Infection, Genetics and Evolution 53 (2017) 7–14

Contents lists available at ScienceDirect

Infection, Genetics and Evolution

j ourna l homepage: www.e lsev ie r .com/ locate /meeg id

Research paper

Complete genome sequences of two avian infectious bronchitis virusesisolated in Egypt: Evidence for genetic drift and genetic recombination inthe circulating viruses

Hassanein H. Abozeid a,b, Anandan Paldurai a, Sunil K. Khattar a, Manal A. Afifi b, Magdy F. El-Kady c,Ayman H. El-Deeb b, Siba K. Samal a,⁎a Virginia-Maryland Regional College of Veterinary Medicine, University of Maryland, College Park, MD, USAb Faculty of Veterinary Medicine, Cairo University, Giza, Egyptc Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef, Egypt

⁎ Corresponding author at: Virginia-Maryland RegionalUniversity of Maryland, College Park, MD 20742, USA.

E-mail address: ssamal@umd.edu (S.K. Samal).

http://dx.doi.org/10.1016/j.meegid.2017.05.0061567-1348/© 2017 Published by Elsevier B.V.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 29 March 2017Received in revised form 5 May 2017Accepted 7 May 2017Available online 08 May 2017

Avian infectious bronchitis virus (IBV) is highly prevalent in chicken populations and is responsible for severeeconomic losses to poultry industry worldwide. In this study, we report the complete genome sequences oftwo IBV field strains, CU/1/2014 and CU/4/2014, isolated from vaccinated chickens in Egypt in 2014. The genomelengths of the strains CU/1/2014 and CU/4/2014 were 27,615 and 27,637 nucleotides, respectively. Both strainshave a common genome organization in the order of 5′-UTR-1a-1b-S-3a-3b-E-M-4b-4c-5a-5b-N-6b-UTR-poly(A) tail-3′. Interestingly, strain CU/1/2014 showed a novel 15-nt deletion in the 4b-4c gene junction region.Phylogenetic analysis of the full S1 genes showed that the strains CU/1/2014 and CU/4/2014 belonged to IBV ge-notypes GI-1 lineage andGI-23 lineage, respectively. The genome of strain CU/1/2014 is closely related to vaccinestrain H120 but showed genome-wide point mutations that lead to 27, 14, 11, 1, 1, 2, 2, and 2 amino acid differ-ences between the two strains in 1a, 1b, S, 3a, M, 4b, 4c, and N proteins, respectively, suggesting that strain CU/1/2014 is probably a revertant of the vaccine strain H120 and evolved by accumulation of pointmutations. Recom-bination analysis of strain CU/4/2014 showed evidence for recombination fromat least three different IBV strains,namely, the Italian strain 90254/2005 (QX-like strain), 4/91, andH120. These results indicate the continuing evo-lution of IBV field strains by genetic drift and by genetic recombination leading to outbreaks in the vaccinatedchicken populations in Egypt.

© 2017 Published by Elsevier B.V.

Keywords:Infectious bronchitis virusComplete genome sequenceGenetic recombinationGenetic driftEgyptian variantEgypt

1. Introduction

Avian infectious bronchitis (IB) is a highly contagious viral disease ofchickens (Gallus gallus) and is responsible for severe economic losses inthe poultry industry around theworld (Cavanagh, 2007). IB is one of themost prevalent diseases in poultry and is manifested clinically in threedifferent forms affecting the respiratory, the reproductive and therenal systems (Cavanagh, 2007; Jackwood, 2012). Avian infectiousbronchitis virus (IBV) has also been reported in other avian species in-cluding guinea fowl, partridge, peafowl and teal, but with no clinicallydetectable disease (Cavanagh, 2007; Liu et al., 2005; Sun et al., 2007).

IBV belongs to the genus Gammacoronavirus in the familyCoronaviridae (King et al., 2011). IBV is an enveloped virus with a sin-gle-stranded, positive-sense RNA genome of about 27.6 kb (Mastersand Perlman, 2013). The genome is organized in the order 5′-UTR-1a-

College of Veterinary Medicine,

1b-S-3a-3b-E-M-4b-4c-5a-5b-N-6b-UTR-poly(A) tail-3′. The 5′ two-third of the genome ismade up of gene 1 (the replicase gene), separatedinto ORFs 1a and 1b and is translated into 1a and 1ab polyproteins, with1ab resulting from −1 ribosomal frame shift at the ORF 1a/1b junction(Brierley et al., 1989). Gene 1 encodes non-structural proteins involvedin proteolytic processing of polyprotein products, virus genome replica-tion and transcription. The 3′ one-third of the genome codes for fourstructural proteins: Spike (S), envelope (E), membrane (M) and nucle-ocapsid (N), as well as, several accessory proteins that are not essentialfor viral replication but may play a role in antagonizing host innate im-munity (Bentley et al., 2013; Cao et al., 2008; Hewson et al., 2011; Liuand Inglis, 1991, 1992) and serve as targets for rational attenuation ofIBV (Casais et al., 2005; Cavanagh, 2007; Hodgson et al., 2006; Shen etal., 2003; Youn et al., 2005). The glycoprotein S is a surface proteinthat is post-translationally processed into S1 (N-terminal part) contain-ing the globular head and S2 (C-terminal part) forming the stalk domainanchored in the viral membrane (Belouzard et al., 2012; Cavanagh,2007). The glycoprotein S1 plays an important role in tissue tropism, in-duction of protective immunity as it contains the receptor binding sites

8 H.H. Abozeid et al. / Infection, Genetics and Evolution 53 (2017) 7–14

and virus neutralizing and serotype-specific epitopes (Belouzard et al.,2012; Cavanagh et al., 1998; Niesters et al., 1987; Wickramasinghe etal., 2011). These epitopes can evolve rapidly, specifically within the hy-pervariable regions (HVRs) in the S1 gene to evade host immune re-sponse (Belouzard et al., 2012). The E and M proteins are required forthe assembly and budding of the virus (Lai and Holmes, 2001; Lim etal., 2001). The N protein plays a key role in viral replication and assem-bly and in the cellular immunity (Lai and Holmes, 2001).

IBV is a continuously evolving virus. Many IBV serotypes and geno-types that exhibit limited cross protection to each other have been re-ported worldwide (Cavanagh, 2007). Mutations including insertions,deletions, and substitutions, as well as, recombination between differ-ent strains occur frequently in nature (Adzhar et al., 1997; Hewson etal., 2014; Jackwood, 2012) leading to emergence of new variant viruses(Abolnik, 2015; Abro et al., 2012; Cavanagh et al., 2007; Jackwood,2012). The variant viruses tend to have increased virulence and triggerIB outbreaks. Recombination in IBV happens due to viral polymeraseswitching templates (copy choice mechanism) during RNA replicationwhich contributes to genetic diversity (Lai, 1992; Lai and Holmes,2001). The phylogenetic analysis of currently available S1 gene se-quences has identified 6 IBV genotypes comprising 32 viral lineages(Valastro et al., 2016).

In Egypt, IBV is highly prevalent and is a major disease problem forthe poultry industry. Several serotypes and genotypes of IBV are co-cir-culating in Egypt, leading to the emergence of variant viruses. Histori-cally, the “classical” IBV vaccines H120 and Ma5, have been used as aroutine method of disease prevention in Egypt. Since 2012, “variant”vaccine strains 4/91, CR88, and D274 were being used along with theclassical vaccine strains to control IB outbreaks all over the country. De-spite of intensive vaccination, classical H120-like viruses and variant vi-ruses have been reported frequently in Egypt.

Studies on molecular epizootiology of IBV in Egypt are limited. In2001, a variant strain Egypt/Beni-Suef/01, also known as, Egyptian var-iant I, was reported and it was closely related to the Israeli variant strainIS/720/99 (Abdel-Moneim et al., 2002). Another distinct variant strain,Egyptian variant II, was reported in 2011 (Abdel-Moneim et al., 2012).The Egyptian variants I and II were described based on the HVR3 se-quences of the S1 gene. However, no complete S1 gene sequence isavailable for these variant strains. In 2003, AbdelMoneim et al. reporteda full S1 gene sequence of strain Egypt/F/03 that showed 98% nucleotide(nt) sequence identity with the classical vaccine strain H120 (Abdel-Moneim et al., 2006). In 2016, Zanaty et al. reported full S1 gene se-quences of four Egyptian variant strains that showed 91 to 95% nt se-quence identity with the Israeli variant strain IS/1494/06 and one

Table 1Consensus primer sets used for the amplification of the Egyptian IBV genomes.

Amplicona nt positionb Forward prim

1 71–1669 CTTAAATACC2 1578–3012 TAYGYRGCR3 2956–4717 ARTGTGARG4 4570–6157 GTGAKTTYTC5 6014–8120 GTGVAGATG6 8021–9546 AYTTBCAACC7 9428–11,153 CACCATCTDG8 11,091–12,523 ATGGTGGTG9 12,435–14,541 TTTAAACGG10 14,250–16,323 GMRGAYCCD11 16,253–18,163 RTTTAARGCW12 18,004–19,270 CTAYGAYAT13 18,990–20,572 AGTBTCYACA14 20,819–22,009 TTAAATCATT15 21,850–23,268 GATGTCAAC16 23,071–24,688 SARAARATTA17 24,638–26,077 CGADTTYCCN18 25,971–27,836 TAGTAAAGA

a Amplicon refers to each of the 18 overlapping RT-PCR amplicons for IBV genome sequencib nt position indicates corresponding nucleotide position of each RT-PCR amplicon in the ali

classical vaccine-like strain that showed 98% nt sequence identity withstrain H120 (Zanaty et al., 2016). Till date, there is no information avail-able on the complete genome sequence of any circulating IBV strain inEgypt.

In this study, we present the first record of complete genome se-quences of two Egyptian IBV field strains: a “classical” vaccine-relatedstrain belonging to GI-1 lineage and a “variant” strain belonging to GI-23 lineage. Our Egyptian variant strain genome is the first complete ge-nome sequence of a lineage GI-23 IBV from the entire Middle East andAfrica. Our results indicate that both mutations and recombination areinvolved in the evolution of the Egyptian field strains.

2. Materials and methods

2.1. Egyptian IBV field strains

In Egypt, IBV field strains IBV/Ck/EG/CU/1/2014 (CU/1/2014) andIBV/Ck/EG/CU/1/2014 (CU/4/2014) were isolated from the field sam-ples received at the Cairo University and at the Beni-Suef University, re-spectively, in 2014, from4-week-old broiler chickens from twodifferentfarms. Birds in both farmswere vaccinated at day 7 of age using IBV vac-cine H120. Strain CU/1/2014 was isolated from tracheal swab samplescollected from birds showing cough, dyspnea and lacrimation. StrainCU/4/2014 was isolated from trachea and kidneys collected from birdsshowing severe respiratory signs in addition to whitish diarrhea. Thepost-mortem examination revealed caseous plug at tracheal bifurcationand swollen pale kidneys filled with urates. The Egyptian IBV strainswere shipped to the University of Maryland (UMD) for complete ge-nome sequencing following USDA/APHIS guidelines. These EgyptianIBV samples were first tested free of exotic Newcastle disease virus inthe USDA Reference Laboratory, Ames, Iowa, USA before being sent toUMD. The IBV strains were propagated in 9 to 11-day-old SPF embryo-nated chicken eggs following standard procedures (OIE, 2013). StrainsCU/1/2014 and CU/4/2014 were subjected to complete genome se-quencing at the 11th and 8th egg passage, respectively.

2.2. Viral RNA extraction, RACE, and RT-PCR

The IBVgenomic RNAwas extracted from the infective allantoic fluidusing QIAamp® viral RNA Mini Kit (Qiagen, Germany) per themanufacturer's instructions. Reverse transcription (RT) was performedusing reverse transcriptase SuperScript® IV (SSIV) (Invitrogen, USA)following manufacturer's protocol. A PCR reaction was performedusing the universal primer set; Oligo S1 5′ mod (forward): 5′-

er sequence (5′-3′) Reverse primer sequence (5′-3′)

TACAGCTGGTCC ATCTYCGGTGTWACACCATCCCTYTDTCWGG TTRCHGGRTCTTGWTAAGAGARGAGGAYGAGG GGYTGAATACAAGCTTCAAGGCCAGAYGCTAAYTGGC GRAASASCAWATAMAGCCAATTCCATTTTRYTYGTCDTG ACACTACCYCTACAATAGCTGTCHAATGGTGTTAGGC TTAGTAACTAAWTTRTCTGGTKGCACAGTTRCCTARTGC CTGACTTTGCAATRTTGGCRGCTWACACAGCAAG ACATCATCAAAGGCTCGCTTTACGTACGGGGTAGC RRCGCGCRACATTRGCAGATGRTYATGGGTTGGG CRCAACTAACTTCHGGCAAGGCAATGAYACAGGC CCARAACATACAAAGACCATCAGC

RGGCAACCCTAAAGG CWCCATAHARTATGTGYTYAGACCCAGTGTTAYAAGCG GGYCTRWANKSRCTYTGGTAGTCAGTGTGTTAATAAT CATAACTAACATAAGGGCAACAGCAGTTTGTAG GCATACTGACTAGCATTAGCTGATGAGTGTGTHAARTC ACCTACTGCWATGTTAAGGGGAARAACGGTTGG RYTCTRCTTGTCCTGCTTTG

TAATCCTTTTCGCGG TAGTGCTGTACCCTCGATCG

ng.gned consensus of the 21 IBV genomes.

9H.H. Abozeid et al. / Infection, Genetics and Evolution 53 (2017) 7–14

TGAAAACTGAACAAAAGA and CK2 (reverse): 5′-CNGTRTTRTAYTGR CA(Gelb et al., 2005) to amplify approximately 700 bp amplicon beginningfrom the start of S1 gene and spanning two hypervariable regions(HVR1–2). The remaining genome sequence, excluding the 5′ and the3′ termini, was amplified as 18 overlapping genome fragments byusing 18 IBV consensus primer sets (Table 1) designed based on the nu-cleotide sequence alignment of genome sequences of 21 different IBVstrains (refer Section 2.4 for database accession numbers). Briefly, a 25μL-PCR reaction was prepared containing 2 μL of cDNA (from the RT re-action described above), 2.5 μL 10× LA Taq buffer, 0.5 μL of 10 mMdNTPs, 0.5 μL of 20 pmol μL−1 of each gene specific primer, 18.8 μL ofPCR-grade water, and 0.2 μL of LA Taq polymerase (TaKaRa, Japan).

Fig. 1. Phylogenetic tree based on the full S1 gene sequences of representative IBV strains. EgyptCU/1/2014 and CU/4/2014 are clustered with IBV strains of genotypes GI-1 and GI-23, respectivmethod with 1000 bootstrap replicates using Kimura-2 parameter and nucleotide substitutiodatabase accession number for each strain is provided at the beginning of the strain name.

The thermocycler conditions were initial denaturation of 94 °C for3 min followed by 35 cycles of 94 °C for 30 s, 53 °C for 30 s, 68 °C for1 min per kbp of amplicon, and final extension at 68 °C for 10 min. 5′-RACEwas performed using SMARTer® RACE 5′/3′Kit (Clontech, Califor-nia, USA) following the manufacturer's instructions. 3′-RACE was per-formed according to the method proposed by Scotto-Lavino et al.(2006).

2.3. Cloning and nucleotide sequencing

The IBV genome specific overlapping RT-PCR products were re-solved by electrophoresis in 1% agarose gels. The DNA bands were

ian IBV strains CU/1/2014 and CU/4/2014 are indicated by solid diamond. Note that strainsely. The phylogenetic tree was computed in the MEGA 7 software using neighbor-joiningn model. All genotypes of representative IBV strains are indicated on the right side. The

Table 2Genome features of the Egyptian field strains CU/1/2014 and CU/4/2014.

UTR orORF

Strain CU/1/2014 Strain CU/4/2014

nt position ntlength

aalength

nt position ntlength

aalength

5′UTR 1–528 528 – 1–529 529 –1a 529–12,330 11,802 3933 530–12,376 11,847 39481ab 529–20,363 19,835 6611 530–20,424 19,895 6631S 20,413–23,802 3489 1162 20,360–23,851 3492 11633a 23,802–23,975 174 57 23,851–24,024 174 573b 23,975–24,169 195 64 24,024–24,215 192 63E 24,150–24,479 330 109 24,196–24,480 285 94M 24,451–25,128 678 225 24,473–25,153 681 2264b 25,129–25,407 279 92 25,154–25,438 285 944c 25,334–25,489 156 51 25,359–25,529 171 565a 25,473–25,670 198 65 25,513–25,710 198 655b 25,667–25,915 249 82 25,707–25,955 249 82N 25,858–27,087 1230 409 25,898–27,127 1230 4096b 27,111–27,341 231 76 27,136–27,363 228 753′UTR 27,342–27,615 274 – 27,364–27,637 274 –

10 H.H. Abozeid et al. / Infection, Genetics and Evolution 53 (2017) 7–14

excised and gel purified using NucleoSpin® Gel and PCR Clean-up Kit(Clontech, California, USA) following manufacturer's protocol. The gelpurified RT-PCR products were ligated to pGEM®-T Easy cloning vector(Promega,Wisconsin, USA) and transformed into chemically competentDH10B cells following the manufacturer's instructions. Three indepen-dent clones were picked and the DNA sequencing was carried outusing BigDye® Terminator v3.1 cycle sequencing kit (AppliedBiosystems, USA) in ABI 3130xl genetic analyzer (Applied Biosystems).Thus, every nucleotide in the genome was sequenced at least threetimes after cloning to ensure a consensus sequence. T7 forward andSP6 reverse primers were initially used to sequence each clone, thengene specific sequencing primers were designed from the obtained se-quences to determine the sequence of the remaining regions.

2.4. Database accession numbers for the IBV sequences

The complete genome sequences of Egyptian IBV field strains IBV/Ck/EG/CU/1/2014 (CU/1/2014) and IBV/Ck/EG/CU/4/2014 (CU/4/2014) were submitted to the GenBank under accession numbers,KY805845 and KY805846, respectively.

The GenBank accession numbers of the complete genome sequencesof IBV strains used in the alignment for designing the IBV consensusprimers were the following: 4/91 vaccine (KF377577.1), A2(EU526388.1), B1648 (KR231009.1), ArkDPI11 (EU418976.1), B17(KT203557.1), Cal56b (GU393331.1), California 99 (AY514485.1),Conn46 1991 (FJ904719.1), Delaware 072 (GU393332.1), CK/SWE/0658946/10 (JQ088078.1), FL18288 (GU393333.1), Gray (GU393334.1),H52 (EU817497.1), H120 (GU393335.1), Holte (GU393336.1), BeaudetteCK (AJ311317.1), Iowa 97 (GU393337.1) JMK (GU393338.1), NGA/A116E7/2006 (FN430415.1), Sczy3 (JF732903.1), and TW2575/98(DQ646405.2).

2.5. Sequence and phylogenetic analysis

The sequences of IBV genomes, ORFs, anddeduced proteinswere an-alyzed using EditSeq, SegMan Pro, MegAlign, and SeqBuilder programsof Lasergene 10 (version 10.0.0[3]) software (DNASTAR Inc., Madison,WI, USA). The phylogenetic analysis was conducted using theMolecularEvolutionary Genetics Analysis 7 (MEGA 7) software (www.megasoftware.net) (Kumar et al., 2016). For the construction of phylo-genetic trees, sequences were aligned using ClustalW multiple align-ment algorithm and then neighbor-joining method was used with1000 bootstrap replicates employing Kimura 2-parameter and nucleo-tide substitution model.

2.6. Recombination analysis

To detect putative recombination events in the genome of Egyptianfield strain CU/4/2014, Recombination Detection Program 4 (RDP4)software version 4.80 that contains the methods - RDP, Bootscan,GENECONV, MaxChi, Chimera, SiScan, and 3Seq (Martin et al., 2015).The P value of 0.05was set in the general settings of the software beforethe analysis. The detection of recombination breakpoints by at least fiveof these methods was taken as confirmatory for any putative recombi-nation event.

3. Results

3.1. Sequence and phylogenetic analysis of S1 gene of Egyptian IBV fieldstrains

Nucleotide sequences of the full S1 genes were used to BLAST searchto identify the genotype of the Egyptian strains CU/1/2014 and CU/4/2014. Strain CU/1/2014 S1 gene sho6wed highest nucleotide (nt) andamino acid (aa) identities with the commercial vaccine strains Ma5(99.6% and 99.1%, respectively) and H120 (99.4% and 98.7%,

respectively). In comparison, other vaccine strains used in Egypt, name-ly, 4/91, CR88 and D274 showed sequence identities of 78%, 77.5%, and80.4% at the nt level and 74.1%, 74.5%, and 77.7% at the aa level, respec-tively. In addition, strain CU/1/2014 S1 gene showed high nt sequenceidentities of 98% and 97.8% with the previously published Egyptianstrains 15629F-SP1-2015 and F/03, respectively.

On the other hand, S1 gene of strain CU/4/2014 showed maximumnt sequence identities with the Egyptian variant strains D1887/2/3/12(99.8%), D1795/2/7/11 (98.9%), 1442F-SP1-2014 (98.2%), 1265B/2012(96.4%), D1344/2/4/10 (96.1%), and CLEVB-2/012 (95.6%). In addition,strain CU/4/2014 S1 gene showed high nt sequence identities of 95.4%and 95.3% with the Israeli variant strain IS/1494/06 and the Polish vari-ant strain G052/2016, respectively. In comparison, the vaccine strains,namely, H120, Ma5, 4/91, CR88, and D274 showed nt sequence identi-ties of 79.8%, 79.5%, 78.1%, 78.4 and 82.2%, respectively.

Phylogenetic analysis was performed using the nucleotide se-quences of full S1 genes of the Egyptian field strains CU/1/2014 andCU/4/2014 with available representative IBV strains (Fig. 1). Strain CU/1/2014 clustered with GI-1 lineage, along with classic IBV strainsH120, H52, M41, and Connecticut. Strain CU/4/2014 clustered with GI-23 lineage IBV strains alongwith other variant strains from Egypt, Israeland Europe.

3.2. Complete genome sequence analysis of Egyptian IBV field strains

The genome lengths of Egyptian field strains CU/1/2014 and CU/4/2014, excluding their poly-(A) tails, were 27,615 and 27, 637 nt, respec-tively. Both IBV genomes contained six genes and 13 ORFs in the order5′-UTR-1a-1b-S-3a-3b-E-M-4b-4c-5a-5b-N-6b-UTR-poly(A) tail-3′(Table 2, Fig. 2). At the genome level, strains CU/1/2014 and CU/4/2014 showed highest nt sequence identity with the classical vaccinestrainH120 (99.6%) and the Polishfield strainG052/2016 (91%), respec-tively. The 5′ and 3′ untranslated regions (UTR) of strain CU/1/2014were 528 and 247 nt in length similar to strain H120 but had 5 and1 nt assignment differences, respectively. The 5′ and 3′ UTRs of strainCU/4/2014 were 529 and 247 nt length. It is to be noted that 5′UTR ofthe Egyptian strain CU/4/2014 is 48 nt longer than the closely relatedPolish strain G052/2016 (accession no. KY047602.1), which is the onlygenome sequence available in the database representing GI-23 lineage.

3.3. ORF and deduced protein sequence analysis of Egyptian IBV field strains

Although the Egyptian IBV strain CU/1/2014 was closely related tothe classical vaccine strain H120 (accession no. GU393335.1), therewere genome-wide differences in the ORFs and deduced protein se-quences of both strains. Strain CU/1/2014 showed highest aa

Fig. 2.Genemap of Egyptian IBV strains CU/1/2014 and CU/4/2014. Both Egyptian strains had the common genome organization as illustrated (drawn to scale)with a few sequence lengthvariations as given in Table 2. The genome lengths of strains CU/1/2014 and CU/4/2014were 27,615nt and 27,637nt, respectively,without their poly-(A) tails. ORFs are indicated based ontheir reading frames (assigned starting from ORF 1a as frame 1) by color: frame 1, orange; frame 2, blue, and frame 3, green. 5′ and 3′ UTRs and poly-A-tail are given in black color. (Forinterpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

11H.H. Abozeid et al. / Infection, Genetics and Evolution 53 (2017) 7–14

assignment differences in the protein 1a involving 27 residues,whereas,proteins 1b, N, M, and 3a showed 14, 2, 1, and 1 aa assignment differ-ences, respectively, compared to strain H120. In the full S protein, strainCU/1/2014 showed 11 aa assignment differences; 6 in the S1 protein,namely, A19V, S56F, G118D, E179A, V204I and D390N among whichS56F and G118D resulted from mutations in the HVR1–2; 5 in the S2protein, namely, N617S, V727A, T748I, G981S and V1008A, comparedto the strain H120. In addition, strain CU/1/2014 showed a novel 15-ntdeletion in the 4b–4c gene junction region compared to strain H120.This 15-nt deletion occurs out-of-frame (in +1 frame) for ORF 4b ofstrain CU/1/2014 resulting in the deletion of 5 aa residues “HYKKD”,from aa position 30 to 34, compared to the 4b protein of strain H120.This out-of-frame 15-nt deletion shifts the downstream stop codon‘TAA’ to ‘CAA’ which codes for a Gln (Q) residue and adds two more aaresidues before meeting a downstream stop codon ‘TAA’ generating aterminal aa sequence of “QMD” for the strain CU/1/2014 protein 4b(Fig. 3A). On the other hand, in strain CU/1/2014 ORF 4c, the 15-nt de-letion occurs in-frame resulting in the deletion of 5 aa residues“IIRRR”, from aa position 22 to 26, compared to strain H120 4c protein(Fig. 3B). Proteins 3b, 5a, 5b and 6b showed 100% aa sequence identitieswith strain H120.

The genome sequences of the Egyptian strain CU/4/2014 and thePolish strain G052/2016 showed the same gene order and organizationbut differed in the lengths of 5′UTR and ORFs 1a and 6b. Strain CU/4/2014 ORFs 1a and 6b were 11,847 and 228 nt in length compared to

Fig. 3. Schematic diagram illustrating the 15-nucleotide deletion at the 4b–4c gene junction(orange) and 4c (Braun and Bluestein, 1997) encompassing the 15-nt deletion are illustrated.modification of the regular 4b stop codon ‘TAA’ (given in red) to CAA (given in blue) which ccolor. The solid arrows indicate the nt positions (bold Arabic numerals) corresponding to thH120. The codon triplets are separated by a white line. (B) Amino acid deletion in the proteinin 4b and 4c, which are HYKKD and IIRRR, respectively. The solid dots indicate the aa positionslegend, the reader is referred to the web version of this article.)

11,853 and 225 nt of corresponding ORFs in the Polish strain G052/2016 leading to respective protein length differences between thestrains. Despite close genetic relatedness, strains CU/4/2014 and G052/2016 vary greatly in their nt sequence identities of ORFs (Table 3).

At theORF level, strain CU/4/2014 showed highest nt sequence iden-tities with the following strains: strain G052/2016 in 1b (91.4%), S(95.1%), E (91.9%), 5a (94.9%), and N (96.3%); strains 4/91, and theQX-like strains ZA/3665/11 and AR251-15 (95.4%) for ORF 3a; strainIBVUkr27-11 with 94.7%, 94%, and 97.6%, respectively, for ORFs M, 4band 5b; strain Gray (93.8%) and strain H120 (97.7%), respectively,with ORFs 3b and 4c. Although the strain CU/4/2014 full S gene showedhighest nt sequence identity with the Polish strain G052/2016, the CU/4/2014 S2 genent sequencewasmore closely related to theQX-like Ital-ian strain 90254/2005. ORFs 1a and 6b of strain CU/4/2014 showedoverall low nt sequence identities with all IBV genotypes. All of thesent sequence identity variations strongly suggested a possible recombi-nation between different IBV genotypes in the genetic constitution ofthe Egyptian field strain CU/4/2014.

3.4. Recombination analysis of Egyptian IBV field strain CU/4/2014

The recombination analysis of Egyptian field strain CU/4/2014 wasperformed using RDP4 software. Based on the analysis, multiple recom-bination breakpoints were detected in the genome of the strain CU/4/2014, especially at the 3′ one-third of the genome. Only the

of the Egyptian IBV strain CU/1/2014 compared to strain H120. (A) ORF sequences of 4bNote the frames in which the 15-nt deletion occurs in the ORFs 4b and 4c. Also note theode for Gln (Q) residue. The new stop codon at the downstream of 4b is given in greene strain H120 genome. The solid dots indicate the nt positions corresponding to strains of 4b (orange) and 4c (Braun and Bluestein, 1997). Note the deletion of 5 aa sequencescorresponding to strain H120. (For interpretation of the references to color in this figure

Table 3Percent nucleotide sequence identities of ORFs of Egyptian field strain CU/4/2014 with IBV reference strains.

Database accession no._IBV strain ORF of strain CU/4/2014

1a 1b s1 s2 3a 3b E M 4b 4c 5a 5b N 6b

AJ311317.1_Beaudette_CK 87.1 90.5 80.1 85.2 86.8 83.1 73 91.1 46.7 42.1 86.9 93.6 90.3 –AY851295.1_Mass_41 87 90.4 80.1 85.8 85.6 84.1 72.7 90.6 89.1 32.2 85.4 94.4 91.2 –EU418976.1_ArkDPI11 87.5 90.8 78.1 86.9 94.3 92.8 77.2 88 87.7 84.2 87.9 95.2 92.4 78.1EU817497.1_H52_China 87.1 90.4 79.9 85.4 83.9 84.1 72.4 90.6 73 97.1 90.4 94.4 91.8 59.9FJ904714.1_Cal_1995 86.8 90.6 77.7 84.9 91.4 89.7 89.5 90.3 83.2 86 90.4 95.2 92.8 78.1FJ904719.1_Conn46_1991 87.3 90.6 79.5 86.5 91.4 92.8 77.5 88 87.7 84.2 87.9 95.6 92.5 50.8FN430414.1_ITA/90254/2005 86.8 89.6 77.7 93.6a 84.5 72.3 71.5 91.4 91.2 86 91.4 96 90.9 80.6a

FN430415.1_NGA/A116E7/2006 87.1 90.8 77.1 84.5 86.8 80.5 88.3 39.2 86.3 79.5 92.9 95.2 91 77.7GU393334_Gray_USA_1960 87.7 90.3 78 85.1 94.3 93.8a 77.2 87.4 87.7 83.6 87.9 94.4 91.5 –GU393335.1_H120 87.2 90.7 80 85.5 83.9 83.6 71.8 91.1 88.1 97.7a 90.9 94.4 91.7 60.3GU393338.1_JMK_USA_1964 87.8a 90.1 77.7 87 94.3 93.3 77.2 89.2 87.7 83.6 87.9 94.4 92.1 –KF377577.1_4/91_vaccine 86.9 90.5 78.4 85.9 95.4a 89.7 75.1 90.2 90.5 85.4 89.9 92.8 91.3 80.6a

KJ135013.1_IBVUkr27-11 87 90.7 79 86.1 94.8 91.3 91.3 94.7a 94a 86.5 94.4 97.6a 91.7 80.6a

KP662631.1_ck/ZA/3665/11 86.5 89.7 75.6 90.9 95.4a 75.9 70.9 92.8 90.5 84.8 92.9 96.4 91.6 70.2KX272465.1_AR251-15_Sudan 87.1 91.4a 77.3 90.5 95.4a 75.9 71.2 93.6 86.7 83.6 89.9 92.4 90.8 79.8KY047602.1_ Poland/G052/2016 86.8 91.4a 95.2a 93.3 87.4 84.1 91.9a 94.4 87.7 84.8 94.9a 96.4 96.3a 80.2KY805845_Strain CU/1/2014 87.1 90.8 79.6 85.4 84.5 83.6 71.8 91.2 85.3 87.1 90.9 94.4 91.9 59.9

‘–’ indicates the absence of ORF 6b.a Indicates the highest nucleotide sequence identity.

12 H.H. Abozeid et al. / Infection, Genetics and Evolution 53 (2017) 7–14

recombination events identified by at least five of the seven in-built de-tection methods of RDP4 were considered stringent and confirmatory(Table 4, Fig. 4). The results showed that the Egyptian variant strainCU/4/2014 was a recombinant IBV evolved from at least three differentIBV strains, namely, the Italian strain 90,254/2005, 4/91, and H120.

4. Discussion

IBV is one of themajor viral pathogens of chickensworldwide. IBV isenzootic in Egypt and existence of many IBV serotypes and genotypeshave been reported since the first record in 1954 (Ahmed, 1954). Thefull extent of the circulating serotypes and genotypes of IBV in Egypt isnot yet known. Currently, live attenuated vaccines representing classicaland variant strains are used to control IBV in Egypt. Despite of intensivevaccinationwith these different vaccine strains, IBVoutbreaks occur fre-quently, indicating that the prevalent strains are probably serologicallydifferent than the vaccine strains. In fact, the currently used live attenu-ated vaccines in Egypt may be contributing to the evolution of new var-iant viruses by recombination with the circulating viruses.

Partial or complete S1 gene sequences are used for rapid genomede-tection using RT-PCR for IBV epizootiology around the world. In addi-tion, the short length and the hypervariable nature of the S1 genesuits well for the analysis of IBV genotyping and phylogeny. Therefore,several IBV field strains reported from Egypt are restricted to analysesof partial or full length sequence of IBV S1 gene (Abdel-Moneim et al.,2002; Abdel-Moneim et al., 2012; Abdel-Moneim et al., 2006; Zanaty

Table 4Genetic recombination events of Egyptian field strain CU/4/2014 detected by RDP4 software.

Recombinationeventa

Breakpoints Geneb Major parentc

(similarity)Minor parent(similarity)

Beginning Ending

1 22,404 23,557 S Unknowne (H120) ITA/90254/20(99.1%)

2 23,888 24,542 3a, 3b, Eand M

ITA/90254/2005(92%)

4/91 (87.5%)

3 25,342 25,485 4b and 4c ITA/90254/2005(91.7%)

H120 (97.9%)

a The genetic recombination (transfer of fragments) identified by at least five detection metb Gene indicates the coding sequences contained within the fragment introduced by recomc Major parent is the genome of parent contributing the larger fraction of sequence.d Minor parent is the genome of parent contributing the smaller fraction of sequence.e Only one parent is detected; strain given in parenthesis indicates inferred parent.f All recombination events were detected by all seven detection methods and their respectiv

et al., 2016). Although the S1 gene encodes the S1 subunit of the spikeglycoprotein, which is the major inducer of protective immunity, thenucleotide sequence by itself is only approximately 5% of the full IBV ge-nomewhich is too short to represent the whole genome. Therefore, it isnecessary to have the full genome which will give more reliable resultsabout the evolution of these IBV strains in Egypt. In this study, for thefirst time, the complete genomes of two Egyptian field strains, CU/1/2014 and CU/4/2014, were sequenced and analyzed. These two fieldstrains were isolated from vaccinated chickens, suggesting that the cur-rently used IBV vaccines in Egypt are ineffective in controlling IBVinfection.

The complete genome sequences of Egyptianfield strains CU/1/2014and CU/4/2014 showed novel genetic markers along the genome al-though both field strains contained six genes and 13 ORFs in the orderof 5′-UTR-1a-1b-S-3a-3b-E-M-4b-4c-5a-5b-N-6b-UTR-poly(A) tail-3′,which is found in most but not all IBV strains (Thor et al., 2011).

The genome of CU/1/2014 is 27,615 nt, excluding the poly(A) tail,and is 15-nt shorter than strain H120. This 15-nt deletion is present inthe overlap region of ORFs 4b and 4c, making their protein products dif-ferent from the published H120-like strains. Little is known about theexact function of these non-structural proteins. However, studies sug-gested the role of non-structural proteins in the antagonism of host in-nate immunity and IBV pathogenicity (Casais et al., 2005; Cavanagh,2007; Hodgson et al., 2006; Shen et al., 2003; Youn et al., 2005). Devel-opment of a reverse genetics systemwill help in understanding the im-portance of this deletion in the IBV replication and pathogenesis.

d p-Value of the detection methodsf RDP, GENECONV, Bootscan, MaxChi,Chimera, SiScan and 3Seq

05 7.92 × 10−53, 1.31 × 10−75, 1.99 × 10−78, 1.28 × 10−22, 9.67 × 10−18, 1.71 ×10−33, 2.17 × 10−09

5.92 × 10−13, 7.01 × 10−23, 2.49 × 10−22, 2.09 × 10−06, 1.88 × 10−10, 1.81 ×10−26, 8.69 × 10−13

6.63 × 10−05, 2.51 × 10−03, 4.95 × 10−03, 3.33 × 10−02, 1.54 × 10−02, 1.16 ×10−04, 2.71 × 10−02

hods are only included in this table.bination.

e p-values are provided.

Fig. 4. Genetic recombination analysis of the Egyptian IBV strain CU/4/2014 using RDP4 software. (A) Genome fragments that are detected as recombination events by at least fivedetection methods in-built in the RDP4 software. (B) Neighbor-joining tree indicating the genetic relatedness of the detected recombinant regions. Potential parents involved in therecombination events of strain CU/4/2014 are color coded. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

13H.H. Abozeid et al. / Infection, Genetics and Evolution 53 (2017) 7–14

The complete genome sequence of the strain CU/1/2014 showed99.6% nt sequence identity with the classical vaccine strain H120.There was a total of 60 aa assignment differences and 7 aa deletions de-tected between the strain CU/1/2014 and strain H120 of which 11 aa as-signment differences were found in the S protein. The sequences of theORFs and the deduced proteins of strain CU/1/2014 3b, E, 5a and 5bshowed 100% nt and aa sequence identities with the strain H120.These results suggest that the Egyptian field strain CU/1/2014 is proba-bly a revertant of the vaccine strain H120, evolved by gradual accumu-lation of point mutations. Our results showed that the vaccine strainH120, which has been used for a long time to control IBV in Egypt, isprobably genetically unstable and may be contributing to some of theoutbreaks in Egypt.

The genome of the Egyptian field strain CU/4/2014 is 27,637 nt, ex-cluding the poly(A) tail, which is longer than the Egyptian field strainCU/1/2014 by 22 nt. Comparison of the S1 gene of the strain CU/4/2014 with those of available Egyptian variant strains showed 94 to99.8% nt sequence identities, indicating a high level of genetic related-ness among Egyptian variant strains. However, comparison of the S1gene sequence of the strain CU/4/2014with those of currently used vac-cine strains H120, Ma5, 4/91, CR88 and D274 showed 79.8%, 79.5%,78.1%, 78.4% and 82.2% nt sequence identities, respectively. These lowlevels of nucleotide sequence identities and the isolation of this virusfrom vaccinated birds suggest that the currently used vaccines are prob-ably not very effective in controlling the field strains in Egypt, althoughprotection studies are needed to confirm this. Phylogenetic analysesbased on the S1 gene sequence showed that the Egyptian variant strainCU/4/2014 belonged to GI-23 lineage and closely related to the variantstrains previously reported from Egypt, Israel and the Europe. In silicorecombination analyses using RDP4 software detected at least three dif-ferent parent strains, namely, Italian strain 90254/2005, 4/91 and H120,attributed to the genetic constitution of the Egyptian field strain CU/4/2014.

It is interesting to note that a field strain, G052/2016, isolated from achicken in Poland in 2016 showed high level of similarity in fiveORFs (S,M, 5a, 5b andN) to the Egyptianfield strain CU/4/2014with nt sequenceidentities ranging from 94.4 to 96.4% (Table 3) among which ORFs S, M

and N code for major structural proteins. It may be possible that thestrains CU/4/2014 and G052/2016 had a common origin. The isolationof the Polish strain two years after the 2014-Egyptian IBV outbreak sug-gests twomajor possibilities – first, the Polishfield strainmay be an out-come of a variant IBV spread from Africa to Europe; second, the GI-23lineage viruses, like the Egyptian strain CU/4/2014 and the Polish strainG052/2016, may have been circulating in different parts of theworld forsome time.

In conclusion, the sequence alignment and phylogenetic analysesshowed that the IBV strains circulating in Egypt are at least of twotypes. One group of strains, belonging to GI-1 lineage, derived fromthe currently used live attenuated classical vaccines. These vaccine-de-rived strains have adapted to grow efficiently and cause disease inchickens in Egypt by acquiring several point mutations (genetic drift).The other group of IBV strains, belonging to GI-23 lineage, includesthe circulating Egyptian variant strains. These variants are probably cre-ated by mutation and by recombination between vaccine strains andthe circulating field strains. Hence, our results showed evidence forboth genetic drift and genetic recombination involved in the evolutionof IBV strains in Egypt. Our circumstantial evidence for recombinationderived from genome sequence alignment and recombination analysessuggests that these events are probably occurring frequently in the field.High density of chickens in poultry farms and co-circulation of multipleIBV strains in a given flock, in addition to the use of different live vaccinestrains, are the reasons for the high frequency recombination. The avail-ability of additional complete genome sequences of the prevalent IBVstrains in Egypt will be helpful to understand the epizootiology, evolu-tion and pathogenicity of circulating IBV strains in Egypt.

Acknowledgements

We thank Dr. Laura Sanglas and all UMD laboratory members fortheir excellent technical assistance and help. We thank Kareem EHassan, Beni-Suef University, for his help in the preparation and ship-ping of the IBV strain CU/4/2014. Hassanein Abozeid is supported bythe Cultural Affairs and Mission Sector, Ministry of Higher Educationand Scientific Research, Egypt.

14 H.H. Abozeid et al. / Infection, Genetics and Evolution 53 (2017) 7–14

References

Abdel-Moneim, A.S., Madbouly, H.M., Gelb Jr., J., Ladman, B.S., 2002. Isolation and identi-fication of Egypt/Beni-Suef/01 a novel genotype of infectious bronchitis virus. Vet.Med. J. Giza 50, 1065–1078.

Abdel-Moneim, A.S., El-Kady, M.F., Ladman, B.S., Gelb Jr., J., 2006. S1 gene sequence anal-ysis of a nephropathogenic strain of avian infectious bronchitis virus in Egypt. Virol. J.3, 78.

Abdel-Moneim, A.S., Afifi, M.A., El-Kady, M.F., 2012. Emergence of a novel genotype ofavian infectious bronchitis virus in Egypt. Arch. Virol. 157, 2453–2457.

Abolnik, C., 2015. Genomic and single nucleotide polymorphism analysis of infectiousbronchitis coronavirus. Infect. Genet. Evol. 32, 416–424.

Abro, S.H., Renstrom, L.H., Ullman, K., Belak, S., Baule, C., 2012. Characterization and anal-ysis of the full-length genome of a strain of the European QX-like genotype of infec-tious bronchitis virus. Arch. Virol. 157, 1211–1215.

Adzhar, A., Gough, R.E., Haydon, D., Shaw, K., Britton, P., Cavanagh, D., 1997. Molecularanalysis of the 793/B serotype of infectious bronchitis virus in Great Britain. AvianPathol. 26, 625–640.

Ahmed, H.N., 1954. Incidence and Treatment of some Infectious Viral Respiratory Diseasesof Poultry in Egypt. Vol. Cairo University, City Ph.D.

Belouzard, S., Millet, J.K., Licitra, B.N., Whittaker, G.R., 2012. Mechanisms of coronaviruscell entry mediated by the viral spike protein. Viruses 4, 1011–1033.

Bentley, K., Keep, S.M., Armesto, M., Britton, P., 2013. Identification of a noncanonicallytranscribed subgenomic mRNA of infectious bronchitis virus and othergammacoronaviruses. J. Virol. 87, 2128–2136.

Braun, S., Bluestein, M., 1997. A new concept: impulse in orthodontics. Am. J. Orthod.Dentofac. Orthop. 111, 437–440.

Brierley, I., Digard, P., Inglis, S.C., 1989. Characterization of an efficient coronavirus ribo-somal frameshifting signal: requirement for an RNA pseudoknot. Cell 57, 537–547.

Cao, J., Wu, C.C., Lin, T.L., 2008. Complete nucleotide sequence of polyprotein gene 1 andgenome organization of turkey coronavirus. Virus Res. 136, 43–49.

Casais, R., Davies, M., Cavanagh, D., Britton, P., 2005. Gene 5 of the avian coronavirus in-fectious bronchitis virus is not essential for replication. J. Virol. 79, 8065–8078.

Cavanagh, D., 2007. Coronavirus avian infectious bronchitis virus. Vet. Res. 38, 281–297.Cavanagh, D., Mawditt, K., Adzhar, A., Gough, R.E., Picault, J.P., Naylor, C.J., Haydon, D.,

Shaw, K., Britton, P., 1998. Does IBV change slowly despite the capacity of the spikeprotein to vary greatly? Adv. Exp. Med. Biol. 440, 729–734.

Cavanagh, D., Casais, R., Armesto, M., Hodgson, T., Izadkhasti, S., Davies, M., Lin, F., Tarpey,I., Britton, P., 2007. Manipulation of the infectious bronchitis coronavirus genome forvaccine development and analysis of the accessory proteins. Vaccine 25, 5558–5562.

Gelb Jr., J., Weisman, Y., Ladman, B.S., Meir, R., 2005. S1 gene characteristics and efficacy ofvaccination against infectious bronchitis virus field isolates from the United Statesand Israel (1996 to 2000). Avian Pathol. 34, 194–203.

Hewson, K.A., Ignjatovic, J., Browning, G.F., Devlin, J.M., Noormohammadi, A.H., 2011. In-fectious bronchitis viruses with naturally occurring genomic rearrangement and genedeletion. Arch. Virol. 156, 245–252.

Hewson, K.A., Noormohammadi, A.H., Devlin, J.M., Browning, G.F., Schultz, B.K., Ignjatovic,J., 2014. Evaluation of a novel strain of infectious bronchitis virus emerged as a resultof spike gene recombination between two highly diverged parent strains. AvianPathol. 43, 249–257.

Hodgson, T., Britton, P., Cavanagh, D., 2006. Neither the RNA nor the proteins of openreading frames 3a and 3b of the coronavirus infectious bronchitis virus are essentialfor replication. J. Virol. 80, 296–305.

Jackwood, M.W., 2012. Review of infectious bronchitis virus around the world. Avian Dis.56, 634–641.

King, A.M., Lefkowitz, E., Adams, M.J., Carsten, E.B., 2011. Ninth Report of the InternationalCommittee on Taxonomy of Viruses (In, City).

Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary genetics analysisversion 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874.

Lai, M.M., 1992. RNA recombination in animal and plant viruses. Microbiol. Rev. 56,61–79.

Lai, M.M.C., Holmes, K.V., 2001. Coronaviridae: the viruses and their replication. In: Knipe,D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B., Straus, S.E.(Eds.), Fields Virology. Lippincott Williams & Wilkins, Philadelphia, PA,pp. 1163–1185.

Lim, K.P., Xu, H.Y., Liu, D.X., 2001. Physical interaction between the membrane (M) andenvelope (E) proteins of the coronavirus avian infectious bronchitis virus (IBV).Adv. Exp. Med. Biol. 494, 595–602.

Liu, D.X., Inglis, S.C., 1991. Association of the infectious bronchitis virus 3c protein withthe virion envelope. Virology 185, 911–917.

Liu, D.X., Inglis, S.C., 1992. Identification of two new polypeptides encoded by mRNA5 ofthe coronavirus infectious bronchitis virus. Virology 186, 342–347.

Liu, S., Chen, J., Chen, J., Kong, X., Shao, Y., Han, Z., Feng, L., Cai, X., Gu, S., Liu, M., 2005. Iso-lation of avian infectious bronchitis coronavirus from domestic peafowl (Pavocristatus) and teal (Anas). J. Gen. Virol. 86, 719–725.

Martin, D.P., Murrell, B., Golden, M., Khoosal, A., Muhire, B., 2015. RDP4: detection andanalysis of recombination patterns in virus genomes. Virus Evol. 1 (vev003).

Masters, P.S., Perlman, S., 2013. Coronaviridae. In: Knipe, D.M., Howley, P. (Eds.), Fields Vi-rology. Vol. 1. Wolters Kluwer Health, pp. 825–858.

Niesters, H.G., Kusters, J.G., Lenstra, J.A., Spaan, W.J., Horzined, M.C., van der Zeijst, B.A.,1987. The neutralization epitopes on the spike protein of infectious bronchitis virusand their antigenic variation. Adv. Exp. Med. Biol. 218, 483–492.

OIE, 2013. Avian infectious bronchitis virus. OIE Terrestrial Manual.Scotto-Lavino, E., Du, G., Frohman, M.A., 2006. 3′ end cDNA amplification using classic

RACE. Nat. Protoc. 1, 2742–2745.Shen, S., Wen, Z.L., Liu, D.X., 2003. Emergence of a coronavirus infectious bronchitis virus

mutant with a truncated 3b gene: functional characterization of the 3b protein inpathogenesis and replication. Virology 311, 16–27.

Sun, L., Zhang, G.H., Jiang, J.W., Fu, J.D., Ren, T., Cao, W.S., Xin, C.A., Liao, M., Liu, W.J., 2007.A Massachusetts prototype like coronavirus isolated fromwild peafowls is pathogen-ic to chickens. Virus Res. 130, 121–128.

Thor, S.W., Hilt, D.A., Kissinger, J.C., Paterson, A.H., Jackwood, M.W., 2011. Recombinationin avian gamma-coronavirus infectious bronchitis virus. Viruses 3, 1777–1799.

Valastro, V., Holmes, E.C., Britton, P., Fusaro, A., Jackwood, M.W., Cattoli, G., Monne, I.,2016. S1 gene-based phylogeny of infectious bronchitis virus: an attempt to harmo-nize virus classification. Infect. Genet. Evol. 39, 349–364.

Wickramasinghe, I.N., de Vries, R.P., Grone, A., de Haan, C.A., Verheije, M.H., 2011. Bindingof avian coronavirus spike proteins to host factors reflects virus tropism and pathoge-nicity. J. Virol. 85, 8903–8912.

Youn, S., Leibowitz, J.L., Collisson, E.W., 2005. In vitro assembled, recombinant infectiousbronchitis viruses demonstrate that the 5a open reading frame is not essential forreplication. Virology 332, 206–215.

Zanaty, A., Naguib, M.M., El-Husseiny, M.H., Mady, W., Hagag, N., Arafa, A.S., 2016. The se-quence of the full spike S1 glycoprotein of infectious bronchitis virus circulating inEgypt reveals evidence of intra-genotypic recombination. Arch. Virol. 161,3583–3587.