binding, the pALCM1 was
synthesized with the aspartic acids replaced into asparagines (899
SEMDWDDSA907
899SEMDWNNSA
907). The mutations eradicated the interaction between the pALCM1 with
KLC1-TPR (Fig 3.4H). Together, the importance of the negatively charged acidic residues in
KLC1-TPRs cargos was confirmed.
40
D C
A B
41
E
G
F
H
42
Figure 3.4 – Isothermal titration calorimetry data showing (A) interaction between KLC1-TPR and
pJIP1, (B) no interaction between KLC2-TPR and pJIP1, (C) no interaction between KLCM1(N343S)
and pJIP1, (D) interaction between KLC1-TPR and pALC1, (E) interaction between KLCM1 and
pALC1, (F interaction between KLCM2(N301A) and pALC1, (G)no interaction between KLC1-TPR and
pJIPM1, (H) no interaction between KLC1-TPR and pALCM1
3.3 Structural Analysis
3.3.1 Mapping of the JIP3 and JIP4 binding site
The KLC1-TPR structure, which was the work of a colleague in the lab, allowed us to map
residues that have previously been identified to be important in the interaction with JIP3 and
JIP4. There are two known sets of mutations on KLC1-TPR that decreased its binding affinity to
JIP3/4.
First, a set of leucine/valine residues of KLC1 that affect binding to JIP3/4 is located in helix-B
of TPR2 (L280, L287) and helix-A of TPR3 (V294, L301), forming inter-TPR2/3 hydrophobic
interactions. None of these side chains are exposed to solvent for interaction with JIP3 and JIP4,
instead their importance lies in maintaining the structural integrity of the TPR domain.
The second set of mutations that specifically affect the binding of KLC1 to JIP3 consists of
R214H, G227W, A232T, R310H, L319M, and D334N. The G227 and R310 residues are located
in the intra-TPR loops in TPR1 and TPR3, respectively. Located in helix-B of TPR 1 and TPR3
are A232 and L319, both with their side chains hidden away in the crevices of the outer surface.
Finally, R214 located in helix-A of TPR1 has its side chain extending to the outer surface of the
TPR domain. A similar pattern was observed with D334 as it was located in the inter-TPR loop
between TPRs’ 3 and 4. From the structural analysis of these mutations, it is probable that most
of these residues do not play a role in the KLC1-TPR and JIP3/4 binding, but two possible
candidates, R214 and D334, stand out as the residues most likely to be important in the
interaction.
43
4 Discussion
4.1 X-ray Crystallography
4.1.1 Cloning, Expression & Purification of Proteins
The cargo constructs were designed on the basis of what was known about the protein, and the
domains that were involved in KLC1-TPR binding. For our crystallography experiments, we
used a high throughput approach by designing multiple constructs for each protein and putting
them through the same initial protocol to find the best construct. Designing constructs requires a
combination of secondary structure and domain prediction, and examining sequence alignments
of homologues that yielded soluble constructs. Even with that, there are still hurdles in
expressing human proteins in E.coli. However, by using multi-construct approach we quickly
found soluble constructs for most of our proteins from a single cycle of high-throughput cloning
and small scale solubility tests. Despite the success, all of the torsinA constructs proved to be
insoluble. This may have resulted from protein misfolding due to the lack of human chaperone
proteins in an E.coli cell. Alternatively, there may be conditions under which these proteins
could be soluble that were not used in our conditions. To make cloning and cell culture more
efficient, we used the same expression host, vectors, T7 promoter system, and culture growing
conditions (e.g. – IPTG concentration, temperature, time of induction). This might not have been
the best condition for torsinA. The expression of torsinA could be improved by the use of
mammalian expression host, as the rare codon analysis for the torsinA gene reveal poor codon
adaptation index and a high rate of unoptimized codons for the E.coli expression host.
4.1.2 KLC1-TPR interacts with ALC1 and S100A6
Using size-exclusion chromatography, KLC1-TPR binding to its cargo was confirmed.
Furthermore, identification of complex formation by the column allowed us to collect
homogeneous complexes of two proteins. Our initial inability to see binding between KLC1-TPR
and its cargos proved to be the result of inhibition by polyhistidine-tag on the KLC1-TPR. Only
after the polyhistidine-tag was removed by TEV protease, KLC1-TPR showed the ability to
interact with some of its cargos. Our KLC1-TPR structure was solved with the tag which showed
that the polyhistidine-tag and its linker were blocking the inner groove from being exposed from
44
the top (Fig 4.1). The polyhistidine-tag and its linker covered TPR1 to TPR3, leaving only
TPR4-6 exposed. Once the polyhistidine-tag was removed, we were able to confirm that KLC1-
TPR interacted with the cytosolic domain of ALC1 at a 2:1 ratio of ALC1 to KLC1-TPR, as
previously suggested (Konecna et al., 2006).
Unfortunately, only two of the six cargo proteins were able to interact with KLC1-TPR in the
SEC binding assay. We believe that several unaccounted factors could explain why majority of
the cargo proteins did not interact with KLC1-TPR. First, our KLC1-TPR construct only
contains the TPR-domain of KLC1 which spans from residues 227 to 495. On the other hand,
experiments that found the cargo interactions with the KLC1 TPR domain included the C-
terminal ends of KLC1. This discrepancy may explain the undetectable interaction between
KLC1-TPR and the CRMP2 (Kawano et al., 2005). It has been shown that the cargos that bind to
the TPR domain may also require a specific splice variant. The splice variants are formed in the
C-terminal end of KLC1 and in the case of torsinA, it is only able to interact with KLC1B and
KLC1C isoforms.
Secondly, the purified cargo proteins may not have had correct structural folds. GST-tagged JIP1
(construct J1) may have been misfolded as it is sometimes the case with GST-tagged proteins.
Also, one of the JIP1 constructs (construct J11) was the soluble recovery portion of a precipitated
protein. As such, this sample may not have had the correct fold either.
However, these factors do not explain the undetectable interaction between JIP3 and KLC1-TPR.
JIP3 does not require the C-terminal end of KLC1 and did not have obvious sign of misfolded
protein. In such case, we believe the assay conditions that we used may not have been optimal
for JIP3 and KLC1-TPR. Assay conditions such as, salt concentrations, temperature, and pH are
important parameters for protein-protein interactions. There were limited efforts to optimize
these conditions as we only tested different salt concentrations, with the temperature constantly
kept at 4C to keep the proteins stable. Therefore, it is quite possible that the conditions used to
test the interactions were not optimal conditions for protein-protein interactions. Finally, SEC
binding assay itself does not have high resolution and is not one of the most common methods in
45
Figure 4.1 – The polyhistidine-tag linker blocking the groove of KLC1-TPR (PDB: 3NF1). The
polyhistidine-tag linker (Blue) extends throughout TPR1-3 blocking the entrance to the groove of
KLC1-TPR (Orange).
detecting protein-protein interactions (Mayer et al., 2009). One reason is that SEC employs a
large volume of solution and decreases the protein concentration which can hinder the detection
of protein interactions with low affinity. However, we required an assay with minimal
modifications to our cloned constructs to use it for x-ray crystallography, and our preliminary
tests found nickel pull down assays unsuitable as KLC1-TPR actively bound to nickel-beads.
46
4.2 Mechanism of Interaction by KLC1-TPR
4.2.1 KLC1-TPR Interaction Interface
From the ITC results, N343 of KLC1-TPR is a crucial residue in the interaction with pJIP1. To
understand the possible role of N343, we inspected the KLC1-TPR structure. The N343, located
on helix-A of TPR4, extend towards its neighbouring N386 of TPR5 at a distance of 3.6Å (Fig
4.2A). These two asparagines, N343 and N386 may form an “asparagine clamp” as it was the
case for the HOP1-Hsc70 interaction. Upon closer inspection, the two asparagines were
surrounded by positively charged lysines creating a highly positive and polar patch (Fig 4.3C).
On the other hand, S328 of KLC2, which has a shorter side chain than the corresponding N343
of KLC1, cannot interact with N364 of TPR5 to form an asparagine clamp (Fig 4.2B). The
corresponding KLC2-TPR polar patch also contains lysines but since the S328 and N364 are too
far apart, it may not form a tight enough “clamp” rendering the polar patch insufficient in
interacting with pJIP1 (Fig 4.3D). This result is supported by a yeast two- hybrid analysis, where
a set of simultaneous site-directed mutations of N218A, N259A, N301A, N302A, N343A, and
N344A inhibited KLC1-TPR and JIP1 interaction supporting that N343 is the residue required
for the interaction with JIP1(Hammond et al., 2008).
In addition to the fact that ALC1 and JIP1 have similar sequences that interact with KLC1, these
two cargos are known to compete for the KLC1 interaction. Therefore the two cargos may utilize
a similar mechanism of interaction for KLC1. Our findings indicate that N301 is involved in
ALC1 binding and not N343, whereas N343 of KLC1-TPR is involved in JIP1 interaction. This
suggests that the competition between ALC1 and JIP1 arise due to steric hindrance of one
protein binding to KLC1 and not because they share the same exact binding interface. Recent
studies have shown that phosphorylation of S460 decreases the binding affinity of KLC1 for
ALC1 (Vagnoni et al., 2011). S460 is located at the junction of TPR6 and the non-TPR helix in
KLC1 and conserved in KLC2. We believe that the non-TPR helix plays a role in keeping TPR5
and TPR6 in close proximity in both KLC1 and KLC2. Together, it is possible that ALC1 may
simultaneously bind to the polar patch near N301 of KLC1-TPR and to the TPR 5 and 6. Thus,
the binding site would extend throughout the groove of KLC1-TPR. It is tempting to speculate
47
Figure 4.2 – Structural insight into the environment of N343 of KLC1- TPR (orange) (PDB:
3NF1) and S328 of KLC2-TPR (green) (PDB: 3CEQ). (A) N343 forms a “clamp” with N386 (B)
S328 is too distant from N371, unable to form a “clamp”, comparison of the (C) N343 centered
polar patch of KLC1, and (D) S328 centered polar patch of KLC2.
48
that this is the reason behind the competition between ALC1 and JIP1 interaction for KLC1.
ALC1 binding to KLC1 would cross over N343 creating hindrance for JIP1 whereas JIP1 bound
KLC1 would not allow the ALC1 to bind to the N301 polar patch and TPR 5 and 6
simultaneously.
We did not investigate the mechanism of interaction between KLC1-TPR and S100A6 through
mutagenesis binding studies. However, S100A6 can interact with the HOP TPR domain and
KLC1-TPR, while inhibiting the KLC1-JIP1 interaction (Shimamoto et al., 2008). From this,
S100A6 may bind to the “asparagine clamp” of KLC1-TPR which is also conserved in the HOP
TPR domain. Our structural observation of S100A6 (PDB: 1K96) has led us to speculate that the
interaction may take place near the loop region of the first EF hand motif of S100A6 (Otterbein
et al., 2002). Considering that this loop region is the only place on S100A6 ith aromatic and
negatively charged side chains facing the same side, this site would be a good candidate for the
interaction with KLC1 (Fig 4.3).
Figure 4.3 – The structure of S100A6 (PDB: 1K96) and the possible site of interaction with
KLC1-TPR. The first helix-loop-helix motif of EF-hand has aromatic (Y19) and negatively
charged residues (E33, E36, E41) on the same face.
49
4.2.2 Negatively Charged Residues in ALC1 and JIP1 are Essential in KLC1-TPR Binding
Aromatic residues, tyrosine 709 (Y709) in JIP1 and tryptophan 903 (W903) or tryptophan 975
(W975) of ALC1 are known to be an integral part of the KLC1-cargo interaction (Konecna et al.,
2006; Verhey et al., 2001). These aromatic residues of the cargos are flanked by negatively
charged glutamic and aspartic acid residues. Our results have shown that the negatively charged
residues are also essential in the KLC1-cargo interaction as indicated by the lack of interaction of
the mutant ALC1 and JIP1 peptides for KLC1-TPR. Overall, the inner groove of KLC1-TPR is
highly positive, and the polar patches of N301 and N343 are surrounded by lysines (Fig 4.4).
Although it is highly speculative, we propose that long-range electrostatic interaction brings the
negative residues on the cargos to the lysines on KLC1-TPR which then also allows the Y709 of
JIP1 and W903/W975 of ALC1 to interact with their respective clamps on KLC1-TPR.
Figure 4.4 – Electrostatic potential of KLC1-TPR. The positively charged inner groove (blue)
and the negatively charged hot spots on the outer surface (red) are quite evident. The figure was
generated by the DelPhi which evaluates the electrostatic potential by Poisson-Boltzmann
equation (Honig & Nicholls, 1995).
4.2.3 N343 Polar Patch versus N301 Polar Patch
In an attempt to understand how the two suggested polar patches achieve their specificity,
sequence and structural alignments were performed. The N301 polar patch is created by TPR
50
repeats 3 and 4 (residues 294-350) whereas N343 polar patch is created by TPR repeats 4 and 5
(residues 336-392). Sequence alignment of the residues reveals several differences in helix-B
whereas only one major difference exists in the polar patch forming helix-A. N301 polar patch
contains an alanine where N343 polar patch has a lysine. However, difference of one residue
near the polar patch does not fully explain the specificity exhibited by the two polar patches. A
structural analysis revealed that the asparagine clamp of N343 was much tighter in comparison to
the clamp of N301. The distance between the two asparagines in N343 was 3.6 Å, while the
same clamp in N301 was 5.7 Å apart (Fig 4.5). This result coincides with our speculation that the
aromatic residues interact with the asparagine clamps, as the indole ring in the tryptophan of
ALC1 is larger than the phenol ring in the tyrosine of JIP1. Collectively, this may explain the
specificity between N301 and N343 polar patches.
4.3 Structural Analysis
4.3.1 Mapping of the JIP3 binding site – Putative Binding Site #3
Through mutation mapping, we were able to identify the locations of mutations that were
previously found to be important in KLC1-TPR and JIP3/4 interaction (Hammond et al., 2008;
Nguyen et al., 2005). The amino acids in the first set of mutations consisting of leucine/valine
are unlikely to interact with JIP3 and JIP4 as their side chains are pushed in towards the crevices
by hydrophobic interactions. Hammond et al., have also suggested that these residues are
important for the helix-packing and that they are of structural support and not the residues
involved in the JIP3/4 binding. The second set of mutations that decreased the affinity of KLC1-
TPR and JIP3 interaction consisted of R214, G227, A232, R310, L319, and D334 residues
(Hammond et al., 2008). From our analysis, we believe that D334 and R214 are the residues
involved in the direct binding of JIP3. This is because A232 and L319 have their aliphatic
sidechains away from solvent and are embedded within the crevices the TPR domain. Also, it is
unlikely that G227 and R310 residues in the intra-TPR loops are involved in the direct binding,
as previous sets of mutations of the intra-TPR loop including the R310 residue had no effect in
KLC1-JIP3 interaction. Interestingly, the location of R214 and D334 are the outer surface
residues that p67phox used to interact with Rac-1, suggesting that that these residues are good
candidates of direct binding involved in KLC1-JIP3/4 interaction.
51
Figure 4.5 – Structural alignment of N301 polar patch to N343 polar patch. Differences in
residues show an alanine (cyan) for N301 polar patch and lysine (orange) for N343 polar patch.
The distance between the “clamp” is greater by 2 Å in the N301 polar patch.
This proposed interaction between KLC1 and JIP3/4 mirrors that of adenosine diphosphate-
ribosylation factor 6 (ARF6) and JIP4 since both the KLC1 TPR domain and ARF6 interact with
the LZDs of JIP3 and JIP4. More importantly, ARF6 inhibits the binding of KLC1-TPR to JIP3
or JIP4 by interacting with the leucine zipper domain of JIP3/4. The interactions between ARF6
and JIP-LZD involve around an elongated network of hydrogen bonds. Similarly, D334 of KLC1
and some of the polar inter-TPR loops of KLC1 can provide an elongated network of polar
residues for hydrogen bond interactions with the LZDs of JIP3 and JIP4 as it was evident in the
structural alignment of KLC1-TPR and p67phox-TPR.
N343
N386
N301
N344
K340 A298
52
4.4 Limitations
JIP1 proteins were difficult to obtain at sufficient concentrations and with the correct structural
fold. To overcome this problem, JIP1 peptides were used to identify the mechanism of
interaction and ALC1 peptides were also used to maintain consistency throughout the
mutagenesis binding studies. However, it is unknown whether the peptides are sufficient enough
to provide all of the binding to KLC1-TPR? It is certain that the peptides do not fully mimic the
proteins activity and are only an approximate of the protein. To investigate this possible
limitation, we conducted an ITC experiment with KLC1 and ALC1 proteins to identify possible
differences between the peptide and protein. We found that the protein-protein interaction did
have a higher affinity with a Kd of 1.94Mol/L, an increase from 41 Mol/L seen with the
pALC1. However, ALC1 contains two stretches of the kinesin binding site from 891-900 and
962-971 whereas the peptide only contains one of these stretches per molecule. Technically, this
translates into a two-fold decrease in the Kd for ALC1 compared to pALC1. However, the two
motifs are in close proximity and one could argue that when one stretch is bound, the other motif
is in close proximity to also bind. This in turn increases the “local concentration”, contributing to
the decrease in the Kd. These additional effects in the Kd may explain the discrepancy between
the peptides and proteins. Even if these additional effects do not fully explain the difference, we
believe this limitation does not affect the integrity of our results as our objective was to find the
mechanism of interaction and the peptides had sufficient capacity to discriminate the mutations
on KLC1.
53
5 Summary
To understand the mechanism of cargo interaction and recognition of KLC TPR domains, we
explored several interfaces of KLC1. We propose that the KLC1 has at least three possible
interfaces, two of which are located in the groove, and one in the outer surface loops of KLC1-
TPR. Despite the fact that we were unable to obtain a structure of the KLC1-Cargo complex, we
believe that the N343 polar patch and the N301 polar patch are required to interact with JIP1 and
ALC1, respectively.
We believe one feature of KLC-TPR that allows it to interact with a number of different cargos
comes from its larger than normal TPR domain. With six repeats and one extra helix on every
turn, the surface and the groove provides a large interface for interaction. Also, KLC1-TPR is not
limited to the two polar patches that were important in JIP1 and ALC1 binding. Another patch
exists between TPR5 and TPR6 which could possibly accommodate other cargo proteins.
Although for now we failed to come up with a structural model of the KLC1-cargo complex,
there is potential in co-crystallization of KLC1-ALC1 complex as it did show signs of
nucleation. However, the C-terminal domain of KLC1, which is important for several of the
cargo binding, will have to be incorporated into future constructs. Our preliminary tests of
constructs that included C-terminal part of KLC1 showed little stability and solubility. This will
have to be overcome through different vectors and/or cell lines which can accommodate the
expression of KLC1 with the C-terminal domain. Another future direction would involve
analyses of tripartite complexes as KLC1-JIP1-APP is transported together while ALC1-X11L-
APP stabilizes APP together. The structures of these complexes would provide invaluable
information about ALC1-JIP1 competition and in-depth information about kinesin-1 mediated
axonal transport of APP.
54
References
Andersson, M. E., Sjolander, A., Andreasen, N., Minthon, L., Hansson, O., Bogdanovic, N.,
Jern, C., Jood, K., Wallin, A., Blennow, K., & Zetterberg, H. Kinesin gene variability
may affect tau phosphorylation in early Alzheimer's disease. Int J Mol Med, 20(2): 233-
239.(2007).
Andersson, M. E., Zetterberg, M., Tasa, G., Seibt-Palmer, M., Juronen, E., Teesalu, P., Blennow,
K., & Zetterberg, H. Variability in the kinesin light chain 1 gene may influence risk of
age-related cataract. Mol Vis, 13: 993-996.(2007).
Araki, Y., Miyagi, N., Kato, N., Yoshida, T., Wada, S., Nishimura, M., Komano, H., Yamamoto,
T., De Strooper, B., Yamamoto, K., & Suzuki, T. Coordinated metabolism of Alcadein
and amyloid beta-protein precursor regulates FE65-dependent gene transactivation. J Biol
Chem, 279(23): 24343-24354.(2004).
Beitner-Johnson, D., & Nestler, E. J. Chronic morphine impairs axoplasmic transport in the rat
mesolimbic dopamine system. Neuroreport, 5(1): 57-60.(1993).
Blatch, G. L., & Lassle, M. The tetratricopeptide repeat: a structural motif mediating protein-
protein interactions. Bioessays, 21(11): 932-939.(1999).
Blundell, T. L., & Johnson, L. (1976). Protein Crystallography. New York: Academic Press.
Byk, T., Ozon, S., & Sobel, A. The Ulip family phosphoproteins--common and specific
properties. Eur J Biochem, 254(1): 14-24.(1998).
Cavalli, V., Kujala, P., Klumperman, J., & Goldstein, L. S. Sunday Driver links axonal transport
to damage signaling. J Cell Biol, 168(5): 775-787.(2005).
Caviston, J. P., & Holzbaur, E. L. Huntingtin as an essential integrator of intracellular vesicular
trafficking. Trends Cell Biol, 19(4): 147-155.(2009).
Coleman, M. Axon degeneration mechanisms: commonality amid diversity. Nat Rev Neurosci,
6(11): 889-898.(2005).
Coy, D. L., Hancock, W. O., Wagenbach, M., & Howard, J. Kinesin's tail domain is an inhibitory
regulator of the motor domain. Nat Cell Biol, 1(5): 288-292.(1999).
Cui, J., Wang, Z., Cheng, Q., Lin, R., Zhang, X. M., Leung, P. S., Copeland, N. G., Jenkins, N.
A., Yao, K. M., & Huang, J. D. Targeted inactivation of kinesin-1 in pancreatic beta-cells
in vivo leads to insulin secretory deficiency. Diabetes, 60(1): 320-330.(2011).
D'Andrea, L. D., & Regan, L. TPR proteins: the versatile helix. Trends Biochem Sci, 28(12):
655-662.(2003).
Das, A. K., Cohen, P. W., & Barford, D. The structure of the tetratricopeptide repeats of protein
phosphatase 5: implications for TPR-mediated protein-protein interactions. Embo J,
17(5): 1192-1199.(1998).
De Vos, K. J., Grierson, A. J., Ackerley, S., & Miller, C. C. Role of axonal transport in
neurodegenerative diseases. Annu Rev Neurosci, 31: 151-173.(2008).
55
Dhaenens, C. M., Van Brussel, E., Schraen-Maschke, S., Pasquier, F., Delacourte, A., &
Sablonniere, B. Association study of three polymorphisms of kinesin light-chain 1 gene
with Alzheimer's disease. Neurosci Lett, 368(3): 290-292.(2004).
Diefenbach, R. J., Diefenbach, E., Douglas, M. W., & Cunningham, A. L. The heavy chain of
conventional kinesin interacts with the SNARE proteins SNAP25 and SNAP23.
Biochemistry, 41(50): 14906-14915.(2002).
Diefenbach, R. J., Miranda-Saksena, M., Diefenbach, E., Holland, D. J., Boadle, R. A., Armati,
P. J., & Cunningham, A. L. Herpes simplex virus tegument protein US11 interacts with
conventional kinesin heavy chain. J Virol, 76(7): 3282-3291.(2002).
Dixit, R., Ross, J. L., Goldman, Y. E., & Holzbaur, E. L. Differential regulation of dynein and
kinesin motor proteins by tau. Science, 319(5866): 1086-1089.(2008).
Dong, H., O'Brien, R. J., Fung, E. T., Lanahan, A. A., Worley, P. F., & Huganir, R. L. GRIP: a
synaptic PDZ domain-containing protein that interacts with AMPA receptors. Nature,
386(6622): 279-284.(1997).
Du, J., Wei, Y., Liu, L., Wang, Y., Khairova, R., Blumenthal, R., Tragon, T., Hunsberger, J. G.,
Machado-Vieira, R., Drevets, W., Wang, Y. T., & Manji, H. K. A kinesin signaling
complex mediates the ability of GSK-3beta to affect mood-associated behaviors. Proc
Natl Acad Sci U S A, 107(25): 11573-11578.(2010).
Dumont, A., Boucrot, E., Drevensek, S., Daire, V., Gorvel, J. P., Pous, C., Holden, D. W., &
Meresse, S. SKIP, the host target of the Salmonella virulence factor SifA, promotes
kinesin-1-dependent vacuolar membrane exchanges. Traffic, 11(7): 899-911.(2010).
Dutta, S., & Tan, Y. J. Structural and functional characterization of human SGT and its
interaction with Vpu of the human immunodeficiency virus type 1. Biochemistry, 47(38):
10123-10131.(2008).
Ertekin-Taner, N. Genetics of Alzheimer's disease: a centennial review. Neurol Clin, 25(3): 611-
667, v.(2007).
Falzone, T. L., Stokin, G. B., Lillo, C., Rodrigues, E. M., Westerman, E. L., Williams, D. S., &
Goldstein, L. S. Axonal stress kinase activation and tau misbehavior induced by kinesin-1
transport defects. J Neurosci, 29(18): 5758-5767.(2009).
Gatto, G. J., Jr., Geisbrecht, B. V., Gould, S. J., & Berg, J. M. Peroxisomal targeting signal-1
recognition by the TPR domains of human PEX5. Nat Struct Biol, 7(12): 1091-
1095.(2000).
Gauthier, L. R., Charrin, B. C., Borrell-Pages, M., Dompierre, J. P., Rangone, H., Cordelieres, F.
P., De Mey, J., MacDonald, M. E., Lessmann, V., Humbert, S., & Saudou, F. Huntingtin
controls neurotrophic support and survival of neurons by enhancing BDNF vesicular
transport along microtubules. Cell, 118(1): 127-138.(2004).
Gindhart, J. G. Towards an understanding of kinesin-1 dependent transport pathways through the
study of protein-protein interactions. Brief Funct Genomic Proteomic, 5(1): 74-86.(2006).
Granata, A., Schiavo, G., & Warner, T. T. TorsinA and dystonia: from nuclear envelope to
synapse. J Neurochem, 109(6): 1596-1609.(2009).
Grove, T. Z., Cortajarena, A. L., & Regan, L. Ligand binding by repeat proteins: natural and
designed. Curr Opin Struct Biol, 18(4): 507-515.(2008).
56
Hammond, J. W., Griffin, K., Jih, G. T., Stuckey, J., & Verhey, K. J. Co-operative versus
independent transport of different cargoes by Kinesin-1. Traffic, 9(5): 725-741.(2008).
Hirokawa, N. The mechanisms of fast and slow transport in neurons: identification and
characterization of the new kinesin superfamily motors. Curr Opin Neurobiol, 7(5): 605-
614.(1997).
Hirokawa, N., & Noda, Y. Intracellular transport and kinesin superfamily proteins, KIFs:
structure, function, and dynamics. Physiol Rev, 88(3): 1089-1118.(2008).
Hirokawa, N., Noda, Y., Tanaka, Y., & Niwa, S. Kinesin superfamily motor proteins and
intracellular transport. Nat Rev Mol Cell Biol, 10(10): 682-696.(2009).
Holm, L., & Park, J. DaliLite workbench for protein structure comparison. Bioinformatics, 16(6):
566-567.(2000).
Honig, B., & Nicholls, A. Classical electrostatics in biology and chemistry. Science, e(5214):
1144-1149.(1995).
Horiuchi, D., Collins, C. A., Bhat, P., Barkus, R. V., Diantonio, A., & Saxton, W. M. Control of
a kinesin-cargo linkage mechanism by JNK pathway kinases. Curr Biol, 17(15): 1313-
1317.(2007).
Huang, S. H., Duan, S., Sun, T., Wang, J., Zhao, L., Geng, Z., Yan, J., Sun, H. J., & Chen, Z. Y.
JIP3 Mediates TrkB Axonal Anterograde Transport and Enhances BDNF Signaling by
Directly Bridging TrkB with Kinesin-1. J Neurosci, 31(29): 10602-10614.(2011).
Inagaki, N., Chihara, K., Arimura, N., Menager, C., Kawano, Y., Matsuo, N., Nishimura, T.,
Amano, M., & Kaibuchi, K. CRMP-2 induces axons in cultured hippocampal neurons.
Nat Neurosci, 4(8): 781-782.(2001).
Junco, A., Bhullar, B., Tarnasky, H. A., & van der Hoorn, F. A. Kinesin light-chain KLC3
expression in testis is restricted to spermatids. Biol Reprod, 64(5): 1320-1330.(2001).
Kabbaj, M., Evans, S., Watson, S. J., & Akil, H. The search for the neurobiological basis of
vulnerability to drug abuse: using microarrays to investigate the role of stress and
individual differences. Neuropharmacology, 47 Suppl 1: 111-122.(2004).
Kajander, T., Cortajarena, A. L., Mochrie, S., & Regan, L. Structure and stability of designed
TPR protein superhelices: unusual crystal packing and implications for natural TPR
proteins. Acta Crystallogr D Biol Crystallogr, 63(Pt 7): 800-811.(2007).
Kamal, A., Almenar-Queralt, A., LeBlanc, J. F., Roberts, E. A., & Goldstein, L. S. Kinesin-
mediated axonal transport of a membrane compartment containing beta-secretase and
presenilin-1 requires APP. Nature, 414(6864): 643-648.(2001).
Kawano, Y., Yoshimura, T., Tsuboi, D., Kawabata, S., Kaneko-Kawano, T., Shirataki, H.,
Takenawa, T., & Kaibuchi, K. CRMP-2 is involved in kinesin-1-dependent transport of
the Sra-1/WAVE1 complex and axon formation. Mol Cell Biol, 25(22): 9920-
9935.(2005).
Konecna, A., Frischknecht, R., Kinter, J., Ludwig, A., Steuble, M., Meskenaite, V., Indermuhle,
M., Engel, M., Cen, C., Mateos, J. M., Streit, P., & Sonderegger, P. Calsyntenin-1 docks
vesicular cargo to kinesin-1. Mol Biol Cell, 17(8): 3651-3663.(2006).
Lamb, J. R., Tugendreich, S., & Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to
TPR? Trends Biochem Sci, 20(7): 257-259.(1995).
57
Ling, S. C., Fahrner, P. S., Greenough, W. T., & Gelfand, V. I. Transport of Drosophila fragile X
mental retardation protein-containing ribonucleoprotein granules by kinesin-1 and
cytoplasmic dynein. Proc Natl Acad Sci U S A, e(50): 17428-17433.(2004).
Lippincott-Schwartz, J., Cole, N. B., Marotta, A., Conrad, P. A., & Bloom, G. S. Kinesin is the
motor for microtubule-mediated Golgi-to-ER membrane traffic. J Cell Biol, 128(3): 293-
306.(1995).
Maney, T., Hunter, A. W., Wagenbach, M., & Wordeman, L. Mitotic centromere-associated
kinesin is important for anaphase chromosome segregation. J Cell Biol, 142(3): 787-
801.(1998).
Mayer, C. L., Snyder, W. K., Swietlicka, M. A., Vanschoiack, A. D., Austin, C. R., &
McFarland, B. J. Size-exclusion chromatography can identify faster-associating protein
complexes and evaluate design strategies. BMC Res Notes, 2: 135.(2009).
McGowan, E., Eriksen, J., & Hutton, M. A decade of modeling Alzheimer's disease in transgenic
mice. Trends Genet, 22(5): 281-289.(2006).
Miki, H., Setou, M., & Hirokawa, N. Kinesin superfamily proteins (KIFs) in the mouse
transcriptome. Genome Res, 13(6B): 1455-1465.(2003).
Miyamoto, Y., Muto, E., Mashimo, T., Iwane, A. H., Yoshiya, I., & Yanagida, T. Direct
inhibition of microtubule-based kinesin motility by local anesthetics. Biophys J, 78(2):
940-949.(2000).
Mountjoy, C. Q., Roth, M., Evans, N. J., & Evans, H. M. Cortical neuronal counts in normal
elderly controls and demented patients. Neurobiol Aging, 4(1): 1-11.(1983).
Nakata, T., & Hirokawa, N. Point mutation of adenosine triphosphate-binding motif generated
rigor kinesin that selectively blocks anterograde lysosome membrane transport. J Cell
Biol, 131(4): 1039-1053.(1995).
Nangaku, M., Sato-Yoshitake, R., Okada, Y., Noda, Y., Takemura, R., Yamazaki, H., &
Hirokawa, N. KIF1B, a novel microtubule plus end-directed monomeric motor protein
for transport of mitochondria. Cell, 79(7): 1209-1220.(1994).
Nguyen, Q., Lee, C. M., Le, A., & Reddy, E. P. JLP associates with kinesin light chain 1 through
a novel leucine zipper-like domain. J Biol Chem, 280(34): 30185-30191.(2005).
Niclas, J., Navone, F., Hom-Booher, N., & Vale, R. D. Cloning and localization of a
conventional kinesin motor expressed exclusively in neurons. Neuron, 12(5): 1059-
1072.(1994).
Okada, Y., Takeda, S., Tanaka, Y., Belmonte, J. C., & Hirokawa, N. Mechanism of nodal flow: a
conserved symmetry breaking event in left-right axis determination. Cell, 121(4): 633-
644.(2005).
Otterbein, L. R., Kordowska, J., Witte-Hoffmann, C., Wang, C. L., & Dominguez, R. Crystal
structures of S100A6 in the Ca(2+)-free and Ca(2+)-bound states: the calcium sensor
mechanism of S100 proteins revealed at atomic resolution. Structure, 10(4): 557-
567.(2002).
Rong, J., Li, S., Sheng, G., Wu, M., Coblitz, B., Li, M., Fu, H., & Li, X. J. 14-3-3 protein
interacts with Huntingtin-associated protein 1 and regulates its trafficking. J Biol Chem,
282(7): 4748-4756.(2007).
58
Scheufler, C., Brinker, A., Bourenkov, G., Pegoraro, S., Moroder, L., Bartunik, H., Hartl, F. U.,
& Moarefi, I. Structure of TPR domain-peptide complexes: critical elements in the
assembly of the Hsp70-Hsp90 multichaperone machine. Cell, 101(2): 199-210.(2000).
Sickles, D. W., Brady, S. T., Testino, A., Friedman, M. A., & Wrenn, R. W. Direct effect of the
neurotoxicant acrylamide on kinesin-based microtubule motility. J Neurosci Res, 46(1):
7-17.(1996).
Stamer, K., Vogel, R., Thies, E., Mandelkow, E., & Mandelkow, E. M. Tau blocks traffic of
organelles, neurofilaments, and APP vesicles in neurons and enhances oxidative stress. J
Cell Biol, 156(6): 1051-1063.(2002).
Stokin, G. B., Lillo, C., Falzone, T. L., Brusch, R. G., Rockenstein, E., Mount, S. L., Raman, R.,
Davies, P., Masliah, E., Williams, D. S., & Goldstein, L. S. Axonopathy and transport
deficits early in the pathogenesis of Alzheimer's disease. Science, 307(5713): 1282-
1288.(2005).
Su, Q., Cai, Q., Gerwin, C., Smith, C. L., & Sheng, Z. H. Syntabulin is a microtubule-associated
protein implicated in syntaxin transport in neurons. Nat Cell Biol, 6(10): 941-953.(2004).
Suzuki, T., Araki, Y., Yamamoto, T., & Nakaya, T. Trafficking of Alzheimer's disease-related
membrane proteins and its participation in disease pathogenesis. J Biochem, 139(6): 949-
955.(2006).
Szolnoki, Z., Kondacs, A., Mandi, Y., & Somogyvari, F. Evaluation of the roles of the A185C
and C406T kinesin light-chain 1 variants in the development of leukoaraiosis. Neurosci
Lett, 429(2-3): 101-104.(2007a).
Szolnoki, Z., Kondacs, A., Mandi, Y., & Somogyvari, F. A genetic variant in cytoskeleton
motors amplifies susceptibility to leukoaraiosis in hypertensive smokers: gene-
environmental interactions behind vascular white matter demyelinization. J Mol
Neurosci, 33(2): 173-179.(2007b).
Tekotte, H., & Davis, I. Intracellular mRNA localization: motors move messages. Trends Genet,
18(12): 636-642.(2002).
Terwel, D., Dewachter, I., & Van Leuven, F. Axonal transport, tau protein, and
neurodegeneration in Alzheimer's disease. Neuromolecular Med, 2(2): 151-165.(2002).
Turner, P. R., O'Connor, K., Tate, W. P., & Abraham, W. C. Roles of amyloid precursor protein
and its fragments in regulating neural activity, plasticity and memory. Prog Neurobiol,
70(1): 1-32.(2003).
Vagnoni, A., Rodriguez, L., Manser, C., De Vos, K. J., & Miller, C. C. Phosphorylation of
kinesin light chain 1 at serine 460 modulates binding and trafficking of calsyntenin-1. J
Cell Sci, 124(Pt 7): 1032-1042.(2011).
Varadi, A., Ainscow, E. K., Allan, V. J., & Rutter, G. A. Involvement of conventional kinesin in
glucose-stimulated secretory granule movements and exocytosis in clonal pancreatic
beta-cells. J Cell Sci, 115(Pt 21): 4177-4189.(2002).
Verhey, K. J., Kaul, N., & Soppina, V. Kinesin assembly and movement in cells. Annu Rev
Biophys, 40: 267-288.(2011).
Verhey, K. J., Meyer, D., Deehan, R., Blenis, J., Schnapp, B. J., Rapoport, T. A., & Margolis, B.
Cargo of kinesin identified as JIP scaffolding proteins and associated signaling
molecules. J Cell Biol, 152(5): 959-970.(2001).
59
von Otter, M., Landgren, S., Nilsson, S., Lundvall, C., Minthon, L., Bogdanovic, N., Andreasen,
N., Gustafson, D. R., Skoog, I., Wallin, A., Hakansson, A., Nissbrandt, H., Zetterberg,
M., Tasa, G., Blennow, K., & Zetterberg, H. Kinesin light chain 1 gene haplotypes in
three conformational diseases. Neuromolecular Med, 12(3): 229-236.(2009).
Ward, B. M., & Moss, B. Vaccinia virus A36R membrane protein provides a direct link between
intracellular enveloped virions and the microtubule motor kinesin. J Virol, 78(5): 2486-
2493.(2004).
Wozniak, M. J., & Allan, V. J. Cargo selection by specific kinesin light chain 1 isoforms. Embo
J, 25(23): 5457-5468.(2006).
Wyszynski, M., Valtschanoff, J. G., Naisbitt, S., Dunah, A. W., Kim, E., Standaert, D. G.,
Weinberg, R., & Sheng, M. Association of AMPA receptors with a subset of glutamate
receptor-interacting protein in vivo. J Neurosci, 19(15): 6528-6537.(1999).