Infection, Genetics and Evolution · In bothPakistan(Jamaletal.,2010)andAfghanistan(Schumann et al., 2008), FMD is endemic and widespread; historically the serotype O has …

Infection, Genetics and Evolution 11 (2011) 1229–1238

Genetic diversity of foot-and-mouth disease virus serotype O in Pakistan andAfghanistan, 1997–2009

Syed M. Jamal a,b,c, Giancarlo Ferrari d, Safia Ahmed b, Preben Normann c, Graham J. Belsham c,*a National Veterinary Laboratory, Park Road, 45500 Islamabad, Pakistanb Department of Microbiology, Quaid-i-Azam University, Islamabad, Pakistanc National Veterinary Institute, Technical University of Denmark, Lindholm, 4771 Kalvehave, Denmarkd Food and Agriculture Organization of the United Nations, Rome, Italy

A R T I C L E I N F O

Article history:

Received 17 January 2011

Received in revised form 11 March 2011

Accepted 11 March 2011

Available online 17 March 2011

Keywords:

FMD

Molecular epidemiology

Genetic characterization

Evolution

RNA sequence

Picornavirus

A B S T R A C T

Foot-and-mouth disease (FMD) is endemic in Pakistan and Afghanistan; serotypes O, A and Asia-1 of the

virus are responsible for the outbreaks in these countries with FMDV type O usually being the most

common. In the present study, the nucleotide sequences encoding the FMDV capsid protein VP1 from

virus samples were determined. Phylogenetic analysis of the serotype O FMD viruses circulating in

Pakistan and Afghanistan between 1997 and 2009 revealed the presence of at least three different

lineages within the ME-SA (Middle East South Asia) topotype. The three lineages detected in this study

are Pak98, Iran2001 and PanAsia. The PanAsia lineage is currently dominant in the area and is evolving

with time as revealed by the appearance of distinct variants e.g. PanAsia-II and a new variant designated

here as PanAsia-III. The rates of evolution of the O-PanAsia-II and III sublineages prevalent in the region

were found to be 6.65 � 10�3 (95% CI = 5.49–7.80 � 10�3) and 7.80 � 10�3 (95% CI = 6.72–8.89 � 10�3)

substitutions per nucleotide per year, respectively. The present study reveals the presence of multiple

(sub-)lineages of FMDV serotype O co-circulating in the region and that significant new variants are

frequently emerging.

� 2011 Elsevier B.V. All rights reserved.

Contents lists available at ScienceDirect

Infection, Genetics and Evolution

jou r nal h o mep ag e: w ww .e ls evier . co m/lo c ate /m eeg id

1. Introduction

Foot-and-mouth disease (FMD) is an infectious, contagious,viral disease of cloven-hoofed mammals (Alexandersen andMowat, 2005). The disease is economically very important as itcauses heavy losses to the livestock industry in terms of highmorbidity in adult animals (especially cattle and pigs), reducedproduction efficiency and also mortality in young stock. Further-more, the disease is a severe restraint to international trade oflivestock and livestock products due to sanitary control measures.The causative agent, foot-and-mouth disease virus (FMDV),belongs to the genus Aphthovirus within the family Picornaviridae

(Belsham, 2005). The virus is non-enveloped and has a positive-sense single stranded RNA genome, with a length of about 8.3 kb.The genome is enclosed within a nearly spherical protein capsid ofabout 28 nm, which consists of 60 copies of four differentstructural polypeptides, i.e. VP1, VP2, VP3 and VP4. The VP1 is

* Corresponding author. Tel.: +45 3588 7985; fax: +45 3588 7901.

E-mail addresses: [email protected] (S.M. Jamal), [email protected]

(G. Ferrari), [email protected] (S. Ahmed), [email protected] (P. Normann),

[email protected] (G.J. Belsham).

1567-1348/$ – see front matter � 2011 Elsevier B.V. All rights reserved.

doi:10.1016/j.meegid.2011.03.006

the most variable of the capsid polypeptides and is considered tobe highly immunogenic.

The virus exists in seven distinct serotypes, i.e. O, A, C, Asia-1,SAT 1, SAT 2 and SAT 3, that do not confer protection against eachother after either infection or vaccination (Bachrach, 1968;Domingo et al., 2003). Within the serotypes, many subtypes canalso be identified that sometimes do not induce total crossprotection against other viruses of the same serotype. In addition,the control of this disease is constantly challenged by theemergence of new strains. The distribution of strains varies bylocation and this has been used to define virus topotypes. Thesedescribe the range of genetically distinct strains, within a serotype,present within a particular geographical area (Knowles andSamuel, 2003). In some areas, several serotypes and subtypescan occur at the same time. Moreover, the distribution of serotypesand subtypes around the world is not static.

FMDV is present in large areas of Africa, Asia and South Americaand can readily cross international boundaries and causesepidemics in previously free areas. FMD serotype O virus ispredominant among the serotypes worldwide (Rweyemamu et al.,2008) and has been found responsible for important outbreaks innormally disease-free countries (Knowles et al., 2001; Bruckneret al., 2002; Sakamoto et al., 2002; Shin et al., 2003; Tsutsui andYamamoto, 2010).

http://dx.doi.org/10.1016/j.meegid.2011.03.006

mailto:[email protected]





http://www.sciencedirect.com/science/journal/15671348

http://dx.doi.org/10.1016/j.meegid.2011.03.006

Table 1Details of the samples from Pakistan and Afghanistan used in the present study.

Reference number Species Date of collection Area Country Accession no. Reference

O/PAK/1/1997 Cattle 24.3.1997 Karachi Pakistan AJ303526 Samuel and Knowles (2001)

O/PAK1/1998 Bovine 13.2.1998 NK Pakistan AJ318848 Knowles et al. (unpublished)

O/PAK/15/2002 Buffalo 15.3.2002 Sheikhopura Pakistan DQ165062 Knowles et al. (2005)

O/PAK/16/2002 Bovine 15.3.2002 NK Pakistan DQ165063 Knowles et al. (2005)

O/PAK/18/2002 Cattle 27.7.2002 Karachi Pakistan DQ115064 Knowles et al. (2005)

O/PAK/1/2003 Cow 6.1.2003 Karachi Pakistan DQ155065 Knowles et al. (2005)

O/PAK/12/2003 NK 2003 Lahore Pakistan DQ155066 Knowles et al. (2005)



O/PAK/17/2003 Vaccine strain Pakistan DQ155069 Knowles et al. (2005)

O/PAK/45/2003 Cow 19.3.2005 CBF, Harichand Pakistan DQ164942 Knowles et al. (2005)

O/PAK/53/2003 Buffalo 27.5.2003 Karachi Pakistan DQ164943 Knowles et al. (2005)

O/PAK/73/2003 NK 27.10.2003 Lahore Pakistan DQ165070 Knowles et al. (2005)

O/PAK/31/2005 Cattle 22.1.2005 Hafizabad Pakistan FJ798162 Waheed et al. (2010)


O/PAK/33/2005 Cattle 00.3.2005 Arifwala Pakistan FJ798164 Waheed et al. (2010)


O/PAK/35/2005 Buffalo 28.2.2005 Lahore Pakistan FJ798166 Waheed et al. (2010)

O/PAK/38/2005 Cattle 12.2.2005 Karak Pakistan FJ798167 Waheed et al. (2010)

O/PUN/PAK/L133/2005 Blue bull 26.1.2005 Lahore Pakistan HQ439221 This study

O/PUN/PAK/L149/2005 Buffalo 4.2.2005 Kharian, Gujrat Pakistan HQ439222 This study

O/PUN/PAK/L150/2005 Buffalo 4.2.2005 Kharian, Gujrat Pakistan HQ439223 This study

O/PUN/PAK/L181/2005 Cattle 1.2.2005 Sargodha Pakistan HQ439224 This study

O/PUN/PAK/L282/2005 Cattle 30.3.2005 Layyah Pakistan HQ439225 This study

O/ISL/PAK/L285/2005 Buffalo 30.3.2005 Islamabad Pakistan HQ439226 This study



O/ISL/PAK/L288/2005 Cattle 30.3.2005 Islamabad Pakistan HQ439229 This study

O/PAK/2/2006 Cattle 31.1.2006 Karachi Pakistan EF494499 Klein et al. (2008)


O/PAK/6/2006 Buffalo 31.1.2006 Karachi Pakistan EF494501 Klein et al. (2008)






Pak 5.2.9 Buffalo 14.9.2006 Karachi Pakistan EF494498 Klein et al. (2008)

Pak 24.18 Buffalo 3.4.20007 Karachi Pakistan EF444993 Klein et al. (2008)



O/PAK/60/2006 Buffalo 4.1.2006 Sargpdha Pakistan FJ798168 Waheed et al. (2010)

O/PAK/61/2006 Cattle 4.1.2006 Sargpdha Pakistan FJ798169 Waheed et al. (2010)

O/PAK/63/2006 Buffalo 8.1.2006 Sheikhopura Pakistan FJ798170 Waheed et al. (2010)

O/PAK/66/2006 Cattle 15.2.2006 Jhang Pakistan FJ798171 Waheed et al. (2010)

O/PAK/67/2006 Buffalo 15.2.2006 Jhang Pakistan FJ798172 Waheed et al. (2010)

O/PAK/68/2006 Buffalo 1.2.2006 Hafizabad Pakistan FJ798173 Waheed et al. (2010)



O/PAK/72/2006 Buffalo 16.1.2006 Gujranwala Pakistan FJ798176 Waheed et al. (2010)

O/PAK/73/2006 Buffalo 16.1.2006 Gujranwala Pakistan FJ798177 Waheed et al. (2010)

O/PAK/74/2006 Cattle 30.1.2006 Okara Pakistan FJ798178 Waheed et al. (2010)

O/PAK/53/2007 Cattle 14.1.2007 Sargodha Pakistan FJ798179 Waheed et al. (2010)

O/PAK/56/2007 Buffalo 23.1.2007 Sheikhopura Pakistan FJ798180 Waheed et al. (2010)

O/PAK/60/2007 Cattle 18.1.2007 Jhang Pakistan FJ798181 Waheed et al. (2010)


O/PAK/63/2007 Cattle 22.2.2007 Gujranwala Pakistan FJ798183 Waheed et al. (2010)

O/PAK/66/2007A Buffalo 7.12.2007 Layyah Pakistan FJ798184 Waheed et al. (2010)

O/PAK/66/2007B Buffalo 7.12.2007 Layyah Pakistan FJ798185 Waheed et al. (2010)

O/PAK/68/2007 Buffalo 3.12.2007 TT Singh Pakistan FJ798186 Waheed et al. (2010)

O/PAK/69/2007 Buffalo 7.12.2007 Layyah Pakistan FJ798187 Waheed et al. (2010)

O/PAK/70/2007 Buffalo 7.12.2007 Layyah Pakistan FJ798188 Waheed et al. (2010)

O/PAK/71/2007 Cattle 8.12.2007 Lakki Marwat Pakistan FJ798189 Waheed et al. (2010)

O/PAK/1/2008 Cattle 3.1.2008 Burki Pakistan FJ798190 Waheed et al. (2010)

O/PAK/2/2008 Buffalo 8.1.2008 Patoki Pakistan FJ798191 Waheed et al. (2010)

O/PAK/3/2008 Cattle 8.1.2008 Patoki Pakistan FJ798192 Waheed et al. (2010)

O/PAK/6/2008 Cattle 24.1.2008 Peshswar Pakistan FJ798193 Waheed et al. (2010)

O/PAK/39/2008 NK 2008 NK Pakistan GU384685 Xu et al. (Unpublished)



O/PUN/PAK/L1343/2008 Cattle 31.12.2008 Faisalabad Pakistan HQ439207 This study

O/PUN/PAK/L1345/2008 Buffalo 31.12.2008 Faisalabad Pakistan HQ439213 This study






S.M. Jamal et al. / Infection, Genetics and Evolution 11 (2011) 1229–12381230

Table 1 (Continued )

Reference number Species Date of collection Area Country Accession no. Reference

O/PUN/PAK/L1370/2009 Buffalo 13.5.2009 Rawalpindi Pakistan HQ439215 This study



O/NWF/PAK/L1414/2009 Cattle 9.2.2009 CBF, Harichand Pakistan HQ439212 This study





O/ISL/PAK/L1573/2009 Rescued virus from

sample No. O/ISL/

PAK/L1413/2009

HQ113232 Belsham et al. (2011)

O/AFG/16/2003 Ovine 10.4.2003 Balkh Afghanistan DQ165035 Schumann et al. (2008)

O/AFG/50/2003 Bovine 10.4.2003 Takhar Afghanistan DQ165036 Schumann et al. (2008)

O/AFG/120/2004 Bovine 17.2.2004 Ghazni Afghanistan EF457984 Schumann et al. (2008)

O/AFG/201/2004 Caprine 17.2.2004 Zabul Afghanistan EF457985 Schumann et al. (2008)

O/AFG/210/2004 Bovine 12.8.2004 Ghazni Afghanistan EF457986 Schumann et al. (2008)

O/KAB/AFG/L1231/2008 Cattle Sept. 2008 Live animal market, Kabul Afghanistan HQ439230 This study

O/KAB/AFG/L1279/2008 Cattle Sept. 2008 Live animal market, Kabul Afghanistan HQ439231 This study

O/KUN/AFG/L630/2009 Cattle 18.1.2009 Khanabad, Kunduz Afghanistan HQ439232 This study

O/KAB/AFG/L643/2009 Cattle 5.1.2009 5th, Kabul Afghanistan HQ439233 This study

O/BAG/AFG/L1494/2009 Cattle 18.5.2009 Dara-i-Boom, Badgis Afghanistan HQ439234 This study



O/JAW/AFG/L1499/2009 Cattle 25.3.2009 Shabarghan, jawzan Afghanistan HQ439237 This study

O/KAB/AFG/L2826/2009 Cattle 1.8.2009 Qarabagh, Kabul Afghanistan HQ439238 This study

S.M. Jamal et al. / Infection, Genetics and Evolution 11 (2011) 1229–1238 1231

In both Pakistan (Jamal et al., 2010) and Afghanistan (Schumannet al., 2008), FMD is endemic and widespread; historically theserotype O has been found to be responsible for the highestnumbers of outbreaks in Pakistan. In order to achieve bettercontrol of the disease in endemic countries, it is essential tomonitor the current variants of the prevalent serotypes of FMDV inthe field to ensure that the most appropriate vaccine strains areused to combat the circulating viruses and to obtain knowledgeabout the origin of an outbreak. Phylogenetic analyses based onpartial or complete VP1 coding nucleotide sequences are widelyused for determination of sub-types of the different serotypes ofFMDV (Beck and Strohmaier, 1987; Tosh et al., 2002; Knowles andSamuel, 2003; Knowles et al., 2005).

Only limited genetic studies of FMDV from Pakistan (Klein et al.,2007, 2008; Waheed et al., 2010) and a single report fromAfghanistan (Schumann et al., 2008) are available. The earlierstudies from Pakistan were either restricted to the Landhi DairyColony, Karachi in 2006–07 or included samples collected within2005–2008 mainly from the Punjab province while those inAfghanistan were from 2003–2005.

The present study has characterized the genetic diversity andgeographical distribution of FMDV serotype O in Pakistan andAfghanistan, during a period of more than one decade (1997–2009)using 99 nucleotide sequences for the complete VP1 (1D) codingregion originating from these countries as determined in this study(some 33 new sequences) or available in GenBank (see Table 1).The rate of nucleotide change per site per year within the PanAsialineage viruses circulating in this region was also determined.

2. Materials and methods

2.1. Samples

Oral swab and epithelial samples were collected in Pakistan andAfghanistan as part of an Italian-funded FAO Regional Project(GTFS/INT/907/ITA) between July 2008 and August, 2009. The mainpurposes of the activities on FMD were to assess the seropreva-lence for FMD in different age-groups of large ruminants, todetermine the extent of virus circulation in clinically healthy

animals and to characterize FMDV in samples collected from theclinically suspect cases. The results from the surveillance studieswill be reported, in detail, separately (Jamal et al., manuscript inpreparation), this report only deals with the molecular characteri-zation of recently circulating serotype O viruses. Oral swabsamples were placed directly into RLT buffer (Qiagen) andepithelial tissues were transferred to RNAlater (Ambion) andtransported to the National Veterinary Institute, TechnicalUniversity of Denmark (DTU Vet), Lindholm, Denmark. In addition,epithelial samples from suspected cases of FMD, collected in 2005and present in the repository of the National VeterinaryLaboratory, Islamabad, Pakistan were also characterized in thisstudy. The samples were named according to the serotype,followed by province, followed by a three letter country-code(i.e. PAK (for Pakistan) or AFG for Afghanistan), followed by L (forLindholm) and laboratory record number, followed by year ofoutbreak (e.g. O/PUN/PAK/L133/2005).

Nucleotide sequence data for the VP1 coding region from otherFMDVs which originated in Pakistan and Afghanistan wereobtained from the GenBank database (www.ncbi.nlm.nih.gov).

2.2. Samples preparation and RNA extraction

The epithelial samples were homogenized in RLT buffer prior toRNA extraction. Briefly, samples of epithelial tissue (7–8 mg) weremixed with disruption beads and 1 ml of RLT buffer and lysed in ahomogenizer (FastPrep, FP120 Thermo Electron Corporation BIO101) for 30 s at a setting of 6.5 m/s. Samples were placed on iceimmediately after disruption and then centrifuged at high speed(14,000 rpm for 10 min). The supernatants were passed throughQIA Shredder Mini Spin Columns (Qiagen) by centrifugation at14,000 rpm for 2 min. The filtrates were used for RNA extraction.The oral swab samples, collected and preserved in RLT buffer, werethawed, mixed and then centrifuged at 3000 rpm for 10 min; thesupernatants were used for RNA extraction. The total RNA wasextracted from the preserved samples either using a manual(QIAamp1RNA Blood Mini Kit) or automated (MagNA Pure LC TotalNucleic Acid Isolation Kit) protocol as described by the manu-facturers. In each case, the RNA was eluted in 50 ml of water.

http://www.ncbi.nlm.nih.gov/

Table 2Oligonucleotide primers used for RT-PCR and sequencing of FMDV VP1 coding region.

Primer’s name Primer’s sequence (50–30) Direction Genome positiona

10-P PN 5 TACCAAATTACACACGGGAA Forward 3161

10-P PN 6 TAGCGCCGGCAAAGACTTTGA Forward 3212

10-P PN 7 GAAGGGCCCAGGGTTGGACTC Reverse 3936

10-P PN 29 GCGTGCAGCCACGTACTACTTCT Forward 3476

10-P PN 34 CAGGGTTGGACTCMACGTCTCC Reverse 3929

11-F PN 28 GGGCCCAGGGTTGGACTC Reverse 3936

11-F PN 29 GCXGCXGACTACGCXTACACYGC Forward 3169

11-F PN 35 GAARGGCCCRGGGTTGGAC Reverse 3938

a Genome position according to the FMD virus strain O UKG 35/2001 (GenBank Accession number AJ539141).


2.3. RT-PCR and sequencing

FMDV RNA, within the RNA preparations, was quantified usingtwo different real time RT-PCR assays which targeted the 3Dpol

coding sequence (Callahan et al., 2002) and the 50-untranslatedregion (50UTR) (Reid et al., 2003). Samples showing stronglypositive results (with Ct values �30) in either of the assays wereused in a conventional PCR to amplify cDNA corresponding to theentire VP1 coding sequence with the primers shown in Table 2. Theamplicons (ca. 900 bp) were eluted from the gel using a gelextraction kit (Qiagen) as per the manufacturer’s instructions andwere sequenced in both directions; the sequences were assembledusing SeqMan Pro. The nucleotide sequences determined in thisstudy have been submitted to the EMBL/GenBank/DDBJ databases;accession numbers are listed in Table 1.

2.4. Genome sequence analysis

Sequence comparisons were performed using BLAST(www.ncbi.nlm.nih.gov/blast) to identify the serotype of the virus.Phylogenetic analyses were conducted for each serotype usingMEGA version 4 (Tamura et al., 2007). The sequence data werealigned and a midpoint rooted tree was constructed. Thephylogenetic tree was constructed using the Neighbor-Joiningmethod (Saitou and Nei, 1987). The robustness of the tree topologywas assessed with 1000 bootstrap replicates (Felsenstein, 1985) asimplemented in the programme. The tree was drawn to scale, withbranch lengths in the same units as those of the evolutionarydistances used to infer the phylogenetic tree. The evolutionarydistances for nucleotide sequences were computed using theKimura 2-parameter method (Kimura, 1980) and are in the units ofthe number of base substitutions per site. The nucleotidesequences were converted into deduced amino acid sequencesusing MEGA version 4 also.

In order to determine the rate of evolution of the PanAsialineage FMDVs circulating in Pakistan and Afghanistan, the rate ofnucleotide substitution per site per year was calculated by linearregression analysis of the genetic distances of the viruses (VP1coding region) from the oldest virus from this region belonging tothe same (sub)lineage. Genetic distances were calculated using theKimura 2-parameter (Kimura, 1980) for the total nucleotidesubstitutions. The roles of host species (cattle and buffaloes) andsource country (Pakistan or Afghanistan) on the rate of nucleotidesubstitutions were also ascertained using multivariate linearregression analysis.

3. Results

A total of 133 samples collected from suspect clinical cases ofFMD from Pakistan and Afghanistan in 2008/2009 and a further 9samples from Pakistan obtained in 2005 were initially tested inreal time PCR assays. The locations from which the samples

included in this work were obtained are listed in Table 1. Fromthese, some 121 were found to be positive for FMDV RNA bydiagnostic real time RT-PCR assays. From this set, 105 were furtheranalysed by sequencing the whole VP1 coding region to determinethe serotype and subtype of the virus. Moreover, 14 oral swabsamples from clinically healthy animals, which also scored positivein the diagnostic assays for FMDV RNA, were also analysed in thesame way to identify the viruses responsible for sub-clinical orpossibly pre-clinical FMD infections. In total, from the 119 VP1sequences determined, 33 (28%) were identified using BLAST asserotype O, while 69 (58%) and 18 (15%) were found positive forserotypes A and Asia-1, respectively (note: one sample waspositive for both serotypes A and Asia-1).

In Pakistan 24 of the 43 samples from suspected cases of FMDcontained serotype O FMDV while in Afghanistan, only 7 out of 59FMDV positive samples were found positive for this serotype. Twoout of six positive samples from apparently healthy animals fromAfghanistan also contained FMDV type O, whereas no samplesfrom among the clinically healthy animals from Pakistan wereidentified as this serotype.

The 33 new serotype O sequences were used in phylogeneticanalysis with previously determined sequences of type O FMDVscirculating in Pakistan and Afghanistan since 1997. This analysis(of some 99 sequences in total) revealed that these virusesbelonged to, at least, four lineages within the ME-SA (Middle EastSouth Asia) topotype. The four lineages detected were Pak98,Iran2001, PanAsia and a previously unrecognized lineage (seeFig. 1).

The Pak98 lineage was responsible for disease outbreaks inPakistan in 1998 and 2003. This lineage has never been reportedelsewhere even from the neighboring countries, Afghanistan, Indiaand Iran. This lineage was detected in samples collected from theeastern part (Lahore area) of Pakistan. Viruses belonging to thislineage show 98.9–99.8% identity to each other in the sequencecoding for VP1. Moreover, the virus strain used for vaccineproduction in Pakistan belongs to this lineage and has 99.8%identity in the VP1 coding region with O/PAK12/2003 (accessionnumber DQ165066). However, this group shows only �88% identitywith the reference strains, O/Manisa/Turkey69 (accession numberAJ251477) and O/IND/R2/75 (accession number AF204276) withinthe VP1 coding region. Viruses belonging to the Iran2001 lineagewere circulating in Pakistan in 2002–2003 and showed 95–96%identity in the VP1 coding region with viruses circulating in Iran in2001, 2003 and 2004 and in the Mersin area of Turkey in 2004. Thislineage was responsible for disease outbreaks in eastern (Sheikho-pura, Punjab) and southern (Karachi, Sindh) parts of Pakistan. Thislineage has not been detected in Afghanistan.

Three different PanAsia sublineages of serotype O FMDV havenow been detected in both Pakistan and Afghanistan i.e. PanAsia-I,II and III; these sublineages are defined on the basis of >5%difference in VP1 coding sequences (Samuel and Knowles, 2001;Hemadri et al., 2002; Nagendrakumar et al., 2009).

http://www.ncbi.nlm.nih.gov/blast

PanAsia-II

PanAsia-II I

O/ISL/PAK/L285 /2005 O/ISL/PAK/L286 /20 05 O/ISL/PAK/L287 /20 05

O/PUN/PAK/L133/200 5 O/PUN/PAK/L181/20 05 O/PUN/PAK/L150/200 5 O/PUN/PAK/L14 9/2005 FJ798 173 .1 (O/PAK/68/2006)

EF45 798 6 (O/AFG/210/200 4)

b

DQ16 496 7 (O/QTR/3/99 ) DQ16505 7 (O/IRQ/30/2000)

DQ16 505 2 ( O/IRN/16/2003 ) DQ16504 8 (O/IRN/2/2003)

DQ165 035 (O/AFG/16 /20 03) DQ16494 2 (O/PAK/45/20 03) DQ165 036 (O/AFG/50 /2003)

AJ3188 38 ( O/IRN/9/99) EU140 964 .1 (UAE/7/99)

DQ296515. 1O/Konya/TUR/512/10/99 AJ539 141 (O/UKG/35/2001 )

AJ539 138 (Tibet/CHA/99 )

a

PanAsia-I

Pan Asia

Ind2 001 DQ16 506 5 (O/PAK/1/2003)

DQ164 943 (O/PAK/53 /2003) DQ16 506 2 (O/PAK/15/2002 ) DQ16 506 3 (O/PAK/16/2002 )

DQ1650 64 (O/PAK/18/2002) DQ16 489 6.1 (O/IRN/61 /2001)

DQ165055 (O/IRN/15/200 4) DQ165049. 1 ( O/IRN/4/20 03)

DQ16505 1 ( O/IRN/8/2003) DQ165050. 1 (O/IRN/6/20 03)

DQ1650 56 (O/IRN/20/200 4) DQ16489 8.1 (O/IRN/15/20 03)

DQ296 502 .1 (O/Mersin/TUR/13 /01 /04 ) DQ296 501 .1 (O/Mersin/TUR/34 /02 /04 )

DQ296 503 .1 (O/Mersin/TUR/35/02 /04 )

Iran2 001

AF2921 07 ( IND/53/79) AF204 276 (R 2/75 IND) AY593 823 (O1/Manisa/TUR/69)

AF189 157 (I srael/85 Geshur e) DQ16 507 0.1 (O/PAK/73 /2003) DQ16 506 8.1 (O/PAK/16 /2003) DQ165069.1 (O/PAK/17/2003) vacc

DQ16 506 7.1 (O/PAK/14/200 3) AJ31 8848.1 (O/PAK/1/98)

DQ165 066 .1 (O/PAK/12/2003)

Pak98

AJ30 352 6.1 (O/PAK/1/97)

ME-SA

SE A Cathay

Euro-SA100

69100

99

6399

8895

6866

100

74

7173

64100

100

86

57

66100

99

99

99

75

99

82

78

5379

56

92

76

81

77

82

61

0.01

Fig. 1. Neighbor joining phylogenetic tree generated using nucleotide sequences (nt = 639) of the complete VP1 coding region of FMDV serotype O. The sequences marked

with circles and triangles originated from Pakistan and Afghanistan, respectively. Sub-trees for the PanAsia-II and PanAsia-III sub-lineages are shown in Fig. 2.


3.1. Rate of evolution of PanAsia lineage

Multivariate linear regression was applied to ascertain the rateof change within the FMDV serotype O PanAsia lineage. The ratesfor the PanAsia-II and PanAsia-III sublineages were found to be6.65 � 10�3 (95% CI = 5.49–7.80 � 10�3) and 7.80 � 10�3 (95%CI = 6.72–8.89 � 10�3) substitutions per nucleotide per year (s/nt/year), respectively (see Fig. 3, panels A and B). Neither the host

species from which the virus was collected nor the country oforigin had a significant effect (p > 0.05) on the rate of nucleotidesubstitution.

The PanAsia-I sublineage was detected in Pakistan in 2003,2005 and 2006 and also in Afghanistan in 2003–2004. The samplespositive for this sublineage originated from both the North-Western (Harichand and Islamabad) and Eastern (Lahore, Hafiza-bad, Kharian, Sargodha) regions of Pakistan. In Afghanistan, this

EF49 4506 (O/PAK14/200 6) EF49 4505 (PAK 12/2006) EF49 4504 (PAK 11/2006) EF49 4499 (PAK 02/2006)

EF4944 98 (Pak 5.2 9) EF49449 3 (Pak 24.1 8)

EF494491 (Pak 23 .2 8) FJ798 179.1 (O/PAK /53/20 07)

EF4945 03 (PAK 10/20 06) EF4945 00 (PAK 04/20 06) EF4945 02 (PAK 08/20 06) EF4945 01 (PAK 06/20 06)

EF49449 0 (Pak23.1 8) O/TUR/290/2008/12208

O/TUR/16 4/20 09/1220 8 FJ79 8189.1 (O/PAK /71 /200 7)

O/PUN /PAK/L13 70/2009 FJ79 8191.1 (O/PAK /2/20 08) FJ79 8192.1 (O/PAK /3/20 08)

FJ79 8169.1 (O/PAK /61 /2006) FJ798 193.1 (O/PAK /6/200 8)

O/KA B/AFG/L282 6/20 09 O/NWF/PAK/L14 17/2009 O/NWF/PAK/L14 14/2009 O/NWF/PAK/L14 18/2009 O/NWF/PAK/L14 16/2009 O/NWF/PAK/L14 15/2009

b

DQ 165059.1 (O/NEP/4/2003) DQ16 5058.1 (O/MAY/6/200 3)

O/IRN/8/200 5 EF45 7984 (O/AFG/120/2004)

EF4579 85 (O/AFG/20 1/20 04) DQ 165 042.1 (O/BHU /47/20 03)

DQ 16486 7.1 (O/BHU/49/2003 ) DQ 165061.1 (O/NEP/6/2003)

DQ 164865.1 (O/BHU /15/2003) DQ 1650 60.1 (O/NEP/5/2003)

DQ 1650 46 (O/BHU /33 /2004) DQ 1650 44.1 (O/BHU /28 /200 4)

DQ16 5043 (O/BHU/26/2004 ) DQ 165045 (O/BHU /30/200 4)

DQ 165047 (O/BHU /40/200 4) OPUN /PAK/L282/20 05

O/ISL/PAK /L288/2005 FJ7981 67.1 (O/PAK /38 /200 5)

FJ79819 0.1 (O/PAK/1/2008) FJ79 8188.1 (O/PAK /70 /2007)

FJ798 187.1 (O/PAK /69/20 07) FJ798 185.1 (O/PAK /66/20 07)( B) FJ798 186.1 (O/PAK /68/20 07)

a

PanAsia-II

GU 384685.1 (O/PAK /39/20 08) GU 384683.1 (O/PAK /44/20 08) GU 384682.1 (O/PAK /45/20 08)

b

FJ79 8165.1 (O/PAK /34 /200 5) FJ798176 .1 (O/PAK /72/2006)

FJ7981 78.1 (O/PAK /74 /200 6) FJ7981 71.1 (O/PAK /66/200 6) FJ7981 81.1 (O/PAK /60/200 7) FJ7981 72.1 (O/PAK /67/200 6) FJ7981 74.1 (O/PAK /70/200 6) FJ7981 62.1 (O/PAK /31/200 5) FJ7981 82.1 (O/PAK /61/200 7) FJ7981 63.1 (O/PAK /32/200 5)

FJ798183 .1 (O/PAK /63/2007) FJ79818 4.1 (O/PAK/66/2007 (A)

FJ798166.1 (O/PAK /35/2005) FJ798168.1 (O/PAK /60/2006) FJ798177.1 (O/PAK /73/2006) FJ798170.1 (O/PAK /63/2006) FJ798180 ( O/PAK /56/2007)

FJ7981 64.1 (O/PAK /33/200 5) FJ7981 75.1 (O/PAK /71/200 6)

a

O/KUND /AFG/L630/2009 O/KAB/AFG/L1231/2008 O/KAB/AFG/L1279/2008

O/KA B/AFG/L643/2009 O/IRN/7/2009 (WRL)

O/ISL/PAK/L14 12/2009 O/PUN /PAK /L134 6/20 08 O/PUN /PAK /L134 7/20 08 O/PUN /PAK /L136 0/20 08 O/PUN /PAK /L135 8/20 08 O/PUN /PAK /L135 3/20 08

O/ISL/PAK/L1573 ( Res-1413) O/ISL/PAK/L1413 /2009 O/PUN/PAK /L1345/200 8 O/PUN/PAK /L1343 /200 8 O/KUN /AFG /L149 6/2009 O/KUN /AFG /L149 7/2009

O/BAG /AFG /L149 4/2009 O/JAW/AFG /L149 9/20 09

c

PanAsia-II I

63

61

50

100

53

99

9587

58

67

100

65

92

7063

91

9287

8799

9953

75

100

67

89

66

88

5579

86

91

6374

97

7859

73

99

67

99

0.005

Fig. 2. Sub-trees showing viruses belonging to O-PanAsia-II and O-PanAsia-III sublineages, circulating within 2004–2009. As in Fig. 1, sequences marked with circles and

triangles originated from Pakistan and Afghanistan, respectively.


sublineage was detected from the Balkh and Takhar provinces in2003 and from Ghazni province in 2004. Viruses from Pakistan andAfghanistan belonging to this sublineage form two distinctbranches (Fig. 1). Viruses responsible for the disease outbreaks

in North-Western Pakistan (Harichand) in 2003 and thosecirculating in Balkh and Takhar provinces of Afghanistan in thesame year are very closely related (�99% identity in the VP1 codingregion) (labeled a). However, some other similar viruses from

Fig. 3. Regression analysis of the rate of evolution (total substitutions per nucleotide per year) of the VP1 coding sequences (nt = 639) of the FMDV type O-PanAsia-II

sublineage circulating in Pakistan and Afghanistan between 2004–2009 (panel A) and O-PanAsia-III sublineage circulating in Pakistan and Afghanistan between 2005–2009

(panel B).


North-Western Pakistan (Islamabad) and Eastern Pakistan (Sar-godha, Lahore, Gujrat) circulating in 2005 and a single virusdetected in 2006 from Haifzabad (O/PAK/68/2006; accessionnumber FJ798173) are closely related to each other (showing99% identity in the VP1 coding region) but form a separate group(labeled b).

A significant variant of the PanAsia lineage, designated asPanAsia-II sublineage (EUFMD, 2007), was first detected inAfghanistan during 2004 and, again, during 2009 and also inPakistan in 2005–2009 (see Fig. 2). Viruses belonging to thissublineage were responsible for disease outbreaks in Ghazni andZabul provinces of Afghanistan in 2004 and during 2009 in Kabulprovince, co-circulating with PanAsia-I viruses in Ghazni and Zabulprovinces in the same year. This sublineage was also detected ineastern (Patoki, Burki, Toba Tek Singh, Layyah and Sargodha),western and North-Western (Karak, Lakki Marwat, Peshawar andIslamabad) and southern (Karachi) regions of Pakistan during2005–2009. Both PanAsia-I and PanAsia-II viruses have been co-circulating in Afghanistan since 2004. Similarly, some of theviruses belonging to the PanAsia-II sublineage circulating during2005–2008 in Pakistan and Ghazni (Afghanistan) in 2004 areclosely related to each other and cluster together, whereas, a virusfrom Afghanistan (O/KAB/AFG/L2826/2009) and some viruses fromPakistan circulating in 2006–2009 cluster together and form aseparate branch (labeled b within the PanAsia-II sublineage inFig. 2). Furthermore, we have also now found additional variantswhich are distinct from both the PanAsia-I and the PanAsia-IIsublineages in samples collected from Pakistan and Afghanistan in2008–2009, these are tentatively designated as PanAsia-III (seeFig. 2). This sublineage shows only 92.8–94.4% identity in the VP1coding region with the previously recognized PanAsia-II subline-age. Phylogenetic analysis showed that this sublineage has been incirculation in different areas of Punjab province of Pakistan since2005, co-circulating with the PanAsia-I and PanAsia-II viruses (seeWaheed et al., 2010). The new PanAsia-III sublineage was alsodetected in samples collected from Kunduz, Badgis, Kabul andJawzan provinces of Afghanistan in 2009. As revealed by thephylogenetic tree (Fig. 2), viruses belonging to this new sublineageform three branches (labeled a–c). Viruses from this sublineagecirculating in Pakistan in 2005–2007 are very closely related toeach other but are slightly different from those responsible fordisease outbreaks in Pakistan and Afghanistan in 2008–2009(Fig. 2).

The O/PAK/1/97 virus (accession number AJ303526) circulatingin Southern Pakistan (Karachi) in 1997 belongs to an unnamed

lineage. This shows 87.3–88.1%, 88–89% and 87–88% identity withPak98, Iran 2001 and PanAsia lineages respectively. This virus isclosely related to viruses circulating in Pakistan in 1994, showing94.8% identity in a partial VP1 coding region.

3.2. Comparison of VP1 amino acid sequences

The deduced amino acid sequences of the VP1 proteins derivedfrom viruses belonging to PanAsia-III sublineage originating fromPakistan and Afghanistan are significantly different from thePanAsia-I and PanAsia-II serotype O viruses which are currentlycirculating there. The presence of both 140S and 158V is unique tothe PanAsia-III sublineage except for three isolates collected in2008 and a single isolate collected in 2007, which each have 158A.Both of these changes are within the G-H loop which is animportant antigenic site (Fig. 4). Interestingly, the PanAsia-I andPanAsia-II viruses circulating in this region share very similardeduced VP1 amino acid sequences with each other, i.e. withresidues 140 (H or P) and 158T, which are distinct from thePanAsia-III viruses (Fig. 4). In addition, other lineage- andsublineage-specific signature amino acid residues were found inthe serotype O viruses under study and are shown in Fig. 4.Residues D45, E46, A96, E99, G139, A158 and M209 were found tobe specific for lineage Pak98 while residues A33 and I76 werefound specific for lineage Iran2001. The RGDLXXL motif, involvedin receptor binding (Fox et al., 1989; Jackson et al., 1997), wasfound conserved in all the serotype O viruses that originated fromPakistan and Afghanistan.

4. Discussion

In the present study, some 33 new serotype O FMDV sequenceshave been generated and analysed within a total set of 99 VP1coding nucleotide sequences of FMDV type O from Pakistan andAfghanistan which were responsible for outbreaks in the period1997–2009 plus a vaccine stain from Pakistan. These sequenceswere compared with other FMDV sequences available in publicdatabases, particularly those derived from viruses circulating inneighboring countries.

Four different lineages of serotype O virus are present in thisregion and each belongs to a single topotype, Middle East SouthAsia (ME-SA). One serotype O virus (O/PAK/73/2007) detected in asample collected in 2007 from Pakistan was found to belong to thePak98 lineage by the WRL-FMD (WRL-FMD, 2008), showing 98.9–99.7% identity with other members of this lineage. Surprisingly, the

PanAsia -III c

PanAsia -III a

PanAsia -III b

PanAsia-IIa

PanAsia-I b

PanAsia-I a

Pak98

Iran200 1

PanAsia -IIb

Fig. 4. Alignment of deduced amino sequences for the whole VP1 capsid protein of FMDV type O viruses from Pakistan and Afghanistan. Only the amino acid differences from the reference sequence are shown. The conserved

receptor binding site motif RGDLXXL is underlined. The sublineage groups labeled in Fig. 2 are also indicated here.

S.M.

Jam

al

et a

l. /

Infectio

n,

Gen

etics a

nd

Ev

olu

tion

11

(20

11

) 1

22

9–

12

38

12

36


O/PAK/73/2007 virus showed 99.2% identity in the whole VP1coding region with a virus circulating in Pakistan in 1998 (O/PAK/1/1998; accession number AJ318848) despite the 9 year timeinterval between them. This close identity may be due tolaboratory contamination, use of improperly inactivated vaccineor laboratory escape of the vaccine strain. The virus used for theproduction of vaccine in Pakistan belongs to this same lineage andits VP1 coding sequences (O/PAK/17/2003; accession numberDQ165069) shows 99.5% identity with the O/PAK/73/2007 plus99.8% identity with a virus circulating in 2003 (O/PAK/12/2003;accession number DQ165066) and 98.2% identity with the O/PAK/1/1998 virus. The vaccine strain was reportedly imported from theWorld Reference Laboratory for FMD, Institute for Animal Health,Pirbright, UK in the 1970s for the production of vaccine (Zulfiqar,2005). However, the Pak98 lineage strain shows only 88% identitywith the O1 Manisa vaccine.

The Iran2001 lineage of serotype O was found in 2001–2004 inthe Middle East and South Asian region and continues to be presentin Pakistan. This lineage, however, was not detected in samplesfrom Afghanistan but this could be due to insufficient sampling.

All the serotype O viruses from Afghanistan belong to a singlelineage, PanAsia. The PanAsia lineage is also predominant amongthe various lineages currently circulating in Pakistan. This lineagewas first detected in India in 1982 (Hemadri et al., 2002) and thespread of this lineage has been described in detail elsewhere(Knowles et al., 2001, 2005; Knowles and Samuel, 2003). ThePanAsia lineage was first detected in 2003 within Pakistan,Afghanistan and Nepal. A distinct variant, designated as thePanAsia-II sublineage, was initially detected in Nepal in 2003 andBhutan in 2003–2004. This sublineage was then detected inAfghanistan in 2004 (Schumann et al., 2008) and in Pakistan in2006–2007 (Klein et al., 2008). The present study shows that thissublineage has been in circulation since 2005 in Pakistan. Thissublineage spread westwards and was detected in Iran in 2005–2006, together with Jordan and Turkey in 2006 and movednorthwards to Kyrgyzstan and Kazakhstan in 2007 (Scherbakovet al., 2008). The present study shows that this sublineage is stillresponsible for disease outbreaks in Afghanistan and Pakistan.Surprisingly, the deduced amino acid sequences of VP1 for thePanAsia-I and II sublineages did not show significant differences(although residue 140 can vary, see Fig. 4). However, the antigenicspecificity of these FMDVs may be altered by other changeselsewhere within the capsid proteins. Phylogenetic analysis showsthat some viruses from Pakistan and Afghanistan circulating in2005–2009 and 2008–2009, respectively have undergone furtherevolution and now form a separate cluster. Viruses belonging tothis cluster show 92.8–94.4% identity in the VP1 coding region tothe PanAsia-II viruses. This new cluster has been designated hereas a PanAsia-III sublineage. A strain belonging to this newsublineage has also been detected in samples from Iran collectedin 2009 (Fig. 2). The molecular epidemiology report of recentsamples originating from Iran in 2010 also shows that this newsublineage continues to circulate in Iran (WRL-FMD, 2010), but itshould be noted that it is considered therein as a separate groupwithin the PanAsia-II sublineage. Similarly, some recent virusesfrom Pakistan which are within the O-PanAsia-III group have beendescribed as belonging to the PanAsia-II sublineage by Waheedet al. (2010), despite the fact that these viruses show more than 5%nucleotide difference in the VP1 coding region with other PanAsia-II viruses and the presence of characteristic changes in the deducedamino acid sequences (see Fig. 4). The occurrence of closely-relatedviruses in Pakistan and Afghanistan may be attributed to theuncontrolled and extensive movement of animals across theborder. Moreover, the co-circulation of more than one (sub)lineageof FMDV serotype O in the same area shows the very complexepidemiological situation of the disease in the region.

The rate of evolution for FMDV has been determined previously,for example Villaverde et al. (1991) reported the rate of nucleotidesubstitution as 6.5 � 10�3 s/nt/year for FMDV serotype C duringthe epizootic outbreak in Spain during 1979–1982. This rate isquite similar to the rates determined for the PanAsia-II andPanAsia-III viruses determined here (6.647 � 10�3 and7.806 � 10�3 s/nt/year, respectively). These rates of nucleotidesubstitution are, however, significantly higher than the rate of2.8 � 10�3 s/nt/year reported by Hemadri et al. (2002) for thePanAsia group circulating in India and the rates of 1.43 � 10�3 s/nt/year for serotype C (Martinez et al., 1992), and 2.7 � 10�3 s/nt/yearfor type O in East Africa (Balinda et al., 2010). The higherevolutionary rate of O-PanAsia-II and -III sublineages are consis-tent with the existence of various genetic variants reported forthese sublineages. However, the rate of evolution reported in thepresent study was much lower than the rates of 0.9–7.4 � 10�2 s/nt/year reported for serotype C FMDV within persistently infectedcattle by Gebauer et al. (1988). The rate of evolution may be higherwhen measured over shorter time periods in which the virusreplicates actively and continuously and selective pressure may bequite different in shorter periods (Martinez et al., 1992).

5. Conclusions

It is apparent from this work that multiple lineages andsublineages of FMDV serotype O circulate in Pakistan andAfghanistan. Detection of new sublineages (O-PanAsia-II andnow PanAsia-III) within the O-PanAsia lineage shows that the typeO viruses are continuously and rapidly evolving in the region. Virussampling in countries such as Pakistan and Afghanistan is alwaysincomplete and thus some of the apparently distinct clusters ofviruses can be accounted for by this but it is also the case that viruspopulations can evolve in different directions following population‘‘bottlenecks’’. The change in virus sequences may either be due tonormal genetic drift in the viral genome (Dopazo et al., 1988) ordue to partial immune pressure as a result of previous infection,low vaccination coverage or vaccination with either a sub-optimaldose or poorly/non-matching vaccine. The newly emerging strainsmay pose a serious threat to the global livestock industryespecially in disease-free countries due to changing scenarios ofinternational trade. A regional control programme includingcontinuous surveillance of FMDV in endemic countries to ascertainthe emergence of new strains for selection of appropriate vaccinesis important. The control of animal movements and the availabilityof appropriate and potent vaccines may help not only in controllingthe disease at its primary source but should also help disease-freecountries to remain free.

Acknowledgements

This study was funded by the FAO Regional project, ‘‘ControllingTrans-boundary Animal Diseases in Central Asian Countries (GTFS/INT/907/ITA)’’ and EuFMD (LoA PR 40134). The authors arethankful to Drs. Manzoor Hussain, Nawroz Habibullah andEhtisham Khan for their support. Thanks are also due to KeithSumption (EuFMD) for his interest.

References

Alexandersen, S., Mowat, N., 2005. Foot-and-mouth disease: host range and path-ogenesis. Curr. Top. Microbiol. Immunol. 288, 9–42.

Bachrach, H.L., 1968. Foot-and-mouth disease. Annu. Rev. Microbiol. 22, 201–244.Balinda, S.N., Sangula, A.K., Heller, R., Muwanika, V.B., Belsham, G.J., Masembe, C.,

Siegismund, H.R., 2010. Diversity and transboundary mobility of serotype Ofoot-and-mouth disease virus in East Africa: implications for vaccination poli-cies. Infect. Genet. Evol. 10, 1058–1065.

Beck, E., Strohmaier, K., 1987. Subtyping of European foot-and-mouth disease virusstrains by nucleotide sequence determination. J. Virol. 61 (5), 1621–1629.


Belsham, G.J., 2005. Translation and replication of FMDV RNA. Curr. Top. Microbiol.Immunol. 288, 43–70.

Belsham, G.J., Jamal, S.M., Tjørnehøj, K., Bøtner, A., 2011. Rescue of foot-and-mouthdisease viruses that are pathogenic for cattle from preserved viral RNA samples.PLoS One 6 (1), e14621 doi:10.1371/journal.pone.0014621.

Bruckner, G.K, Vosloo, W., Du Plessis, B.J., Kloeck, P.E., Connoway, L., Ekron, M.D.,Weaver, D.B., Dickason, C.J., Schreuder, F.J., Marais, T., Mogajane, M.E., 2002.Foot and mouth disease: the experience of South Africa. Rev. Sci. Tech. 21 (3),751–764.

Callahan, J.D., Brown, F., Osorio, F.A., Sur, J.H., Kramer, E., Long, G.W., Lubroth, J., Ellis,S.J., Shoulars, K.S., Gaffney, K.L., Rock, D.L., Nelson, W.M., 2002. Use of a portablereal-time reverse transcriptase-polymerase chain reaction assay for rapiddetection of foot-and-mouth disease virus. J. Am. Vet. Med. Assoc. 220 (11),1636–1642.

Domingo, E., Escarmis, C., Baranowski, E., Ruiz-Jarabo, C.M., Carrillo, E., Nunez, J.I.,Sobrino, F., 2003. Evolution of foot-and-mouth disease virus. Virus Res. 91 (1),47–63.

Dopazo, J., Sobrino, F., Palma, E.L., Domingo, E., Moya, A., 1988. Gene encodingcapsid protein VP1 of foot-and-mouth disease virus: a quasispecies model ofmolecular evolution. Proc. Natl. Acad. Sci. U.S.A. 85, 6811–6815.

EUFMD, 2007. Report of the 37th Session of the European Commission for theControl of Foot-and-Mouth Disease (EUFMD), held at Rome, Italy. 18–20 April2007.

Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using thebootstrap. Evolution 39, 783–791.

Fox, G., Parry, N.R., Barnett, P.V., McGinn, B., Rowlands, D.J., Brown, F., 1989. The cellattachment site on foot-and-mouth disease virus includes the amino acidsequence RGD (arginine–glycine–aspartic acid). J. Gen. Virol. 70, 625–637.

Gebauer, F., De La Torre, J.C., Gomes, I., Mateu, M.G., Barahona, H., Tiraboschi, B.,Bergmann, I., de Mello, P.A., Domingo, E., 1988. Rapid selection of genetic andantigenic variants of foot-and-mouth disease virus during persistence in cattle.J. Virol. 62 (6), 2041–2049.

Hemadri, D., Tosh, C., Sanyal, A., Venkataramanan, R., 2002. Emergence of a newstrain of type O foot-and-mouth disease virus: its phylogenetic and evolution-ary relationship with the PanAsia pandemic strain. Virus Genes 25 (1), 23–34.

Jackson, T., Sharma, A., Ghazaleh, R.A., Blakemore, W.E., Ellard, F.M., Simmons, D.L.,Newman, J.W.I., Stuart, D.I., King, A.M.Q., 1997. Arginine–glycine–aspartic acid-specific binding by foot-and-mouth disease viruses to the purified integrinavb3 in vitro. J. Virol. 71 (11), 8357–8361.

Jamal, S.M., Ahmed, S., Hussain, M., Ali, Q., 2010. Status of foot-and-mouth disease inPakistan. Arch. Virol. 155, 1487–1491.

Kimura, M., 1980. A simple method for estimating evolutionary rate of basesubstitutions through comparative studies of nucleotide sequences. J. Mol.Evol. 16, 111–120.

Klein, J., Hussain, M., Ahmad, M., Normann, P., Afzal, M., Alexandersen, S., 2007.Genetic characterization of the recent foot-and-mouth disease virus subtype A/IRN/2005. Virol. J. 4, 122 doi:10.1186/1743-422X-4-122.

Klein, J., Hussain, M., Ahmad, M., Afzal, M., Alexandersen, S., 2008. Epidemiology offoot-and-mouth disease in Landhi dairy colony, Pakistan, the world largestBuffalo colony. Virol. J. 5, 53 doi:10.1186/1743-422X-5-53.

Knowles, J., Samuel, A.R., Davies, P.R., Kitching, P., Donaldson, A.I., 2001. Outbreak offoot-and-mouth disease virus serotype O in the UK caused by a pandemic strain.Vet. Rec. 148, 258–259.

Knowles, N.J., Samuel, A.R., Davies, P.R., Midgley, R.J., Valarcher, J.-F., 2005. Pan-demic strain of foot-and-mouth disease virus serotype O. Emerg. Infect. Dis. 11(12), 1887–1893.

Knowles, N.J., Samuel, A.R., 2003. Molecular epidemiology of foot-and-mouthdisease virus. Virus Res. 91 (1), 65–80.

Martinez, M.A., Dopazo, J., Hernandez, J., Mateu, M.G., Sobrino, F., Domingo, E.,Knowles, N.J., 1992. Evolution of the capsid protein genes of foot-and-mouth

disease virus: antigenic variation without accumulation of amino acid sub-stitutions over six decades. J. Virol. 66 (6), 3557–3565.

Nagendrakumar, S.B., Madhanmohan, M., Rangarajan, P.N., Srinivasan, V.A., 2009.Genetic analysis of foot-and-mouth disease virus serotype A of Indian originand detection of positive selection and recombination in leader protease-andcapsid-coding regions. J. Biosci. 34 (1), 85–101.

Reid, S.M., Grierson, S.S., Ferris, N.P., Hutchings, G.H., Alexandersen, S., 2003.Evaluation of automated RT-PCR to accelerate the laboratory diagnosis offoot-and-mouth disease virus. J. Virol. Methods 107 (2), 129–139.

Rweyemamu, M., Roeder, P., Mackay, D., Sumption, K., Brownlie, J., Leforban, Y.,Valarcher, J.-F., Knowles, N.J., Saraiva, V., 2008. Epidemiological patterns of foot-and-mouth disease worldwide. Transbound. Emerg. Dis. 55, 57–72.

Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for recon-structing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.

Sakamoto, K., Kanno, T., Yamakawa, M., Yoshida, K., Yamazoe, R., Murakami, Y.,2002. Isolation of foot-and-mouth disease virus from Japanese black cattle inMiyazaki Prefecture, Japan, 2000. J. Vet. Med. Sci. 64 (1), 91–94.

Samuel, A.R., Knowles, N.J., 2001. Foot-and-mouth disease type O viruses exhibitgenetically and geographically distinct evolutionary lineages (topotypes). J.Gen. Virol. 82 (Pt 3), 609–621.

Scherbakov, A., Timina, A., Borisov, V., 2008. Phylogenetic study of FMDV isolatescollected in Russia, CIS-countries and Mongolia in 2000–2007. Appendix 9. Theglobal control of FMD – tools, ideas and ideals. Erice, Italy. 14–17 October, 2008.Open session of the Research Group of the Standing Technical Committee onFMD. European Commission for the control of FMD, Food and AgricultureOrganization of the United Nations. Rome, Italy, pp. 69–72.

Schumann, K.R., Knowles, N.J., Davies, P.R., Midgley, R.J., Valarcher, J.F., Raoufi, A.Q.,McKenna, T.S., Hurtle, W., Burans, J.P., Martin, B.M., Rodriguez, L.L., Beckham,T.R., 2008. Genetic characterization and molecular epidemiology of foot-and-mouth disease viruses isolated from Afghanistan in 2003–2005. Virus Genes 36(2), 401–413.

Shin, J.H., Sohn, H.J., Choi, K.S., Kwon, B.J., Choi, C.U., Kim, J.H., Hwang, E.K., Park, J.H.,Kim, J.Y., Choi, S.H., Kim, O.K., 2003. Identification and isolation of foot-and-mouth disease virus from primary suspect cases in Korea in 2000. J. Vet. Med.Sci. 65 (1), 1–7.

Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionarygenetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599.

Tosh, C., Sanyal, A., Hemadri, D., Venkataramanan, R., 2002. Phylogenetic analysis ofserotype A foot-and-mouth disease virus isolated in India between 1977 and2000. Arch. Virol. 147 (3), 493–513.

Tsutsui, T., Yamamoto, T., 2010. The foot-and-mouth disease epidemic in Japan,2010. New tools and challenges for progressive control of FMD. Vienna, Austria.27 September to 1 October, 2010. Open Session of the Research Group of theStanding Technical Committee on FMD. European Commission for the control ofFMD, Food and Agriculture Organization of the United Nations, Rome, Italy, p. 3.

Villaverde, A., Martinez, M.A., Sobrino, F., Dopazo, J., Moya, A., Domingo, E., 1991.Fixation of mutations at the VP1 gene of foot-and-mouth disease virus, Canquasispecies define a transient molecular clock? Genes 103, 147–153.

Waheed, U., Parida, S., Khan, Q.M., Hussain, H., Ebert, K., Wadsworth, J., Reid, S.M.,Hutchings, G.H., Mahapatra, M., King, D.P., Paton, D.J., Knowles, N.J., 2010.Molecular characterisation of foot-and-mouth disease viruses from Pakistan,2005–2008. Transbound. Emerg. Dis. doi:10.1111/j.1865-1682.2010.01186.x.

WRL-FMD, 2008. Report on FMDV O from Pakistan in 2007–2008. IAH-P-EP-MEG-FOR-005-1. August 4 2008. World Reference laboratory for FMD, Institute forAnimal Health, Pirbirght, UK, pp. 1–8.

WRL-FMD, 2010. Genotyping Report. FMDV type O (Iran). Batch: WRLFMD/2010/00011. 20 April, 2010, pp. 1–37.

Zulfiqar, M., 2005. Report for development of a national control policy for foot-and-mouth disease in Pakistan. FAO project, Support emergency for prevention andcontrol of main transboundary diseases in Pakistan (Rinderpest, FMD, PPR), p. 16.

doi:10.1371/journal.pone.0014621

doi:10.1186/1743-422X-4-122

doi:10.1186/1743-422X-5-53

doi:10.1111/j.1865-1682.2010.01186.x

Documents

Infection, Genetics and Evolution · In bothPakistan(Jamaletal.,2010)andAfghanistan(Schumann et al., 2008), FMD is endemic and widespread; historically the serotype O has …