INDIAN SOCIETY OF PULSES RESEARCH AND DEVELOPMENTisprd.in/pdf/june_final_8nov12.pdfMr Brahm Prakash Treasurer Dr KK Singh Vice President Dr JS Sandhu Editors Dr MA Iquebal, IASRI,

The Indian Society of Pulses Research andDevelopment (ISPRD) was founded in April 1987 with thefollowing objectives: To advance the cause of pulses research To promote research and development, teaching and

extension activities in pulses To facilitate close association among pulse workers

in India and abroad To publish “Journal of Food Legumes” which is the

official publication of the Society, published four timesa year.

Membership : Any person in India and abroad interestedin pulses research and development shall be eligible formembership of the Society by becoming ordinary, life orcorporate member by paying respective membership fee.Membership Fee Indian (Rs.) Foreign (US $)Ordinary (Annual) 350 25Life Member 3500 200Admission Fee 20 10Library/ Institution 3000 100Corporate Member 5000 -

INDIAN SOCIETY OF PULSES RESEARCH AND DEVELOPMENT(Regn. No.877)

The contribution to the Journal, except in case ofinvited articles, is open to the members of the Societyonly. Any non-member submitting a manuscript will berequired to become annual member. Members will beentitled to receive the Journal and other communicationsissued by the Society.

Renewal of subscription should be done in Januaryeach year. If the subscription is not received by February15, the membership would stand cancelled. Themembership can be revived by paying readmission fee ofRs. 10/-. Membership fee drawn in favour of Treasurer,Indian Society of Pulses Research and Development,through M.O./D.D. may be sent to the Treasurer,Indian Society of Pulses Research and Development,Indian Institute of Pulses Research, Kanpur 208 024,India. In case of outstation cheques, an extra amount ofRs. 40/- may be paid as clearance charges.

EXECUTIVE COUNCIL : 2010-2012

Zone I : Dr (Mrs) Livinder KaurPAU, Ludhiana

Zone II : Dr HK DixitIARI, New Delhi

Zone III : VacantZone IV : Dr Vijay Prakash

ARS, Sriganganagar

Editor-in-Chief : Dr. NP Singh

Councillors

Dr A Amarendra Reddy, ICRISAT, HyderabadDr AB Rai, IIVR, VaranasiDr AK Tripathi, CSAUAT, KanpurDr CS Praharaj, IIPR, KanpurDr IP Singh, IIPR, KanpurDr Jagdish Singh, IIPR, KanpurDr KB Saxena, ICRISAT, HyderabadDr Li Zhenghong, RIRI, PRC ChinaDr MK Singh, IIPR, Kanpur

Chief PatronDr S Ayyappan

PatronDr SK Datta

Co-patronDr N Nadarajan

Zone V : Dr KK NemaRAK College, Sehore

Zone VI : Dr Ch Srinivasa RaoCRIDA, Hyderabad

Zone VII : VacantZone VIII : Dr Anoop Singh Sachan

IIPR, Kanpur

PresidentDr JS Sandhu (Acting)

SecretaryDr AK Choudhary

Joint SecretaryMr Brahm Prakash

TreasurerDr KK Singh

Vice PresidentDr JS Sandhu

EditorsDr MA Iquebal, IASRI, New DelhiDr Mohd Akram, IIPR, KanpurDr P Duraimurugan, DRR, HyderabadDr Rajindar Peshin, SKUAT, SrinagarDr RK Varshney, ICRISAT, HyderabadDr RS Raje, IARI, New DelhiDr Sarvjeet Singh, PAU, LudhianaDr SC Gupta, ARS, DurgapuraDr VK Shahi, RAU, Pusa

Journal of Food Legumes(Formerly Indian Journal of Pulses Research)

Vol. 25 (2) June 2012

CONTENTSRESEARCH PAPERS1. Genetic diversity in urdbean [Vigna mungo (L.) Hepper] revealed by ISSR markers 89

Priyanka Bhareti, D.P. Singh and R.K. Khulbe2. Genetic studies on drought tolerance attributes in chickpea (Cicer arietinum L.) 94

V. Jayalakshmi, C. Kiran Kumar Reddy and G. Jyothirmayi3. In vitro regeneration and micrografting of shoots for enhancing survival and recovery of plants in chickpea 97

(Cicer arietinum L.)Indu Singh Yadav and N. P. Singh

4. Heterosis and inbreeding depression studies in urdbean [Vigna mungo (L.) Hepper] 102Rama Kant and R.K. Srivastava

5. An assessment of chemical mutagen induced polygenic variability in M3 progenies of mungbean 109[Vigna radiata (L.) Wilczek]O. P. Balai and K. Ram Krishna

6. Multivariate analysis of agro-morphological variation in exotic germplasm of grasspea 112(Lathyrus sativus L.)Archana Singh, D. Deb, U.P. Singh and A.K. Roy

7. Influence of legume residues management and nitrogen doses on succeeding wheat yield and soil properties in 116Indo-Gangetic PlainsK.K. Singh, C.H. Srinivasarao, K. Swarnalakshmi, A.N. Ganeshamurthy and Narendra Kumar

8. Effect of integrated nutrient management on growth, seed yield and economics of field pea (Pisum sativum L.) 121and soil fertility changesAnupma Kumari, O.N. Singh and Rakesh Kumar

9. Effect of time of planting on nodulation, growth and seed yield of kharif urdbean genotypes 125Guriqbal Singh, Hari Ram, H.S. Sekhon, K.K. Gill and Veena Khanna

10. Feasibility studies in transplanted pigeonpea + soybean intercropping system 128V.V. Goud and A.S. Andhalkar

11. Performance evaluation of mechanical planters for planting of chickpea and pigeonpea 131M.K. Singh, Narendra Kumar, Prasoon Verma and S.K. Garg

12. Transmission efficiency of Mungbean yellow mosaic virus by indigenous and B-biotype whiteflies 135B. Manjunath, H.A. Prameela, Neetha Jayaram and V. Muniyappa

13. Screening for resistance against Rhizoctonia bataticola causing dry root-rot in chickpea 139Om Gupta, Manisha Rathi and Madhuri Mishra

14. Calendar based application of newer insecticides for the management of gram pod borer in chickpea 142R.M. Wadaskar, Jayashri Ughade and A.N. Patil

SHORT COMMUNICATIONS15. Genetic and molecular diversity analysis of chickpea (Cicer arietinum L.) genotypes grown under rice fallow 147

conditionA.Shrivastava, A. Babbar, V. Prakash, N. Tripathi and M. A. Iquebal

16. Assessment of genetic diversity among interspecific derivatives in chickpea 150Rupinder Pal Singh, Inderjit Singh, Sarvjeet Singh and J.S. Sandhu

17. Effect of nitrogen management on soil fertility and NPK uptake in soybean 153K.S. Rathod, R.K. Pannu and S.S. Dahiya

18. Effect of zinc and vermicompost on fenugreek (Trigonella foenum graecum L.) under irrigation with 156different RSC waterS.R. Kumawat and B.L. Yadav

19. Effect of sowing dates and fertility levels on grain yield and its component traits in lentil 159R.K. Gill, Manpreet Singh, Sarvjeet Singh and Johar Singh

20. Evaluation of Rynaxypyr 20SC against pigeonpea pod borer complex 162N. S. Satpute and U. P. Barkhade

List of Referees for vol.25(2) 164

Journal of Food Legumes 25(2): 89-93, 2012

Genetic diversity in urdbean [Vigna mungo (L.) Hepper] revealed by ISSR markersPRIYANKA BHARETI, D.P. SINGH and R.K. KHULBE

Department of Genetics and Plant Breeding, G. B. Pant University of Agriculture & Technology, Pantnagar, Uttarakhand– 263 145, India; E-mail: [email protected](Received: December 29, 2011; Accepted: May 31, 2012)

ABSTRACT

Inter simple sequence repeat (ISSR) markers were used tostudy the DNA polymorphism in advance lines and cultivars ofintervarietal and interspecific crosses in urdbean. Amplificationof genomic DNA of 33 urdbean and one mungbean genotypeusing 10 ISSR primers yielded 71 bands, of which 65 werepolymorphic with an average of 6.5 polymorphic bands perprimer. Number of amplified bands with ISSR primers rangedfrom four (primer 4824-050) to ten (primer 4824-039) and variedin size from 100 bp to 3000 bp. Percentage polymorphism rangedfrom 50.0% (primer 4824-050) to a maximum of 100% (primers4824-038, 4824-041, 4824-043, 4824-049 and Primer 4824-051), with an average of 80%. Cluster analysis grouped the 33urdbean (V. mungo) and 1 mungbean (V. radiata) genotypes intotwo main clusters, I and II comprising of 22 and 11 genotypes,respectively. The clustering pattern indicated that the variationobserved in morphological characters was not corroborated bymolecular variation. The Jaccard similarity coefficient betweendifferent Vigna genotypes ranged from 0.47 to 1.00. All thegenotypes and checks exhibited more than 61% similarity andin most of the genotypes similarity ranged from 86-100%. Thehigher degree of commonness in their pedigree may explainthe high degree of closeness among genotypes studied. Thegenetic variation among 33 genotypes of urdbean and onemungbean cultivar revealed by ISSR analysis could be usefulin selecting parents for hybridization in blackgramimprovement programmes.

Key words : Blackgram, Genetic diversity, ISSR markers,Mungbean, Polymorphism, Vigna

Urdbean [Vigna mungo (L.) Hepper: 2n=2x=22] is animportant pulse crop in India. Indian subcontinent is the centreof origin of urdbean. It is commonly known as blackgram ormash. In India, it is widely cultivated throughout plains andupto 1820 m elevation (Singh and Ahlawat 2005). Vigna mungovar. silvestris is regarded as the most probable progenitor ofcultivated urdbean. Urdbean is cultivated in different seasonsin India i.e., in kharif (rainy season) as a mixed crop withcereals and pigeonpea, and in rabi and zaid (spring andsummer) as a pure culture. It is also grown in Bangladesh,Pakistan, Sri Lanka and Myanmar (Singh 1991). Blackgram isthe fourth most important pulse crop after chickpea, pigeonpeaand green gram in India. All India area, production andproductivity of urdbean during 2010-11 was 3.10 m ha, 1.40 mtonnes and 451 kg/ha, respectively (Anonymous 2011).

Morphological, phenological and agronomiccharacteristics have conventionally been used for estimatinggenetic variation. However, many of these traits are polygenicand influenced by environmental conditions and therefore,are difficult to evaluate with accuracy. Molecular markers, byvirtue of their abundance and constancy across environments,provide reliable means for assessment of genetic diversity. Alarge number of molecular marker types are available forcharacterization and study of genetic diversity (Soller andBeckmann 1983). DNA based ISSR markers are generated byamplification of DNA segments present at an amplifiabledistance between two identical microsatellite repeat regionsoriented in opposite direction. The microsatellite repeats usedas primers can be di-, tri-, tetra- or penta-nucleotide. The primersused in ISSR 15-30 mers that permit the use of high annealingtemperature leading to higher stringency. The technique issimple, quick, and the use of radioactivity is not essential.ISSR markers usually show high polymorphism, although thelevel of polymorphism has been shown to vary with thedetection method used. ISSRs segregate mostly as dominantmarkers, although co-dominant segregation has also beenreported in some cases (Semagn 2006). Although significantefforts have been invested in the development of SSR markersin recent years in Vigna radiata which is closely related toV. mungo, but their use has been limited due to the lack ofpolymorphism in this species (Tangphatsornruang et al. 2009).

ISSR markers have been used for analysis of geneticrelationships in genus Vigna (Ajibade et al. 2000, Bisht et al.2010, Chattopadhyaya et al. 2011), and varietal identificationin urdbean (Ranade et al. 2000). In the present study, ISSRmarkers were used to assess genetic diversity among 34 Vignagenotypes derived through intervarietal and interspecifichybridization.

MATERIALS AND METHODS

Plant Material: The experimental material for the presentstudy comprised of advance lines derived from inter-varietaland interspecific crosses, and selections from local germplasm.The experimental material included two check varieties, namely,Pant U-31 and Pant U-40 and one mungbean genotype BDYR-1, which is the female parent in the wide cross involvingurdbean cv. DPU-88-31 as male (Table 1). The plant genomicDNA was isolated from fresh 15-day old leaves of 34 Vignagenotypes raised in the glass house. CTAB method (Doyleand Doyle 1990) was used for the extraction of DNA.

9 0 Journal of Food Legumes 25(2), 2012

PCR amplification: ISSR amplifications were performed in a20 µl volume containing 50ng/µl genomic DNA, 0.5 U of TaqDNA polymerase, 0.2mM each of dNTPs, 10 pmol/µl ISSRprimer in 1×reaction buffer that contained 10 mM Tris-HCl(pH 8.3), 50 mM KCl, 2.5mM MgCl2 and 0.01% gelatin (allchemical and primers from Bangalore Genei Pvt. Ltd. India).Amplifications were performed in an Eppendorf Master Cyclergradient (Eppendorf Netheler-Hinz, Hamburg, Germany).Amplification conditions were an initial denaturation at 94°Cfor 5 min and 40 cycles at 94°C for 1 min, 42°C for 1 min, 72°Cfor 2 min, followed by 10 min at 72°C. Amplified products weremixed with 4 µl of DNA loading dye and electrophoresedthrough a 1.2% agarose gel using 0.5X TAE buffer (100 mMTris HCl, pH 8.0, 83 mM glacial acetic acid, 0.5 mM EDTA) at50 volts in horizontal unit for fractionating ISSR primers. Thegels were stained with 0.5 µg/ml ethidium bromide solutionand visualized by illumination under UV light and documentedusing a gel documentation and image analysis system(Syngene, UK). The size of amplification products wasestimated by comparing the DNA bands with low range DNARuler plus marker.Recording and analysis of molecular data: The PCR productswere scored qualitatively for presence (1) or absence (0), each

of which was treated as an independent character regardlessof its intensity. Only clear and apparently unambiguous bandswere scored for ISSR analysis. Binary data were analyzed usingNTSYS-pc (Numerical Taxonomy System, Version 2.1, Rohlf2000). The SIMQUAL subprogram was used to calculate theJaccard’s coefficient, a common estimator of genetic identityor similarity.

Similarity matrices were used to construct the UPGMA(un-weighted pair group method with arithmetic average)dendrograms to elucidate the diversity among the genotypestudied. Correlation between the tree and similarity matriceswas estimated by means of the Mantel matrix correspondence

Table 1. Urdbean and mungbean* genotypes used in the studyGenotypes Pedigree Salient features PU 07-7 UPU 97-10 × DPU 88-31 Large seeded, MYMV resistant PU 08-1 UPU 97-10 × KU 97-1 Large seeded, early maturing, MYMV resistant PU 08-2 UPU 97-10 × KU 97-1 Early maturing, MYMV resistant PU 08-3 UPU 97-10 × DPU 88-31 Early maturing, MYMV resistant PU 08-4 UPU 97-10 × DPU 88-31 Early maturing, MYMV resistant, high yield/plant PU 08-5 UPU 97-10 × KU 96-3 Early maturing, MYMV resistant PU 08-6 UPU 97-10 × KU 96-3 Early maturing, MYMV resistant PU 07-7 UPU 97-10 × DPU 88-31 Early maturing, MYMV resistant PU 08-8 UPU 97-10 × DPU 88-31 Early maturing, MYMV resistant PU 08-9 Pant U-30 × ICU-7 Early maturing, MYMV resistant PU 08-10 Pant U-30 × ICU-7 Early maturing, MYMV resistant PU 08-11 Pant U-30 × AKU-15 Early maturing, MYMV resistant PU 08-12 UPU 97-10 × KU-303 Early maturing, MYMV resistant, high yield/plant PU 08-13 UPU 97-10 × KU-303 Early maturing, MYMV resistant, high yield/plant PU 08-14 Pant U-19 × KU 96-3 Early maturing, MYMV resistant PU 08-15 Pant U-19 × KU 96-3 Early maturing, MYMV resistant PU 06-14 BDYR-1* × DPU 88-31 Early maturing, MYMV resistant PU 06-15 BDYR-1* × DPU 88-31 Early maturing, MYMV resistant PU 06-16 BDYR-1* × DPU 88-31 Early maturing, higher pod length, MYMV resistant PU 06-17 BDYR-1* × DPU 88-31 Early maturing, MYMV resistant PU 06-18 BDYR-1* × DPU 88-31 Early maturing, MYMV resistant PU 06-19 BDYR-1* × DPU 88-31 Early maturing, higher pod length, MYMV resistant PU 06-21 BDYR-1* × DPU 88-31 Early maturing, MYMV resistant PU 06-22 BDYR-1* × DPU 88-31 Early maturing, MYMV resistant PU 06-23 BDYR-1 *× DPU 88-31 Early maturing, MYMV resistant PU 06-24 BDYR-1 *× DPU 88-31 Early maturing, higher pod length, MYMV resistant PMU 01 Local selection from Uttarakhand, India Susceptible to MYMV, higher seeds/pod and pods/plant PMU 02 Local selection from Uttarakhand, India Susceptible to MYMV PMU 03 Local selection from Uttarakhand, India Susceptible to MYMV Local-60 Local selection from Uttarakhand, India Early maturing, moderately resistant to MYMV Pant U-31 UPU 97-10 × DPU 88-31 Early, dwarf and compact plant type, resistant to MYMV, released for commercial

cultivation Pant U-40 UPU 89-6-7 × DPU 88-31 Erect plant type, resistant to MYMV, released for commercial cultivation

DPU 88-31 PLU-31 × Type-9 Highly resistant to foliar diseases BDYR-1* Selection from NM-92 Large seeded, susceptible to MYMV

Table 2. Details of primers used and their sequencesPrimer code Sequence (5’ to 3’) Mer TM % GC 4824-038 AGAGAGAGAGAGAGAGC 17 46.8 53 4824-039 GAGAGAGAGAGAGAGAC 17 43.3 53 4824-040 GAGAGAGAGAGAGAGAA 17 44.3 47 4824-041 AGAGAGAGAGAGAGAGTT 18 45.4 44 4824-043 AGAGAGAGAGAGAGCCTA 18 52.2 44 4824-044 GAGAGAGAGAGAGAGACC 18 43.3 55 4824-047 ACACACACACACACACC 17 49.2 53 4824-049 GAGAGAGAGAGAGAGAC 17 44.3 53 4824-050 GAGAGAGAGAGAGAGAA 17 44.3 47 4824-051 AGAGAGAGAGAGAGAGAGTT 18 45.6 50

Bhareti et al. : Genetic diversity in urdbean [Vigna mungo (L.) Hepper] revealed by ISSR markers 9 1

test (Mantel 1967). This test results in product momentcorrelation(r) that validate the dendrogram obtained from thesimilarity matrix. For matrix correlation of this type, a correlationvalue (r) greater than 0.5 will be statistically significant at 0.01probability level if the number of observed taxonomic unitexceeds 15 (Lapointe and Legendre 1992). Statistical stabilityof the branches in the cluster was estimated by bootstrapanalysis using the Winboot software program (Yap and Nelson1996).

RESULTS AND DISCUSSION

Amplification of genomic DNA of the 34 genotypes,using ISSR primers yielded a total of 71 fragments that couldbe scored. Out of 71 bands, 65 were polymorphic. Number ofamplified bands ranged from 4 (primer 44824-050) to 10 (primer4824-039), with a size range of 100 bp to 3000 bp. The averagenumbers of bands per primer and polymorphic bands perprimer were 7.1 and 6.5, respectively.

Percentage polymorphism ranged from 50.0% (primer4824-049) to a maximum of 100% (primers 4824-038, 4824-041, 4824-043, 4824-044, 4824-049 and 4824-051), with anaverage of 80% polymorphism across all the genotypes. Sevenof the 10 ISSR primers showed >80% polymorphism. Themaximum number of polymorphic bands was 8 (primers 4824-038, 4824-039, 4824-044 and 4824-050).

Jaccard’s similarity coefficients between differenturdbean lines ranged from 0.47 to 1.00. Among the 33 urdbeanand one mungbean genotype, highest genetic similarity value(minimum diversity) was observed between PU 06-23 and PU06-22, PU 06-24 and PU 06-22, and PU 06-24 and PU 06-23(0.99) followed by between PU 06-22 and PU 06-21, PU 06-23and PU 06-21, and PU 06-24 and PU 06-21 (0.94), while lowestgenetic similarity value (maximum diversity) was observedbetween Local-60 and PU 08-2 (0.47) followed by betweenLocal-60 and PU 08-1 (0.51).

The UPGMA (un-weighted pair group method witharithmetic mean) dendrogram was constructed using Jaccardsimilarity coefficient of ISSR marker data generated on 33urdbean and 1 mungbean lines employing programme NTSYS(Fig. 1). Cluster analysis grouped the 33 urdbean and 1mungbean genotypes into two main clusters, cluster I andcluster II. Cluster I was divided into two main sub-clusters,sub-cluster Ia and sub-cluster Ib. Cluster II was also dividedinto two main sub-clusters, sub-cluster IIa and sub-clusterIIb. Sub-cluster Ia was further divided into sub-cluster Ia´ andIb´. Sub-cluster Ia´ comprised of 2 genotypes, PU 08-1 andPU 08-2, whereas sub-cluster Ib´ consisted of 9 genotypes,namely, PU 08-3, PU 08-4, Pant U-31, PU 08-5, PU 08-8, PU 08-9, PU 08-6, PU 07-7 and PU 08-10. Sub-cluster Ib containedonly one genotype, PU 08-11.

Fig. 1. Dendrogram generated using unweighted pair group method with arithmetic average analysis, showing relationship betweenurdbean and mungbean genotypes, using ISSR data. The numbers at the forks indicate the confidence limit for the grouping ofthe genotypes in a branch based on 2000 cycles in bootstrap analysis using the Winboot program.


Cluster II, the larger of the two clusters consisted of 22genotypes, of which 5 genotypes were placed in sub-clusterIIa and 17 genotypes in sub-cluster IIb. Sub-cluster IIa wassubdivided into sub-cluster IIa´ and sub-cluster IIb´. Sub-cluster IIa´ comprised of only one genotype, PU 08-12, whilesub-cluster IIb´ comprised of four genotypes, namely, PU 08-13, PU 08-14, Pant U-40 and PU 08-15. The sub-cluster IIb wasfurther split into sub-cluster IIa´ and sub-cluster IIb´. Sub-cluster IIa´ is subdivided into sub-cluster IIa´1 and sub-clusterIIa´2. Sub-cluster IIa´1 comprised of seven genotypes, namely,PU 08-7, PMU-01, PMU-02, BDYR-1, PU 08-14, PMU-03 andDPU 88-31, whereas, sub-cluster IIa´2 consisted of only onegenotype, i.e., Local-60. Sub-cluster IIb´ was further dividedinto two sub-clusters IIb´1 and IIb´2. Sub-cluster IIb´1comprised of two genotypes, PU 06-15 and PU 06-16, whereas,sub-cluster- IIb´2 comprised of seven genotypes, namely,PU 06-17, PU 06-18, PU 06-19, PU 06-21, PU 06-22, PU 06-23and PU 06-24. The advance breeding lines PU 06-22, PU 06-23and PU 06-24 exhibited similarity coefficient of 1.

Characterization of diversity present among thegenotypes is of immense importance in any crop improvementprogram for judicious choice of parents and efficient handlingof segregating populations. The genetic information providedby morphological traits has limitations which can be overcomeby molecular techniques such as ISSR. Since molecularmarkers are considered to be more stable under a non-labilegenetic system, they have been used in many crops to obtainresults with higher precision in breeding programmes. In thepresent study, ISSR markers have been used to assess geneticvariability among urdbean genotypes. The ISSR techniquehas been applied earlier to assess molecular polymorphism inmungbean (Chattopadhyay et al. 2011) and urdbean (Ranadeet al. 2004). It is, therefore not surprising to find significantlevels of polymorphism among the 33 genotypes of urdbeanand one genotype of mungbean through ISSR markers. Thesuccess of this study in identifying polymorphism is due tothe use of a number of selected pre-screened highly informativeprimers.

The 10 ISSR primers in the present study yielded 65polymorphic bands that unambiguously discriminated 34genotypes into 4 sub-clusters. It is evident from the ISSRderived dendrogram that all genotypes were similar to theextent of more than 61%. Twelve genotypes were grouped incluster I and the remaining 22 genotypes were grouped in onelargest cluster (cluster II). This indicated that the variationobserved in morphological characters is not beingcorroborated by molecular variation. It may also be noted thatmolecular variation as revealed by ISSR technique may notalways be applicable because it does not reflect the functionalrelationship of genome with character expression of the traitsin plant.

The ISSR dendrogram was unable to discriminateblackgram genotypes on the basis of their inter-specific and

intra-specific origin. All the genotypes and checks exhibitedmore than 61% similarity and in most of the genotypessimilarity ranges from 86-100%. The higher degree ofcommonness in their pedigree may explain the high degree ofcloseness among genotypes studied. This is confirmed by100% similarity among three genotypes, PU 06-22, PU 06-23and PU 06-24, which have common parentage. Genetic variationamong 33 genotypes of urdbean and one mungbean cultivarbased on ISSR analysis could be useful in selecting parentsfor generating appropriate populations in urdbeanimprovement programmes.

The narrow genetic base of the lines studied revealedby low variations between groups which suggests the needfor incorporation of genes from wild ancestors in order tobroaden the genetic base in urdbean. Inter-specific crosseswith mungbean or with wild progenitors may contributesignificantly to achieve this goal.

REFERENCES

Anonymous 2011. Vision 2030. Indian Institute of Pulses Research(IIPR), Kanpur, India. Pp 42.

Ajibade SR, Weeden NF and Chite SM. 2000. Inter simple sequencerepeat analysis of genetic relationships in the genus Vigna. Euphytica111: 47-55.

Bisht N, Singh DP and Khulbe RK. 2010. Analysis of genetic diversityin Vigna species using ISSR markers. Journal of Food Legumes 23:201-204.

Chattopadhyay K, Sarkar HK and Bhattacharyya S. 2011. Estimationof genetic distances based on agro-morphological and molecularparameters in mungbean - a case study. Journal of Food Legumes24: 277-281.

Tangphatsornruang S, Somta P, Uthaipaisanwong P, Chanprasert J,Sangsrakru D, Seehalak W, Sommanas W, Tragoonrung S and SrinivesP. 2009. Characterization of microsatellites and gene contentsfrom genome shotgun sequences of mungbean (Vigna radiata (L.)Wilczek). BMC Plant Biology 9:137 (http://www.biomedcentral.com/1471-2229/9/137).

Doyle JJ and Doyle JL. 1990. Isolation of plant DNA from freshtissue. Focus 12: 13-15.

Jaccard P. 1908. An Introduction to Numerical Classification. In: HTClifford W and Stephenson (Eds), New York Academic Press, USA.Pp. 54.

Lapointe FJ and Legendre P. 1992. Statistical significance of the matrixcorrelation coefficient for comparing independent phylogenetictrees. Systematic Biology 41: 378–384.

Mantel N. 1967. The detection of disease clustering and generalizedregression approach. Cancer Research 27: 209–220.

Ranade R, Vaidya UJ, Kotwal SA, Bhagwat A and Gopalakrishna T.2000. Hybrid seed genotyping and plant varietal identification usingDNA markers. In: DAE-BRNS Symposium on the Use of Nuclearand Molecular Techniques in Crop Improvement, 6–8 December2000, Mumbai, India. Pp. 338–345.

Ranade R and Gopalakrishna T. 2004. DNA polymorphism amongblackgram (Vigna mungo L. Hepper) genotypes using inter simplesequence repeat (ISSR) markers. Plant Genetic Resources 2: 37–42.

Bhareti et al. : Genetic diversity in urdbean [Vigna mungo (L.) Hepper] revealed by ISSR markers 9 3

Rohlf FJ. 2000. NTSYS-pc: Numerical Taxonomy and MultivariateAnalysis System, version 2.1. Exeter Software, New York. Pp. 83.

Semagn G. 2006. Applications and advantages of Inter simple sequencerepeat (ISSR) polymorphism in plant breeding. Euphytica 129:10-15.

Singh DP. 1991. Genetics and Breeding of Pulse crops. Kalyani Publ.Ludhiana Delhi. Pp. 354.

Singh DP and Ahlawat IPS. 2005. Greengram (Vigna radiata (L.)Wilczek) and blackgram (Vigna mungo (L.) Hepper) improvement

in India: past, present and future prospects. Indian Journal ofAgricultural Sciences 75: 243-250.

Soller M. and Beckmann JS. 1983. Genetic polymorphism in varietalidentification and genetic improvement. Theoretical and AppliedGenetics 67: 25-33.

Yap IV and Nelson RJ. 1996. Winboot: a program for performingbootstrap analysis of binary data to determine the confidence limitsof UPGMA-based dendrograms. IRRI Discussion Paper Series No.14. International Rice Research Institute, Manila, Philippines.


Genetic studies on drought tolerance attributes in Chickpea (Cicer arietinum L.)V. JAYALAKSHMI, C. KIRAN KUMAR REDDY and G. JYOTHIRMAYI

Regional Agricultural Research Station, Nandyal – 518 502 (Andhra Pradesh), India;E mail: [email protected](Received: August 07, 2010 ; Accepted: April 25, 2012)

ABSTRACT

In breeding programmes for improving drought tolerance,selection for physiological traits that are closely associatedwith drought hastens up the progress rather than simplyattempting to select high yielding types under droughtcondition. Genetic studies were conducted utilizing F 2populations of chickpea crosses JAKI 9218 x ICC 4958, ICC506EB x ICC 4958, KAK 2 x ICC 4958, JG 11 x ICC 506EB,JAKI 9218 x ICC 506EB, to elucidate the nature of inheritanceof leaf chlorophyll content as indicated by the surrogate trait,SPAD Chlorophyll meter reading (SCMR). SCMR valuesindicate leaf chlorophyll content which in turn is related toleaf ‘N’ status. Frequency distribution graphs of F2 populationof all the five crosses were unimodal, continuous andasymmetric. Variable distribution was observed in five crossesindicating the presence of different allelic frequencies forSCMR in different parental genotypes. The appearance oftransgressive individuals in both the extremes, F2 phenotypicratio of 1:4:6:4:1 and the measures of skewness and kurtosis infive crosses revealed that the trait leaf chlorophyll in chickpeais governed by a fewer genes which under the influence ofmodifying factors might have resulted in continuous variationas observed in the trait.

Key words: Chickpea, Drought, Inheritance, Leaf chlorophyll,SPAD Chlorophyll meter

India, the largest producer of chickpea, accounts for60-70% of total global production (8.21 m ha, 7.48 m tonnes in2010-11). Chickpea is mainly grown as rainfed crop onconserved soil moisture. In India, during recent years,chickpea has spread to Central and Southern India, where thecrop is often exposed to drought spells coupled with shortwinters which lead to physiological problems restricting theyield potential of the crop. Of late, breeding programmes totackle drought shifted focus to identify and utilize surrogatetraits that are closely associated with drought rather thansimply attempting to select high yielding types under droughtcondition (Ludlow and Muchow 1990, Subbarao et al. 1995).Genetic enhancement of transpiration efficiency (TE) has beentaken up as a major research effort in crop improvementprogrammes through out the world (Bindu Madhava et al.2003). It is very difficult to screen for TE under field conditions.Light weight SPAD chlorophyll meters were utilized in traitbased groundnut breeding programmes for measuring leafchlorophyll content for improving drought tolerance. A directclose relationship of TE with SPAD Chlorophyll meter reading

(SCMR) was reported in groundnut (Nageswara Rao et al.2001, Bindu Madhava et al. 2003) and SCMR has a directlinear relationship with extracted leaf chlorophyll (Yadava 1986)and also related to leaf nitrogen concentration (Bullock andAnderson 1998). This strategy was also applied to chickpeato measure variation of SCMR in the mini core germplasm ofchickpea (Kashiwagi et al. 2006, 2010). Keeping this in view,genetic studies were made to elucidate the nature ofinheritance of leaf chlorophyll content as indicated by thesurrogate trait, SCMR.


The present study was carried out at RegionalAgricultural Research Station, Nandyal during post rainyseason of 2007-08. Five F2 population of crosses viz., JAKI9218 x ICC 4958, ICC 506EB x ICC 4958, KAK 2 x ICC 4958,JG 11 x ICC 506EB and JAKI 9218 x ICC 506EB were grown inplots of 4 meter length and the number of rows varied fromcross to cross depending on size of the population. Theparental genotypes were grown in single row of five meterlength. Non – experimental chickpea variety was plantedaround the experimental area to avoid border effect. Amongthe parental genotypes, JG 11 and JAKI 9218 are high yieldingdesi varieties. KAK 2 is a high yielding kabuli variety.ICC 4958 is a drought tolerant desi line with deep root systemand ICC 506EB is a desi line with tolerance to Helicoverpa,Gram pod borer. Standard production practices were followedto raise the crop. SCMR of all individual plants in each crosswas measured on the leaf lets of third leaf from the top at 60days after sowing using SPAD-502 Chlorophyll Meter (MinoltaKonica Co. Ltd, Japan) (Kashiwagi et al. 2006). In parentalgenotypes, observations were recorded on ten randomly takenplants. Estimates of the coefficient of skewness (g1), kurtosis(b2) and of the amount of kurtosis (g2) were computed foreach F2 population (Snedecor and Cochran 1980).


The SCMR values recorded in parental genotypesduring 2006-07 and 2007-08 are presented in Table 1. In boththe years, ICC 4958 has recorded higher SCMR followed byJG 11 and JAKI 9218. Among all parents, ICC 506EB hasrecorded a lower SCMR value. The relative ranking of theparents almost remained the same indicating that the trait isstable across the years and can be considered as a reliabletrait. Kashiwagi et al. (2006) observed that there was

Jayalakshmi et al. : Genetic studies on drought tolerance attributes in Chickpea 9 5

significant correlation in SCMR between rainfed and irrigatedconditions. Regardless of irrigation scheme (r =0.534, P= 0.01),ICC 4958 recorded a better SCMR value.

In F2 populations, a wide range of SCMR values wererecorded. These SCMR values of five crosses were groupedinto different classes by taking a class interval of two andfrequency distribution graphs were plotted by taking SCMRvalues on X-axis and frequency of individuals on Y-axis(Fig. 1). The frequency curves of all the five crosses wereunimodal, continuous and asymmetric. According to Allard(1960) continuous variation may be due to low heritability of

a trait or moderately higher number of genes involved in theinheritance. The SCMR values in each cross were groupedinto five classes and the Chi square test fitted well with aphenotypic ratio of 1:4:6:4:1.This indicates that a fewer genesare involved in the inheritance of the trait with duplication offactors with masking or inhibitory action on minor genesresulting in an array of genotypes. Genetic parameters viz.,Genotypic Coefficient of Variation (GCV), PhenotypicCoefficient of Variation (PCV), heritability in broad sense [h2

(b)] and Genetic Advance as per cent mean (GAM) were alsoestimated for five crosses (Table 2). The genotypic variationwas high in JG 11 x ICC 506EB and JAKI 9218 x ICC 506EB.Heritability was low in KAK 2 x ICC 4958 and ICC 506EB

x ICC 4958, moderate in JAKI 9218 x ICC 4958 and high in JG11 x ICC 506EB and JAKI 9218 x ICC 506EB. The latter twocrosses also had high GAM indicating that these are quiteamenable for improvement of the trait through simple selectionprocedures. Jayalakshmi et al. (2011) also reported high GCV,high heritability and high GAM for SCMR in four crosses ofchickpea. Vasanthi et al. (2005) measured leaf chlorophyllcontent in terms of SCMR in groundnut and reported moderateto high heritability for this trait.

Estimates of the coefficient of skewness (g1), kurtosis(b2) and of the amount of kurtosis (g2) of F2 distribution of fivecrosses are presented in Table 3. The results clearly indicatedvariable distribution in all the five crosses. Skewness waspositive and significant in ICC 506EB x ICC 4958 where as itwas negative in JAKI 9218 x ICC 4958 and JAKI 9218 x ICC506EB. Skewness was negligible in KAK 2 x ICC 4958 and JG11 x ICC 506EB. Kurtosis was negative and significant in twocrosses JG 11 x ICC 506EB and JAKI 9218 x ICC 4958. Kurtosiswas positive in ICC 506EB x ICC 4958 while it was negativeKAK 2 x ICC 4958 and JAKI 9218 x ICC 506EB as well. Theshape of the curve was leptokurtic in ICC 506EB x ICC 4958and JG 11 x ICC 506EB. This variable distribution for SCMRin different crosses might be attributed to the presence ofdifferent allelic frequencies in different parental genotypes ofcrosses, assuming additivity in all loci, no epistasis andindependent factors (or) dominance and / or epistasis with inand / or among some loci.

SCMR Parent 2006-07 2007-08 JG 11 53.3 55.8 JAKI 9218 51.0 53.6 ICC 4958 55.3 58.2 ICC 506EB 45.9 45.5 KAK 2 48.0 53.1

Table 1. SPAD Chlorophyll meter readings (SCMR) in fivechickpea genotypes

Table 2. Genetic parameters for SCMR in population of fivechickpea crosses

Cross n g1 b2 g2 JAKI 9218 x ICC 4958 140 -0.167 2.133* -0.866 ICC 506EB x ICC 4958 337 0.515 ** 3.093 0.093 KAK 2 x ICC 4958 150 0.050 2.357 -0.642 JG 11 x ICC 506EB 283 0.053 2.393* -0.606 JAKI 9218 x ICC 506EB 105 -0.227 2.121 -0.878

A perusal of frequency distribution curves clearlyindicates that there are transgressive individuals with lowerSCMR values than the lower parent as well as with higherSCMR values than the parents with high SCMR values in allthe five crosses. However, the frequency of higher SCMRindividuals was higher in three crosses viz., JAKI 9218 x ICC4958, JG 11 x ICC 506EB and JAKI 9218 x ICC 506EB. In thelatter two crosses, ICC 506EB, a low SCMR parent might havecontributed positive alleles which are not existing in ICC 4958,a high SCMR parent, throwing transgressive individuals betterthan ICC 4958. Vasanthi et al. (2005) and Babitha et al. (2006)reported that leaf chlorophyll content (in terms of SCMR) ingroundnut may be governed by a fewer genes acting in nonadditive manner.

* Significant at P= 0.05, ** Significant at P= 0.01.

Table 3. Coefficient of skewness (g1), kurtosis (b2) and theamount of kurtosis (g2) in F2 distribution of fivecrosses

Coefficient of Variation

Cross Phenotypic Genotypic

Herita-bility (%)

Genetic advance

as percent Mean

JAKI 9218 x ICC 4958 14.8 7.7 26.8 9.1 ICC 506 EB x ICC 4958 9.9 4.3 18.6 4.1 KAK 2 x ICC 4958 12.9 5.0 15.2 5.3 JG 11 x ICC 506 EB 14.7 11.6 62.2 18.0 JAKI 9218 x ICC 506 EB 13.4 10.5 61.7 16.6

Fig 1. Distribution of SCMR in F2 population of five crossesof chickpea


It is evident from the present study that two crossesviz., JG 11 x ICC 506EB and JAKI 9218 x ICC 506EB with highheritability and genetic advance have potential to give superiorrecombinants with high SCMR as they can be easily exploitedthrough simple selection procedures. Even the parentalgenotype ICC 506EB with low SCMR is also carrying somepromoting alleles. The appearance of transgressive individualsin both extremes, the F2 phenotypic ratio of 1:4:6:4:1 andvariable distribution of frequency curves in different crosses(as shown by the measures of skewness and kurtosis) clearlyindicated that the trait leaf chlorophyll in chickpea is governedby a fewer genes which under the influence of modifyingfactors might be resulting in continuous variation as observedin the trait.

REFERENCES

Allard RW. 1960. Principles of Plant Breeding. John Wiley and Sons,New York. Pp. 110-132.

Babitha M, Vasanthi RP and Reddy PV. 2006. Genetic studies on leafchlorophyll content in groundnut, (Arachis hypogaea L.) in termsof SPAD chlorophyll meter reading. Journal of Oilseeds Research23: 247-251.

Bindu Madhava H, Sheshshayee MS, Shankar AG, Prasad TG andUdayakumar M. 2003. Use of SPAD chlorophyll meter to assesstranspiration efficiency of peanut. In: Cruickshank AW, RachaputiNC, Wright GC and Nigam SN (Eds), Breeding of drought resistantpeanut: Proceedings of a Collaborative Review Meeting, 25-27 Feb2002, Hyderabad, India, ACIAR Proceedings No. 112. Canberra,Australia. Pp 3-9.

Bullock DG and Anderson DS. 1998. Evaluation of the Minolta SPAD

– 502 chlorophyll meter for nitrogen management in corn. Journalof Plant Nutrition 21: 741-755.

Jayalakshmi V, Jyothirmayi G, Trivikrama Reddy A and Kiran KumarReddy C. 2011. Genetic variability for drought tolerance and yieldtraits in chickpea. Journal of Food Legumes 24: 33-35.

Kashiwagi J, Krishnamurthy L, Sube Singh and Upadhyaya HD. 2006.Variation of SPAD Chlorophyll Meter Readings (SCMR) in themini-core germplasm collection of chickpea. International Chickpeaand Pigeonpea Newsletter 13: 16-18.

Kashiwagi J, Upadhyaya HD and Krishnamurthy L. 2010. Significanceand genetic diversity of SPAD chlorophyll meter reading in chickpeagermplasm in the semi-arid environments. Journal of Food Legumes23: 99-105.

Ludlow MM and Muchow RC. 1990. Critical evaluation of traits forimproving crop yields in water limited environments. Advances inAgronomy 43: 107-153.

Nageswara Rao RC, Talwar HS and Wright GC. 2001. Rapid assessmentof specific leaf area and leaf N in peanut (Arachis hypogaea L.)using chlorophyll meter. Journal of Agronomy and Crop Science189: 175-182.

Snedecor GW and Cochran WG 1980. Statistical methods. Seventhedition. The Iowa State University Press. Ames lowa. Pp 507.

Subbarao GV, Johansen C, Slinkard AE, Rao RCN, Saxena NP and ChauhanYS. 1995. Strategies for improving drought resistance in grainlegumes. Critical Reviews in Plant Science 14: 469-523.

Vasanthi RP, Seethala Devi G, Babitha M and Sudhakar P. 2005.Inheritance of leaf chlorophyll content in groundnut (Arachishypogaea L.). Indian Journal of Genetics and Plant Breeding 65:196-198.

Yadava UL. 1986. A rapid and non destructive method to determinechlorophyll in intact leaves. Horticulture Science 21: 1449-1450.


In vitro regeneration and micrografting of shoots for enhancing survival and recoveryof plants in chickpea (Cicer arietinum L.)INDU SINGH YADAV2 and N. P. SINGH1

1Indian Institute of Pulses Research, Kanpur-208024, India; 2National Research Centre on Plant Biotechnology,IARI, New Delhi-110012, India; Email: [email protected](Received: January 11, 2012; Accepted; June 06, 2012)

ABSTRACT

A successful regeneration protocol relies on the number ofsurviving plants in soil that can be obtained. Low recovery ofcultured plants on account of poor rooting is still a keyrestrictive factor for regeneration and transformation ofchickpea. Induction of root organogenesis in chickpea isdiff icult and genotype dependent. The resulting loss ofregeneration potential due to poor formation of roots is veryhigh. Therefore, a rapid micro grafting technique, an alternativeto robust rooting was developed to increase the recovery ofcomplete plants in vitro. The micro grafting of in vitroregenerated shoots onto the rootstock grown in vivo proved tobe simple and reliable method allowing up to 80% recovery ofnon-rooted shoots from culture of chickpea. Success of anygiven graft was directly related to scion size (2mm) and age ofthe rootstock (6-12 days). The method appeared to be genotypeindependent and will be useful as an alternative method ofrooting of chickpea varieties showing poor rooting potential.

Key words: Cicer arietinum L., Chickpea, Regeneration,Micrografting, Transgenics

Chickpea is the world’s third most important pulse cropand India produces 75% of the worlds supply. Chickpea is agood source of carbohydrate (48.2-67.6%), protein (12.4-31.5%), starch (41-50%), fat (6%) and nutritionally importantminerals (Geervani and Umadevi 1989). However, there arenumber of diseases and pests which cause very heavy yieldlosses to chickpea production every year. The advancementof biotechnology and molecular biology techniques offers anopportunity to overcome some of the limitations of this crop.A robust regeneration and transformation system is pre-requisite for development of functional transgenic foreconomic traits in chickpea. However, reports on de novoorganogenesis in chickpea are scarce and are confined to themultiplication of pre-existing meristems (Bajaj and Dhanju 1979,Kartha et al. 1981, Altaf and Ahmad 1985, Chandra et al. 1993,Brandt and Hess 1994).

Plant regeneration via callus has also been reported inchickpea (Surya-Prakash et al. 1992, Barna and Wakhlu 1994).Regeneration of chickpea is the most difficult among allleguminous crops. Regardless of the regeneration methodemployed, all methods depend on root formation for recoveryof plants from culture. The loss of regeneration potential due

to failure to form strong root system results in very lowfrequency of plant regeneration. After rooting of in vitroregenerated shoots, the frequency of survival of hardenedplants into soil is negligible. Therefore, efficient and robustregeneration protocol for chickpea is only possible by graftingof regenerated shoot onto homozygous root stock. Fordevelopment of transgenics, after genetic transformation withcandidate gene, micro grafting is the only way to overcomethe problem of rooting as well as hardening. However, it isvery uncommon to see a shoot tip grafted onto the germinatedroot stocks which is successful in softwood plants particularlyin leguminous crops. Thus, the objective of this study was todevelop an efficient grafting system for the recovery of plantsfrom in vitro regenerated shoots through micrografting.


Preparation of explants: Five chickpea cultivars/genotypesviz., C235, K850, BG256, E1004 and PDG 85-1 were selectedbased on their regeneration potential and seeds were obtainedfrom AICRP-Chickpea Unit, Indian Institute of PulsesResearch, Kanpur. The seeds were washed thoroughly inTween 20 (Polyoxyethylene sorbiton monolaurate, MERCK)for 10-15 minutes. The seeds were further rinsed under runningtap water and surface sterilized with 10% sodium hypochloritesolution for 5 minutes followed by repeated washing (5-6times) with sterile double distilled water. Further, these seedswere soaked in sterile distilled water for 16-18 hr. The seedcoat was removed and the dissected cotyledons (top portion)and the embryonic axes were used as explants for in vitroshoot induction and regeneration.Culture Media & Culture Conditions: The explants werecultured on the Murashige and Skoog (MS) medium (1962)supplemented with different concentrations of NAA, IBA,IAA, BAP and Kinetin. Sucrose (4%w/v) was added to themedia as a carbon source. The pH of the media was adjustedto 5.8 and solidified with 0.8% agar before autoclaving at 15psi(pound per square inches) pressure for 15 minutes. All thecultures were maintained at a temperature of 25±1°C under a16/8 hr (light/dark) photoperiod provided by cool whitefluorescent light (3000 lux).

The explants were cultured in five different media andthen sub-cultured 3 times at 15-day-intervals, prior toassessment of the effect of nature of explant and composition


of the culture medium on shoot regeneration capacity. Thepercentage of shoot producing explants (frequency) and thenumber of shoots per explant (efficiency) were determined at60 days after culturing. After the shoot regenerationassessment, the best performing 120 explants (60 from eachgenotype) with 3 cm long shoots, were randomly selectedand placed in sterilized culture tubes (one explant per culturetube) containing 20 ml of rooting medium with varyingconcentrations of NAA, IBA or IAA, as shown in Table 1.After formation of well-developed roots, 45-50 days afterintroducing into the rooting media, plantlets (4-5 cm long)were removed from culture tubes, washed thoroughly withtap water to remove the medium and transferred to a pre-sterilized potted soil and sand mixture (1:1). The rootingfrequency was recorded after 20-30 days. Some of theregenerated in vitro shoots were taken and micrografted ontopregerminated root stock of the same or other genotypes.The survival rate of the two processes (rooting andmicrografting) was studied subsequently (Table 4).

Method of grafting: The shoot of each genotype was cutfrom the middle of the second internodes starting from base/soil surface. Three different procedures were used forpreparation and union of scion and root stock (Table 3).

Table 1. Influence of different auxins on rooting of in vitroderived shoots of chickpea after three weeks ofculture

Scion (Survival %) Root stock C235 K850 BG 256 E-1004 PDG85-1

Total (%)

C235 32.26 70.00 50.00 50.00 80.00 38.51 K850 30.00 15.71 00 00 20.00 17.70 BG 256 50.00 00 02.17 00 00 10.53 E-1004 20.00 00 00 00 00 20.00 PDG 85-1 80.00 20.00 00 00 00 50.00

Table-2: Relative performance of different genotype as scionas well as root stocks

Table-3: Comparison of different grafting methods inchickpea (success rate)

Method of joining (no.) Method of grafting Aluminium foil Wax Straw pipe

Total (%)

Side 00 00 15 18.07 Mid 00 04 78 40.59 Saddle 00 00 02 03.08 Total 00 04 95

Table 4: Comparison of survival rate with rooting andmicrografting

Genotypes No. of plants Rooted

No. of Plants Micrografted

% survival after

rooting

% survival after

micrografting C235 20 15 6 86.6 K850 20 15 0 100 BG 256 20 15 0 60 E-1004 20 15 13 93 PDG 85-1 20 15 6 100

1. Side Grafting: The scion was placed laterly on the sideof a root stock. The scion was prepared by removing all thelateral branches and vegetative growths were removed nearthe point of graft. The long, slopping and wedge shaped cutwas made for scion. Soon after bringing together the rootstock and scion, the point of the union was sealed withgrafting material.

2. Mid grafting: Diagonal cuts on both scion and rootstock were made. The girth of the plants was approximately0.8 cm in diameter. Approximately 1 cm long plantlets werechosen for grafting purpose. Long smooth sloping cut wasmade in scion at one stroke. The root stock was prepared bymaking cut in reverse downward direction starting about ¼ ofthe distance from the top. The scion and the root stock wereinterlocked in such a way that the cambium layers matched onboth the sides of completed grafts and secured in positionwith grafting material.

3. Saddle grafting: Diagonal cuts of equal length weremade on the scion and root stocks of equal girth in the form ofsaddle to match each other. These two components werebrought together facing cambium layers, tide securely andcoated with grafting material (aluminium foil, straw pipe andwax).

Grafting material: Three kinds of material such as straw pipe,aluminium foil and wax were used for assembly of root stockand scion. A direct cut of 0.5cm size was made in the rootstock. The first leaf on the root stock was removed by bladeto facilitate easy slip over straw pipe/ aluminium foil/ waxassembly. The length of straw pipe was selected dependingon the length of the root stock. This assembly was slippeddown to union point of scion and root stock to provide proper

Auxin (mg/l) MS basal Medium IAA IBA NAA

Frequency of root induction (%)

MS - - - 00 ½ MS - - - 00 MS 0.1 - - 00 0.5 - - 00 1.0 - - 40 ½ MS 0.1 - - 00 0.5 - - 00 1.0 - - 80 MS - 0.1 - 00 - 0.5 - 00 - 1.0 - 00 ½ MS - 0.1 - 00 - 0.5 - 00 - 1.0 - 00 MS - - 0.1 25 - - 0.5 38 - - 1.0 18 ½MS - - 0.1 50 - - 0.5 68 - - 1.0 25

Yadav and Singh : Micrografting of shoots for enhancing survival and recovery of regenerated plants in chickpea 9 9

strength. The scion was sliced from both sides, removing theskin of the stalk with the help of the blade and then inserted inthe cut of the root stock. The straw pipe/ aluminium foil waspulled down to the joint while wax was pasted to the joint.Comparison of these three different kind of materials used formicrografting was studied (Table 3). The pots were filled withgravel. The planting material for root stock was grown intopot containing sand. The grafted plants in pot containingsand were kept in bigger pot and watered twice a day. Thewater was also sprayed over the gravel to keep conditionhumid and cool around the pots. The pots were protectedfrom the direct light by covering from all sides with the blackopaque plastic sheets. The sprouts coming up from the nodesof the root stock were removed daily to retain true scion only.After 5 days the grafted plants were shifted to light conditions.The plants were watered with ¼ Hoagland solution as pertheir requirement. After two days of grafting, assembly of thestraw pipe /aluminium foil/ wax was removed by cutting themgently from one side down and then pulling apart the twofolds.


Regeneration of chickpea shoots, used under presentinvestigation, from different explants was achieved usingprocedures and methods described earlier by Yadav and Singh(2012). The difficulties in getting functional roots wereobserved with number of genotypes (Table 1). Even if theroots were developed, there was problem in establishmentinto pot/field (Table 4). Similar to results of presentinvestigation, there are number of reports depicting problemsin rooting of in vitro regenerated shoots in chickpea (Bankoand Stefani 1989, Shankar and Mohan Ram 1990, Malik andSaxena 1992) and lentil (Williams and McHughen 1986, Singhand Raghuvanshi 1989, Polanco and Ruiz 1997).

Since the rooting efficiency and survival rate of rootedplantlets after hardening was comparatively low, graftingprocedure was standardized to increase the survival of invitro derived plantlets (Table 1 & 4). The results of variousexperiments on grafting are depicted in Fig. 1 & Table 2, 3. Outof the three grafting methods used, mid grafting showedmaximum (40.60%) success followed by side grafting (18.07%)

Fig 1: Micrografting of different genotypes as scion as well as root stock, A. Scion prepared of in vitro shoots, B. Pregerminated rootstock, C. Micrografted shoot on root stock supported by a straw pipe, D. Union between root stock and scion, E. Transverse sectionof a graft shoot showing cambium formation, F. Established micrografted shoot, G. Micrografted shoots after 2 month of grafting bearingflowers, H. Pod formation on micrografted shoot, I. Mature micrografted plant.

100 Journal of Food Legumes 25(2), 2012

(Fig.1A). However, minimum success (3.09%) was achievedwith saddle grafting method (Table 3). Out of the three kindsof material used for joining of scion and root stock, straw pipemethod showed best response (35.85%) in terms of survivalof successful grafted plants (Fig 1C). However, no successcould be achieved using aluminium foil for joining the graftedportion. Choosing suitable root stock and scion was found tobe key in getting successful grafting. Among variouscombinations of genotypes of root stock and scion used,C235 and PDG 85-1 showed best response (80.0%) to grafting.Further, there was no reciprocal difference as these genotypesgave best response either used as a scion and root stock(38.5%) as well as scion (32.26%). Besides, moderate response(50-70%) was also obtained when C235 was used incombination with K850, BG256 and E1004 (Table 2). However,12 out of 25 combinations did not show any success inrecovery of grafted plants. Although successful grafts wereobtained in all ages of rootstocks, graft survival was bestwhen root stock were 6-12 days old. Graft survival rate rapidlydecreased when root stocks were older than 18 days.

The results of these experiments provided the basis forgrafting in vitro derived shoots (scion) on pot raised rootstock. Although, there are number of successful reports ofmicrografting in woody plants (Murashige et al. 1972 andNavarro et al. 1975), where these techniques have becomeroutine, these information are very scanty in crop plants. Evenif micrografting has been performed in some crop plants eg.,Lens culnaris (Gulati et al. 2001), Vicia narbonensis (Pickardtet al. 1995), Phaseolus acutifolius (Dillen et al. 1997), Pisumsativum (Bohmer et al. 1995, Bean et al. 1997) and Cicerarietinum (Krishnamurthy et al. 2000), the detailedmethodology has not been described. Therefore, success ingetting micrografting in chickpea will increase the possibilityof raising successful plants coming from the lab to field. Thiscould be of immense use in transformation experiments wherepossibility of chimeric shoots do exist and raise a challenge toscientists to develop homozygous transgenic lines. Dua etal. (1997) attempted grafting in chickpea for the first time todetermine the control of root and shoot in imparting salinitytolerance. Besides, in past, there are number of reports of useof grafting to study the role of root in controlling ionaccumulation under salt stress (Grtten and Maas 1985).However, grafting of in vitro induced shoots on to root stocksis difficult, pose challenge and requires high level of skill.Similar to the approach of present investigation, Jinhua andGould (1999) also used rapid in vitro shoot tip grafting (STG)technique to increase recovery of intact cotton plants fromshoots developed in culture because induction of rootorganogenesis in cotton shoot is genotype dependent andunreliable. In vitro grafting of cotton shoots to seedling rootstock has been reported to be a simple and reliable methodallowing 90-100% recovery of non- rooting shoots fromculture. Success with any graft was directly related to scionsize (0.8-1.0cm) and age (14-35 days) of the seedling root stocks.

The resulting loss of regeneration potential due to failure toform roots under in vitro culture varied from 30 to 80% inchickpea depending on genotypes and represents a significantbottleneck in the overall recovery of plants from the culture.In transformation experiments, this loss in regenerationpotential on account of non formation of functional roots canbe considered substantial. The method of micrograftingreported under present investigation is genotype independentand varietal differences between root stock and scion did notaffect the rate of plant recovery from culture in contrary toresults obtained in cotton. In vitro grafting was also used torejuvenate adult phase woody shoots to assist in vitro rootingof woody perennials (Navarrow, 1988) and to add in therecovery of transgenic citrus plant-from culture (Pena et al.1995 a, b).

A comparative study was done to check the survivalrate of shoots through rooting and micrografting. It was foundthat with micrografting there was 100% survival rate ingenotypes K850, PDG85-1 followed by 93% in E-1004.Whereas, the survival rate after rooting was almost zero ingenotypes K850 and BG-256. Genotype E-1004 showed somebetter response with 13% survival rate (Table 4). It was alsoobserved that grafting of shoots even reduced the time fromrooting to transplantation. In our case, the total time periodrequired from grafting of shoots to successful transplantationwas less than 2 week. These micrografted plants successfullyreached to maturity and seeds could be harvested from them(Fig 1H).

Micrografting of chickpea shoots overcomes rootingproblem and is independent of genotypic effects. Thistechnique enables the quick regeneration (significantreduction in the regeneration period) of whole plants andincreases efficiency of regeneration of chickpea. Thismicrografting technique will be of immense use intransformation experiments where transformed shoots are veryprecious and possibility of chimeric shoots do exist and raisea challenge to scientist to develop homozygous transgeniclines.

REFERENCES

Altaf N and Ahmad MS. 1986. Plant regeneration and propagation ofchickpea (Cicer arietinum L.) through tissue-culture techniques.In: Proceeding of a symposium on Nuclear techniques and in vitroculture for plant improvement. FAO and IAEA, Vienna, 19-23Aug., 1985, 407-417.

Bajaj YPS and Dhanju MS. 1979.Regeneration of plants from apicalmeristem tips of some legumes. Current Science 48: 906-907.

Banko TJ and Stefani MA. 1989. In vitro propagation of Oxydendrumarboretum from mature trees. Horticulture Science 24: 183–186.

Barna KS and Wakhlu AK. 1994. Whole plant regeneration of Cicerarietinum from callus cultures via organogenesis. Plant Cell Report13: 510-513.

Bean SJ, Gooding PS, Mullineaux PM and Davies DR. 1997. A simplesystem for pea transformation. Plant Cell Report 16: 513–519.

Yadav and Singh : Micrografting of shoots for enhancing survival and recovery of regenerated plants in chickpea 101

Bohmer P, Meyer B and Jacobsen HJ. 1995. Thidiazuron-induced highfrequency of shoot induction and plant regeneration in protoplastderived pea callus. Plant Cell Report 15: 26–29.

Brandt EB and Hess D. 1994. In vitro regeneration and propagation ofchickpea (Cicer arietinum L.) from meristem tips and cotyledonarynodes. In vitro Cellular and Developmental Biology 33: 114-118.

Chandra R, Chatrath A, Polissety R and Khetarpal S. 1993.Differentiation of in vitro grown explants of chickpea (Cicerarietinum L.). Indian Journal of Plant Physiology 36: 121-124.

Dillen W, De Clercq J, Goossens A, Van Montagu M and Angenon G.1997. Agrobacterium-mediated transformation of Phaseolusacutifolius A. Gray. Theoretical and Applied Genetics 94: 151–158.

Dua RP. 1997. Grafting technique in gram to ascertain control of rootand shoot for salinity tolerance. Indian Journal of AgriculturalScience 67: 212-214.

Geervani P and Umadevi T. 1989. Effect of maturation of nutrientcomposition of selected vegetable legumes. Journal of Science andFood Agriculture 46: 243–248.

Gulati A, Schryer P and McHughen A. 2001. Regeneration andmicrografting of lentil shoots. In Vitro Cellular and DevelopmentalBiology 37: 798- 802.

Jinhua L and Gould JH. 1999. In vitro shoot-tip grafting improvesrecovery of cotton plants from culture. Plant Cell Tissue and OrganCulture 57: 211–213.

Kartha KK, Pahl K, Leung NL and Mroginski LA. 1981. Plantregeneration from meristems of grain legumes Soybean, cowpea,peanut, chickpea and bean. Canadian Journal of Botany 59: 1671-1679.

Krishnamurthy KV, Suhasini K, Sagare AP, Meixner M, Kathen A de,Pickardt T and Schieder O. 2000. Agrobacterium mediatedtransformation of chickpea (Cicer arietinum ). Plant Cell Report19: 235–240.

Malik KA and Saxena PK.1992. Thidiazuron induces high frequencyshoot regeneration in intact seedlings of pea (Pisum sativum),chickpea (Cicer arietinum) and lentil (Lens culinaris). AustralianJournal of Plant Physiology 19: 731–740.

Murashige T and Skoog F. 1962. A revised medium for rapid growth andbioassays with tobacco tissue cultures. Physiologia Plantarum 15:473-497.

Navarro L, Roistacher CN and Murashige T. 1975. Improvement ofshoot-tip grafting in vitro for virus-free citrus. Journal of AmericanSociety of Horticultural Science 100: 471-479.

Navarro L, Ll.cer G, Cambra M, Arregui JM and Ju.rez J. 1983. Shoot-tip Grafting: In Vitro for Elimination of Viruses in Peach Plants(Prunus persica Batsch). Acta-Horticulturae (ISHS) 130: 185-192.

Pena L, Cervera M, Juarez J, Navarro A, Pina JA, Duran-Vila N andNavarro L .1995a. Agrobacterium-mediated transformation ofsweet orange and regeneration of transgenic plants. Plant CellReport 14: 616–619.

Pena L, Cervera M, Juarez J, Ortega C, Pina JA, Duran-Vila N andNavarro L. 1995b. High-efficiency Agrobacterium-mediatedtransformation and regeneration of citrus. Plant Science 104: 183–191.

Pickardt T, Saalbach I, Waddell D, Meixner M, Muntz K and SchiederO. 1995. Seed specific expression of the 2S albumin gene fromBrazil nut (Bertholletia excelsa) in transgenic Vicia narbonensis.Molecular Breeding 1: 295–301.

Polanco MC and Ruiz ML. 1997. Effect of benzylaminopurine on invitro and in vivo root development in lentil, Lens culinaris Medik.Plant Cell Report 17: 22–26.

Shanker S and Mohan Ram HY. 1990. Plantlet regeneration fromtissue cultures of Sesbania grandiflora. Current Science 59: 39–43.

Surya-Parkash, Chowdhury JB, Jain RK and Chowdhury VK. 1992.Factors affecting plant regeneration in chickpea, Cicer arietinumL. Indian Journal of Experimental Biology 30: 1149- 1153.

Williams JD and McHughen A. 1986. Plant regeneration of the legumeLens culinaris Medik in vitro. Plant Cell Tissue and Organ Culture7: 149–153.

Yadav IS and Singh NP. 2012. An effective protocol for improvedregeneration capacity of kabuli chickpeas. Canadian Journal ofPlant Sciences 92: 1-8.


Heterosis and inbreeding depression studies in urdbean [Vigna mungo (L.) Hepper]RAMA KANT and R.K. SRIVASTAVA

Department of Genetics and Plant Breeding, N. D. University of Agriculture and Technology, Kumarganj, Faizabad-224 229 Uttar Pradesh, India; E-mail: [email protected](Received: September 9, 2011; Accepted: May 7, 2012)

ABSTRACT

An investigation was conducted to study the extent of heterosisover mid parent, better parent (heterobeltiosis), and parent(NDU1) as well as inbreeding depression in F2 generation. Eightgenotypes were used to produce six crosses viz.; NDU 97-10 ×IPU 981(cross I), NDU 99-2 × IPU 981 (cross II), Shekhar 1 × KU300 (cross III), Shekhar 1 × KU 300 (cross IV), Uttara × NDU 1(cross V) and Uttara × KU 321 (cross VI) and their F2 populations.These populations were laid out in Compact Family BlockDesign with three replications at Genetics and Plant BreedingResearch Farm, N.D.University of Agriculture and Technology,Kumarganj, Faizabad (U.P.) during Zaid and Kharif 2008. Positiveand highly significant standard heterosis (%) for seed yieldper plant was registered in all the six crosses. Most heteroticcrosses for yield were cross II (37.52), cross VI (26.48), cross IV(24.95) during Zaid and cross V (55.31), cross II (53.22), cross I(35.85), cross VI (35.05) in Kharif. All these crosses alsoregistered highly significant inbreeding depression for yieldduring both crop seasons. Negative and significant standardheterosis, heterobeltiosis, mid parent heterosis and inbreedingdepression were recorded for days to 50 per cent flowering(cross I and III) and days to maturity (cross I, III and IV) in Zaidand days to 50 per cent flowering (cross V and VI) and days tomaturity (cross I, III, V and VI) during Kharif.

Keywords: Heterobeltiosis, Inbreeding depression, Mid parentheterosis, Standard heterosis, Urdbean

Among pulses, urdbean is an important short durationgrain legume cultivated over a wide range of agro-climaticconditions. The total area under the crop has increasedprogressively from 1.98 million ha in 1964-65 to 2.67 million hain 2008-09. Similarly, the production has increased from 0.64million tones to 1.17 million tones during same period(Directorate of Economics & Statistics, Department ofAgriculture and Cooperation, 2010). Increase in both area andproduction has been observed in Andhra Pradesh, Karnataka,Maharashtra, Rajasthan, Uttar Pradesh and Tamil Nadu. Thebreeding approaches aimed at development and isolation ofsuperior homozygous lines or pure line varieties in selfpollinated crop like urdbean, essentially involve identificationof highly heterotic crosses and selection of superior lines inadvance segregating generations. Heterosis is a valuableexpression that often results from genetic recombination(Lamkey and Edwards 1999). The exploitation of heterosis inurdbean has not been commercialized due to limited extent ofout crossing (Singh 1982, 2000). However, highly heterotic

crosses can be used for development of high yielding pureline varieties in a self-pollinated crop like urdbean. Therefore,the present study was undertaken to generate information onheterosis and inbreeding depression for yield and itscomponents in urdbean.


Eight genotypes/varieties (‘NDU 97-10’, ‘NDU 99-2’,‘IPU 981’, ‘Shekhar 1’, ‘KU 300’, ‘KU 321’, ‘Uttara’ and ‘NDU1’) were crossed to produce six F1’s namely NDU 97-10 × IPU981 (cross I), NDU 99-2 × IPU 981 (cross II), Shekhar 1 × KU300 (cross III), Shekhar 1 × KU321 (cross IV), Uttara × NDU 1(cross V) and Uttara × KU 321 (cross VI) during Kharif 2006.The F1’s were advanced to get F2 populations andsimultaneously fresh F1’s were also made in Kharif 2007. Thus,eight parents (including check), six F1, and their F2 populationswere evaluated in Compact Family Block Design with threereplications during Zaid and Kharif 2008 at the Genetics andPlant Breeding Research Farm, N.D.U.A.&T. Kumarganj,Faizabad (U.P.). Seeds of parents and F1’s were sown in asingle row plot, whereas, six rows constituted a plot for F2generations, each of 5 m long with a spacing of 30 cm betweenrows and 10 cm between plants. Observations were recordedon 10 plants from parents and F1’s and 30 plants from F2progenies selected randomly in each replication for twelvequantitative traits viz., days to 50 per cent flowering, days tomaturity, plant height, number of clusters per plant, number ofpods per plant, number of seeds per pod, pod seed ratio (%),biological yield per plant (g), 100-seed weight (g), harvestindex (%), seed yield per plant (g) and protein content (%).The protein content (%) was determined by using macro-Kjeldhal method (Jackson 1976).

The mean data on above traits were used to computemean heterosis, heterobeltiosis, standard heterosis (Hays etal. 1955) and inbreeding depression. Variety ‘NDU 1’ was usedas the standard parent (check) as it is one of the best releasedvariety for the UP. The test of significance was carried out forthe estimates of heterosis by adopting the t test as per theformula given by Sharma (1988). These calculated ‘t’ valuesfor relative heterosis, heterobeltiosis and standard heterosiswere compared with table ‘t’ value at error degrees of freedomat P=0.05 and 0.01 level of significance.

Calculated ‘t’ value = difference/SESE for heterobeltiosis, standard heterosis and

inbreeding depression = 2Me/r

Kant and Srivastava : Heterosis and inbreeding depression in urdbean 103

Where,Me = mean error variancer = number of replications


The analysis of variance of Compact Family BlockDesign revealed that the mean sum of squares due todifferences among generations (progenies) in cross familywere significant for all the characters during both crop seasons(Kharif and Zaid) except number of cluster per plant in crossI, V and V; number of seeds per pod in cross I and III, 100-seedweight in cross III, V and VI in Zaid. However, number ofclusters per plant in cross I, V and VI, number of seeds perpod in cross I and III, number of seeds per pod, 100-seedweight and biological yield per plant in cross III. Thus, theabove characters showing non-significant differences amongthe progenies in different cross-combinations were not utilizedin further statistical analyses (Table 1).

Heterosis over standard variety ranged from -9.33%(days to 50 per cent flowering in cross I) to 55.315 (seed yieldper plant in cross I) during Kharif, while in Zaid it varied from-19.99 to 55.67% (days to 50 per cent flowering in cross I). In

Zaid, significant and positive estimate of heterosis overstandard variety (Table 1) was observed for plant height(cross III, IV, V and VI), number of clusters per plant (crossIII), number of pods per plant (cross III and IV), number ofseeds per pod (cross II, IV, V and VI), pod seed ratio (cross Iand V), biological yield per plant and seed yield per plant (inall crosses) and protein content (cross II, V and VI); whilesignificant and negative standard heterosis was recorded fordays to 50 per cent flowering (cross I, II, III and V), days tomaturity (cross I, III, IV and V), plant height (cross I), podseed ratio (cross III), harvest index (cross V) and proteincontent (cross I, III and IV). During Kharif, significant andpositive heterosis over standard parent (NDU 1) was observedfor plant height, pod seed ratio, and seed yield per plant in allthe crosses. In both the seasons, significant and positiveheterosis over standard parent was recorded for number ofseeds per pod, biological yield per plant in all the crossesexcept cross III, 100-seed weight (cross I, II, V and VI), harvestindex (cross I, II, V and VI) and protein content (cross I, V andVI); while, significant and negative heterosis over standardvariety was observed for days to 50 per cent flowering (crossI, III, IV, V and VI), days to maturity in all crosses and proteincontent (cross II and III).

*, **: Significant at P = 0.05 and 0.01, respectively; ANOVA have been computed from the experiment consisted of six i.e. P1, P2, F1, F2, B1 and B2generations of six crosses.

Cross I Cross II Zaid Kharif Zaid Kharif

Characters

Replication Progeny Error Replication Progeny Error Replication Progeny Error Replication Progeny Error D.F. 2 5 10 2 5 10 2 5 10 2 5 10

Days to 50% flowering 0.056 34.055** 0.389 0.222 26.455** 0.489 0.500 29.600** 0.300 0.723 32.222** 1.322 Days to maturity 1.055* 23.121** 0.189 0.387 11.956** 0.589 0.387 40.855** 0.456 0.87 7.156** 0.489 Plant height (cm) 2.703 115.701** 1.097 1.625 314.684** 2.273 1.176 128.933*

* 1.367 4.742** 190.673*

* 0.508

Number of clusters per plant 0.073 0.586 0.254 0.160 0.930 0.664 0.013 0.618* 0.119 1.872* 3.580** 0.361 Number of pods per plant 0.783 8.828** 1.328 0.393 15.019** 1.663 0.200 9.618** 1.733 0.230 4.707* 1.237

Number of seeds per pod 0.061 0.171 0.069 0.065 0.324** 0.059 0.064 0.450** 0.049 0.129 0.506** 0.051 Pod seed ratio (%) 0.164 15.130** 0.233 0.180 14.342** 0.072 0.828 2.480** 0.874 8.477 65.653** 7.176 100-seed weight (g) 0.004 0.069 0.023 0.015 0.233** 0.031 0.045 2.277** 0.040 0.021* 1.637** 0.005 Biological yield per plant (g) 0.009 8.775** 1.363 0.728 5.442** 1.427 0.883 6.629** 0.858 3.028 9.825* 2.263 Harvest index (%) 0.205 8.821 2.794 0.496 41.191** 1.910 4.192 55.503** 2.142 5.197 30.688** 1.751 Seed yield per plant (g) 0.002 1.437** 0.098 0.001 4.868** 0.176 0.235 3.352** 0.194 0.269 6.012** 0.107 Protein content (%) 0.040 13.99** 0.027 0.039 12.509** 0.016 0.201* 4.885** 0.047 0.034 6.686** 0.042

Table 1. ANOVA for differences between progenies (generations) within families (crosses) for cross I to VI during Zaid and Kharif2008

Cross III Cross IV Zaid Kharif Zaid Kharif

Replication Progeny Error Replication Progeny Error Replication Progeny Error Replication Progeny Error

Characters

D.F. 2 5 10 2 5 10 2 5 10 2 5 10 Days to 50% flowering 0.723 31.822** 0.389 0.057 15.789** 0.389 0.390 11.789** 0.322 0.723 50.722** 0.388 Days to maturity 0.723 21.256** 0.255 0.222 17.290** 0.489 0.168 39.600** 0.366 0.887 52.456** 0.589 Plant height (cm) 0.160 80.790** 1.767 6.375 102.294** 2.450 1.445 3.468 2.481 2.063 53.784** 1.612 Number of clusters per plant 0.126 1.609* 0.345 0.786 3.859** 0.269 0.044 1.205* 0.283 0.518 1.630* 0.382 Number of pods per plant 0.134 20.287** 1.380 0.675 25.551** 1.075 3.684 54.549** 3.039 2.792 16.916** 1.571 Number of seeds per pod 0.145 0.358 0.174 0.032 0.384 0.147 0.110* 0.446** 0.024 0.100 0.576** 0.065 Pod seed ratio (%) 0.539 21.253** 0.133 0.441 20.523** 0.148 0.152 9.560** 0.336 0.04 8.922** 0.091 100-seed weight (g) 0.032 0.055 0.033 0.556 0.172 0.078 0.054 0.256* 0.064 0.05 0.139* 0.027 Biological yield per plant (g) 2.522 33.677** 1.026 4.050 6.470 2.549 2.634 48.582** 2.305 2.726 19.023** 0.896 Harvest index (%) 2.514 31.418** 1.811 2.456 44.547** 1.846 1.753 26.421** 2.980 2.320 24.360** 1.267 Seed yield per plant (g) 0.039 1.781** 0.124 0.130 4.059** 0.102 0.080 1.897** 0.322 0.489 2.987** 0.126 Protein content (%) 0.052 3.527** 0.045 0.224* 2.983** 0.042 0.045 4.180** 0.102 0.096 2.710** 0.058

*, **: Significant at P = 0.05 and 0.01, respectively


Cross V Cross VI Zaid Kharif Zaid Kharif

Replication Progeny Error Replication Progeny Error Replication Progeny Error Replication Progeny Error

Characters

D.F. 2 5 10 2 5 10 2 5 10 2 5 10 Days to 50% flowering 1.056* 17.556** 0.189 0.500 20.367** 0.567 0.889 32.322** 0.490 1.055 21.156** 0.456 Days to maturity 0.723 35.289** 0.455 0.387 21.289** 0.589 1.164 44.367** 0.434 0.387 72.355** 0.456 Plant height (cm) 2.269 62.189** 2.271 0.672 402.240** 2.549 1.332 31.856** 1.556 0.641 62.627** 3.172 Number of clusters per plant 0.121 0.754 0.633 0.182 1.758 0.680 0.034 0.132 0.228 0.750 0.482 0.383 Number of pods per plant 1.356 11.608** 1.270 1.653 7.958** 1.115 1.324 19.453** 2.434 0.949 11.030** 0.551 Number of seeds per pod 0.055 0.582** 0.043 0.019 0.747** 0.055 0.468* 0.619** 0.082 0.142 1.363** 0.089 Pod seed ratio (%) 0.031 10.92** 0.177 1.699 5.653** 0.546 0.035 5.863** 0.230 0.863 8.455** 0.294 100-seed weight (g) 0.048 0.037 0.033 0.036 0.837** 0.051 0.049 0.052 0.029 0.041 0.052* 0.015 Biological yield per plant (g) 2.886 8.091** 0.986 1.229 23.254** 1.148 1.737 19.251** 0.766 3.187 39.895** 2.453 Harvest index (%) 0.613 9.850** 1.526 1.209 44.409** 1.135 5.523 8.051* 1.921 0.025 41.941** 2.115 Seed yield per plant (g) 0.078 0.414** 0.065 0.138 8.938** 0.092 0.109 1.765** 0.077 0.139 3.907** 0.125 Protein content (%) 0.041 20.040 0.021 0.042 24.029** 0.043 0.011 16.028** 0.030 0.002 15.318** 0.033

*, **: Significant at P = 0.05 and 0.01, respectively; ANOVA have been computed from the experiment consisted of six i.e. P1, P2, F1, F2, B1 andB2 generations of six crosses.

It is evident that during both crop seasons, positiveand significant standard heterosis was observed for plantheight in cross II, IV, V and VI; number of clusters per plant incross III; number of seeds per pod in cross V; pod seed ratioin cross I and V; biological yield per plant in all the crosses,harvest index in cross II; seed yield per plant in all the crosses;and protein content in cross V and VI. Singh and Singh (1971)and Gupta (2005) have also reported significant standardheterosis for yield per plant, cluster number and pod numberper plant. However, negative and significant heterosis overstandard parent was noted for days to 50 per cent flowering incross I, III and V; days to maturity in cross I, III, IV and V andprotein content in cross III. The result is very similar to findingsof Gupta (2005), indicating significantly negative standardheterosis for flowering and maturity duration.

In Zaid, heterosis over better parent (Table 3) forseed yield per plant varied from 12.99 (cross II) to 32.32 percent (cross VI), while, during Kharif heterobeltiosis for seedyield per plant ranged from -8.30 (cross III) to 29.63 per cent(cross VI). In Zaid, positive and significant heterobeltiosis

was observed for days to 50 per cent flowering in cross I, IVand VI; days to maturity in cross II and VI; plant height in allcrosses; number of clusters per plant in cross II and III; numberof seeds per pod in cross V; number of pods per plant in crossII, III and IV; pod seed ratio in cross I, IV, V and VI; biologicalyield per plant in cross I and II; harvest index in cross VI; seedyield per plant in cross III, IV, V and VI and protein content inall the crosses except cross I; while, negative and significantheterosis over better parent was recorded for days to 50 percent flowering in cross I and III; days to maturity in cross I,III, IV and V; pod seed ratio in cross III and IV; 100-seedweight in cross II and III; biological yield per plant in cross IIIand VI and harvest index in cross III and V. During Kharif,significant and positive heterosis over better parent wasobserved for days to 50 per cent flowering (cross I, II and III),days to maturity (cross I and IV), plant height in all crosses,number of clusters per plant (cross II and III), number of podsper plant (II and IV), number of seeds per pod (cross I, II, Vand VI), pod seed ratio (cross II, V and VI), 100-seed weight (I,IV and V), biological yield per plant (cross IV and V), harvest

Table 2. Heterosis over standard variety (%) for 12 metric traits in cross I-VI during Zaid and Kharif 2008


Zaid Kharif Character

Cross I Cross II Cross III Cross IV Cross V Cross VI Cross I Cross II Cross III Cross IV Cross V Cross VI Days to 50% flowering -19.99** -4.34** -19.12** 0.88 -10.43** -2.60 -2.30* 4.57 -3.06** -7.64** -9.93** -9.17** Days to maturity -8.41** 3.28** -5.14** -5.60** -8.41** -1.40 -2.62** -6.11** -3.49** -4.36** -6.98** -8.73** Plant height (cm) -2.40* 0.54 8.64** 21.20** 13.91** 26.12** 18.28** 3.26** 25.72** 33.15** 34.99** 31.13** Number of clusters per plant -- -2.41 14.31* -9.44 -- -- -- 21.35* 20.34* -6.73 -- -- Number of pods per plant 2.81 6.36 8.07* 24.41** 0.21 -4.52 1.75** 2.70 5.63* -2.20 3.31 -1.87 Number of seeds per pod -- 9.39** -- 9.04* 20.36** 20.08* 15.56** 17.91** -- 14.69** 15.90** 30.78** Pod seed ratio (%) 2.14** -1.06 -1.55** -0.75 1.25** -0.20 2.28** 1.80** 5.91** 0.94** 2.99** 2.61** 100-seed weight (g) -0.58 18.25 -- -7.92* -- -- 13.92** 25.95** -- 4.90 30.93** 4.90* Biological yield per plant (g) 24.64** 15.92** 24.46** 47.23** 55.67** 18.92** 15.14** 15.90** -- 17.81** 21.30** 11.76* Harvest index (%) -5.31 23.23* 1.04 -11.58 -21.20** -1.90 19.65** 32.26** -5.89 -0.33 28.03** 20.82** Seed yield per plant (g) 13.71** 37.52** 20.95** 24.95** 16.95** 26.48** 35.85** 53.22** 9.97** 17.68** 55.31** 35.05** Protein Content (%) -7.37** 3.25** -44.95** -3.07** 4.77** 2.39** 22.36** -5.40** -7.77** -0.41 5.89** 4.82**


index (cross I, V and VI), seed yield per plant (cross I, II, III, Vand VI) and protein content (cross II, III, IV, V and VI); while,negative and significant heterobeltiosis was recorded for daysto 50 per cent flowering (cross V and VI); days to maturity(cross I, III, V and VI); number of seeds per pod (cross III);100-seed weight (in cross II); seed yield per plant (cross III)and protein content (cross I) .

During both the crop seasons, positive and significantheterobeltiosis was recorded for days to 50 per cent flowering(cross II and IV); days to maturity (cross II); plant height(cross I, II, IV, V and VI); number of clusters per plant (crossII and III); number of pods per plant (cross II and IV); numberof seeds per pod (cross II and IV); pod seed ratio (cross II, Vand VI); biological yield per plant (cross IV and V); harvestindex (cross VI); seed yield per plant (cross IV, V and VI) andprotein content in all the crosses except cross I; while it wassignificant and negative for days to 50 per cent flowering incross V, days to maturity in cross I, III and V and 100-seedweight in cross II. Singh and Singh (1971) reported that sixhybrids excelled significantly than better parent in yield. Therelative range of hybrid vigour was from -55.2 to 121.0 with

average of 14.9%. Heterosis in hybrids over better parent wasobserved for cluster number and pod number, while overallnegative heterosis was noted for 100-grain weight and podlength. In case of branch number, half the crosses exhibitedpositive heterosis and remaining crosses showed negativeheterosis. Sagar and Chandra (1977) also reported significantheterosis for plant height. For pods per plant heterosis overbetter parent was significant in all the crosses except two.Elangaimannan et al. (2008) observed significant positiveheterobeltiosis for number of clusters per plant, number ofpods per plant and seed yield per plant in all crosses, testweight in 3 crosses; number of branches per plant in 2 crosses;and pod length and number of seeds per pod in one cross.

During Zaid, significant and positive mid parentheterosis (Table 4) was recorded for days to maturity in crossV; plant height in cross IV, V and VI; number of clusters perplant in cross II; number of pods per plant in cross II, III, IVand VI; number of seeds per pod in cross IV, V and VI; podseed ratio in cross I, II, V and VI; biological yield per plant incross I, IV and V; harvest index in cross II, III and VI; seedyield per plant and protein content in all the crosses; whereas,

Table 3. Heterosis over better parent (%) for 12 metric traits in cross I-VI during Zaid and Kharif 2008Zaid Kharif Character

Cross I Cross II Cross III Cross IV Cross V Cross VI Cross I Cross II Cross III Cross IV Cross V Cross VI Days to 50% flowering -10.69** 8.91** -10.59** 3.56** -5.50** 6.66** 11.30** 18.10** 2.42* 2.42* -6.36** -5.55** Days to maturity -2.97** 8.87** -4.25** -6.04** -1.99* 4.97** -1.76** 4.44** -3.91** 3.95** -3.62** -4.13** Plant height (cm) 4.34** 5.23** 8.09** 3.15* 13.90** 6.77** 20.27** 10.68** 2.83 7.77** 35.00** 6.21** Number of clusters per plant -- 6.75** 26.08** -7.11 -- -- -- 31.11** 37.48** 5.24 -- -- Number of pods per plant 0.73 3.75** 5.84* 42.22** -4.48** -8.86 5.77 8.45** 2.90 17.07** 0.49 -3.37 Number of seeds per pod -- -8.65** -- 1.35 20.50** 9.02 9.75* 10.57** -- 6.94 15.66** 20.15** Pod seed ratio (%) 4.14** 2.87** -3.72** -3.75** 1.24** 1.84** 2.57 3.12** 1.19 -3.21 3.00** 2.49** 100-seed weight (g) 1.02 -15.08** -- -13.82** -- -- 8.60** -14.06** -- 3.30** 29.60** 1.34 Biological yield per plant (g) 2.57 -1.41 -6.52* 8.65* 22.94** -4.37** 1.68 2.95 -- 0.87** 3.80** -1.17 Harvest index (%) 0.05 7.62 -7.33** -9.61 -0.22 14.77* 21.52** 13.67** -4.21 10.56 28.06** 31.01** Seed yield per plant (g) 1.89 8.90 8.54** 24.48** 13.94** 21.83* 27.30** 15.37** -8.30** 30.48** 14.15** 29.63** Protein Content (%) -9.57 9.29** 5.39** 1.70* 4.82** 9.23** -8.40** 3.30** 4.11** 5.36** 5.89** 13.86**


Table 4. Heterosis over mid parent (%) for 12 metric traits in cross I-VI during Zaid and Kharif 2008


Zaid Kharif Character Cross I Cross II Cross III Cross IV Cross V Cross VI Cross I Cross II Cross III Cross IV Cross V Cross VI

Days to 50% flowering -15.97** 0.00 -14.29** -0.91 -8.04** 1.76 2.40** 7.03** -0.40 -10.04** -8.17** -10.85** Days to maturity -5.08** 7.28** -6.24** -7.87** 5.32** -0.24 -2.60** -4.87** -5.55** -7.21** -5.33** -9.33** Plant height (cm) -2.99** 0.95 -0.56 3.39* 12.86** 5.31** -9.28 -3.28** 10.31** 3.74** 19.92** 2.76** Number of clusters per plant -- 12.31** 31.72** -1.19 -- -- -- 36.39** 43.34** 2.84 -- -- Number of pods per plant 5.28 8.62** 16.40** 39.37** -2.17 1.52** 11.05** 8.11** 14.38** 18.48** 1.86 4.93 Number of seeds per pod -- 1.54 -- 6.02** 20.50** 14.14** 12.11** 18.15** -- 16.09** 15.86** 26.95** Pod seed ratio (%) 4.99** 6.69** -0.55 -1.50** 4.04** 3.66** 3.51** 6.96** 3.88** -1.06** 4.91** 4.54** 100-seed weight (g) 2.31 -0.42 -- -11.08** -- -- 9.11** 1.45 -- 8.82** 30.26** 3.03 Biological yield per plant (g) 6.26** 0.14 3.96 20.56** 37.38** 2.91 5.33 4.30** -- 8.72** 11.87** 4.30 Harvest index (%) 7.94 13.05* 11.09** 9.10 -14.44** 21.19* 32.60** 25.58** 7.23 33.73** 35.00** 32.76** Seed yield per plant (g) 14.39** 12.99** 18.03** 31.58** 15.41** 32.32** 36.51** 29.97** 14.17** 48.48** 51.65** 38.61** Protein Content (%) 1.12* 14.06** 8.11** 5.91** 16.05** 17.72** 1.64** 10.24** 7.68** 7.17** 18.15** 22.38**


it was negative and significant for days to 50 per cent flowering,in cross I, III and V; days to maturity in cross I, III and IV;plant height in cross I; pod seed ratio in cross IV; harvestindex in cross V. Positive and significant heterosis over midparent during Kharif was noted for days to 50 per centflowering in cross I and II; plant height in cross III, IV, V andVI; number of clusters per plant in cross II, and III; number ofpods per plant in cross I, II, III and IV; number of seeds perpod in cross I, II, IV, V and V; pod seed ratio in all the crossesexcept IV; 100-seed weight in cross I, IV and V; biologicalyield per plant in cross II, IV and V; harvest index in cross I II,IV, V and VI; seed yield per plant and protein content in all thecrosses; while significant and negative heterosis over midparent was recorded for days to 50 per cent flowering in crossIV, V and VI; days to maturity in all the crosses; plant height incross I and II; and pod seed ratio in cross IV.

In both the season (Kharif and Zaid), positive andsignificant heterosis over mid parent was noted for plant heightin cross IV, V and VI; number of clusters per plant in cross IIand III; number of pods per plant in cross II, III and IV; numberof seeds per pod in cross IV, V and VI; pod seed ratio in crossI, II, V and VI; biological yield per plant in cross IV and V;harvest index in cross II and VI; seed yield per plant andprotein content in all the crosses while negative and significantmid parent heterosis was recorded for days to 50 per centflowering in cross V; days to maturity in cross I, III and IV;plant height in cross I and pod seed ratio in cross IV. Singhand Singh (1971) reported positive heterosis over mid parentfor yield, cluster number, pod number and branch number. Rerelative range of heterosis in F1 hybrids for grain yield overmid-parent was from -52 to 152 % with an average of 37%.Sagar and Chandra (1977) also characterized all hybrids by ahigh degree of heterotic expression when compared to midparent.

In Zaid experiment, inbreeding depression (Table 5)ranged from -26.87% (days to 50 per cent flowering in crossIII) to 33.22% (biological yield per plant in cross V), whereas,during Kharif, it varied from -26.46% (days to 50 per centflowering in cross IV) to 43.0% (harvest index in cross V).During Zaid significant and positive inbreeding depression(Table 5) was observed for number of clusters per plant (crossII); number of pods per plant (all crosses except cross VI);number of seeds per pod (cross IV, V and VI); pod seed ratio(cross I, III and VI); 100-seed weight (cross II); biologicalyield per plant (cross I, II, III and V); harvest index (cross II,III, IV and VI); seed yield per plant (all the crosses) andprotein content (cross II); whereas, it was negative andsignificant for days to maturity and days to 50 per centflowering (all the crosses); plant height (cross I, II, III andVI); number of pods per plant (cross VI); pod seed ratio (crossII, IV and V); 100-seed weight (cross I); biological yield (crossVI) and protein content (cross I, III, V and VI.). Inbreedingdepression estimated from F2 over F1 was noted positive andsignificant for plant height (cross I and V); number of clustersper plant (cross II); number of pods per plant (cross I, II, III,V and VI); number of seeds per pod (cross I, II, IV, V and VI);pod seed ratio (cross I, III and V); 100-seed weight (cross II,IV, V and VI); harvest index (cross I, II, V and VI); seed yieldper plant (all crosses) and protein content (cross VI); while itwas negative and significant for days to 50 per cent flowering(cross III, IV, V and VI), days to maturity (all crosses); plantheight (cross II and VI) and protein content (cross I and IV)during Kharif.

During both the environments (Zaid and Kharif),significant and positive inbreeding depression was noted fornumber of clusters per plant (cross II); number of pods perplant (cross I, II, III and V); number of seeds per pod (cross IV,V and VI); pod seed ratio (cross I, III and IV); 100-seed weight(cross II); seed yield per plant (all the crosses), whereas

Table 5. Inbreeding depression (%) for 12 metric traits in cross I-VI during Zaid and Kharif 2008


Zaid Kharif Character Cross I Cross II Cross III Cross IV Cross V Cross VI Cross I Cross II Cross III Cross IV Cross V Cross VI

Days to 50% flowering -19.01** -13.75** -26.87** -10.34** -14.56** -16.96** -8.60** -5.10 -7.87** -26.46** -19.50** -11.77** Days to maturity -11.22** -5.88** -6.90** -13.37** -13.78** -9.00** -4.94** -5.58** -1.81* -15.52** -9.39** -17.22** Plant height (cm) -16.89** -11.97** -10.13** 2.59 -1.12 -4.20** 3.21** -13.07** 0.86 2.29 8.08** -5.14** Number of clusters per plant -- 18.06** 7.51 8.32 -- -- -- 35.65** 5.83 -3.84 -- -- Number of pods per plant 5.22* 14.97** 11.47** 12.49* 13.95** -9.58 11.17** 8.77** 6.23** -0.27 11.34** 6.26** Number of seeds per pod -- -2.27 -- 15.56 9.47** 23.28** 9.76** 5.80* -- 7.72* 22.74** 29.85** Pod seed ratio (%) 6.44** -6.05** 3.02** -5.92** -8.96** 2.28** 4.45** -10.47 7.57** -5.93** 4.28* -0.86 100-seed weight (g) -4.02* 15.64** -- 7.34** -- -- 1.13 17.18** -- 9.34** 30.31** 3.19* Biological yield per plant (g) 9.51** 11.51** 8.96** 1.68 33.22** -8.15* 10.89** 12.78** -- 6.40** 16.26** -17.41** Harvest index (%) -0.31 19.45** 31.21** 28.22** -22.88** 21.56** 13.62** 18.86** 5.81 9.79 43.00** 46.37** Seed yield per plant (g) 9.56** 25.62** 24.88** 29.27** 17.10** 24.51** 21.89** 29.27** 7.02* 16.53* 52.17** 37.02** Protein Content (%) -0.92* 7.71** -2.51* -0.22 -1.09** -3.95** -2.64** 0.95 -0.85 -1.60* 0.11 4.80**


negative and significant inbreeding depression was recordedfor days to 50 per cent flowering and days to maturity (allcrosses); plant height (cross II and VI); biological yield perplant (cross VI) and protein content (cross I and IV).

During Zaid, positive and significant or highlysignificant estimates of heterosis over standard parent, betterparent, mid parent and inbreeding depression were recordedfor number of pods per plant (cross III and IV), number ofseeds per pod (cross V), biological yield per plant (cross V),seed yield per plant (cross III, IV, V and VI) and protein content(cross II and VI), whereas, negative and significant values forthese four parameters were observed for days to 50 per centflowering (cross I and III) and days to maturity (cross I, IIIand IV). During Kharif, positive and significant standardheterosis, heterobeltiosis, mid parent heterosis and inbreedingdepression were recorded for plant height (cross V); numberof clusters per plant (cross II); number of seeds per pod(cross I, II, IV and VI); pod seed ratio (cross V). 100-seedweight (cross V); biological yield (cross IV and V); harvestindex (cross I, II, V and VI); seed yield per plant (cross I, II, IV,V and VI) and protein content (cross VI), while negative andsignificant heterosis over standard parent, better parents, midparent and inbreeding depression was observed for days to50 per cent flowering (cross V and VI) and days to maturity(cross I, III, V and VI). Elangaimannan et al. (2008) has alsoreported in cross 2KU 53 × LC 216, positive inbreedingdepression was observed for days to 50% flowering, plantheight and number of clusters per plant, whereas negativeinbreeding depression was observed for number of branches,number of seeds per pod, and grain yield per plant. In crossV 48 × LC 216, negative inbreeding depression was observedfor number of days to 50% flowering, number of branches,number of pods and seed yield. Inbreeding depression waspositive for plant height, and negative for number of clusters,number of pods, number of seeds and seed yield in cross LC216 × 2KU 53. ADT 5 × 2KU 53 showed positive inbreedingdepression for 3 characters and negative inbreedingdepression for 2 characters. Cross DT 5 × LC 216 wascharacterized by negative inbreeding depression for numberof branches, test weight and seed yield per plant. Dasgupta(1983), Kalia et al. (1988) and Andhle et al. (1996) reportedpresence of significant heterosis coupled with strongestinbreeding depression for yield and its components in urdbean.

Nature and magnitude of heterosis and inbreedingdepression varied with crosses and characters as well asenvironments (cropping seasons). It was interesting to notein our results that expression of heterosis in yield is the resultsof occurrence of significant heterosis in four of its majorcomponents viz., number of pods plant, 100-seed weight,number of clusters per plant and number of seeds. As regardsyield, however, all hybrids were characterized by a high degreeof heterotic expression when compared to mid parent and tosuperior parent and standard variety. Singh et al. (1971)

reported that pod number and cluster number are the mostimportant yield components in urdbean. Thus it is obviousthat increase in seed yield in F1 hybrids is the result of increasein the yield components. Further, Singh (1971) has alsoextensively reviewed the literature on heterosis in pulse cropsand its possible use in varietal improvement programme. Hehas ruled out the possibility of making use of F1 or advancedgenerations to develop hybrid varieties at the present. He hasdemonstrated, taking example of mungbean, that it waspossible to develop high yielding pure lines from those F1hybrids which had shown hybrid vigour over better parentand best variety of the area. All those crosses showing noheterosis over better parents got rejected in early segregatinggenerations. He emphasized that this approach may beadopted in pulse crops for getting quick success. On thisbasis, it is suggested that those crosses which have shownheterosis over the best variety and better parents in urdbeanmay be further exploited in breeding programme fordevelopment of high yielding pure lines. Although, themagnitude and high incidence of heterosis in these crosseswere indicative of high dominance or epistasis or both (Kantand Srivastava 2012).

REFERENCES

Andhale BM, Patil JG and Dumbre AD. 1996. Heterosis and inbreedingdepression studies in blackgram. Journal of Maharashtra AgricultureUniversity 21: 141-142.

Dasgupta T. 1983. Genetic divergence, yield components, gene actionand nodulation in blackgram. Ph. D thesis, Bidhan Chandra KrishiViswavidyalay, West Bengal, India.

Elangaimannan R., Anbuselvam Y, Venkatasan M and Karthikeyan P.2008. Hetreosis and inbreeding depression for yield and yieldattributes in urdbean. Madras Agricultural Journal 95: 453-457.

Ghafoor A, Tahir M, Zubair and Malik, B. A. 1993. Combining abilityin Vigna mungo (L.) Hepper. Pakistan Journal of Botany 25: 1-6.

Gupta RS. 2005. Genetic study for yield and its component traits inurdbean [Vigna mungo (L) Hepper]. Ph. D. Thesis, NDUA&T,Faizabad (UP), India.

Hays HK, Immer FR and Smith DC. 1955. Methods of Plant Breeding.Mc Graw hill Book Co., Inc., New York.

Jackson MK. 1976. Soil chemical analysis. Prentice Hall of India Pvt.Ltd., India.

Kalia RK, Gupta VP and Kalia NR. 1988. Estimates of heterosis andinbreeding for seed yield over locations in urdbean. Indian Journalof Pulses Research 1: 43-49.

Kant R and Srivastava RK. 2012. Inheritance of some quantitativecharacters in urdbean [Vigna mungo (L.) Hepper]. Journal of FoodLegumes 25: 1-8

Lamkey KR and Edwards JW. 1999. Quantitative genetics of heterosis.In : (eds. Coors J. G., Pandey S.), The Genetics and Exploitation ofHeterosis in Crops. American Society of Agronomy, Crop ScienceSociety of America, and Soil Science Society of America, Madison,WI. Pp. 31–48

Sagar P and Chandra S. 1977. Heterosis and combining ability in urdbean.Indian Journal of Genetics and Plant Breeding 37: 420-424.


Sharma JR. 1988. Statistical and Biometrical Techniques In PlantBreeding I edition. New Age International Publisher (P) Ltd, NewDelhi Pp 284-309.

Singh D P. 1982. Genetics and breeding of black gram and green gram.Govind Ballabh Pant University of Agriculture and Technology,Pantnagar, Uttar Pradesh (now Uttaranchal) Research Bulletin 109.Pp 68.

Singh D P. 2002. Blackgram. In: Genetics and Breeding of pulse Crops,.Kalyani Publishers, Ludhiana, Punjab, India. Pp. 346-85.

Singh, K. B. 1971. Heterosis breeding in pulse crops. Proc. V. All-IndiaPulse Conf., Hissar. Pp 18-20.

Singh K B and Singh JK. 1971. Heterosis and combining ability inblackgram. Indian Journal of Genetics and Plant Breeding 47: 99-103.


An assessment of chemical mutagen induced polygenic variability in M3 progenies ofmungbean [Vigna radiata (L.) Wilczek]O.P. BALAI and K. RAM KRISHNA

Department of Plant Breeding and Genetics, S K N College of Agriculture (S K Rajasthan Agricultural University),Jobner ( Jaipur) – 303329, Rajasthan, India; E-mail: [email protected](Received: January 2, 2012; Accepted: April 30, 2012)

ABSTRACT

The M3 progenies of 184 high yielding M2 progenies resultingfrom chemical mutagen (SA, HA and EMS) treatment on threevarieties of mungbean (RMG-62, RMG-268 and RMG-344) wereevaluated along with 5 checks (including parents). The analysisof variance revealed significant differences within the progeniesand the checks. Mutant progenies were also significantlydifferent from the checks for all the traits (except days toflowering). The progenies exhibited relatively high values ofheritability (~ 71 – 93 %) for all the characters studied, but themagnitude of genetic advance as percentage of mean wasrelatively low for branches/plant (33.34 %), pod/plant (28.59%), clusters/plant (27.59 %) and seed yield/plant/ (26.80 %)and still low for other traits. On the basis of seed yield/plant,13 M3 progenies were better than the best check MUM -2. Theobserved higher yield was due to higher no. of pods/plant. TheseM3 progenies represented all the three parent varieties. Mutantprogeny 173 of RMG-344 recorded the highest seed yield of8.10 g per plant which was 50.83 per cent higher than the bestcheck and 67.70 per cent higher than RMG-344.

Key words : Mutant progenies, Mungbean, Induced variability

Mungbean [Vigna radiata (L.) Wilczek] is third mostimportant pulse crop of India (Grover 2011) and an importantkharif pulse crop of the state of Rajasthan where it is consumedas whole grains as well as dal in a variety of ways and thegreen leaves as cattle feed. Its productivity in the state is 500kg/ha, which is low (Anonymous 2011). Although there arefew varieties of mungbean which are relatively droughttolerant and cultivated in the state, but have relatively lowyield potential (700-900 kg/ha). Improvement of cultivatedcrops largely depends on the extent of genetic variabilityavailable within the species and self pollinated crop, such asmungbean, possesses limited variability (Khan et al. 2000). Itis encouraging to note that some of the high yielding varietiessuch as MUM-2 (1200 kg/ha), BM-4 (1100-1200 kg/ha) andLGG-407 (1400 kg/ha) are mutant derivatives, therefore, it wasthought justified to exploit induced mutations to improve theyield potential of the varieties cultivated in the state. Keepingthe aforesaid in view, three varieties of mungbean weresubjected to treatment with chemical mutagen Sodium azide,Hydroxylamine and EMS (Balai and Ramkrishna 2009). Thepresent communication deals with the assessment of inducedvariation and agronomic performance of 184 M3 progenies ofthe three varieties of mungbean.


The present investigation was carried out at theAgronomy Farm, S.K.N. College of Agriculture, Jobner(Jaipur), Rajasthan. The material for investigation wascomprised of M1 and M2 generations produced from treatmentof the chemical mutagens on three mungbean varieties, viz.,RMG-62, RMG-268 and RMG-344. The mutagen, namelySodium azide ( 1.0, 2.0 and 3.0 mM ), hydroxylamine ( 0.1, 0.3and 0.6 % ) and Ethylmethanesulphonate ( 0.3, 0.5 and 0.7 % )at the indicated concentration were applied and the efficiencyof these mutagenic treatments were determined and reportedearlier (Balai and Ramkrishna 2009). During 2006 (kharif), theM3 generation of certain M2 mutant progenies of the threevarieties were grown. The M3 generation consisted of seedsof individual selected M2 plants. These individual M2 plantswere, in turn, selected from high yielding M2 progenies (thoseshowing statistically significant mean and significantly highor low CV than their respective parent). Thus, M3 progeniesof 184 M2 progenies were selected from the three genotypesof mungbean and raised. The mean of M3 progenies wereanalyzed for variances as per the method suggested by(Federer 1956) and elaborated by Sharma (1998). The materialwas divided into four groups each accommodating 51 M3progenies. Each group of M3 progenies was accommodatedin a separate block. Five check (including parent) genotypesi.e. RMG-62, RMG-268, RMG-344, RMG-492 and MUM-2 werealso included in each block. Thus in each block, 46 M3progenies and 5 check varieties were grown in plots of singlerow after randomization. Each row was 4.0 m long and spaced30 cm apart. The plant to plant distance was maintained at 10cm. The data recorded on various characters on tencompetitive plants selected randomly in a progeny weresubjected to the analysis of variance.


The mean squares due to M3 progenies, checkgenotypes and blocks were significant for all the charactersstudied indicating further possibility of exercising selection(data not shown). The mean squares due to check v/sprogenies were also significant for all the characters exceptdays to flowering indicating that mutant progenies as a groupsignificantly differed from the group of checks and hencecarried significant mutational changes. Both genotypic andphenotypic variances were closely comparable indicating less


* mutagenic treatment originally received , HA , SA and EMS stand for Hydroxylamine, Sodium azide and Ethylmethane sulphonate, respectively.

Characters Genotypic coefficient of variation (GCV)

Phenotypic coefficient of variation (PCV)

Heritability in broad sense (%)

Genetic advance as percentage of mean

Days to flowering (no.) 5.18 5.44 90.76 10.18 Days to maturity (no.) 5.05 5.26 92.01 9.97 Plant height (cm) 8.09 9.53 72.07 14.15 Branches/plant (no.) 18.67 21.54 75.14 33.34 Pods/plant (no.) 15.91 18.23 76.10 28.59 Clusters/plant (no.) 15.68 18.35 72.99 27.59 Seeds/pod (no.) 4.14 4.82 73.86 7.34 Pod length (cm ) 4.24 4.51 88.39 8.21 100 Seed (g) 10.67 11.07 92.83 21.18 Seed yield per plant (g) 15.44 18.33 70.98 26.80

Table 1 : Genotypic and phenotypic coefficient of variation, heritability in broad sense and genetic advance as percentage of meanfor different characters in M3 lines of mungbean.

Table 2 : Magnitude of seed yield and yield attributes in 13 M3 progenies of three different genotypes of mungbeanMean of the M3 progenies M3

progeny No.

M2 Pedigree Seed yield/ plant

Days to

flowering

Days to maturity

Plant height

Branches / plant

Pods/ plant

Clusters / plant

Seeds / Pod

Pod Length

100 Seed weight

173 1333-1C(0.3% HA)* 8.10 36.10 70.45 56.63 4.14 19.04 4.33 12.45 8.15 3.97 146 1066-1C(2.0 mM SA)* 7.99 38.10 70.65 63.05 2.92 19.20 4.69 12.09 7.30 4.29 30 321-3A(1.0 mM SA)* 7.84 35.90 70.25 58.63 3.80 22.20 5.51 11.37 7.68 3.31 135 1040-2B (0.3% EMS + 1.0 mM

SA)* 7.81 38.10 74.65 59.58 3.12 17.18 4.79 12.37 7.99 4.25 165 1321-1C(0.5% EMS)* 7.78 34.90 68.65 57.96 3.54 19.70 4.23 12.49 7.92 4.00 70 533-7B(1.0 mM SA + 0.1 % HA)* 7.31 37.10 70.65 62.98 2.54 18.18 4.87 12.41 8.13 4.00 184 1351-8C(0.5% EMS)* 7.20 39.10 74.45 55.82 4.14 21.04 4.83 10.85 7.13 4.04 166 1323-1C (3.0 mM SA)* 7.17 34.90 66.45 66.57 3.44 16.94 3.63 11.75 7.83 4.32 29 320-3A(0.3% EMS)* 7.11 33.90 68.25 63.38 3.20 19.00 4.91 11.27 7.31 3.10 83 672-10B(1.0 mM SA)* 6.98 39.10 74.65 61.55 2.94 17.28 4.27 11.71 7.75 4.06 179 1344-3C(0.3% EMS + 0.1% HA)* 6.93 38.90 73.45 67.77 3.34 18.04 4.33 11.45 7.73 4.36 10 122-6A(0.3% EMS + 1.0 mM SA)* 6.82 34.90 70.25 73.23 3.60 20.00 4.91 12.47 7.97 3.22 56 437-1A (0.3% EMS + 0.1 % HA)* 6.70 36.10 70.65 63.18 3.14 17.98 4.47 12.01 7.42 3.16 Mean of the checks RMG-62 3.87 34.75 67.00 78.82 2.58 11.05 3.40 10.83 7.61 3.18 RMG-268 5.23 36.00 67.25 72.71 3.08 14.05 3.80 11.73 7.84 4.08 RMG-344 4.83 36.25 68.75 76.73 2.40 13.23 3.73 11.73 7.84 4.21 RMG-492 4.78 36.00 68.50 73.62 2.63 13.65 3.90 11.58 7.74 4.24 MUM-2 5.37 35.50 65.75 70.35 2.93 14.23 4.63 11.78 7.93 4.06 CD (P=0.05) Between check genotypes 0.51 0.58 1.00 3.50 0.26 1.23 0.36 0.28 0.11 0.11 Between progenies within a block 1.61 1.85 3.17 11.08 0.84 3.90 1.13 0.87 0.35 0.35 Between progenies between blocks 1.80 2.06 3.55 12.39 0.93 4.37 1.26 0.97 0.40 0.39 Between check genotypes and progenies 1.32 1.50 2.59 9.04 0.68 3.18 0.92 0.71 0.29 0.29

influence of environment. This was also substantiated by theobserved higher values of broad sense heritability for all thecharacters (Table 1). Moderate to high heritability estimatesin M3 for yield components in mungbean have also beenreported by Sahu and Patra (1997). More recently highheritability and genetic advance values for plant height, podsper plant and seed yield have been reported by Momin andMisra (2004) and Lal and Mishra (2006). However, a morereliable parameter is to estimate genetic advance as percentageof mean. Branches per plant, pods per plant, clusters per plantand seed yield exhibited relatively higher magnitude of geneticadvance values and selection based on these will be more

effective. However, the phenotypic variances observed forplant height was of higher order followed by days to maturity,pods per plant and days to flowering.

On the basis of significantly higher mean for seed yieldper plant, 13 M3 progenies were found better than the bestcheck MUM-2 (5.37 g/plant). The seed yield per plant of theseM3 progenies along with the magnitude of other yield traitsare given in Table 2. A perusal of data revealed that theprogenies exhibiting higher yield also showed significantlyhigher magnitude of pods per plant and at par values ofbranches per plant, but showed significantly lower values orat par with control for plant height, clusters per plant, seeds

Balai and Krishna : Induced polygenic variability in M3 progenies of mungbean 111

per pod, pod length and seed index. It is further seen that outof these 13 progenies, four progenies were the mutants ofRMG-62, three of RMG-268 and six of RMG-344 indicating theabsence of genotypic influence. One of the M3 progenies i.e.173 of RMG-344 recorded the highest seed yield of 8.10 g perplant which is 50.83 per cent higher than the best check i.e.MUM-2 or 67.70 per cent higher than its parent, i.e. RMG-344.The M3 progenies exhibiting significantly better yield thanthe parent have been reported by Yadav and Singh (1988) andKulkarni et al. (1990). A M5 mutant with 60 per cent higheryield than parent have been reported by Tickoo and Chandra(1999). In this study, the superior M3 progenies also recordedsignificantly higher values of pods per plant. Singh and Yadav(1991) have also found that significant increase in pods perplant was responsible to support higher yield of superior M3progenies. Khan and Wani (2006) have also made similarobservations in M3 generation mutant of Pusa Baisakhi varietyof mungbean. Very recently, Sodium azide has been shown tobe effective in inducing polygenic variability for yieldimprovement in mungbean (Lavanya et al. 2011).

From the results of present study it is inferred that(i) chemical mutagens may effectively be used for improvementof the yield potential of greengram (ii) since , the progeniesexhibiting high seed yield per plant in M3 generation belongedto all the three mutagen treatments originally received (thelower concentrations of the mutagens were prominent),therefore, further breeding may concentrate on any one ofthese mutagens or their combination studied at the dosesindicated in the table 2 and (iii) based on the estimates ofgenetic advance in M3, further selection may be executed onbranches per plant, seeds per pod and clusters per pod toimprove the seed yield.

REFERENCES

Anonymous 2011. www.krishi.rajasthan.gov.in/Dept.of Agric./statistics/kharif crops-2011-12 accessed on April 30, 2012.

Balai OP and Ram Krishna K. 2009. Efficiency and effectiveness ofchemical mutagens in mungbean. Journal of Food Legumes 22:105-108.

Federer WT. 1956. Augmented Design. Hawaiin Planters Record 40:191-207.

Grover DK. 2011. Farm level estimates of harvest and post harvestmungbean losses in Punjab. Journal of Food Legume 24: 225-229.

Khan S and Wani MR. 2006. MMS and SA induced genetic variabilityfor quantitative traits in mungbean. Indian Journal of PulsesResearch 19: 50-52.

Khan S, Mujeeb-Ur-Rehman, Mehraj-Ud-Din-Bhat and Siddiqui BA.2000. MMS induced biological damage and polygenic variability ingreengram (V. radiata (L.) Wilczek). Legume Research 23: 126-129.

Kulkarni UG, Patil SS and Goud JV. 1990. Induced mutagenesis andselection response for yield in greengram. Maharashtra Journal ofAgriculture 15: 220-222.

Lal N and Mishra R . 2006. Induced genetic variability and geneticdivergence in M3 generation in mungbean. Indian Journal of PulsesResearch 19: 47-49.

Lavanya GR, Yadav L, Sureshbabu G and Paul PJ. 2011. Sodium azidemutagenic effect on biological parameters and induced geneticvariability in mungbean. Journal of Food Legume 24: 46-49.

Momin BW and Misra RC. 2004. Induced variability, characterassociation and path coefficient analysis in mutant cultures of greengram. Environment and Ecology 22: 608-611.

Sahu BC and Patra GJ. 1997. Evaluation of quantitative characteristicsin some mutant lines of greengram ( Vigna radiata). Indian Journalof Agricultural Science 67: 533-535.

Sharma JR 1998. Statistical and biometrical techniques in plant breeding.New Age International Pub. New Delhi. Pp 15-29.

Singh VP and Yadav RDS. 1991. Induced mutation of quantitative andqualitative traits in greengram. Indian Journal of Genetics 45: 1-5.

Tickoo JL and Chandra N. 1999. Mutagen induced polygenic variabilityin mungbean ( Vigna radiata (L) Wilczek. Indian Journal of Genetics59: 193-201.

Yadav RDS and Singh RD.1988. Induced synchronized mutant inmungbean. National Academy of Scientific Letters 11: 271.


Multivariate analysis of agro-morphological variation in exotic germplasm ofgrasspea (Lathyrus sativus L.)ARCHANA SINGH, D. DEB, U.P. SINGH and A.K. ROY

Indian Grassland and Fodder Research Institute, Jhansi (UP), India; Email: [email protected](Received: January 5, 2012; Accepted: May 27, 2012)ABSTRACT

Fifteen exotic accessions of grasspea (Lathyrus sativus. L) wereevaluated for 11 quantitative traits including forage and grainyielding attributes over two consecutive years 2008-09 and 2009-2010 following RBD design. The analysis of variance (ANOVA)revealed significant variation for the characters namely plantheight, dry matter yield per plant, secondary branches, podsper plant, seeds per pod, 100 seed weight, seed yield per plant,days to flowering and forage crude protein. The analyses fordifferent characters suggested that the pods per plant have thehighest standard deviation and the total variance. PrincipalComponent Analysis (PCA) revealed that the first PrincipalComponent (PC1) alone explains about 94% of total variance,and the second Principal Component (PC2) explains only 2%.Cumulatively these two account for 96% of total variance. Eigenvectors depicted highest contribution of pods per plant in PC1.The component pattern profile showed the correlation ofdifferent characters with PC1, PC2 and PC3.Cluster analysisperformed using PROC CLUSTER option suggested groupingof accessions in 2 clusters. The cluster I consists of EC539025,EC539026, EC 539030, EC 539031, EC 539020, EC 539023,EC 539032, EC 539038, EC 539027, EC 539034 and EC 539035and cluster II consists of 4 accessions EC 539021, EC539036EC 539037 and EC 539013. It was also observed that theaccessions of cluster I exhibited more variation than theaccessions of cluster II. The present study suggests thatcategorizing and clustering germplasm accessions intomorphologically similar and presumably genetically similargroups are useful for selecting parents belonging to differentclusters in crossing programme. This could maximizeopportunities for transgressive segregation to improve the grainand forage yield of grasspea in the Bundelkhand region ofCentral India.

Keywords: Cluster analysis, Fodder yield, Genetic variation,Grain yield, Grass pea, Lathyrus sativus, PrincipalComponent Analysis

Lathyrus sativus L. commonly known as grasspea orkhesari (in Hindi) is a protein rich food, feed and forage cropbelonging to tribe Viceae in the family Fabaceae. The genusLathyrus contains 200 species and subspecies and, Lathyrussativus is the only member which is cultivated and used asgrain legume (Biswas 2007). It is believed to have originatedin southeast and central Asia which subsequently spread tothe east of Mediterranean (Smartt 1984). All grasspea linesappeared to divide into two geographical origins- one groupderives from the Indian subcontinent and another from the

Mediterranean / European region. Grasspea has strong rootsystem hence can be grown on wide range of soil types. Thishardiness with its ability to fix atmospheric nitrogen makesthe crop highly adaptive to grow under adverse conditions(Campbell et al. 1994, Kumar et al. 2011). Grass pea is adaptedto both drought and flooded lands (Kaul 1986, Campbell et al.1994). It is also resistant to many pests and insects, includingstorage insects (Palmer et al. 1989). The farmers adopt differentstrategies to avoid the problem of lathyrism such as avoidingconsumption of grass pea in the form that they suspect tocause the problem, blending/mixing with other crops, applyingdifferent processing/detoxification methods (Girma et al. 2011).

Grasspea is an annual Rabi pulse crop in Indiaoccupying an area of about 0.45 million ha, production of 0.31m tones and productivity of 698 kg/ha (Anonymous, 2011).Traditionally, it is cultivated for human consumption as dal orbesan as well as forage purposes in mainly marginalenvironment of Eastern India and the Bundelkhand region ofthe central part of India. The seeds of grasspea contain 31 %protein, 41% carbohydrate, 17% total dietary fiber (2 % solubleand 15% insoluble), 2 % fat and 2 % ash, on a dry matter basis(Akalu et al. 1998). One of the major drawbacks of grasspea isthe presence of a major anti-nutritional compound of â-N-oxalyl-L-á, â-diaminopropionic acid (â-ODAP) in the seeds(Padmanabh 1980, Wang et al. 2000, Zhao et al. 1999).Therefore, the cultivation and marketing of grasspea wasbanned in India as well as in many parts of the world (Roy andSpencer 1991). In view of this, isolation of high yielding lineswith low seed neurotoxin, ODAP is one of the prime objectivesfor improvement of this crop. Therefore, present study wasplanned to collect a wider base of exotic germplasm, theircharacterization and clustering/grouping for utilization inimprovement of grasspea.


In present study, 15 low ODAP exotic accessions ofLathyrus sativus collected from International LivestockResearch Institute (ILRI), Ethiopia were used. Theseaccessions were evaluated for years 2008-09 and 2009-2010 inrandomised block design (RBD) at Crop Research Farm ofIndian Grassland and Fodder Research Institute, Jhansi (UP).Each accession was grown in four rows plot of 3 meters. Rowto row and plant to plant spacing was 30 cm and 15 cm,respectively. Data were recorded on five randomly chosen

Singh et al. : Multivariate analysis of agro-morphological variation in exotic germplasm of grasspea 113

plants for days to flowering, plant height, primary branches,secondary branches, number of pods per plant, seeds perpod, 100-seed weight, seed yield per plant, forage crudeprotein, plant fresh weight and dry weight of plant.

Data were subjected to statistical analysis followingthe SAS 9.2 statistical tool for assessing the genetic variabilityamong the accessions for forage and grain yielding traits usingPCA and cluster analysis. An analysis of variance (ANOVA)procedure was conducted for variables. Principal ComponentAnalysis (PCA) was performed on mean data for each traitthrough PROC PRINCOMP procedure of the Software. Thesum of first two components was used in subsequent analysis.Cluster analysis was performed through PROC CLUSTERoption and the accessions were clustered using Ward’sminimum-variance method (SAS institute 1987) and thecorresponding tree diagram was produced using TREEprocedure.


Mean value over the years for different forage and grainyielding traits is given in Table 1. Analysis of Variance(ANOVA) revealed significant variability among genotypesfor the characters namely days to flowering, plant height, dryweight, secondary branches, pods per plant, seeds per pod,100- seed weight, seed yield per plant and forage crude protein.Simple statistics suggested that the character pods/plantshowed maximum variation (6.17 %) followed by seed yieldper plant (3.76 %) and primary branches (3.54 %). Besides,pods/plant has the highest standard deviation (1.23) amongstother characters. In contrast, days to flowering (0.22 %) andforage crude protein (0.34 %) had lowest variation (CV).However, plant fresh weight (2.70 %), secondary branches(2.58 %), seeds per pod (2.52 %) and plant height (2.27 %)exhibited moderate variation.

The PCA analysis revealed a difference among theaccessions studied. Thumb rule as suggested by Johnsonand Wichern (1988) was used to decide the importance ofcharacters in different principal components which suggesteduse of square root of the standard deviation of the Eigenvalue for the respective principal component as significant orimportant. The Eigen values representing the variance of the

principal component and the cumulative per cent of the Eigenvalues indicating percentage contribution to the total varianceattributable to each principal component are given in table 2.The first three Principal Components with greater that unityexplained > 98 % of the total variation among 15 accessionsand for 11 traits. The first principal component accounted for94.17% of variation reflected maximum influence on pods perplant followed by the plant fresh weight, because these traitshad highest standard deviation. The second component traitswere plant height and pods per plant which accounted 2.4 %of the variance. However, plant fresh weight with the largestcoefficient was more important in third principal component.The third component traits were plant fresh weight, seed yieldper plant and days to flowering that indicated > 1.8 % ofvariation. It is interesting to note that yield and some yieldcomponent traits appear strongly in the first two components.Earlier, similar findings have been reported in Lathyrus sativusby Tavoletti and Capitani (2000) and Polignano et al. (2005).

Figure 1 and 2 representing the graphical results of PCAdiscriminated EC539013, EC539020, EC539021, EC539023,EC539025, and EC539026 accessions from the others in PCA.The component pattern profile depicted the correlation ofdifferent characters with PC1, PC2 and PC3 (Fig 2). The firstprincipal component was a contrast between plant height andpods per plant and, between 100-seed weight and secondarybranches per plant. However, dry weight per plant showedvery low effect and forage crude protein exhibited no effecton variation. Negative values and positive values of exoticaccessions reflected a high and low frequency of plant heightand pods per plant, respectively. Intermediate values for thiscomponent were found for fresh plant weight, primarybranches and secondary branches per plant. Polignano et al.(2005) have also reported similar kind of findings in Lathyrussativus.Cluster analysis : Clustering the accessions based onsimilarity of the first three principal components, theaccessions of present study were clustered into two largegroups accounting for a 98 % share of variance. Cluster Iincluded 11 accessions while 4 accessions were in cluster II.The cluster I consists of EC539025, EC539026, EC 539030, EC539031, EC 539020, EC 539023, EC 539032, EC 539038, EC

Table 1. Mean range, standard deviation and CV in accessions of L. sativus L. S. No. Characters Mean Std. dev. Minimum Maximum CV (%) 1 Plant height (cm) 41.91 0.95 40.21 43.44 2.27 2 Plant fresh weight (g) 9.19 0.25 8.74 9.46 2.70 3 Dry weight of plant (g) 1.59 0.03 1.54 1.63 1.67 4 Primary branches 3.85 0.14 3.65 4.04 3.54 5 Secondary branches 5.69 0.15 5.48 5.92 2.58 6 Pods/plant 19.96 1.23 18.13 21.63 6.17 7 Seeds/pod 3.68 0.093 3.51 3.80 2.52 8 100-seed weight (g) 12.31 0.23 11.93 12.70 1.85 9 Seed yield/ plant (g) 3.12 0.12 2.99 3.32 3.76 10 Days to flowering 60.74 0.14 60.39 60.92 0.22 11 Forage crude protein (%) 10.29 0.04 10.24 10.34 0.34


per plant and 100-seed weight than the accessions of clusterII where plant height and pods per plant showed maximumvariation.

Table 2. Eigen values, total variance, cumulative variance and Eigen vectors for 11 quantitative characters in Lathyrus sativus L.exotic germplasm

Variation Eigenvectors Traits Eigen value Difference Proportion Cumula- tive PC1 PC2 PC3

Plant height 2.46601304 2.40293739 0.9417 0.9417 -.593689 0.759908 0.204559 Plant fresh weight 0.06307565 0.01696551 0.0241 0.9658 0.115645 -.084965 0.761963 Dry weight of plant 0.04611014 0.01310017 0.0176 0.9834 0.007951 0.002849 0.103418 Pri. branches 0.03300997 0.02652615 0.0126 0.9960 0.081955 0.010702 0.113543 Sec. branches 0.00648382 0.00460257 0.0025 0.9985 0.084820 -.010730 0.153876 Pods/plant 0.00188125 0.00058411 0.0007 0.9992 0.777913 0.564394 0.003157 Seeds/pod 0.00129715 0.00089476 0.0005 0.9997 0.056999 -.055770 0.062842 100-seed weight 0.00040238 0.00020121 0.0002 0.9999 -.097868 -.268781 0.025318 Seed yield per plant 0.00020117 0.00011975 0.0001 1.0000 -.018878 -.120994 0.441713 Days to flowering 0.00008141 0.00006083 0.0000 1.0000 0.043056 -.080724 0.347025 Forage crude protein 0.00002059 -- 0.0000 1.0000 -.000150 -.005737 0.100823

539027, EC 539034 and EC 539035 and cluster II consists of 4accessions EC 539021,EC539036 EC 539037, and EC 539013. Itwas also observed that the accessions of cluster I exhibitedmore variation for plant height, secondary branches, pods

Fig. 3 showed the grouping of accessions on the basisof mainly pods per plant and seed yield per plant. Theaccessions of Cluster I have more number of pods than theaccessions of cluster II. For some traits it was impossible toclearly differentiate the phenotypic diversity among clusters,such as the forage crude protein, seeds per pod and dry weightper plant. Polignano et al. (2005) have also reported similarkind of findings in Lathyrus sativus germplasms.

The results suggest variation in adaptive characterslike plant height, days to flower, secondary branches and seedsper pod of different accessions of cultivated Lathyrus sativusin Ethiopia. Similar to present findings, Stemler et al. (1977)also found that the Lathyrus sativus accessions collected

Fig. 3. Dendrogram showing clustering pattern of exoticaccessions of Lathyrus sativus L

Accession

539035

539038

539032

539031

539030

539027

539034

539026

539025

539023

539020

539037

539021

539036

539013

R-Squared1.0 0.8 0.6 0.4 0.2 0.0

Fig 2. Correlation of traits with first three PrincipalComponents

Fig 1. Distribution of 15 accessions of grasspea based on PCAresults

Singh et al. : Multivariate analysis of agro-morphological variation in exotic germplasm of grasspea 115

from Ethiopia were less variable and clustered in only twoclusters differing on the basis of number of pods per plant.This could be due to limited gene flow between the collectionsor accessions which might be collected from one small region.Therefore, crossing between accessions belonging to differentclusters could maximize opportunities for transgressivesegregation because there is higher probability that unrelatedgenotypes would contribute unique desirable alleles atdifferent loci (Kanwal et al. 1993).

Therefore, the grouping of accessions by multivariatemethods would be of practical value to Lathyrus breeders asrepresentative accessions may be chosen from differentclusters for crossing programmes. Further, future germplasmcollection strategies should aim to explore as manygeographically and climatically different areas, which will behelpful in improving the grain and forage yield of Lathyrussativus in the Bundelkhand region of Central India.

REFERECNCES

Akalu G, Johansson G and Nair BM. 1998. Effect of processing on thecontent of â-N-Oxalyl-L-á, â-diaminopropionic acid (â-ODAP) ingrasspea (Lathyrus sativus L.) seeds and flour as determined by flowinjection analysis. Food Chemistry 62: 233-237.

Anonymous. 2011. Department of Agriculture and Co-operation,Ministry of Agriculture, Govt. of India.

Biswas AK. 2007. Induced mutation in grasspea. In: S. ochatt and SMJain, (eds.), Breeding of neglected and underutilized crops, spicesand herbs, Science Publisher, Enfield. Pp 29-39.

Campbell CG, Mehra RB, Agrawal SK, Chen YZ, El-Ali AMA, KhwajaHIT, Yadav CR and Araya WA. 1994. Current status and futurestrategy in breeding grasspea (Lathyrus sativus L.). Euphytica73:167-175.

Grima A, Tefera B and Dadi L. 2011. Grass pea and neurolathyrism:farmers’ perception on its consumption and protective measure inNorth Shewa, Ethiopia. Food Chemistry & Toxicology 49: 668-72.

Johnson RA and Wichern DW. 1988. Applied multivariate statisticalanalysis, Prentice-Hall, Englewood Cliffs.

Kanwal KS, Singh RM, Singh J and Singh RB. 1983. Divergent gene

pools in rice improvement. Theoretical and Applied Genetics 65:263-267.

Kaul AK, Islam, MQ and Hamid A. 1986. Screening of Lathyrusgermplasm of Bangladesh for BOAA content and some agronomiccharacters. In: AK Kaul and D Combs (eds.), Lathyrus andLathyrism, Third world medical Research foundation, New York,NY. Pp 93-97.

Kumar S, Bejiga G, Ahmed S, Nakkoul H and Sarker A. 2011. Geneticimprovement of grasspea for low neurotoxin (â-ODAP) content.Food chemistry & Toxicology 49: 589-600.

Padmanabh G. 1980. Lathyrogens. In: IE Liener (Ed.), Toxicconstituents of plant food stuffs (2nd ed.), New York Academicpress. Pp 244-250.

Palmer VS, Kaul AK and Spencer PS. 1989. International network forthe improvement of Lathyrus sativus and eradicators of Lathyrism(INILSEL): ATWMRF initiative. In: P.S. Spencer (ed.), TheGrasspea, Threat and promise, Third world medical Researchfoundation, New York, NY. Pp 219-223.

Polignano GB, Uggenti P, Olita G, Bisignano V, Alba V and Perrino P.2005. Characterization of Grasspea (Lathyrus sativus L.) entries bymeans of agronomically useful traits. Lathyrus Lathyrism Newsletter4: 10-14.

Roy DN and Spencer PS. 1991. Lathyrogens. In: PR Check (Ed.),Toxicants of plant origin Vol. III: Proteins and amino acids BocaRaton, Fl: CRC press, Inc. Pp. 170-201.

SAS/STAT Guide for Personal computers version 6. 1987. SAS InstituteInc., Cary, NC USA, SAS institute.

Smartt J.1984. Evolution of grain legumes. I. Mediterranean pulses.Experimental Agriculture 20: 275-296.

Stemler ABL, Harlan JR and De Wet JMJ.1977. The sorghum ofEthiopia. Economic Botany 31: 446-460.

Tavoletti S and Capitani E. 2000. Field evaluation of grasspeapopulations collected in the Marche region (Italy). LathyrusLathyrism News Letter 1: 17-20.

Wang F, Chen X, Chen Q, Qin XC and Li Z. 2000. Analysis of neurotoxinODAP and its á -isomer in Lathyrus sativus by HPLC with 6-diaminoquinolyl-N-hydroxy succinimidyl carbomate (AQC)derivatization. Journal of Agriculture and Food Chemistry 48: 3383-3386.

Zhong GY and Qualset CO. 1995. Quantitative genetic diversity andconservation strategies for an allogamous annual species, dasypyrumvillosum (L.) candogy (poaceae). Theoretical and Applied Genetics91: 1064-1073.


Influence of legume residues management and nitrogen doses on succeeding wheatyield and soil properties in Indo-Gangetic PlainsK.K. SINGH1, CH. SRINIVASARAO2, K. SWARNALAKSHMI3, A.N. GANESHAMURTHY4 and NARENDRAKUMAR5

1,5Indian Institute of Pulses Research, Kanpur, India; 2Central Research Institute for Dryland Agriculture, Hyderabad,India 3Indian Agricultural Research Institute, Pusa, New Delhi, India 4Indian Institute of Horticultural Research,Bengaluru, India; E-mail: [email protected](Received: December 29, 2011; Accepted: May 11, 2012)

ABSTRACT

A field experiment was conducted in a mungbean/urdbean-wheatcropping system for two consecutive years (2004-06) to assessthe effect of different methods of legume residues managementalong with fertilizer N on succeeding wheat yield and soilproperties. Despite environmental aberrations as a result ofabrupt increase in air temperature during reproductive stagescausing relatively lower yields during second year (2005-06),the extent of wheat yield reduction was less evident in residuesincorporated plots over that in control. Grain yield of wheatwas increased by 12.7-38.0% with incorporation of legumeresidues over the control during both the years. There wassignificant improvement in the number of panicles per unitarea with different residues management (10.2-20.9%) overresidues removal. Irrigating plots after incorporation of choppedresidues increased soil microbial biomass carbon by 156% overcontrol. Direct incorporation of urdbean residues raised soilorganic carbon by 35.5% over control. Residues incorporationalso led to higher soil available major nutrients viz., N by24.6%, P by 11.5% and K by 18.5% over initial levels. Soilphysical properties such as bulk density, particle density, percentpore space and water holding capacity (WHC) were also improvedin residues incorporated plots over residues removal plots.Application of 120 kg N/ha to wheat improved different soilproperties besides increased wheat yield (by 8%).

Key words: Legume - wheat rotation, Residues incorporation, Seedyield, Soil properties

The Indo-Gangetic Plains (IGP) covering large tract ofIndia, Pakistan, Nepal and Bangladesh is the ‘bread basket’for many living in these regions of Southern Asia. Rice andwheat, the major cereals of India, are grown in 41.85 m ha and28.46 m ha producing 89.13 m tonnes and 80.80 m tonnes,respectively (Anonymous 2012). Over the years, productionof this magnitude from soil without adequate nurishmentcaused wide scale soil fertility problems. Thus, soil qualitydeterioration due to modern agriculture pose a major limitingfactor for improving yields and productivity of many fieldcrops (Aggarwal et al. 2004). Soil organic C and N content arealso important indicators of soil quality and are essential forsustaining agricultural production (Doran et al. 1994). Changesin these parameters over time due to modification in soil andcrop management practices such as cultivation, crop rotation,

residues management or fertilization can also influence long-term sustainability of cropping system. Since pulses play animportant role in different cropping systems as they enrichsoil through fixation of atmospheric nitrogen, it could havetremendous potential for improvement in soil quality on long-term basis. Pulses also improve nutrient availability andmicrobial activity which can be assessed quantitativelythrough soil microbial biomass carbon (SMBC) and N contentof soil (Yusuf et al. 2009).

Urdbean and mungbean are important pulse crops andboth can fit well in diverse cropping systems with wheat(Lathwal et al. 2009). Short duration legumes like urdbean andmungbean with profuse growth may offer opportunities todiversify various cropping system (Singh et al. 2009). Generallycrop residues of urdbean and mungbean is available at thetime of crop harvest and is often left on the road side or onthreshing floor without further use and are thus, subjected tobiomass loss through wind or rain. Moreover, there is sufficientturn around time available between legume harvest and sowingof succeeding wheat. The residues of these two pulse cropsalso contain a significant amount of nutrients and have anarrow C: N ratio base leading to faster decomposition rateover other cereal crops. Thus, the common problem of nutrientsimmobilization following cereal residues incorporation doesnot happen in the case of pulses and the succeeding crop(cereal or oilseed) might be benefited by assimilation of mineralnutrients from decomposing plant residues. Therefore, thepresent investigation was carried out to evaluate appropriatelegume residues incorporation along with fertilizer nitrogenon growth and yield of succeeding wheat and soil properties.


A field experiment was carried out during 2004-05 and2005-06 at Indian Institute of Pulses Research, Kanpur on aTypic Ustochrept soil. The soil was neutral in reaction (pH7.3), low in organic C (0.28%), N (190.5 kg/ha) and K2O (121kg/ha) and medium in available P2O5 (16 kg/ha). The treatmentsconsisted of 4 methods of residues management each formungbean and urdbean viz., 1) incorporation, 2) incorporation+ irrigation, 3) chopping + incorporation and 4) chopping +incorporation + irrigation along with a control (residues

Singh et al. : Residues management on succeeding wheat yield and soil properties 117

removal). These main plot treatments (9) were furthersubdivided into two sub plots with 120 and 90 kg N/ha tosucceeding wheat crop. The experiment was laid out in a splitplot with 3 replications. In residues removal plots, all theabove ground residues of mungbean and urdbean wereremoved. Both urdbean and mungbean crops were grown inthe same field in monsoon season to obtain its crop residuesand were incorporated in situ as per treatments after pickingof pods. In the year 2004-05, immediately after incorporationof crop residues, the soil received 15 mm of rainfall. Totalamount of N added to the soil during two years throughmungbean and urdbean crop residues were 60.1 kg and 56.2kg N, respectively while similar quantities of P (9.7 kg each)and K (81.7 kg each) were added by both the crops.

Urdbean and mungbean crop were fertilized with 18 kgN and 46 kg P2O5/ha. Wheat crop was uniformly applied with60 kg P2O5, 40 kg K2O and 20 kg S/ha through DAP, MOP andelemental sulphur in all the plots. N was applied through ureaas per the treatments. Full doses of P, K and S and 50% of Nwere applied at the time of sowing while the rest of N wasapplied after first irrigation. Mungbean and urdbean crop weresown in the second fortnight of July during both years. Afterpicking of pods, mungbean and urdbean residues wereincorporated as per treatments in October. Sowing of wheat

was carried out in November and the crop was harvested inMarch. The rainfall and temperature recorded during the monthof October to April in both the years (Fig 1) revealed thatthere was an unprecedented increase in both minimum andmaximum temperature during January and February 2006 whichadversely affected on wheat yield.Soil sampling and analysis: Five soil samples from eachexperimental plot were taken randomly at 0-15 cm depth usingcore sampler of 8 cm diameter. The samples were thoroughlymixed and bulked, and a representative sample was drawn forinitial biological and chemical analysis. After incorporation ofcrop residues during second year, soil samples from 3 placesin each plot were taken at a week interval to find out thebiological changes. After harvest of wheat crop, soil samplesfrom three places in each plot were taken to find out the changesafter completion of the experiment/cropping cycle. Bulkdensity was determined from oven dried undisturbed coresas mass per volume of oven dried soil. However, particledensity was estimated by the procedure given by Jury andHorton (2004). The soil porosity was calculated using equationand relationship developed by Danielson and Sutherland(1986).Microbial biomass carbon: Soil microbial biomass C wasmeasured by the fumigation-extraction method (Vance et al.1987). Thrice replicated 50 g portions of each soil were weighedinto petriplates and fumigated with ethanol free chloroformfor 24 h at 25°C. After fumigant removal, the soil was extractedwith 100 ml 0.5M K2SO4 for 30 min. Three replicates of un-fumigated soil were extracted similarly at the time of fumigationcommenced. Organic C in soil (SOC) extracts was measuredby dichromate oxidation and soil microbial biomass C (SMBC)was calculated as ‘Ec/0.25’, where EC = (organic C extractedfrom fumigated soils) - (organic C extracted from non-fumigatedsoils) and 0.25 is kEC (Voroney et al. 1993).The results wereanalyzed using the SPSS package version 11 for LSD atP = 0.05. Data was subjected to F test for testing the equalityFig. 1 Weather parameters during wheat growth period

Table 1. Yield attributes and yields of wheat as influenced by different pulse residue treatments

Note: 1- Incorporation; 2- Incorporation + irrigation; 3- Chopping + incorporation; 4- Chopping + incorporation + irrigation

Ears/m2 Seeds/ears Grain yield (kg/ha) Straw yield (102 kg/ha) Treatment 2004-05 2005-06 Mean 2004-05 2005-06 Mean 2004-05 2005-06 Mean 2004-05 2005-06 Mean

Residues management Mungbean1 207.33 182.0 194.6 51.40 47.25 49.33 4806 4004 4405 69.16 103.70 86.43 Urdbean1 203.33 200.3 201.8 48.16 43.16 45.66 4673 3864 4269 67.50 104.41 85.96 Mungbean2 203.66 185.33 194.5 51.83 46.20 49.02 4718 4136 4427 65.16 107.25 86.21 Urdbean2 224.33 191.66 207.9 51.00 46.75 48.88 4888 3824 4356 73.27 104.81 89.04 Mungbean3 195.33 183.66 189.4 51.80 47.30 49.55 4938 4324 4631 68.67 106.76 87.72 Urdbean3 209.66 191.66 200.66 53.00 47.81 50.41 5080 4125 4603 71.67 103.88 87.78 Mungbean4 200.66 180.99 190.82 51.83 46.22 49.03 5058 4495 4777 70.98 108.52 89.75 Urdbean4 217.0 193.66 205.33 52.16 48.11 50.13 5221 4338 4780 75.00 104.53 89.77 Control 181 162.99 171.9 51.33 47.92 49.62 4147 3256 3702 59.30 107.02 83.16 CD (P=0.05) 25.65 23.48 26.72 NS NS NS 466 858 703 5.52 NS NS N dose (kg/ha) 120 212 199.17 205.59 53.59 51.16 52.38 5023 4287 4655 74.33 108.21 91.27 90 197.62 172.43 185.03 49.21 42.33 45.77 4646 3800 4223 63.13 103.04 83.09 CD (P=0.05) 8.64 9.08 11.63 NS 3.58 3.89 202 278 246 2.66 NS 4.50


of variance. The error variance for growth and yield parametersof respective treatments during 2 years were foundhomogenous, hence the results were pooled. Interactioneffects were found to be not significant.


Physical properties of soil: Soil physical properties improvedsignificantly due to residues management practices (Table 2).A decrease in bulk density was observed in plots wherechopped crop residues were incorporated along with irrigation.Particle density in the surface layer was also significantlylowered under chopping + incorporation of crop (urdbean/mungbean) residues + irrigation. It also increased pore spaceand WHC by 28.9% and 38.9%, respectively. However,application of N had no influence on any of the physicalparameters measured. Crop residues are being reported todecrease bulk density, improve pore space and water holdingcapacity (Bellakki et al. 1998).Available NPK and SOC: All the residues incorporationtreatments gave significantly higher soil available NPKcontent over control (Table 2). Among crop residuestreatments, incorporation of chopped straw + irrigation provedmost beneficial in raising soil available N. The plots undercrop residues removal (control) gave the lowest soil availableN (196.8 kg/ha). Similarly, available P and K content in soilalso increased in the range of 4-11.5 and 8.1-18.1%, respectivelydue to different methods of residues incorporation overcontrol. Application of 120 kg N/ha also resulted in 4.9%increase in soil available N over the lower dose (90 kg/ha). Pand K being relatively less mobile and stable in soil, no suchimprovements in its availability were observed.

Different methods of residues management had alsosignificant effect on final status of soil organic matter quantifiedthrough SOC. All the residues management treatmentsincluding control gave significantly higher SOC over its initialvalue of 0.28%. But the highest increase in SOC (35.48 %)was recorded in direct incorporation of urdbean residues over

control. Application of 120 kg N/ha significantly increasedSOC (by 5.5%) over 90 kg N/ha (Table 3). Since crop residueswere recycled in incorporation treatments, an increase in soilavailable N, P, K and SOC were also evident (Singh et al.2008). The increase in SOC over its initial value in a control(crop residues removal) plot could be attributed to thecontribution from root biomass.Dynamics of SMBC: Crop residue incorporation resulted insignificantly higher SMBC over control. All the crop residuesmanagement plots were having similar SMBC values exceptthat in urdbean crop residues where significantly lower SMBCvalues were observed over the rest of crop residuesincorporation treatments. Highest SMBC values were evidentin the treatments with incorporation of chopped straw ofurdbean/mungbean residues + irrigation (Table 3). Applicationof 120 kg N/ha also gave significantly higher SMBC (by 38.5%)over 90 kg N/ha. All the residues management treatments werealso superior on ratios of microbial carbon to soil organiccarbon. But there was a drastic reduction in the ratio whenurdbean residues were incorporated without irrigation in spiteof the fact that this had highest SOC (Table 3).

Periodic changes in SMBC monitored at four stages,starting from day 7 to day 56 reveled that irrespective of theresidues management its values increased up to 56 days. Theincrease in SMBC was more in mungbean than urdbean plots.On day 14, the differences in SMBC values due to differentresidues management were not similar. In direct incorporationand incorporation + irrigation treatments, there was also awide variation in SMBC status while the differences in SMBCbetween different crop residues were less in chopping +incorporation and chopping + incorporation + irrigation. Butno such improvement was recorded in control plot except at33 days stage when an increase to the extent of 10.74% inSMBC was recorded. Incorporation of chopped straw +irrigation generally had more SMBC than rest of themanagement treatments up to the harvest of wheat crop.Application of higher doses of N (120 kg/ha) not only gave

Table 2. Effect of crop residues incorporation and fertilizer on soil physic-chemical properties


Soil physical properties Available nutrient (kg/ha) Treatment Bulk density

(g/cc) Particle density

(g/cc) Pore space

(%) Water holding capacity (%) N P K

Residue management Mungbean1 1.38 2.42 45.5 37.3 228.2 18.72 146.4 Urdbean1 1.39 2.39 44.7 38.3 222.1 18.16 154.2 Mungbean2 1.38 2.38 46.8 38.3 237.8 19.58 152.1 Urdbean2 1.38 2.40 47.0 41.6 235.7 17.84 149.2 Mungbean3 1.34 2.38 47.3 42.5 240.4 18.91 148.7 Urdbean3 1.35 2.39 48.2 45.1 241.1 17.32 147.6 Mungbean4 1.32 2.36 49.6 46.4 245.3 17.46 145.7 Urdbean4 1.33 2.35 48.2 45.9 246.1 18.02 141.1 Control 1.44 2.50 38.2 33.4 196.8 16.65 130.5 CD (P=0.05) 0.05 0.10 3.5 3.8 14.9 0.78 9.6 N dose (kg/ha) 120 1.37 2.39 46.6 45.5 238.2 18.29 143.8 90 1.38 2.42 44.7 43.2 227.0 17.85 148.5 CD (P=0.05) NS NS NS NS NS NS NS

Singh et al. : Residues management on succeeding wheat yield and soil properties 119

significantly higher SMBC over 90 kg N but also maintainedhigher level of SMBC even up to harvesting stage. HigherSMBC in residues incorporation treatment may be due to theenhancement of the pool sizes of microbial biomass (Roy etal. 2006). Increase in SMBC at 33 days stage in control plotsand higher SMBC in other treatments at 56 days stage may bedue to basal application of fertilizers and top dressing of ureaafter 1st irrigation respectively, in wheat.Yield attributes: During both the years, significantly highernumber of panicles per unit area was recorded by differentresidues management practices over control (Table 1). Onpooled data, higher number of ears per unit area was recordedunder urdbean incorporation + irrigation (224.3) but none ofthe residues incorporation treatments differ significantlyamong themselves. Nitrogen application brought aboutsignificant change in the number of ears per unit area as it wasincreased to the tune of 7.2, 15.5 and 11.1% with 120 kg Nduring 1st, 2nd year and in pooled data, respectively over 90 kgN/ha. Number of seeds per ear however, was not affected byany of the crop residues treatment. Application of 120 kg N/ha gave 20.85% higher number of seeds per year in 2005-06but no such improvement was noticed during 2004-05. Modernhigh yielding varieties of wheat responded to more than 150kg/N ha (Sharma et al. 2007). Therefore, in this experimenthigher yield of wheat at 120 kg N application over 90 kg wasevident.Grain and straw yield: On comparison with the control, grainyield of wheat varied from 4673 to 5221 kg/ha and 3824 to 4495kg/ha in first and second year, respectively, in differentresidues management treatments (Table 1). Crop residues oftwo pulses along with the different methods of residuesmanagement behaved differently in both the years. In the firstyear due to heavy rain just after residues incorporation broughtabout sufficient moisture to all residues management

treatments, and therefore no differences among residuemanagement practices could be observed. However, it waspertinent during 2nd year and there was a reduction in grainyield in all the treatments during second year. This decreasein grain yield was however, more evident in control plots(21.5%) over the residues incorporation plots (11.1- 21.8%).Extent of increase in grain yield in different residuesmanagement treatments over control was less in first year(12.7-25.9%) than in second year (17.4-38.1%). Sudden increasein temperature (Fig. 1) during 2005-06 reduced grain yield ofwheat as higher temperature is known to reduce wheat yield.Yet, the adverse impact of increased temperature was lesspronounced under residues incorporation over removal plotsdue to improved soil quality (Singh et al. 2005).

Application of N at 120 kg/ha gave significantly highergrain yield (8.1%) over 90 kg N/ha. Straw yield however,showed the reverse trend as that of grain yield. Straw yield ingeneral was higher during 2005-06 in comparison to 2004-05.All the residues incorporation treatments gave significantlyhigher straw yield in the range of 9.9-26.5% over control during2004-05 while the difference was not pertinent during 2005-06.Application of 120 kg N/ha proved superior over 90 kg N/ha(by 17.7%) in terms of straw yield during 2004-05 only (Table1). On pooled data also application of 120 kg N/ha gave 10%and 9.8% higher grain and straw yield, respectively, over 90kg N/ha.

It can be inferred from the above study thatincorporation of easily decomposable mungbean and urdbeancrop residues may improve the soil properties as these act assupplemental source of nutrients to succeeding wheat.Incorporation of chopped residues followed by irrigation hasbeneficial effects on wheat yield. Wheat productivity can alsobe maintained even under climatic aberrations throughresidues incorporations.

Table 3. Effect of residues incorporation and fertilizer on periodic changes in microbial biomass carbon and organic carboncontent in soil


Periodic (days) changes in SMBC after residues incorporation (µg/100 g)

After wheat harvest Treatment

7 14 33 56 SMBC (µg/100 g)

SOC (g/kg)

Ratio of SMBC to SOC (%)

Residues management Mungbean1 335 347 345 351 262 3.9 6.71 Urdbean1 270 178 282 264 222 4.2 5.28 Mungbean2 345 351 358 367 322 3.9 8.25 Urdbean2 230 237 237 230 312 4.1 7.60 Mungbean3 348 369 363 378 327 3.6 9.08 Urdbean3 330 351 343 351 337 3.7 9.10 Mungbean4 355 395 377 391 320 3.5 9.14 Urdbean4 320 359 375 327 347 3.7 9.37 Control 240 242 268 248 132 3.1 4.25 CD (P=0.05) 4.78 4.81 5.16 4.96 39.8 0.29 NS N dose (kg/ha) 120 322 329 340 342 353 3.96 8.91 90 299 300 315 317 222 3.52 6.30 CD (P=0.05) 2.32 2.48 3.57 3.41 15.9 0.14 NS


REFERENCES

Anonymous. 2012. Indiastat.com (http://www.indiaagristat.com/table/agriculture/2/wheat /17195 /7400/data.aspx assessed on 3-5-2012).

Aggarwal PK, Joshi PK, Ingram JSI and Gupta RK. 2004. Adapting foodsystems of the Indo- Gangetic plains to global environmentalchange: key information needs to improve policy formulation.Environmental Science & Policy 7: 487–498.

Bellakki MA, Badanur VP and Setty RA. 1998. Effect of long-termintegrated nutrient management on some important properties ofa vertisol. Journal of Indian Society of Soil Science 46: 176–180.

Danielson RE and Sutherland PL. 1986. Porosity. In : A Klute (Ed),Methods of soil analysis. Part 1. 2nd Ed. Agronomy Monograph 9.ASA and SSSA, Madison WI. Pp 443–461.

Doran JW, Coleman DC, Bezdicek DF and Stewart BA. 1994. Definingsoil quality for a sustainable environment; Soil Science Society ofAmerica. Special Publication No. 35, Madison, WI, USA.

Jury WA and Horton R. 2004. Soil Physics (6th Edition), John wileyand Sons Inc., Hobken, New Jersey.

Lathwal OP. 2009. Performance and evaluation of summer mungbeanin rice-wheat cropping system through frontline demonstrations inthe irrigated ecosystem of Haryana. Journal of Food Legumes 22:73-75.

Roy M, De Chhonkar PK and Patra AK. 2006. Effect of crop residuesand urea on microbial biomass carbon and nitrogen under rice-wheat cropping sequences. Indian Journal of Microbiology 46:59-64.

Sharma RP, Pathak SK, Raman KR and Chattopadhyaya N. 2007.Enhancing productivity and profitability of rice (Oryza sativa) –wheat (Triticum aestivum) system through site specific nutrientmanagement in south Bihar alluvial plains. Farming Systems Research& Development 13: 107-113.

Singh KK, Ch. Srinivasarao and Ali M. 2008. Phosphorus and mungbeanresidue incorporation improve soil fertility and crop productivityin sorghum and mungbean –lentil cropping system. Journal of PlantNutrition 31: 459-471.

Singh KK, Pramanik SC and Singh NB. 2009. Agrotechniques in latesown mungbean. Journal of Food Legumes 22: 221-222.

Singh Y, Singh B and Timsina J. 2005. Crop residue management fornutrient cycling and improving soil productivity in rice-basecropping systems in the tropics. Advances in Agronomy 85: 269-407.

Vance ED, Brookes PC and Jenkinson DS. 1987. An Extraction methodfor measuring soil microbial biomass carbon. Soil Biology andBiochemistry 19: 703-707.

Voroney RP, Winter JP and Beyaert RP. 1993. Soil microbial biomasscarbon and N. In: MR Carter (Ed), soil sampling and methods ofanalysis. Canadian Society of Soil Science, Lewis Publishers.

Yusuf AA, Abaido RC, Iwuafor ENO, Olufajo OO and Sanginga N.2009.Rotation effects of grain legumes and fallow on maize yield,microbial biomass and chemical properties of an Alfisol in theNigerian savanna. Agriculture Ecosystem and Environment 129:325-331.


Effect of integrated nutrient management on growth, seed yield and economics offield pea (Pisum sativum L.) and soil fertility changesANUPMA KUMARI1*, O.N. SINGH2 and RAKESH KUMAR3

1,2Department of Agronomy, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi - 221 005,Uttar Pradesh, India, 3ICAR Research Complex for NEH Region, Nagaland Centre, Jharnapani-797106, India;E-mail: [email protected](Received: October 16, 2011; Accepted: April 11, 2012)

ABSTRACT

A field experiment was carried out during rabi 2007 - 09 atAgricultural Research Farm, Institutes of Agricultural Sciences,Banaras Hindu University, Varanasi, Uttar Pradesh to evaluatethe effect of biofertilizers, inorganic fertilizers andvermicompost on field pea. Application of 50% N throughvermicompost (1.33 t/ha) along with recommended inorganicnutrients (40:17:16:20 kg of N:P:K:S/ha) to field pea resultedin higher number of branches (5.34/plant), dry matter atmaturity (34.87g/plant), seeds/pod (5.46), 100 seed weight(20.52g), seed yield (1717 kg/ha), straw yield (2430 kg/ha) andharvest index (41.37%). Net return (Rs. 45358/ha) and B: Cratio (2.21) were also higher with the above treatment. Inaddition, organic carbon, available N, P, K, S and Zn status insoil improved significantly at this fertility level. Seedinoculation with biofertilizers (Rhizobium +PSB+PGPR) alongwith 5 kg Zn/ha markedly enhanced crop growth and yieldattributes, seed (1498 kg/ha) and straw (2184 kg/ha) yield offield pea and soil fertility status. Net return and B: C ratioswere also higher with biofertilizers + zinc. Combinedapplication of inorganic nutrients, 50% N throughvermicompost, biofertilizers and Zn produced the highest seedyield (1873 kg/ha) of field pea and was 38.74% higher overrecommended inorganic nutrients.

Key words: Bio-fertilizers, Field pea, Inorganic nutrient, Organicnitrogen, Vermicompost

Field pea (Pisum sativum L.) is an important rabi pulsecrop grown in Indian subcontinent. It is one of the main sourcesof dietary protein for the majority of Indians. The productivity(1356 kg/ha) of this crop is highest among the pulses.Moreover, its high yield potential (3.5 tonnes/ha) throughbalanced fertilization envisages ample scope to increase itsyields further (Anonymous 2009). Moreover, a number ofinvestigations have convincingly proved that field peainvariably responds to a high level of improved productiontechnology including application of phosphate (Yadav etal.1992) and sulphur (Scherer et al. 2006). In intensiveagriculture, integrated nutrient management takes care of bothcrop nutritional needs as well as soil fertility considerationsleading to increased yield through judicious consumption of

inorganic nutrients in the system. Now-a-days, organicfarming is also becoming an important component ofenvironmentally sound sustainable agriculture. The beneficialeffect of enriched compost such as vermicompost in improvingboth soil fertility and productivity is well documented.However, the information on the requirements for anappropriate combination of nutrients through various sourcesviz., biofertilizers, inorganic fertilizers and organics in fieldpea is meager. Hence, the present investigation was conductedto assess the response of field pea to integrated crop nutritionviz., biofertilizers (Rhizobium+PSB+PGPR), vermicompost andinorganic fertilizers under irrigated condition.


A field experiment was conducted at AgriculturalResearch Farm, Institute of Agricultural Sciences, BanarasHindu University, Varanasi, Uttar Pradesh during rabi 2007-08 and 2008-09 (25018' N, 8303' E and 128.93 m above mean sealevel ).The sandy loam soil of the experimental field was low inorganic carbon (0.35%), available N (197.02 kg/ha) and S (17.5kg/ha), medium in available P (19.07 kg/ha) and K (210.2 kg/ha) with pH 7.42. The experiment was laid out in split plotdesign with five fertility levels viz., control, IN (recommendeddose of N,P,K and S @40:17:16:20 kg/ha) , ON (recommendeddose of N @ 40 kg/ha through 2.66 t/ha of vermicompost), IN+ 50% ON and ON + 50% IN in main plot and four combinationsof biofertilizers (Rhizobium + PSB + PGPR) and micronutrient(zinc @ 5 kg/ha) viz., control, biofertilizers, zinc andbiofertilizers + zinc in sub plot and was replicated three times.All the treatments were applied at the time of planting.Vermicompost was applied as per treatment on the basis of Ncontent only. Pea seeds were inoculated with Rhizobiumleguminosarum, Bacillus polymixa (PSB) and Pseudomonasfluorescence (PGPR)@ 20 g/kg seed as per treatment. Thefield pea ‘HUDP 15’ of 110-120 days duration was sown in lineat a row spacing of 30 cm at the seed rate of 80 kg/ha. Thecrop was planted on November 7 and 10 during 2007-08 and2008-09, respectively and harvested on March 21 during boththe years. The crop was raised under irrigated condition withrecommended package of practices. The data on all growthand yield attributes viz., plant height, number of branches,dry matter accumulation, pods per plant and yields were

*Based on Ph.D. Dissertation work submitted to Department of Agronomy, Institutes of Agricultural Sciences, B.H.U. Varanai-221005, India.


recorded at maturity and analyzed as per split-plot design.Since similar trend was noticed during both the years, thedata pertaining to both the years were pooled. Soil sampleswere analyzed for available N, P and K as per standard methods.S and Zn content in soil was analyzed as per standardturbidometric method (Chesin and Yien 1950) and extractionwith DTPA Solution (Lindsay & Norvell 1978).


Growth characters: Plant growth parameters such as branchesand dry matter per plant at maturity increased significantlywith IN + 50% ON (Table 1). Higher values of these growthparameters at this integrated level were the result of bettersupply of all the essential mineral nutrients in a balancedamount that resulted in better crop growth and development(Khan et al. 2009). The lowest values of these attributes were,however, recorded under control and ON owing to inadequatenutrient availability. Significant variations in growth attributesdue to application of vermicompost with inorganic fertilizerswere also attributed to both (higher) availability and absorptionof nutrients (Hegde and Dwivedi 1993). Seed inoculation withbiofertilizers and zinc alone also showed significantadvantages in the form of branches and dry weight per plantat maturity over control. This might be due to the beneficialeffect of Rhizobium, Bacillus and Pseudomonas strains inenhancing the nutrient supply to the plants (Srivastava andAhlawat 1995). Application of zinc alone also improved growthattributes over control which was mainly due to their directand indirect role in many physiological activities in plant. Inaddition, a synergistic effect of zinc with biofertilizers wasevident since it was involved in many enzymatic activities(Vairavan et al. 1997).Yield attributes: Pods per plant increased significantly withthe superimposition of 50% ON with IN over rest of thetreatments envisaging it as an important harvest attribute

contributing towards realization of higher seed yield. Similarly,seeds/pod and 100 seed weight also showed significantimprovement with variation in fertility levels due to abovefactors over control (Table 1). As field pea is mainly grownunder irrigated condition, the beneficial effect of vermicompostwith inorganic fertilizers is envisaged by a greater and longeravailability of nutrients as per crop demand (Khanda andMohapatra 2003). Pods/plant and seeds/pod were alsoinfluenced significantly following seed inoculation overcontrol except 100 seed weight. This might be attributed toincreased nodulation and biological N fixation, moresolubilization of native P and production of secondarymetabolites by the bacteria (Srivastava and Ahlawat 1995).Zinc application although improved yield attributes, yet itwas on par with application of biofertilizers alone.Seed Yield: Both seed and straw yield increased significantlyfollowing integrated nutrient management with IN + 50% ON(Table 1). The trend observed for yield attributes perpetuatedto build up the final outcome in terms of seed yield. Further,the same fertility level also facilitated a greater economic sinkcapacity as the yield had a highly significant correlation withyield attributes (Kushwaha 1994). Even though the dose ofapplied N was same in both IN and ON applied plots, yetlower seed yields were recorded in ON applied plots. It wasbecause of the fact that vermicompost (ON) alone probablycould not provide all the necessary nutrients in adequatequantities at critical stages for proper growth and developmentof field peas. On the contrary, the above INM did provide.Even harvest index was found significant over control withmaximum value of 41.37% at IN + 50% ON. This envisagessimilar rate of partitioning of dry matter under different fertilitylevels (Bansal 2009). Application of both biofertilizers andzinc significantly increased seed and straw yield over control.Combined application of biofertilizers and zinc might have asynergistic effect which enhanced nitrogenase activity and

Table 1. Growth, yield attributes, seed yield and harvest index of field pea as influenced by integrated nutrient management(Pooled for 2 years)

Growth and yield attributes Yield and harvest index

Treatments Height (cm) Branches/

plant Dry matter /plant (g)

Pods/ plant

Seeds/ pod

100-seed weight (g)

Seed yield/

plant (g)

Straw yield

/plant (g)

Seed yield

(kg/ha)

Straw yield

(kg/ha)

Harvest index (%)

Fertility level

Control 45.31 3.22 25.15 8.41 3.90 18.79 6.81 16.94 889 1514 37.01 IN 49.04 4.73 30.61 11.86 5.29 20.07 11.19 19.44 1510 2231 40.36 ON 48.12 3.97 27.14 10.76 4.08 19.51 9.37 17.73 1340 1999 40.13 IN + 50% ON 51.88 5.34 34.87 15.26 5.46 20.52 12.81 22.12 1717 2430 41.37 ON + 50% IN 51.39 4.78 31.68 12.67 5.08 19.94 11.25 20.43 1540 2263 40.49 SEm (±) 1.12 0.018 0.327 0.315 0.08 0.101 0.13 0.14 14 15.3 0.217 CD (P=0.05) NS 0.06 0.98 0.95 0.24 0.30 0.39 0.43 43 46 0.65 Biofertilizers + micronutrient Control 47.39 4.26 28.24 10.44 4.25 19.69 9.32 17.95 1304 1978 39.53 Biofertilizers 49.86 4.40 30.22 11.72 4.91 19.94 10.29 19.35 1387 2081 39.75 Zn (5 kg/ha) 48.24 4.40 29.10 11.51 4.79 19.46 10.30 19.36 1408 2107 39.81 Biofertilizers+Zn 51.1 4.56 32.00 13.49 5.10 19.99 11.23 20.67 1498 2184 40.38 SEm (±) 2.18 0.008 0.113 0.134 0.10 0.12 0.059 0.128 6.5 9.4 0.141 CD (P=0.05) NS 0.024 0.32 0.38 0.29 0.34 0.17 0.36 18 26 0.40 IN= NPK through inorganic fertilizers; ON= N through Vermicompost; Biofertilizers= Rhizobium + PSB +PGPR

Kumari et al. : Effect of integrated nutrient management on growth, seed yield and economics of field pea 123

in turn supplied more N by fixation for better growth andincreased yield in the field pea. Application of Zinc alsoincreased seed yield probably due to its influence on auxinsynthesis, nodulation and N fixation (Sinha et al. 2001).

Interaction effects of fertility level (vermicompost andinorganic nutrient) with biofertilizers and zinc on seed yield offield pea were significant (Table 2). It was evident thatapplication of 50% ON (50 % N through vermicompost)integrated with IN (recommended inorganic fertilizers),biofertlizers and zinc increased seed yield by 38.74% overapplication of IN alone. Higher microbial population undervermicompost, in addition to the specific role of Rhizobium,phosphorus solubilizing bacteria and pseudomonas could bethe possible reason for a favourable effect of integratedapplication (of vermicompost, inorganic fertilizers, biofertilizersand zinc) on seed yield of field pea (Singh and Rai 2004).Similar results were also reported by Singh and Pareek (2003)in mungbean.Economics: Integrated fertility level viz., IN + 50% ON alsoproduced higher net return and B:C ratio over other fertilitylevels (Table 3).This is in confirmity with the results obtainedby Khan et al. 2009. Similarly, biofertilizers + micronutrient(Zinc) resulted in higher net return and B: C ratio. Thus,integrated nutrient management involving IN and 50% ONcombined with biofertilizers + Zn was the most remunerativefor field pea.

Soil fertility: The treatment viz., IN+ 50% ON also showedsignificantly higher soil organic carbon (SOC) after the harvestwhen compared with IN alone (Table 3). This might be due todirect addition of organic matter from vermicompost (Ansariand Kumar 2010). Application of IN + 50% ON was foundbeneficial for improving organic carbon and NPKS and Znstatus of soil over the initial value. Highest available N in soilat harvest was recorded with the treatment that received 100%inorganic fertilizer along with 1.33 t/ha of vermicompost, whichwas closely followed by the application of vermicompost (2.66t/ha) along with 50% inorganic fertilizer (Table 3). Thefavourable soil conditions in vermicompost plots might havehelped in the mineralization of soil nitrogen leading to buildup of higher available N (Ansari and Kumar 2010 and Ansariand Jaikishun 2011). Similarly, significantly higher value of P,K, S and Zn were analyzed with IN blended with 50 % ON(1.33 t/ha of vermicompost) over their initial values. It is alsoreported that vermicompost applied alone or in combinationwith inorganic fertilizers also significantly increased availableK in soil (Vasanthi and Kumaraswamy 1999). Individual orcombined application of biofertilizer and micronutrient alsoincreased the nutrient availability in post-harvest soil whencompared to control. Moreover, in the presence ofvermicompost, the microorganisms in biofertilizer get enoughfood and suitable media to proliferate both in terms of theirnumber and activity. Thus, the increase the organic status ofsoil has also made nutrient available to growing plants.

Table 3. Net return, B: C ratio and soil nutrient status under integrated nutrient management (Pooled for 2 years)

IN=NPK through inorganic fertilizers; ON = N through Vermicompost; Biofertilizers= Rhizobium + PSB + PGPR

Available nutrient (kg/ha) Treatment

Net return (Rs/ha)

B:C ratio SOC (%) N P2O5 K2O S Zn (ppm)

Fertility level Control 23742 1.25 0.405 195.88 19.52 200.43 17.61 0.602 IN 39978 2.12 0.445 205.35 22.18 207.65 18.67 0.649 ON 35506 1.68 0.482 199.70 20.97 203.50 18.25 0.650 IN + 50% ON 45358 2.21 0.491 211.88 24.49 215.66 20.33 0.711 ON + 50% IN 40770 1.84 0.481 207.34 22.71 209.56 18.91 0.666 SEm (±) 834 0.04 0.002 0.111 0.07 0.103 0.021 0.002 CD (P=0.05) 1923 0.09 0.004 0.365 0.24 0.337 0.067 0.005 Biofertilizers + micronutrient Control 22047 1.73 0.438 198.54 20.44 202.8 18.63 0.635 Biofertilizers 24027 1.86 0.458 204.74 22.12 207.23 18.73 0.659 Zn (5 kg/ha) 23980 1.78 0.447 202.29 21.60 204.64 18.78 0.662 Biofertilizers+Zn 26112 1.91 0.499 210.52 23.73 214.73 18.86 0.666 SEm (±) 677 0.03 0.002 0.09 0.062 0.084 0.02 0.001 CD (P=0.05) 1383 0.07 0.004 0.28 0.178 0.244 0.060 0.003 Initial Value - - 0.440 199.18 20.64 211.0 17.59 0.52

Table 2: Interaction effects of integrated nutrient management on field pea seed yield (kg/ha) (Pooled for 2 years)

IN= NPK through inorganic fertilizers; ON= N through Vermicompost; Biofertilizers= Rhizobium + PSB +PGPR

Fertility level Biofertilizers + micronutrient Control IN ON IN + 50% ON ON +50% IN

Control 858 1350 1243 1596 1473 Biofertilizer 878 1484 1326 1705 1544 Zn (5 kg/ha) 882 1584 1362 1694 1519 Biofertilizer+Zn 939 1622 1431 1873 1627 SE m (±) CD (P=0.05) Two sub plot mean at the same main plot 13.5 39 Two main plot means at same or different sub plot 15.8 46


Thus, the study suggests that combined application ofvarious nutrient sources viz., inorganic fertilizer, 50% Nthrough vermicompost, biofertilizers and Zn is beneficial interms of soil fertility and crop productivity.

REFERENCES

Anonymous. 2009. Project Co-ordinator’s Report, All India Co-ordinatedResearch Project on MULLaRP. Pp 16.

Ansari Abdullah Adil and Jaikishun Sirpaul. 2011. Vermicomposting ofsugarcane bagase and rice straw and its effect on Phaseolus vulgarisin Guyana. Current Advances in Agricultural Sciences 3: 20-30.

Ansari Abdullah Adil and Kumar Sukhraj. 2010. Effect of vermiwashand vermicompost on soil parameters and productivity of okra(Abelmoschus esculentus) in Guyana. Current Advances inAgricultural Sciences 2:1-4.

Bansal RK. 2009. Synergistic effect of Rhizobium, PSB and PGPR onnodulation and seed yield of mungbean. Journal of Food Legumes22: 37-39.

Chesnin L and Yien CH. 1950. Turbidmetric determination of availablesulphur. Proceedings of Soil Science Society 15: 149-151.

Hedge DM and Dwivedi BS. 1993. Integrated nutrient supply andmanagement as a strategy to meet nutrient demand. FertilizersNews 38: 49-59.

Kanda CM and Mohapatra BK. 2003. Effects of farmyard manure andinorganic fertilizers on yield and nutrient uptake of seed amaranth(Amaranthus hypochondricus L.). Indian Journal of Agronomy48: 142-144.

Khan Naushad, Tripathi AK and Dubey AP. 2009. Effect of integratednutrient management on productivity and profitability of gardenpea (Pisum sativum L. subsp. hortense) in cereal plain zone of

Uttar Pradesh. Current Advances in Agricultural Sciences 1: 91- 93.

Kushwaha BL. 1994. Response of French bean to nitrogen applicationin north Indian plains. Indian Journal of Agronomy 39: 34-37.

Lindsay WL and Norvell WA. 1978. Development of DTPA soil testfor zinc, iron, manganese and copper. Soil Science Society ofAmerican Journal 42: 421-448.

Scherer HW, Pacyna S, Manthey N and Schulz M. 2006. Sulphursupply to peas (Pisum sativum) influences symbiotic N2 fixation.Plant Soil Environment 52: 72-77.

Singh B and Pareek RG. 2003. Effect of phosphorus and biofertilizerson growth and yield of mungbean. Indian Journal of Pulses Research16: 31-33

Singh R and Rai RK. 2004. Yield attributes, yield and quality of soybean(Glycine max) as influenced by integrated nutrient management.Indian Journal of Agronomy 46: 141-144.

Sinha BK, Hemantranjan A and Chhabra, M L.2001. Yield and yieldcomponent of pea (Pisum sativum L.) as affected by zinc nutrition.Annals of Biology 17: 157-158.

Srivastava TK and Ahlawat IPS. 1995. Response of pea (Pisum sativumL.) to phosphorus, molybdenum and biofertilizers. Indian Journalof Agronomy 40: 630-635.

Vairavan K, Ramasamy M and Srinivasan K. 1997. Studies on the effectof micronutrients in urd bean. Indian Journal of Pulses Research10: 252-253.

Vasanthi D and Kumaraswamy K. 1999. Efficiency of vermicompostto improve soil fertility and rice yield. Journal of Indian Society ofsoil science 47: 268-72.

Yadav RP, Chauhan DVS and Kushwaha HS. 1992. Effect of irrigationphosphorus and row spacing on yield contributing characters of pea(Pisum sativum L.). Indian Journal of Agronomy 37: 617-618.


Effect of time of planting on nodulation, growth and seed yield of kharif urdbeangenotypesGURIQBAL SINGH1, HARI RAM1, H.S. SEKHON1, K.K. GILL2 and VEENA KHANNA1

1Department of Plant Breeding and Genetics and 2Department of Agricultural Meteorology, Punjab AgriculturalUniversity, Ludhiana - 141004, Punjab, India; Email: [email protected](Received: June 23, 2011; Accepted: April 03, 2012)

ABSTRACT

A field investigation was carried out at the Punjab AgriculturalUniversity, Ludhiana during kharif 2005 and 2006 to study theeffect of time of planting (July 5, 15, 25 and August 5) on growth,nodulation and seed yield of three urdbean genotypes (‘KUG114’, ‘KUG 173’ and ‘Mash 338’). Results revealed that plantingurdbean during July 15-25 was optimum under the existingsituation. Delayed planting on August 5 resulted in drasticreduction in seed yield. Nodulation and pods/plant were alsohigher in case of July 15 and July 25 planting over the otherdates of planting. Accumulated growing degree days (GDD)and accumulated photothermal units (PTU) for 50% floweringas well as maturity were highest in July 5 planted crop anddecreased further with delayed planting. Genotype ‘KUG 114’produced 5.9 and 22.2% higher yield over ‘KUG 173’ and ‘Mash338’, respectively. It had also more nodules/plant, dry weight ofnodules/plant and pods/plant over the other two. ‘KUG 114’required more or less higher GDD and PTU over the other twogenotypes to attain 50% flowering and physiological maturity.

Key words: Genotypes, Nodulation, Planting time, Seed yield,Urdbean

Urdbean [Vigna mungo (L.) Hepper] is an importantkharif pulse crop in India. Being a leguminous crop, its dualrole in providing protein-rich seeds and improving soil fertilityby adding nitrogen in the soil is well known. Urdbean is highlysensitive to abiotic stresses and thus, its yield levels areusually low. Time of planting is one of the most importantnon-monetary agronomic factors for realizing the yield potentialof improved varieties as it helps in achieving completeharmony between vegetative and reproductive growth stagesof the crop. Planting the crop at optimum time therefore, playsa key role in obtaining high seed yields (Ihsanullah et al.2002, Dubey and Singh 2006, Rathore et al. 2010). Sincegenotypes of pulse crops do differ in productivity (Rathore etal. 2010), genetic enhancement is a pre-requisite for improvingproductivity of these pulses.

Growing degree days and heat unit requirement areoften used for characterizing thermal responses in crops. InIndia, this concept is being applied to various crops as thesesimplify growth and yield prediction models, needing lessinput data. Temperature along with photoperiod affectsflowering time but temperature along with humidity affects

initiation and normal pod development. It is reported thatinitiation of flowering and start of pod development stagewere influenced by variations in photoperiod (Bhatia et al.1997).

The optimum planting time for urdbean is the firstfortnight of July for central districts and July 15-25 for sub-mountainous districts of Punjab, India (PAU 2010). Thoughlots of data are available on time of planting of urdbean yetinformation is lacking on new and improved genotypes underPunjab conditions. Therefore, the present study was carriedout to assess the effect of time of planting on growth,nodulation, thermal requirement and yield of urdbeangenotypes.


A field study was conducted at the research farm ofPunjab Agricultural University, Ludhiana during Kharif 2005and 2006 on a loamy sand soil under irrigated conditions. Theexperiment was laid out in thrice replicated split plot designby assigning four dates of planting (July 5, 15, 25 and August5) in main plot and three genotypes (‘KUG 114’, ‘KUG 173’and ‘Mash 338’) in sub plot. The soil of the experimental fieldwas low in organic carbon (0.3%), medium in availablephosphorus (16-18 kg P/ha) and available potash (302 kg K/ha). The crop was sown at 30 cm row spacing using a seedrate of 20 kg/ha. A common fertilizer dose of 12.5 kg N and 25.0kg P2O5/ha was applied at planting. The crop received oneirrigation during the growing season in both the years. Theweeds were managed using pendimethalin @ 0.75 kg/ha aspre-emergence. The crop was harvested with sickle andthreshed manually. A rainfall of 399.9 and 446.1 mm werereceived during kharif 2005 and 2006 crop season, respectively.The data on nodulation were recorded 35 days after planting(DAS). The observations on 50% flowering, days to maturity,plant height, branches/plant, pods/plant, seeds/pod, 100-seedweight and seed yield were also recorded.

Agroclimatic indices viz., growing degree days (GDD)and photothermal units (PTU) were accumulated from the dateof planting to 50% flowering and physiological maturity during2005 (Nuttonson 1955) to calculate accumulated indices forGDD (AGDD) and PTU (APTU), respectively.



Effect of planting dates: Plant height, an index of plantgrowth, was significantly influenced by planting dates (Table1). Significantly taller plants were recorded in July 5 plantedcrop over all other planting dates. A drastic reduction in plantheight was recorded in August 5 planted crop. It was mainlyattributed to a short growth period as temperature as well asday length declined during September and October. Similarly,branches/plant were on par in three earlier dates of planting(July 5, 15 and 25) and was reduced substantially in August 5planted crop. As a result, one of the major yield attributes viz.,pods/plant was significantly influenced by dates of plantingalthough it was on par only in July 5,15 and 25 planted crop.Seeds/pod was not influenced by planting dates. Plantingdates significantly influenced 100-seed weight as July 25planted crop recorded the highest 100-seed weight which washowever, on par with July 15 and August 5.

During both the years, nodule number and its dryweight/plant were the highest in case of July 15 planting date(Table 2). Moreover, bold and pink coloured nodules wereindicative of higher leghaemoglobin pigments accompaniedwith higher N-fixation activity. Nodulation was reducedsignificantly following delayed planting. During 2005,although maximum seed yield was obtained in the case of July25 planting yet it was similar at July 15 planting. Planting onJuly 5 also produced significantly lower yield than in July 15and 25 while there was a drastic reduction in yield when cropwas sown beyond it (August 5). During 2006, seed yields

were similar when urdbean was sown on July 5, 15 or 25 andplanting beyond July (August 5) yielded the minimum. On anaverage (for two years), planting on August 5 yielded 33.5%lower yield than that on July 15 and 25. Higher seed yieldsrealized in case of July 15 and 25 planted crops were becauseof higher number of pods/plant and 100-seed weightassociated with a more stronger sink during this period. Underlate sown conditions of August 5, the plant however, couldnot accumulate sufficient photosynthates due to poorvegetative growth. Higher yields of existing varieties whenplanted during July were also reported by Singh and Singh2000, Ihsanullah et al. 2002, Dubey and Singh 2006 and Rathoreet al. 2010.

Accumulated agroclimatic indices i.e. growing degreedays and photothermal units computed for urdbean genotypesunder different dates of planting also indicated that days takento 50% flowering and physiological maturity, in general,decreased as the planting was delayed (Table 3). Ihsanullahet al. (2002) also observed similar effects on mungbeanmaturity by different dates of sowing. In early sown (July 5)crop, higher agroclimatic indices (AGDD and APTU) wererequired for the crop to attain 50% flowering and maturity.Similarly when planting was delayed further (Aug 5),comparatively lower agroclimatic indices were calculated.Performance of genotypes: Genotype ‘KUG 114’ was tallestof all the genotypes (Table 1) although these genotypes didnot differ in branching habit. However, pods/plant weresignificantly higher in ‘KUG 114’ than in ‘Mash 338’ whereas

Table 2. Effect of date of planting on nodulation and seed yield of urdbean genotypes

*Not recorded

Treatment Nodules/plant Nodule dry weight (mg)/plant Seed yield (kg/ha) 2005 2006 Mean 2005 2006 Mean 2005 2006 Mean Dates of planting July 5 27.5 26.0 26.8 98.3 92.4 95.4 1079 1412 1246 July 15 28.7 29.3 29.0 119.4 111.3 115.4 1246 1463 1355 July 25 NR* 20.3 20.3 NR* 84.5 84.5 1287 1421 1354 August 5 13.4 12.0 12.7 58.3 73.7 66.0 866 936 901 CD (P=0.05) 1.2 3.1 28.9 4.1 97 256 Genotypes KUG 114 23.7 24.0 23.9 102.0 96.3 99.2 1239 1396 1318 KUG 173 23.6 21.2 22.4 93.8 91.7 92.8 1090 1398 1244 Mash 338 21.8 20.5 21.2 80 83.5 81.8 1029 1127 1078 CD (P=0.05) 1.2 1.7 - 9.5 4.5 76 121

Table 1. Effect of planting dates and genotypes on growth and yield attributes of urdbean (mean of 2 years)

Treatment Plant height (cm) Branches/plant Pods/ plant Seeds/pod 100-seed weight (g) Dates of planting July 5 45.9 6.5 22.9 6.4 3.51 July 15 43.0 7.2 23.7 6.4 3.68 July 25 36.9 6.8 23.9 6.2 3.80 August 5 27.5 3.4 13.5 6.2 3.74 CD (P=0.05) 2.7 0.9 3.1 NS 0.23 Genotypes KUG 114 40.2 6.1 22.5 6.5 3.66 KUG 173 36.4 5.7 20.6 6.3 3.78 Mash 338 38.3 6.1 19.9 6.3 3.62 CD (P=0.05) 2.0 NS 2.1 0.1 0.14

Singh et al. : Effect of time of planting on nodulation, growth and seed yield of kharif urdbean genotypes 127

‘KUG 114’ recorded significantly higher seeds/pod over othertwo genotypes. ‘KUG 173’ recorded the highest 100-seedweight which was significantly higher than in ‘Mash 338’.

Nodule number and its dry weight/plant weresignificantly higher in ‘KUG 114’ than in ‘Mash 338’ (Table 2).During 2005, the highest seed yield was recorded in ‘KUG114’ and was significantly superior to ‘KUG 173’ and ‘Mash338’. However, during 2006, ‘KUG 114’ and ‘KUG 173’ were onpar with respect to seed yield; yet were significantly higherover ‘Mash 338’. On an average (for two years), ‘KUG 114’gave 22.2 and 5.9% higher seed yield than ‘Mash 338’ and‘KUG 173’, respectively. Urdbean genotypes do differ in planttraits and productivity (Dubey and Singh 2006, Rathore et al.2010) and higher yields could be due to better agronomictraits and/or resistance to diseases (Kaur et al. 2010).Interaction effect between dates of planting and genotypewas non-significant in respect of seed yield.

Among the genotypes, ‘KUG 114’ required higheragroclimatic indices over ‘KUG 173’ and ‘Mash 338’ to attain50% flowering and physiological maturity. At physiologicalmaturity, in general, earlier sown crop had more AGDD andrecorded more APTU than that in late sown crop for all thegenotypes.

It can be inferred from this two-year study that underPunjab conditions the optimum time of planting of urdbeanduring kharif season is July 15-25. Improved urdbeangenotypes ‘KUG 114’ and ‘KUG 173’ were found promisingover ‘Mash 338’.

Table 3. AGDD and APTU for various genotypes of urdbean sown on different dates during 200550% flowering Physiological maturity Genotype Date of planting

DAS AGDD (oC day)

APTU (oC day hour)

DAS

AGDD

(oC day) APTU

(oC day hour) 5 July 45 925 12666 80 1593 21106 15 July 43 899 12138 78 1548 20183 25 July 42 876 11613 70 1379 17763

KUG 114

5 August 37 755 9832 71 1341 16830 5 July 46 947 12950 79 1575 20885 15 July 43 899 12138 76 1513 19763 25 July 40 835 11091 72 1413 18164

KUG 173

5 August 37 755 9832 71 1341 16830 5 July 43 885 12138 76 1517 20189 15 July 43 899 12138 74 1476 19323 25 July 40 835 11091 70 1379 17763

Mash 338

5 August 36 736 9596 73 1371 17178

REFERENCES

Bhatia VS, Manglik P, Bhatrigar PS and Guruprasad KN. 1997. Variationin sensitivity of soybean genotypes to varying photoperiods inIndia. Soybean Genetics Newsletter 14: 99-103.

Dubey SC and Singh B. 2006. Influence of sowing time on developmentof cercospora leaf spot and yellow mosaic diseases of urdbean (Vignamungo). Indian Journal of Agricultural Sciences 76: 766-769.

Ihsanullah, Jan A, Taj FH, Khan IA and Khan N. 2002. Effect of sowingdates on yield and yield components of mashbean varieties. AsianJournal of Plant Science 1: 622-624.

Kaur L, Gill KK, Cheema HK, Dhaliwal LK, Sirari A and Kingra PK.2010. Meteorological factors attributing yellow mosaic virusseverity on greengram. Indian Journal of Agricultural Sciences 80:1007–1009.

Nuttonson MY. 1955. Wheat climate relationships and use of phenologyin ascertaining the thermal and photothermal requirements of wheat,American Institute of Crop Ecology, Washington DC. 388 pp.

PAU. 2010. Package of Practices for Kharif Crops of Punjab, PunjabAgricultural University, Ludhiana 141 004, Punjab, India.

Rathore SS, Dshora LN and Kaushik MK. 2010. Effect of sowing timeand fertilization on productivity and economics of urdbeangenotypes. Journal of Food Legumes 23: 154-155.

Singh DK and Singh VK. 2000. Growth and nitrogen uptake pattern ofpromising urdbean genotypes under different sowing dates and plantdensities during rainy season. Annals of Agricultural Research 21:456-458.


Feasibility studies in transplanted pigeonpea + soybean intercropping systemV.V. GOUD and A.S. ANDHALKAR

Pulses Research Unit, Dr. Panjabrao Deshmukh Krishi Vidyapeeth, Akola-444104, Maharashtra, India;E-mail: [email protected](Received: March 17, 2012; Accepted: May 19, 2012)

ABSTRACT

An investigation was carried out during kharif 2010-11 underrainfed condition to study the feasibility of transplanting ofvarying age pigeonpea seedling under sole and intercroppingwith direct sown soybean (6:1) at Pulses Research Unit, Dr.Panjabrao Deshmukh Krishi Vidyapeeth, Akola. Individualpigeonpea seedling transplanted under sole as well asintercropped with soybean showed positive effect on variousagronomic traits such as stem diameter, number of branches,biomass, pods and grain weight/plant over direct sown plants.Sole transplanting of varying age pigeonpea seedling recordedsignificantly higher pigeonpea equivalent yield (2206 kg/ha)over direct sown sole crop (1747 kg/ha). However, higher netreturn was recorded with direct sown sole pigeonpea (Rs 50737/ha) with B:C ratio 3.92 over sole transplanting of varying ageof pigeonpea seedling (Rs 35159/ha with B:C ratio 1.69).Soybean + transplanted pigeonpea (6:1) with varying age ofseedling produced significantly higher pigeonpea equivalentyield (2153 kg/ha) compared to direct sown soybean+ pigeonpea(1614 kg/ha). Soybean + transplanted pigeonpea with varyingage gave higher returns (55765 kg/ha) over direct sownpigeonpea + soybean (Rs 49259/ha). Highest land equivalentratio was recorded with transplanting varying age of pigeonpeaseedling intercropped with soybean. Transplanting varying ageof pigeonpea seedling also found more competitive than soybeanas evident from aggressivity and competitive ratio. Soil fertilitystatus after harvest of transplanted pigeonpea intercropped withsoybean and their sole cropping did not show depletion frominitial status.

Key words: Competitive indices, Economics, Land equivalentratio, Nutrient uptake, Pigeonpea transplanting, Soilfertility, Soybean

Pigeonpea with soybean intercropping system isdominant in Maharashtra. However, soybean reduces growthand yield of pigeonpea in intercropping system because ofhigher competitive ability of soybean over pigeonpea as theformer has a faster vegetative growth during early stage (Billoreet al. 2009). Moreover, terminal moisture stress duringreproductive stage further declines pigeonpea productivity.In order to ensure timely sowing due to late onset of monsoon,transplanting of pigeonpea seedlings may be one of theagronomic measures to overcome delayed sowing. Thistechnique involves raising of seedlings in the polythene bagsin nursery and transplanting these seedlings in the main field

after certain age. As established seedlings, these pick upgrowth quickly under field condition and can be morecompetitive. Keeping above in view, a trial was carried out tostudy the feasibility and economics of transplanted pigeonpeaunder standard field condition.


A field experiment was conducted at Pulses ResearchUnit, Dr. Panjabrao Deshmukh Krishi Vidyapeeth, Akola duringkharif 2010-11 to evaluate the performance of transplantedpigeonpea, PKV TARA (TAT-9629) with varying age ofseedling under both sole and intercropping with soybean.The medium clayey soil was alkaline (pH 8.11), medium inorganic carbon (0.44%), available N (235 kg/ha), available P(18.88 kg/ha) and available K (383 kg/ha). Nine treatmentsviz., transplanting 2 week old pigeonpea seedling (WOPS) asan intercrop in soybean, transplanting 3 and 4 WOPS insoybean + pigeonpea, direct sowing of pigeonpea in soybean+ pigeonpea, transplanting 2, 3 and 4 WOPS as a sole crop,direct sowing of sole pigeonpea and sole soybean were takenin a randomized block design with four replications. Seeds ofpigeonpea were sown on 17 June, 24 June and 30 June 2010 inpolythene bags of 6 x 8”, 7 x 12” and 7 x 16” size, respectively,with 3/4th portion of bags filled with soil and transplanted on10 July 2010. After germination, only one seedling per bagwas maintained by thinning at 10 days after sowing (DAS).On the day of transplanting, varying age of pigeonpeaseedlings were transplanted and seeds were also directly sownat 5 cm depth at 90 x 20 cm. Amongst pigeonpea + soybeansystems, both the crops was sown at a row spacing of 45 cmwhile plant to plant spacing was maintained at 20 cm forpigeonpea and 10 cm for soybean (JS-335). The row ratio forsoybean + pigeonpea intercropping is 6:1. Recommended doseof fertilizers for pigeonpea (N:P2O5::25:50 kg/ha) and soybean(N:P2O5::30:75 kg/ha) were applied at sowing. Normalagronomic practices recommended for the crop and plantprotection measures were adopted as and when needed. Thetotal rainfall received during the crop growth was 100.65 cm in43 rainy days. Growth and yield components were recorded inthe five randomly selected plants. Net returns were calculatedby deducting cost of cultivation from gross returns. The B:Cratio was worked out as a ratio of gross returns to cost ofcultivation. Competitive indices, nutrient uptake and soilfertility status were also taken following standard procedures.

Goud and Andhalkar : Feasibility studies in transplanted pigeonpea + soybean 129


Seed yield and economics: In the present investigation,growth and yield parameters of transplanted pigeonpea suchas per plant dry matter accumulation, branches, stem girth,pods/plant, seed weight/plant and 100-seed weight wereinfluenced significantly over direct sowing due to enhancedphotosynthetic activity and efficient transfer of metabolitesin the seed with the resultant increase in 100-seed weight(Table 1).

Comparison made amongst varying age pigeonpeaseedling revealed numerically higher net return and BCR wereobtained with either transplanting of 2 WOPS (Rs 56595/haand 3.05) or 3 WOPS (Rs 56259/ha and 3.00) over 4 WOPS (Rs54441/ha and 2.89). However, direct sowing of sole crop ofpigeonpea recorded significantly higher net return and BCR(Rs 50737/ha and 3.92) over sole crop of transplantedpigeonpea (Rs 35159/ha and 1.69). Similar result was obtainedby Pavan et al. (2009).

Table 2. Competition functions in soybean + pigeonpea intercropping system

TP- Transplanting; WOPS-Week old pigeonpea seedling

Relative crowding coefficient (RCC) Competitive ratio Aggressivity Treatment

LER Pigeon pea (Kh)

Soy bean (Ki)

System (K=Kh x Ki) Pigeon pea Soy bean

Pigeonpea Soybean

TP 2 WOPS + Soybean (1:6) 1.28 2.64 4.76 12.57 0.98 -0.98 1.87 0.54 TP 3 WOPS + Soybean (1:6) 1.25 2.58 2.63 6.79 0.99 -0.99 1.89 0.53 TP 4 WOPS + Soybean (1:6) 1.22 2.88 1.29 3.72 1.21 -1.21 2.17 0.46 Direct sown soybean + pigeonpea 1.02 1.18 0.96 1.13 0.16 -0.16 1.16 0.86

Direct sown sole pigeonpea 1.00 -- -- -- -- -- -- -- Sole sown soybean 1.00 -- -- -- -- -- -- --

Table 1. Effect of different age of pigeonpea seedlings on productivity, ancillary parameters and monetary advantage undersoybean + pigeonpea intercropping system


Pigeonpea growth traits Pigeonpea yield traits

Treatment Dry

matter accumulation (g)

branches/

plant

Plant height at branch

initiation (cm)

Stem diameter

(mm)

pods/ plant

Seed weight/ plant (g)

100- seed wt. (g)

Soybean yield

(kg/ha)

Pigeonpea yield

(kg/ha)

Pigeonpea equivalent

yield (kg/ha)

CC (Rs/ha)

Gross monetary

return (Rs/ha)

Net return

(Rs/ha)

B:C ratio

TP 2 WOPS as sole crop 138.7 21.9 29.6 41.8 133 31.5 9.3 -- 2080 2080 48887 81120 32233 1.66 TP 3 WOPS as sole crop 149.7 24.2 25.9 44.6 156 34.3 9.4 -- 2256 2256 50601 87984 37383 1.74 TP 4 WOPS as sole crop 198.0 26.0 19.5 47.4 164 35.1 9.6 -- 2281 2281 53088 88959 35871 1.68 Direct sown sole pigeonpea 88.2 18.2 31.5 36.2 121 25.9 8.9 -- 1747 1747 17396 68133 50737 3.92 TP 2 WOPS + soybean (6:1) 132.4 20.5 26.5 40.7 156 34.2 10.3 2541 660 2159 27606 84201 56595 3.05 TP 3 WOPS + soybean (6:1) 140.4 22.4 25.6 40.7 175 37.3 10.3 2470 707 2163 28098 84357 56259 3.00 TP 4 WOPS + soybean (6:1) 172.6 25.3 16.6 42.2 184 39.8 10.0 2319 769 2136 28863 83304 54441 2.89 Direct sown soybean+ pigeonpea 82.9 15.3 36.1 36.2 80 15.6 9.5 2227 301 1614 13687 62946 49259 4.60

Sole sown soybean -- -- -- -- -- -- -- 2635 -- 1554 16500 60606 44106 3.67 S.Em (+) 3.09 0.2 0.5 0.5 4.4 1.6 0.1 115 74 67 -- 3302 3302 -- CD (P = 0.05) 9.09 0.7 1.5 1.5 13.4 4.8 0.35 NS 222 196 -- 9637 9637 -- CV% 5.6 7.7 3.2 3.2 5.3 8.6 2.4 9.4 9.4 7.0 -- 13.3 13.3 --

Pigeonpea equivalent yield (PEY) was influencedsignificantly with respect to transplanting of pigeonpeaseedlings in sole and intercropping system. Transplantingvarying age pigeonpea seedling intercropped with soybean(6:1) and their sole cropping recorded significantly higher PEYover direct sowing both under intercropping and solecropping situations. Transplanting varying age pigeonpeaseedling as an intercrop and their sole crop recorded 25 and21% increased in PEY respectively, over direct sowing.However, significantly higher net return was recorded withtransplanting varying age pigeonpea seedling intercroppedwith soybean (Rs 55765/ ha) over direct sowing (Rs 49259/ha)although benefit cost ratio (BCR) was higher with the latter(4.60) over the former due to high transplanting cost ofpigeonpea.

Land equivalent ratio: Biological efficiency of land inintercropping system measured through land equivalent ratio(LER) varied from 1.02 to 1.28 due to varying age of pigeonpeaseedling. Thus, production efficiency of intercropping washigher as compared to sole soybean/pigeonpea and directsowing of pigeonpea intercropped with soybean.Transplanting of varying age pigeonpea seedling intercroppedwith soybean also recorded superiority over direct sowing ofpigeonpea intercropped with soybean and their sole croppingin terms of LER. As the highest LER was obtained withtransplanting varying age of pigeonpea seedling intercroppedwith soybean (1.25) and the lowest one with direct sowing ofpigeonpea + soybean (1.02), it was inferred that for the sameseed yield, 25% more area would be required under solitarysystem compared to intercropping situation.


Competition functions: The values of relative crowdingcoefficient (RCC) for the component crops were higher thanunity indicating yield advantages under intercropping exceptin direct sown pigeonpea intercropped with soybean (Table2). Similarly, the product of relative crowding coefficient ofcomponent crops was more than unity in all intercroppingtreatments revealing non-competitive interference than thecompetitive one. The highest value of system RCC obtainedunder transplanting of 2 WOPS + soybean (12.57) followedby that of 3 WOPS + soybean (6.79) indicated bettercompatibility of both the crops and higher yields. The lowestRCC recorded with direct sowing of pigeonpea + soybean(1.13) showed more competition for nutrients between cropsresulting in lower yields. RCC values also decreased withincrease in age of pigeonpea seedling transplanted. Thus,transplanting either of 2 or 3 WOPS + soybean should bepreferred over rest of the two intercropping systems.Aggressivity values of intercropping were also greater thanzero indicating yield advantage over sole cropping. Negativevalues of aggressivity under soybean showed dominance ofpigeonpea over soybean. Transplanting of varying agepigeonpea seedling as an intercrop with soybean showeddominance of pigeonpea over direct sown crop and was moreevident in transplanting of 4 weeks old seedling. Thus,transplanted pigeonpea was more competitive than soybeanunder both intercropping and sole cropping over direct sownpigeonpea intercropped with soybean as was evident withhigher values of competitive ratio (CR) and positiveaggressivity. The competitive ability of pigeonpea was highestwith transplanting of 4 weeks old seedling as an intercropwith soybean (2.17) over that of 2 and 3 WOPS. In all theintercropping treatments, higher CR in pigeonpea showed itsdominance over soybean. These results confirmed thefindings of Padhi et al. (2010) and Maitra et al. (2001).Nutrient Uptake: Transplanting varying age of pigeonpeaseedling intercropped with soybean and their sole croppingrecorded significantly higher uptake of N, P and K over theirrespective direct sown crop. Among intercropping, varyingage of pigeonpea seedling with soybean recorded highernutrient uptake with 4 WOPS both as a sole crop orintercropped with soybean, and the trend increased with

increasing age of seedling. Nutrient uptake also increasedwith increasing age of transplanted pigeonpea intercroppedwith soybean. Transplanting 3 and 4 WOPS as an intercropwith soybean and their sole cropping recorded significantlyhigher uptake of nutrients over direct sown soybean +pigeonpea and sole direct sown pigeonpea, respectively.Soil fertility status: Significant differences were observed insoil chemical properties except for soil pH. Soil organic carbon(SOC) had shown a significant improvement undertransplanting varying age of pigeonpea seedling grown assole and intercrop with soybean over their direct sowncounterparts. Transplanting 4 WOPS under both sole andintercropping recorded significantly higher SOC over the restof treatments. Similar was the trend for soil available N, P andK. Numerically higher soil available N, P and K were recordedunder transplanting 4 WOPS in sole and intercropping overtheir respective direct sown treatments.

From the above it was inferred that performance oftransplanted pigeonpea seedling was superior whenintercropped with soybean and their sole cropping ascompared to direct sown crop under rainfed condition.However, on economic front direct sown pigeonpea undersole and intercropping with soybean proved advantageousover transplanted pigeonpea.

REFERENCES

Billore SD, Vyas AK and Joshi OP. 2009. Effect of integrated nutrientmanagement in soybean (Glycine max L.) and pigeonpea (Cajanuscajan L.) intercropping on productivity, energy budgeting andcompetition functions. Journal of Food legumes 22: 124-126.

Maitra S, Ghosh D, Sounda G and Jana PK. 2001. Performance ofintercropping legumes in finger millet (Eleusine coracana) at varyingfertility levels. Indian Journal of Agronomy 46: 38-44

Padhi AK, Panigrahi RK and Jena BK. 2010. Effect of planting geometryand duration of intercrops on performance of pigeonpea+fingermillet intercropping systems. Indian Journal of AgricultureResearch 44: 43-47.

Pavan AS, Nagalikar VP, Halepyati AS and Pujari BT 2009. Effect ofplanting on the yield, yield components and economics oftransplanted pigeonpea. Karnataka Journal of Agriculture Science22: 433-434.

Table 3. Total nutrient uptake and soil properties after harvest of pigeonpea as influenced by different treatments


Nutrient uptake (kg/ha) Available nutrients (kg/ha) Treatment

N P K pH EC

(dSm-1) O C (%) N P K

TP 2 WOPS as sole crop 94.5 17.6 43.6 8.18 0.42 0.52 241 20.5 394 TP 3 WOPS as sole crop 110.5 19.9 49.1 8.25 0.41 0.53 243 21.1 395 TP 4 WOPS as sole crop 119.1 20.6 50.8 8.30 0.42 0.54 245 21.3 397 Direct sown sole pigeonpea 77.2 15.4 38.3 8.12 0.43 0.52 238 20.0 393 TP 2 WOPS + soybean (6:1) 34.8 7.2 18.0 8.17 0.42 0.55 250 20.7 401 TP 3 WOPS + soybean (6:1) 43.7 8.9 21.9 8.22 0.42 0.56 254 20.9 403 TP 4 WOPS + soybean (6:1) 50.5 9.6 23.7 8.27 0.41 0.57 257 21.1 404 Direct sown soybean+ pigeonpea 17.7 4.2 10.7 8.17 0.42 0.54 245 20.6 400 Sole sown soybean -- -- -- 8.20 0.42 0.55 252 20.5 399 SEm (±) 3.61 0.73 1.71 0.03 0.004 0.005 3.91 0.03 0.31 CD (P = 0.05) 10.63 2.17 5.04 N.S. N.S. 0.015 11.41 0.11 0.92 Initial status -- -- -- 8.11 0.41 0.44 235 18.8 383


Performance evaluation of mechanical planters for planting of chickpea andpigeonpeaM.K. SINGH, NARENDRA KUMAR, PRASOON VERMA and S.K. GARG

Division of Crop Production, Indian Institute of Pulses Research, Kanpur - 208 024, Uttar Pradesh, India; E-mail:[email protected](Received: February 8, 2012; Accepted: May 29, 2012)

ABSTRACT

Pulse productivity is significantly affected by poor emergence,lack of uniformity and difficulty in achieving target populationand weed infestation. Commercial sowing equipments such asseed drill and seed-cum-fertilizer drill operated by animal,power tiller and tractor, meter high and non-uniform seed ratecausing thinning as an extra operation. Under this situation, acommercial bed planter and CIAE inclined plate planter wereevaluated for planting of chickpea and pigeonpea to assess theirsuitability. The commercial and CIAE incline plate planterhave resulted in a mean plant spacing of 115 mm and 136 mm,respectively for Kabuli chickpea against the set spacing of 100mm. The missing and multiple seed percentage were 15.3%and 7.7% for commercial bed planter as compared to 27.2% and9.1% in CIAE inclined plate planter, respectively. Uniform depthof seed placement was obtained for both the planters whichwere within the permissible range of 50-60 mm for chickpeaand pigeonpea.

Key words: Broadcasting, Dibbling, Planter, Seed drill, Sowingequipment

Mechanization in pulses helps timely completion of fieldoperations, adds to the efficiency of the farmers in performingfield operations and economizes cost of cultivation. Dubeyet al. (2011) revealed that there was increasing trends in theproductivity and profitability of pulses due to varioustechnological interventions. Use of animal or tractor drawnseed drill for pulses has enabled farmers to cover large areasin a short period very economically. However, the seed rate insowing with the seed drill is quite high and thinning becomesessential to maintain the optimum plant stand and to ensureeach plant get the desired quantity of sunlight, water andnutrients. This could be achieved by planting of differentsizes of seeds with the help of appropriate planters (Kepneret al. 1987). It has been reported that planters provide desiredplant population with uniform plant spacing and depth ofoperation, which results in uniform crop stand and hence,reduced cost of cultivation is achieved due to elimination ofthinning operation as well as savings of seed and fertilizer(Pandey 2009).

A tractor-drawn pneumatic precision planter developedat CIAE Bhopal has worked satisfactorily for singulation ofdifferent types of seed with the help of aspirator blower whichprovided the negative pressure in the seed metering disc,

which has cell to pick up and release the seed at predeterminedposition in the field (Yadav and Yadav 1987). Kathirvel et al.(2001, 2005) have evaluated the planters for cotton crop. Theyobserved that the planting operation with ridger seeder,pneumatic planter and cultivator seeder resulted 44.00, 42.85and 41.64% saving in cost, respectively, when compared toconventional method. Singh et al. (2005) evaluated a tractoroperated pneumatic planter for planting cotton, groundnutand mustard seeds in black soil using metering disc with 120degrees entry cone angle on 2.5 mm seed hole for cotton, 120degrees entry cone angle on 4.5 mm seed hole for groundnutand 90 degrees entry cone angle on 1.5 mm seed hole formustard seed, respectively. They found that the variability inseeds/plant spacing for cottonseeds (25.07 and 29.82 cm),groundnut seeds (10.05 and 12.36 cm) and mustard seeds(10.91 and 13.58 cm) obtained in the laboratory and fieldconditions, respectively, could not be compared as thevariability in field condition included variation in plant spacingdue to vibration of machine and seed viability. Keeping inview of these developments, CIAE inclined plate planter anda commercial bed planter were field evaluated for theirsuitability to pulse crops viz., pigeonpea and chickpea.


Two available models of tractor drawn planters, namely,bed planter (ASS model) and inclined plate planter (CIAEmodel) were used for planting of pulses. These two implementswere selected for the field performance evaluation. Descriptionand specification of the planters are as under:a. Bed planter (ASS model): The tractor drawn bed planterfrom ASS Foundry and Agricultural Works, Amritsar wasdeveloped for tractor of 35 to 45 hp range. The unit consistedof a raised bed forming mechanism and a planter (Fig. 1A) toplace two rows of seeds on a bed in one pass. Seeds sown onthe raised bed facilitate better root growth and yieldenhancement. The furrows formed are used for irrigationpurpose and removal of excess water. The planter consistedof inclined disc type seed metering mechanism, three ridgers,ground wheel, chain and sprocket drive for transmitting powerfrom ground wheel to the seed metering and placement device.A separate fertilizer box with fertilizer metering mechanismand drive from ground wheel is provided. It is suitable forsowing of maize, peas, pulses, groundnut etc. Thespecifications of the unit are shown in Table 1.


assemblies are adjustable for row-to-row spacing and work asa modular unit for sowing of each row. The drive to seedmetering mechanism is transmitted from ground drive wheelthrough chain and sprockets. The ground drive wheel andpower transmission system are fixed on the main frame. It issuitable for planting groundnut, gram, soybean, mustered etc.Row-to-row distance can be adjusted and planting of differentseeds in different rows is also possible. The effective fieldcapacity and field efficiency were 0.45- 0.65 ha/h and 70-75%,respectively (CIAE 2010). The specifications of the unit areshown in Table 2.

b. Inclined plate planter (CIAE model): A tractor mountedsix row inclined plate type planter was developed at CIAE,Bhopal (Fig. 1B). It consists of a main frame with tool bar, seedboxes, furrow openers and ground drive wheel system. Theplanter is provided with six seed boxes of modular designwith independent inclined plate type seed meteringmechanism. The shoe type furrow openers are mounted ontool bar of main frame through clamps. The seed boxes arebolted to the furrow openers and seed box-furrow opener

Table 1. Specification of tractor drawn Bed planter (ASS model)Particulars Specification Over all dimensions (LxBxH), mm 2400x1750x1100 Weight, kg 260 Source of power 35-45hp tractor Row spacing, mm 6 rows, 250-450 (Adjustable) Plant spacing in rows, mm 150-300 (Adjustable) Field capacity, h/ha 2 - 2.5 Type of seeds used Small and bold seeds Nominal working width, mm 1350-1800 (Adjustable) Depth of planting, mm 30-150 (Adjustable) Type of seed metering mechanism Inclined disc driven by ground

wheel through chain-sprocket and bevel gears

Furrow opener and closer Shovel type furrow openers, plastic tubes convey the seeds to the boot

Table 2. Specification of tractor drawn CIAE Inclined PlatePlanter

Particulars Specification Over all dimensions (LxBxH), mm

2500x1215x1010

Weight, kg 210 Source of power 35 hp or above, Tractor Row spacing, mm 6 rows, 250-450 (Adjustable) Plant spacing in rows, mm 150-300 (Adjustable) Field capacity, h/ha 2 - 2.5 Type of seeds used Small and bold seeds Nominal working width, mm 1350-1800 (Adjustable) Depth of planting, mm 30-150 (Adjustable) Type of seed metering mechanism

Inclined plate, spiked ground wheel drives the seed plates through chain-sprocket and bevel gears

Furrow opener and closer Shoe type furrow opener, plastic tubes convey the seeds to the boot

The field evaluation of the planters was done at theMain Research Farm of Indian Institute of Pulses Research,Kanpur, India during 2010-11. The climate is tropical sub-humid, receives annual rainfall of 722 mm and mean annualmaximum and minimum temperature is 33.0 and 20.00Crespectively. The soils of experimental site comes undertaxonomical class Typic ustochrept with sandy loam texture

Table 3. Field conditions under which performance testsconducted

Test condition Particulars (a) Condition of seed Name of seed Shape of seed Weight of 100 grains, gm (b) Condition of field Location Length of field, m Width of field, m Type of soil Method of preparation of field (c) Operational parameters of machine Row spacing, mm Plant spacing, mm Depth of seed placement, mm (d) Specification of power source Make and model Rated power hp Control: Manual dibbling

Chickpea (‘IPCK-02’ & ‘IPC-98-4’) and Pigeonpea (‘IPA 203’) Spherical (55, 22) and 12 IIPR, Main Farm 20 9 Sandy loam Cultivator twice and harrow once 250 (Adjustable) 100 50 (Adjustable) Swaraj 855 45

Fig 1. (A) ASS Bed planter, (B) CIAE Inclined plate planter

A

B

Singh et al.: Evaluation of mechanical planters for chickpea and pigeonpea 133

having pH 8.1, bulk density 1.43 g/cc and with low organiccarbon content (2.8 g/kg). The field condition under whichperformance test was conducted is given in Table 3. The seedsof pigeonpea genotype 'IPA-203' and chickpea variety 'IPCK-02' and genotype 'IPC-98-4' were field tested and germinationof these breeder seeds, were more than 98%. These seedswere obtained from the institute farm. Plant stand andassociated plant spacing distribution in the field were recordedup to 20 days after sowing in all the crops.

The measurements for evaluation of planters were depthof seed placement, seed spacing and plant stand. The datameasured were used to calculate the following indices ofplanter performance.1. Mean seed spacing

Mean seed spacing (S) is the mean of total number ofspacing measured.

N

1iN/xiS

Where, N is the total number of spacing measured; xi isthe distance between seed/plant i and the next seed/plant.2. Miss Index

The missing percentage is represented by an indexcalled the Miss Index (MI) which is the percentage of spacingsgreater than 1.5 times the set spacing (X) (Katchman and Smith1995, Bracy et al. 1999).

M = n1/NWhere, n1 = number of spacing > 1.5 X.

3. Multiple Index

The multiple, more than one seed, percentage isrepresented by an index called Multiple Index (DI) which isthe percentage of spacings that are less than or equal to halfof the set spacing (X) (Katchman and Smith 1995).

DI = n2 /NWhere, n2 = number of spacing < 0.5 X.

4. Quality of feed index

The quality of feed index is an alternate way to presentthe performance as a result of combined effect of misses andmultiples. The quality of feed index (A) is the percentage ofspacings that are more than half but not more than 11/2 timesthe set spacing.

Quality of feed index = 100 - (miss index + multipleindex)


During the field evaluation both planters were operatedfor planting of chickpea and pigeonpea. The following

performance parameters were measured and calculated. Thesalient results are presented below.Planting depth: The depths of chickpea seeds placement areshown in Table 4. The average value of Kabuli chickpea (IPCK-02) seed placement depths with manual, inclined plate planterand bed planter were calculated and found to be 28, 53 and 46mm, respectively. This indicates that seed placement withmanual sowing was not within the range of target depth of 50-60 mm whereas the seeds placed with both the planters werevery close to the target depth. Also, more uniform depth ofseed placement was obtained with the planters. The similartrends of seed placement depths were observed for othervariety of chickpea and pigeonpea seeds with both theplanters.

Mean seed spacing: The mean value of the Kabuli chickpea(IPCK-02) seed spacing measured along each planted rowwas about 87, 115 and 136 mm with manual, bed planter andinclined plate planter, respectively (Table 5). Hence the meanseed spacing is within range of the optimal seed spacing of100 mm. The mean seed spacing of chickpea (IPC-98-4) seedswere found as 125 and 100 mm with bed planter and inclinedplate planter, respectively. The mean seed spacing ofpigeonpea was observed similar as chickpea (IPC-98-4) seedspacing and was observed in the very optimal range of 100mm with both planters.Miss Index (MI): The average miss index of the Kabuli chickpea(IPCK-02) seed for the data taken along the planted rows were15.3% and 27.2% with bed planter and inclined plate planter,respectively whereas in case of chickpea (IPC-98-4) seeds theaverage miss index were 31.2% and 20.0% with bed planterand inclined plate planter, respectively (Table 5). The missindex trend for pigeonpea seeds was similar as chickpea (IPC-98-4) seeds for both the planters. This level of miss indexcould be due to a number of factors including the design ofseed plate, failure of the metering plate to be filled with seeds,failure in dropping seed holes and any possible clogging ofseeds along the boot and/or drop tube. Multiple Index (DI): The average multiple index of the Kabulichickpea (IPCK-02) seed for the data taken along the plantedrows were 7.7% and 9.1% with bed planter and inclined plateplanter, respectively whereas in case of chickpea (IPC-98-4)

Manual Inclined plate planter

Bed planter S.N.

IPCK-02 IPC-98-4 IPCK-02 IPC-98-4 IPCK-02 IPC-98-4 1 30 30 50 45 55 45 2 25 25 50 35 50 40 3 40 35 45 50 45 35 4 35 20 60 45 45 50 5 25 25 50 50 55 45 6 30 35 45 65 35 40 7 35 15 55 60 40 35 8 20 20 70 45 50 50 9 15 20 55 35 45 45 10 20 30 50 50 35 40 Average 27.5 25.5 53 48 45.5 42.5

Table 4. Depth of seed placement, mm


Manual Inclined plate planter Bed Planter Particulars IPCK-02 IPC-98-4 IPCK-02 IPC-98-4 IPCK-02 IPC-98-4

Seed placement depth, mm (average) 28 26 53 48 46 43 Mean seed spacing, mm (average) 87 70 136 100 115 125 Missing index 1.5 1.3 27.2 20.0 15.3 31.2 Multiple index 5.6 10.5 9.1 15.0 7.7 6.3 Quality of feed index 93.8 88.2 63.7 65.0 77.0 62.5 Row to row distance, mm 250 250 250 250 250 250

Table 5. Results of field performance evaluation

seeds the average multiple index were 6.3% and 15.0% withbed planter and inclined plate planter, respectively (Table 5).The multiple index trends for pigeonpea seeds were similar aschickpea (IPC-98-4) seeds for both the planters. This meansthat the seeds viewed as "dropped at the same time" as theprevious seed were observed more in case of Kabuli chickpea(IPCK-02) with inclined plate planter as compared to bedplanter. However, reverse trend was observed in case ofpigeonpea and chickpea (IPC-98-4) with both the planters.This level of multiple indexes could be due to seed droppingfrom the metering plates or from the drop tube.Quality of feed index: The average feed index of the Kabulichickpea (IPCK-02) seed were 77.0% and 63.7% with bedplanter and inclined plate planter, respectively whereas in caseof chickpea (IPC-98-4) seeds the average feed index were 62.5%and 65.0% with bed planter and inclined plate planter,respectively (Table 5).

The above results show that the CIAE inclined plateplanter is performing better for small to medium size seedswhereas the large seeds are better sown with the help of ASSbed planter. This can be explained with the reference to thedesign of the inclined plates of both the planters. The seedmetering plates of ASS bed planter are of oval shape insteadof flat as provided with inclined plate planter. This oval shapeand notching at edges, the plates of ASS bed planter hold andguide the large size seeds to the seed dropping orifice in abetter way than flat one. However, for medium size seeds, thesupport by inclined plates of bed Planter is not proper andhence the seeds fall back easily. It can be concluded that theboth planters have shown promising benefits for pulse cropsat large.

REFERENCES

Bracy RP, Parish RL and Mc COY JE. 1999. Precision seeder uniformityvaries with theoretical spacing. Hort Technology 9: 47-50.

CIAE 2010. Central Institute of Agricultural Engineering ProductCatalogue, 2010, Bhopal. 34 pp.

Dubey SK, Sah U and Singh SK. 2011. Participatory impact assessmentof technological interventions disseminated in Bundelkhand regionof Uttar Pradesh. Journal of Food Legumes 24: 36-40.

Kachman DS and Smith JA (1995). Alternative measures of accuracyin plant spacing for planters using single seed metering. Transactionsof the ASAE 38: 379-387.

Kathirvel K, Shivaji KP and Manian R. 2001. Development andevaluation of a till planter for cotton. Agricultural Mechanisationin Asia, Africa and Latin America, Japan 32: 23-27.

Kathirvel K, Shivaji KP and Manian R. 2005. Performance evaluationof planters for cotton crop. Agricultural Mechanisation in Asia,Africa and Latin America, Japan 36: 61-65.

Kepner RA, Bainer R and Barger EL. 1987. 1st Indian Ed. Principles offarm machinery. CBS Publishers and Distributors, New Delhi.

Pandey MM. 2009. Country Report India -Indian Agriculture anIntroduction. Central Institute of Agricultural Engineering Bhopal,India. Presented in Fourth Session of the Technical Committee ofAPCAEM 10-12 February 2009, Chiang Rai, Thailand.

Singh RC, Singh G and Sarswat DC. 2005. Optimization of design andoperational parameters of a pneumatic seed metering device forplanting of cotton seeds. Biosystem Engineering 92: 429-438.

Yadav BG and Yadav RNS. 1987. Design and development of tractordrawn pneumatic precision planter for field experiments. Journalof Agricultural Engineering ISAE 24: 227-232.


Transmission efficiency of Mungbean yellow mosaic virus by indigenous andB-biotype whitefliesB. MANJUNATH1, H.A. PRAMEELA1, NEETHA JAYARAM2 and V. MUNIYAPPA1

1Department of Plant Pathology, UAS, GKVK, Bangalore - 560 065, Karnataka, India; 2Department of Genetics andPlant Breeding, UAS, GKVK, Bangalore - 560 065, Karnataka, India; E-mail: [email protected](Received: November 25, 2011; Accepted : April 12, 2012)

ABSTRACT

Among the major constraint in the successful cultivation ofmungbean is the occurrence of Mungbean yellow mosaicvirus(MYMV)/Mungbean yellow mosaic India virus (MYMIV).The MYMV is transmitted easily by the whitefly Bemisia tabaci.Transmission studies revealed that single whitefly of B-biotypeand indigenous B. tabaci was able to transmit MYMV. The B-biotype had less acquisition access period and inoculation accessperiod to acquire and transmit the virus in comparison withthe indigenous whitefly. The latent period in the vector afteracquisition access period was found to be four and six hours inB-biotype and indigenous whiteflies respectively. Activetransmission of virus was found to be 53.3 and 33.3% in case offemale and male of B-biotype respectively as compared toindigenous whiteflies.

Key words: B-biotype, Mungbean, MYMV, Transmission, Whitefly

Mungbean [Vigna radiata (L.) Wilczek] is one of thethirteen food legumes grown in India and the third mostimportant pulse crop of India after chickpea and pigeonpea.Mungbean is grown principally for its high protein seeds thatare used in human diet, can be prepared by cooking,fermenting, milling or sprouting. They are utilized in makingsoups, curries, bread, sweets, noodles, salads, boiled dhal,sprouts, bean cake, confectionery, to fortify wheat flour inmaking vermicelli and many other culinary products like sabutdhal, dhal, papad, namkeen, halwah, and vari etc. (Singh et al.1988). The mungbean suffers from several diseases, majorones being Cercospora leaf spot (Cercospora canescens, C.cruenta), powdery mildew (Erysiphe polygoni) and rootdisease complex (Pythium spp., Rhizoctonia solani, Fusariumspp.). Moreover mungbean harbours different viruses namely,Alfalfa mosaic virus, Urdbean leaf crinkle virus, Groundnutbud necrosis virus, Mungbean yellow mosaic India virus;Bean common mosaic virus, Cucumber mosaic virus, Mosaicmottle virus and Mungbean yellow mosaic virus (Yadav etal. 2011). Among all the viruses, Mungbean yellow mosaicvirus and Mungbean yellow mosaic India virus are moredestructive viruses. These viruses has been reported to infectcowpea (Naimuddin and Akram 2010) and many wildaccessions of Vigna.

The introduction of B-biotype of B. tabaci in Kolardistrict was responsible for the epidemics of Tomato leaf curlvirus in 1999 (Banks et al. 2001) and since then B-biotype has

spread to many other places in Karnataka (Rekha 2004). Singhet al. (1997) observed highest incidence of MYMV in summer-sown mungbean as compared to the crop grown in kharif andspring seasons. Since there is dearth of information pertainingto transmission of MYMV by B-biotype whiteflies, the presentstudy was undertaken to study the transmission efficiency ofmungbean yellow mosaic virus by B-biotype and indigenouswhiteflies Bemisia tabaci.


The experiment was carried out at the Plant VirologyLaboratory, Department of Plant Pathology, University ofAgricultural Sciences, Hebbal, Bangalore. The type culture ofB. tabaci used for inoculation was maintained on cotton,Gossypium hirsutum cv. ‘Varalakshmi’ plants kept in insectproof wooden cages. For transmission studies ‘China mung’variety was used. Completely Randomized Design (CRD) wasemployed in the present study. Healthy B-biotype andindigenous whiteflies were separately allowed for 24 hrs ofacquisition access on MYMV infected mungbean plants. Thewhiteflies were then transferred to young healthy seedlingsin batches of 1, 2, 3, 5, 10, 15, 20 and 25 separately. In eachcase 15 plants were inoculated. Whiteflies were giveninoculation access period of 24 hrs. Similarly healthy whitefliesof B-biotype and indigenous were separately allowed fordifferent acquisition and inoculation feeding periods viz., 2, 5,10, 15, 30 minutes and 1, 4, 8, 12, 16 and 24 hrs on MYMVinfected mungbean plants. The viruliferous whiteflies werereleased on to healthy mungbean seedlings at the rate of 10-15 whiteflies per plant. The inoculated plants developed yellowmosaic symptoms 12-15 days after inoculation. Per centtransmission was calculated by using the following formula

x 100Per cent transmission =Number of plants infected

Total number of plants

The B-biotype and indigenous whiteflies wereseparately given a minimum acquisition access period of 1 hron infected mungbean plant. Groups of 10-15 whiteflies werereleased on the healthy mungbean seedlings after 1, 2, 4, 6, 8,10, 12, 16, 20 and 24 hrs of inoculation access periodsseparately. Both male and female of B-biotype and indigenouswhiteflies were allowed to feed on infected mungbean for 24hrs as acquisition access period. The male and female B. tabaci


of each biotype were separately inoculated to healthyseedlings. In each case one whitefly per seedlings were used.Ten to fifteen viruliferous whiteflies B-biotype and indigenouswhiteflies were separately inoculated to individual mungbeanplants of different stages viz., 8, 12, 16 and 20 days oldseedlings. For each treatment fifteen plants were inoculatedwith 10-15 whiteflies per plant. The characters distinguishing

(Mandal 1989) and Pumpkin yellow vein mosaic virus (Babitha1996).

The studies also showed that the minimum 10viruliferous B-biotype were required per plant to obtain 100per cent infection whereas in case of indigenous it was with15 viruliferous B. tabaci. Similar observation was earlierreported by Murugesan and Chellaiah (1977), Chenulu et al.(1979) with indigenous whitefly with other whitefly borneviruses viz., Croton yellow vein mosaic virus (Mandal 1989)and Cotton leaf curl virus (Nateshan 1992).

Table 1. Comparison of Indigenous and B-biotype of Bemisiatabaci

Character Indigenous type B-biotype Developmental stages

Longer body length when reared on cotton

Lesser body length when reared on poinsettia

Pupae Longer and wider are the wax margins; Anterior sub marginal setae pairs (ASMS4) are present

Smaller and wide are the anterior and posterior wax margins; ASMS4 are absent

Adults Indistinguishable, less fecundity. Males will be shorter than females

Morphologically distinguishable, more fecundity. Males will be shorter than females

Silvering on squash

Does not produce Produces

Esterase pattern

2-6 bands depending on host. Two bands in cotton which were densely stained and pumpkin showed 4 additional band, which were genetically faint

Yielded a single band which migrated faster than either of the two densely staining bands of cotton and pumpkin

between indigenous and B- biotype whiteflies (Bethke et al.1991, Perring et al. 1993, Bellows et al. 1994, Schuster et al.1990, Yokomi et al. 1990, Costa and Brown 1991) are presentedin Table 1.

RESULTS AND DISCUSSIONVirus-vector relationship studies revealed that single

whitefly of B. tabaci B-biotype and indigenous were able totransmit MYMV. Active transmission of 46.67% was obtainedwhen single B-biotype whiteflies were inoculated per plantwith 24 hrs of acquisition and inoculation access periodcompared to the indigenous whiteflies (33.34%) (Table 2).Ability of single whitefly to transmit the MYMV was reportedearlier by Rathi and Nene (1974), Murugesan and Chellaiah(1997) and Chenulu et al. (1979) and also with other whiteflyborne viruses viz., Horsegram yellow mosaic virus(Muniyappa et al. 1975), Croton yellow vein mosaic virus

It was found that the minimum time period required byB. tabaci B-biotype to acquire virus from infected mungbeanwas 10 min and inoculation access period was 10 min also.The B-biotype of B. tabaci in both the cases has less IAPand AAP required to transmit the virus in comparison withthe indigenous whitefly whereas B. tabaci indigenousrequired 15 min of AAP and IAP (Table 3 and 4). Similarobservation was reported by Nair and Nene (1974).

The latent period in the vector after acquisition accessperiod was found to be 4 hrs in B. tabaci B-biotype whereasin indigenous whiteflies it was 6 hrs (Table 5). This is in close

aAcquisition and Inoculation access periods- 24 hrs, b8 days old mungbean seedlingswere used

Table 2. Effect of number of whiteflies (Bemisia tabaci) of B-biotype and indigenous on transmission of MYMV

B-biotype Indigenous No. of plants No. of plants

Number of whiteflies a

Infected/ Inoculated b

Transmission (%)

Infected/ Inoculated b

Transmission (%)

1 7/15 46.67 5/15 33.34 2 9/15 60.00 7/15 46.67 3 11/15 73.34 8/15 53.34 5 13/15 86.67 10/15 66.67

10 15/15 100.00 12/15 80.00 15 15/15 100.00 15/15 100 20 15/15 100.00 15/15 100 25 15/15 100.00 15/15 100

Table 3. Effect of Acquisition access period (AAP) ontransmission of MYMV by B-biotype and indigenouswhitefly (Bemisia tabaci)

a Inoculation access period of 24 hrs; b Group of 10-15 adult whiteflies

B-biotype Indigenous No. of plants No. of plants

Acquisition Access Period Infected /

Inoculated a,b Transmission

(%) Infected/


(%) 2 min 0/15 0.00 0/15 0.00 5 min 0/15 0.00 0/15 0.00 10 min 1/15 6.67 0/15 0.00 15 min 2/15 13.33 1/15 6.67 30 min 4/15 26.60 2/15 13.33 1 hour 5/15 33.30 3/15 20.00 4 hours 7/15 46.60 5/15 33.30 8 hours 9/15 60.00 7/15 46.67 12 hours 12/15 85.71 8/13 61.53 16 hours 15/15 100.00 12/15 80.00 24 hours 15/15 100.00 15/15 100.00

Table 4. Effect of Inoculation access period (AAP) ontransmission of MYMV by B-biotype and indigenouswhitefly (Bemisia tabaci)

a Acquisition access period of 24 hrs; b Group of 10-15 adult whiteflies

B-biotype Indigenous No. of plants No. of plants Inoculati

on Access Period Infected/


(%) Infected/


(%) 2 min 0/15 0.00 0/15 0.00 5 min 0/15 0.00 0/15 0.00 10 min 1/14 7.14 0/15 0.00 15 min 3/15 20.00 1/15 6.67 30 min 5/15 33.33 2/15 13.33 1 hour 7/15 46.67 4/15 26.67 4 hours 10/15 66.60 7/15 46.67 8 hours 11/15 73.30 8/15 53.30 12 hours 12/15 80.00 10/15 66.60 16 hours 14/15 100.00 13/15 86.67 24 hours 15/15 100.00 15/15 100.00

Manjunath et al. : Transmission efficiency of mungbean yellow mosaic virus by indigenous and B-biotype whiteflies 137

agreement with the reports made by Chenulu et al. (1979) incase of indigenous whiteflies and also with othergeminiviruses (Muniyappa et al. 1975, Nateshan 1992).

Different age group seedlings of mungbean for theirsusceptibility using B. Tabaci B-biotype and indigenousrevealed that 8-12 days old seedlings were found mostsusceptible for infection (Table 6). However per centtransmission was higher in B-biotype in twelve days oldseedlings compared to the indigenous. Similar observationwere reported by Chenulu et al. (1979) in MYMV and also inother whitefly borne viruses viz., Euphorbia mosaic virusand Cotton leaf curl virus (Costa and Benett 1950).

biotype female and male was more efficient in transmission ofMYMV in comparison with indigenous whitefly. A similarobservation was reported earlier by Rathi and Nene (1974).The results are similar to those reported by Mandal (1989)where females (52%) were more efficient when compared tomales (27%) in transmitting Croton yellow vein mosaic virus.

REFERENCES

Babitha CR. 1996. Transmission, host range and serodiagnostics ofpumpkin yellow mosaic geminivirus. M.Sc. Thesis, University ofAgricultural Sciences, Bangalore, India.

Banks GK, Colvin J, Reddy CRK, Maruthi MN, Muniyappa V, VenkateshHM, Kiran KM, Padmaja AS, Beitia FJ and Seal SF. 2001. Firstreport of Bemisia tabaci B-biotype in India and an associated tomatoleaf curl virus disease epidemic. Plant Disease 85: 231.

Bellows TS, Perring TM, Gill RJ and Headrick DH. 1994. Descriptionof a species of Bemisia (Homoptera: Aleyrodidae). Annals ofEntomological Society of America 87: 195-206.

Bethke JA, Paine TD and Nessly GS. 1991. Comparative biology,morphometrics and development of two populations Bemisia tabaci(Homoptera: Aleyrodidae) on cotton and poinsettia. Annals ofEntomological Society of America 84: 401-411.

Costa AS and Benett CW. 1950. Whitefly transmitted mosaic ofEuphoria prunifolia. Phytopathology 40: 266-283.

Costa HS and Brown JK. 1991. Variation in biological characteristicsand in esterase patterns among populations of Bemisia tabaci (Genn)and the association of one population with silver leaf symptomsdevelopment. Entomologia Experimentalisa et Applicata 61: 211-219.

Chenulu VV, Venkateswarlu V and Rangaraju R. 1979. Studies on yellowmosaic virus disease of mungbean. Indian Phytopathology 32: 230-235.

Mandal B. 1989. Studies on croton yellow vein mosaic virus. M.Sc.Thesis, University of Agricultural Sciences, Bangalore, India.

Muniyappa V, Reddy HR and Shivashankar G. 1975. Yellow mosaicdisease of Dolichos biflorus L (horsegram). Current Research 4:176.

Murugesan S and Chellaiah S. 1977. Transmission of greengram yellowmosaic virus by the whitefly, Bemisia tabaci. Madras AgriculturalJournal 64: 437-438.

Naimuddin and Akram M. 2010. Detection of mixed infection ofbegomoviruses in cowpea and their molecular characterization basedon CP gene sequences. Journal of Food Legumes 23: 191-195.

Nair NG and Nene YL. 1974. Studies on the yellow mosaic of urdbean(Phaseolus mungo L.) caused by mungbean yellow mosaic virus:Nature and extent of losses due to yellow mosaic virus infection atvarious stages of growth. Indian Journal of Farm Sciences 2: 48-50.

Nateshan HM. 1992. Biological properties of cotton leaf curlgeminivirus. M.Sc. Thesis, University of Agricultural Sciences,Bangalore, India.

Perring TM, Cooper AD, Rodriguez RJ, Farrar CA and Bellows TS.1993. Identification of a whitefly species by genomic andbehavioural studies. Science 259: 74-77.

Rathi YPS and Nene YL. 1974. Some aspects of the relationship betweenmungbean yellow mosaic virus and its vector Bemisia tabaci. IndianPhytopathology 27: 459-462.

a Acquisition access period-1 hr; b Group of 10-15 adult whiteflies

Table 5. Incubation period of MYMV in B-biotype andindigenous whitefly (Bemisia tabaci)

B-biotype Indigenous No. of plants No. of plants Incubation

Period (Hours) Infected/


(%) Infected/


(%) 1 0/15 0.00 0/15 0.00 2 0/15 0.00 0/15 0.00 4 1/15 6.67 0/15 0.00 6 3/15 20.00 1/15 6.67 8 4/15 26.67 2/15 13.33 10 5/15 33.30 4/15 26.67 12 7/15 46.67 5/15 33.30 16 8/15 53.30 7/15 46.67 20 8/15 53.30 7/15 46.67 24 10/15 66.67 8/15 53.30

Table 6. Effect of age of the seedlings on transmission ofMYMV by B-biotype and indigenous whitefly(Bemisia tabaci)

aAcquisition and inoculation access period- 24 hrs; bGroup of 10-15adult whiteflies

B-biotype Indigenous No. of plants No. of plants Age of the

seedlings Infected/ Inoculated a,b

Transmission (%)

Infected/ Inoculated a,b

Transmission (%)

8 days 15/15 100.00 15/15 100.00 12 days 12/15 80.00 10/15 66.60 16 days 7/15 46.67 6/15 40.00 20 days 6/15 40.00 5/15 33.33

The results also indicated that the transmissionobtained from female and male B. tabaci B-biotype when singlewhitefly per plant was used and survived for 24 hrs afterinoculation (Table 7). From this study it is evident that B-

Table 7. Effect of sex of whitefly, Bemisia tabaci (B-biotypeand indigenous) on transmission of MYMV

a Acquisition and inoculation access period- 24 hrs; b Group of 10-15 adultwhiteflies

B-biotype Indigenous No.of plants No.of plants Experi-

ment Sex of

B. tabaci a Infected/ Inoculated a,b

Transmission (%)

Infected/ Inoculated a,b

Trans-mission

(%) 1 Female

Male 6/15 3/15

40.00 20.00

4/15 2/15

26.60 13.33

2 Female Male

8/15 5/15

53.30 33.30

6/15 3/15

40.00 20.00


Rekha AS. 2004. Molecular characterization of pumpkin yellow veinmosaic virus and Bemisia tabaci on vegetables and weeds. Ph. D.Thesis, University of Agricultural Sciences, Bangalore, India.

Schuster DJ, Kring JB and Price JF. 1990. Association of sweet potatowhitefly with leaf disorder of squash. Horticultural Science 26:155-156.

Singh RA, Ghosh A, Gurha SN and De Rajib K. 1997. Genotypic responseto yellow mosaic in mungbean in different cropping seasons. In:National Symposium on Recent Advances in Diagnosis andManagement of Important Plant Diseases, 19-20 December 1997,Kanpur, India. Pp 102.

Singh VP, Chhabra A and Kharb RPS. 1988. Production and utilizationof mungbean in India. In: Proceedings of the Second InternationalSymposium, 16-20 November 1987, AVRDC, Shanhua, Taiwan. Pp588.

Yadav NK, Sarika, Iquebal MA and Akram M. 2011. In-silico analysisand homology modelling of coat-protein of mungbean yellow mosaicIndia virus. Journal of Food Legumes 24: 138-141.

Yokomi RK, Hoelmer KA and Osborne LS. 1990. Relationship betweenthe sweet potato whitefly and the squash silver leaf disorder.Phytopathology 80: 895-900.


Screening for resistance against Rhizoctonia bataticola causing dry root-rot inchickpeaOM GUPTA, MANISHA RATHI and MADHURI MISHRA

Department of Plant Pathology, JNKVV, Jabalpur 482 004 (MP), India; Email: [email protected](Received: January 30, 2012; Accepted: May 31, 2012)

ABSTRACT

One hundred seventy chickpea genotypes procured fromAICRP-Chickpea Unit, NBPGR and ICRISAT were evaluatedfor locating new and better sources of resistance against dryroot rot through blotter paper technique and in multiple diseasesick fields at JNKVV, Jabalpur during 2007 to 2010. Thesusceptible cultivar BG 212 showed 100 per cent mortality i.e.rating 9 in 1-9 scale. The studies led to conclusion that out of170 accessions, 68 genotypes exhibited resistant reaction (<10%mortality), out of which 26 are the promising lines namely (JG1-14, 2-125, 2-4-110, 14-11, 14-10, 2001-13, 2001-13, 2001-18,2001-80, 2001-115, 2002-20, 2003-95, 2003-14-16, 2004-110, 210,9605, 1-9, 99-115, 2001-04, 2003-14-2, JG 2000-07, JSC 37, MPJG89-11551,MPJG 89-9023, CSJ 592 and Rajas) from JNKVV,Jabalpur. These lines further evaluated for their performancein sick field for three consecutive years and revealed six linesviz., JG 2000-07, JSC 37, MPJG 89-11551,MPJG 89-9023, CSJ592 and Rajas as resistant exhibiting <10 per cent mortality,however 14 lines showed moderately resistance reaction.Resistant genotypes had white healthy root system with greaternumber of lateral roots. All other lines having >20% mortalityshowed necrotic root lesions leading to extensive root rotting.The genotypes identified as resistant are of great value andmay be exploited in breeding programme for developing highyielding resistant varieties.

Key words: Cicer arietinum, Dry root rot, Resistance, Rhizoctoniabataticola

Chickpea (Cicer arietinum L.) is the world’s third mostimportant food legume after soybean and pea. Out of totalproduction of pulses, chickpea accounts for 37 per cent andarea wise 28.28 per cent. India contributes the major share tothe global chickpea area (about 65%) and production (68%).In India, it is grown in 8.75 mha area with a production of 8.25mt (DAC 2011). Among states, Madhya Pradesh (3.09 mt) andMaharashtra (1.11 mt) contribute maximum to the totalproduction (Agricultural Statistics at a Glance 2011) during2009-2010. Chickpea is prone to several fungal diseases,among them dry root rot caused by Rhizoctonia bataticola(Taub.) Butler is one of the major production constraints thatcause 10-20 per cent annual loss (Vishwadhar and Chaudhary2001). Looking at present expanding area in South zone,cropping system and the changing climatic scenario, dry rootrot is becoming more severe in the central and southern partsof India. Gupta et al. (1983) reported the incidence of dry root

rot ranging from 3.2 to 20.6 per cent in 30 villages of northernMadhya Pradesh. Nene et al. (1984) also recorded heavylosses to chickpea crop due to this disease.

Combining useful economic traits with multiple diseaseresistance and wider adoptability is the demand of the dayparticularly in soybean-chickpea based cropping system asthis pathogen survives in the soil year after year. Sources ofresistance to vascular wilt have been reported from differentpart of the country but only a few moderate resistant lines/germplasms to dry root rot are available. Therefore, commercialcultivars with genetic resistance to the disease have not yetbeen developed (Pande et al. 2004). Keeping the above factsin view, an investigation was undertaken with an objective toidentify the sources of resistance in different genotypes ofdesi and kabuli chickpea.


Chickpea dry root rot infected plants were collectedfrom field of JNKVV, Jabalpur and the isolations were madefrom roots showing characteristics symptoms of disease. Thepurified culture of Rhizoctonia bataticola was maintained onPDA slants for screening the germplasms line. In preliminaryscreening, 170 accessions of the desi and kabuli chickpeagenotypes were evaluated against dry root rot by using blotterpaper technique (Nene et al. 1981). Promising lines exhibitingresistant /moderately resistant reactions under blotter papertechnique were further screened to see their performanceunder multiple disease sick fields for three years.Blotter paper screening technique: A 5mm disc of the culturewas placed on PDA poured Petri-plates and incubated at 25±1oCfor five days. A mycelial disc from this culture was transferredto 250ml flasks each containing 100ml of sterilized PDB. Afterfive days of incubation at 25±1oC mycelial mats were removedfrom the flask, were added to 100 ml sterilized distilled water ina beaker after its proper crushing for one minute in the blender.

Five-days old chickpea seedlings of each genotypeswere surface sterilized with 2.5% sodium hypochlorite for 5min of each genotype, alongwith susceptible check BG 212grown on plastic trays containing sterilized soil + sand (1:1)and were uprooted carefully and washed in running water.Roots of 20 seedlings of each test line dipped at a time in thefreshly prepared inoculum for 30 seconds. Inoculatedseedlings were placed in folded, moist blotting paper (size


45cm x 25cm with one fold), so that the cotyledons and rootswere covered, while the green tops remain exposed. Eachplastic tray contained heaps of ten blotters with seedlingsand an inoculated susceptible check BG 212 was kept in eachheap. The seedlings inoculated with the culture of R.bataticola were kept into trays in an Environmental TestChamber (ETC) at 300C with 12 h artificial light/day for 8 days.The blotter paper was moistened adequately with sterilizeddistilled water on alternate day. Individual seedlings werescored for the extent of root infection eight days afterincubation on the basis of 1-9 rating scale (Nene et al.1981).Field screening: Promising lines exhibiting resistant andmoderately resistant reaction were further screened in theconsecutive years (2007-2010) in the multiple disease sickfields at Seed Breeding Farm, JNKVV, Jabalpur. Each test entrywas sown in a plot of two rows of 5 meter length at 30 cm apartwith one row of susceptible check BG 212 after every two testentry and replicated twice in randomized block design.Observations on emergence count were recorded at 20 DASand per cent mortality due to R. bataticola recorded at 20days interval upto maturity of the crop plant and finallycomputed as follows:

2002-20, 2003-95, 2003-14-16, 2004-110, 210, 9605, 1-9, 99-115,2001-04, 2003-14-2, JG 2000-07, JSC 37, MPJG 89-11551, MPJG89-9023, CSJ 592 and Rajas) from JNKVV, Jabalpur. Nosymptom of necrotic lesion on roots were observed in resistantlines as the root system was quite healthy, completelydeveloped and exhibited white appearance. Seventy fivegenotypes were found moderately resistant (>10.1 to 20%mortality). In these lines the disease rating is recorded1 (resistant) but the average per cent mortality due to root rothas been observed in the range of 10-20 per cent, that’s whythey are scored as resistant to moderately resistant (Table 1).Pande et al. (2004) evaluated 29 chickpea germplasmaccessions for resistance against dry root rot caused by R.bataticola under in vitro conditions and 22 lines were eithersusceptible or highly susceptible to dry root rot (0-100 percent mortality). While remaining 16, 4 and 7 germplasms weretolerant, moderately susceptible and susceptible, respectively(Table 1). Many lesions on roots were seen in moderatelysusceptible and susceptible genotypes though the new rootswere generally free from these lesions. The roots werecompletely discoloured and rotten in highly susceptiblegenotype BG 212 (check) which had a disease rating of 9 ateight days after incubation at 300C. Chickpea genotypes havebeen screened and identified as resistant to dry root rot byvarious workers on the basis of in vitro and field conditions(Nene et al. 1981, Anand Rao and Haware, 1987, Reddy et al.,1990, Bhatt, 1993, Gupta, 1997, Khalid and Ilyas, 2000 andGupta et al., 2003).

Among 170 chickpea germplasms lines evaluatedagainst R. Bataticola, 26 promising lines exhibiting resistancewere further evaluated under disease sick field for threeconsecutive years. The data revealed that six lines viz., JG2000-07, JSC 37, MPJG 89-11551, MPJG 89-9023, CSJ 592 and

X 100Number of diseased plants

Total number of plantsPer cent mortality =


The results of in-vitro screening indicated that out of170 genotypes, 68 were found resistant (< 10 per cent mortality)out of which 26 are promising lines viz., JG 1-14, 2-125, 2-4-110, 14-11, 14-10, 2001-13, 2001-13, 2001-18, 2001-80, 2001-115,

Rating Disease Reaction Entries/genotypes Total 1 Resistant BG 112, C2 14-83, 25, 25-1, CSJ 426, 427, 438, 440, CSJ 592, JSC 37, IC 269263, 327069, 327073,

327290, 327332, 327583, 327654, 327675, 327944, ICC 03104, 03105, 03106, 03112, 03205, 03206, 03207, 04107, 04109, 11322, 12467, 14374, 14376, 14391, 14432, 14433, 16124, 950106-49P-BP, 950106-64P-BP, ICCV 87315, IPC 2000-6, 2004-54, 2004-68, 2005-68, 2005-74, JG 2000-07, MPJG 89-11551, MPJG 89-9023,1-14, 2-125, 2-4-110, 14-11, 14-10, 2001-13, 2001-18, 2001-80, 2001-115, 2002-20, 2003-95, 2004-110, 210, 9605, 1-9, 99-115, 2001-04, 2003-14-2, PG 00109, Vishal, Rajas,

68

2 - 3 Moderately Resistant

BCP 91, 114, C2 25(IPC), 1-41-32, CSJ 433, 437, 458, H 82-2, GJG 0205, 0312, GL 24080, 97016, IC 269240, 322-16, 327056, 327116, 327673, 327703, 327821, 327829, 327933, 327960, 327968, ICC 03111, 11324, 12233, 14344, 14404, 14409, 14434, 14436, 950102-43P-BP, ICCV 87316, 92944, 95992, IPC 9391, 98-58, 2005-34, 2005-36, 2005-41, 2005-59, JG 74, 63, 1-18, 1-55, 2-14-1, 2-14-115, 2002-108, 2003-210, 98003, 2-25, 2004-03, 2004-110, 2004-944, MPJGK3, Simpleleaf, Compacta, Broad few leaflets, A3(MPxV1)xA6, Fasciated stem, Outward curved, JG 2003-14-16, JG 2001-12, JG 315, MPJG 2001-04, H02-14, CSJ 556, CSJ 558, GNG 1488 PG01108, HK- 02-201, HK 03-45, HK 03113 WCG 2000-07, IPC 2005-28

75

4 - 5 Tolerant BCP 17, JG 2003-95, C2-44, IC 327070, 327074, 327100, 327104, 327337, 327364, 327383, 327393, 327446, 527582, ICC 12450, IPC 98-22, 2004-77

16

6 - 7 Moderately Susceptible

Chaffa, JG 200-14, PG 9425-5, 9425-9 04

8 - 9 Susceptible BCP 21, 49, BG 212, Cracked, C2-97, 2003-196, 2004-24, 99-213 07

Table 1: Reaction of chickpea entries/genotypes against dry root rot through blotter paper screening technique

Test lines showing ratings: 1-3 – Acceptable for the breeding programme, 4-5 – Acceptable if lines with rating 1-3 are not available, 6-9 – Notacceptable.

Gupta et al. : Screening for resistance against Rhizoctonia bataticola in chickpea 141

Rajas were resistant exhibiting <10 per cent mortality, however14 lines showed moderately resistant reaction (JG 2003-14-16,JG 2001-12, JG 315, MPJG 2001-04, H02-14, CSJ 556, CSJ 558,GNG 1488, PG01108 , HK- 02-201, HK 03-45, HK 03113, WCG2000-07 and IPC 2005-28) against R. bataticola during thetesting years under high disease pressure.

Gangwar et al. (2002) screened 35 chickpea cultivars forresistance to dry root rot in a field experiment, only 10 cultivars(ICC 2644, 10384, 10630, 112244, 11332, ICCL 81002, 810810,ICC 12263, 12441 and ICCV 90254) were found resistanthowever, Phule G 9504, 96020, 96105, 96313 and GL 91059 weremoderately resistant. Prajapati et al. (2003) and Gupta andBabbar (2006) identified broad-based stable resistant lines towilt and root rots on the basis of multi-location evaluation. Inthe present study, chickpea lines that possessed consistentresistant reaction to dry root rot may be used in breedingprogramme to incorporate the resistance to dry root rot inhigh yielding varieties of chickpea.

REFERENCES

Anand Rao PK and Haware MP. 1987. Inheritance of dry root-rotRhizoctonia bataticola resistance in chickpea. Plant Breeding 98:349-352.

Agricultural Statistics at a Glance, 2011. Ministry of AgricultureGovernment of India, NewDelhi.

Bhatt J. 1993. Reaction of chickpea cultivars of Rhizoctonia bataticola(Taub) Butler (Macrophomina phaseolina) (Tassi) Goid. IndianJournal of Pulses Research 6: 118-119.

Gangwar RK, Prajapti RK, Shrivastava SSL, Kumar Kumud and KumarK. 2002. Resistance in chickpea germplasms against dry root rot.

Annals of Plant Protection Sciences 10: 393-394.

Gupta Om. 1997. Occurrence of combined resistance to wilt and dryroot rot in chickpea. Indian Journal of Pulses Research 10: 125-126.

Gupta Om and Babbar A. 2006. Identification of desi and kabuli chickpeagenotypes for multiple disease resistance against soil borne disease.Indian Journal of Pulses Research. 19: 129-130.

Gupta Om, Jharia HK and Sharma ND. 2003. Bacillus subtilis: Aneffective antagonist of Rhizoctonia bataticola (Taub) Butler causingdry root rot of chickpea. Indian Journal of Pulses Research 16: 42-46.

Gupta RN, Gupta JS and Sharma BL. 1983. Studies on wilt and root rotincidence of Cicer arietinum of Madhya Pradesh. IndianPhytopathology 36: 82-84.

Khalid Iftikhar and Ilyas MB. 2000. Screening of chickpea germplasmagainst dry root rot disease (Macrophomina phaseolina) in pots/glass house. Pakistan Journal of Phytopathology 12: 66-70.

Nene YL, Haware MP and Reddy MV. 1981. Chickpea disease resistancescreening techniques. Information Bulletin ICRISAT 10: 10-11.

Nene YL, Shukla VK and Sharma SB. 1984. Pulse pathology progressreport, ICRISAT, Patancheru, A.P., India.

Pande S, Rao JN and Kishore GK. 2004. Evaluation of chickpea linesfor resistance to dry root rot caused by Rhizoctonia bataticola.International Chickpea and Pigeonpea Newsletter 11: 37-38.

Prajapati RK, Shrivastava SSL and Gangwar RK. 2003. Resistant sourceof chickpea against dry root rot. Farm Science J. 12: 86.

Reddy MV, Raju RN and Pundir RPS. 1990. Additional sources ofresistance to wilt and root rot in chickpea. International ChickpeaNewsletter 22: 36-38.

Vishwadhar and Chaudhary RG. 2001. Disease resistance in pulse crops-current status and future approaches. In: S Nagrajan and DP Singh(eds.), Role of Resistance in Intensive Agriculture. Kalyani Publisher,Ludhiana, India, Pp 145-157.


Calendar based application of newer insecticides for the management of gram podborer in chickpeaR.M. WADASKAR1, JAYASHRI UGHADE2 and A.N. PATIL1

1Pulses Research Unit, Dr. Panjabrao Deshmukh Krishi Vidyapeeth, Akola - 444 104 Maharashtra, India; 2ZonalAgricultural Research Station, Dr. Panjabrao Deshmukh Krishi Vidyapeeth, Yavatmal - 445 401, Maharashtra, India;Email: [email protected](Received: November 14, 2011; Accepted : May 25, 2012)

ABSTRACT

Ravages of Helicoverpa armigera (Hubner) throughout chickpeagrowth period especially in reproductive phase is the majorbottle neck in attainment of desired productivity level ofchickpea, the most important rabi pulse crop of Maharashtra.Present study was framed to devise farmer friendly module forgram pod borer management by targeting pod borer abundancewith calendar based application approach on chickpea, grownunder residual moisture conditions during rabi 2009-10 and2010-11 at Akola and Yavatmal in 2010-11. Evaluation of elevenmodules along with control categorically revealed superiorityof module comprised of spraying of deltamethrin 1EC +triazophos 35EC ready mix formulation @ 2.5ml per litre ofwater at 50% flowering stage of crop followed by a second sprayof emamectin benzoate 5SG @ 0.3g per litre of water at 15 dayafter first application of insecticide as the most effective andeconomic module for gram pod borer management. The modulealso registered the highest yield (20.9 q/ha) and net profit (Rs.16172/ ha) along with Incremental Cost Benefit Ratio of 1: 6.0

Key words: Calendar based application, Chickpea, Gram podborer, Newer insecticides

India is a principal chickpea producing country. Though,the present day potential of chickpea cultivars exceeds 2.0tonnes/ha, average productivity is still about 0.8 tonnes/ ha(Haware 1998). Amongst the insect pests, Gram pod borer,Helicoverpa armigera (Hubner) is one of the major bioticconstraints for this disparity (Deepa and Srivastava 2011).Even though, the pod borer larvae feed voraciously from earlyvegetative to pod formation stage, it inflicts enormous lossesby virtue of its preference for reproductive organs in chickpea(Fitt 1989). Single H. armigera larva per meter row lengthespecially during flowering and pod formation stage damages7–10% pods translating into 5.4% yield loss of chickpea(Chaudhary and Sharma 1982) and reports of 60–80% croplosses in Maharashtra are common (Puri et al. 1998). Use ofchemical insecticides forms the first line of defense for podborer management in chickpea but intelligent use ofinsecticides is the need of the day. The current pestmanagement strategy emphasize on application of insecticideson the basis of attainment of ETL, which is seldom observedby farmers, the major reason being the reluctance of farmersfor ETL based application of insecticide. Hence, present study

was carried out to evaluate the efficacy of insecticide moduleswith a calendar based application approach to manage thepod borer, which will not only be convenient but will also bean ideal component to farmers for pest management.


The present study was carried out at Pulses ResearchUnit, Dr. Panjabrao Deshmukh Krishi Vidyapeeth, Akola duringrabi 2009-10 and 2010-11 and at Zonal Agricultural ResearchStation, Yavatmal during rabi 2010-11 to devise farmer friendlypest management approach against gram pod borer in chickpea.Twelve treatment comprising of calendar based applicationof eleven insecticide module along with untreated control(Table 1) were evaluated under residual moisture conditionwith ‘JAKI 9218’ as test variety. Each treatment had grossplot of 4.2 x 2.1m and net plot of 4.0 x 1.8 m, replicated thrice inrandomized block design (RBD). Calendar based applicationof insecticides was decided on the basis of literature andcurrent recommendation of the university indicating higherincidence of pod borer during flowering and pod formationstage supported by review of Sharma (2005), signifyingtargeting of pod borer at 50% flowering. First application ofinsecticide of the module was made at 50% flowering phase;whereas, second spray of insecticide of the module wasapplied at 15 day after application of first treatment. Bio-efficacycomparisons of modules were based on per cent larvalpopulation reduction over control, per cent pod damage (podsdamaged by pod borer/total number of pods) from fiverandomly selected plants at maturity and net plot seed yield,extrapolated to per hectare.


Seven days after first spray: All the treatments weresignificantly superior in terms of larval population reductionability over control. Higher per cent reduction of 99.1 wasrecorded due to application of deltamethrin + triazophos2.5ml/lit (Module 10). It was followed by application ofdeltamethrin + triazophos 2.5 ml/lit (Module 9), profenophos2.5ml/lit (Module 8), deltamethrin + triazophos 2.5ml/lit(Module 11) and profenophos 2.5ml/lit (Module 7) with 76.8,73.3, 73.2 and 71.8% larval population reduction over control,respectively (Table 1).

Wadaskar et al. : Calendar based application of newer insecticides for the management of gram pod borer in chickpea 143

Fourteen day after first spray: All the insecticides as firstspray of module were significantly superior over control.Higher per cent reduction of 88.2, 79.7, 74.5, 74.3 and 72.1 wasobserved in H. armigera larval population due to applicationof deltamethrin + triazophos 2.5 ml/lit (Module 10), deltamethrin+ triazophos 2.5 ml/lit (Module 11), profenophos 2.5 ml/lit(Module 7), deltamethrin + triazophos 2.5 ml/lit (Module 9)and profenophos 2.5 ml/lit (Module 8), respectively (Table 1).Seven days after second spray: All the treatments hadsignificant superiority in larval population reduction overcontrol. Data revealed that higher per cent reduction of 99.8 inlarval population due to application of indoxacarb 0.55 ml/lit(Module 10), which was at par with emamectin benzoate 0.3ml/lit (Module 8), spinosad 0.22 ml/lit (Module 9), spinosad0.22 ml/lit (Module 6) and emamectin benzoate 0.3 ml/lit(Module 11) with 97.9, 95.8, 92.0 and 91.4% larval reductionover control, respectively (Table 1).Fourteen day after second spray: Higher efficacy oftreatments on larval population reduction to the extent of 99.8,99.6 99.1, 97.7 and 94.9% over control was observed due toapplication of emamectin benzoate 0.3 ml/lit (Module 11),emamectin benzoate 0.3 ml/lit (Module 8), indoxacarb 0.55 ml/lit (Module 10), spinosad 0.22 ml/lit (Module 9), emamectinbenzoate 0.3ml/lit (Module 5), respectively (Table 1). Othertreatments though lagging were significantly superior overcontrol.

Present findings of higher efficacy of deltamethrin +triazophos (Pal et al. 1996, Barve and Patil 2000) andprofenophos (Ujagir et al. 1997, Chandrakar and Srivastava2001) as initial spray for management of pod borer larvalpopulation was well supported by the review. The applicationof emamectin benzoate in second spray inflicting the highestpod borer larval reduction in chickpea was supported byfindings of Ahmed and Ashraf (2004), Rahman et al. (2006).Higher potency of emamectin benzoate as well as spinosadinflicting high larval mortality at lower concentration wasevidenced in laboratory bioassays (Stanley et al. 2009,Duraimurugan et al. 2007). Thus, insecticide like emamectinbenzoate will help in achieving pest management throughgreen chemistry (Stanley et al. 2009). The pod borer larvalreduction efficacy trends of spinosad and indoxacarb inlaboratory (Ahmed et al. 2004) and indoxacarb under fieldcondition on chickpea (Rahman et al., 2006) are in conformitywith the present experimental findings. Rashid et al. (2003)observed that at pod formation stage application of spinosadand indoxacarb were most effective in curbing the chickpealosses supporting the hypothesis of present study.Pod damage by Helicoverpa armigera: The final assessmentof pod damage at maturity revealed significant superiorityover control. Application of deltamethrin + triazophos 2.5 ml/lit - emamectin benzoate 0.3 g/lit (Module 11) was thestatistically significant treatment in terms of the lowest per

Table 1. Mean per cent reduction in Helicoverpa armigera larval population over control - 7 and 14 days after module componentapplication

Mean per cent reduction in Helicoverpa larval population over control* Module

No. Module details 7 days after first

application

14 days after first

application

7 days after Second

application

14 days after Second

application

1. Azadirachtin 10000 PPM 1ml/lit (fb)HaNPV @250 LE/ha 47.6 (43.6) 48.3 (44.0) 67.8 (55.4) 79.3 (62.9)

2. Azadirachtin 10000 PPM 1ml/lit + Endosulfan 35 EC 1ml/lit (fb) HaNPV @250 LE/ha + Endosulfan 35 EC 1ml/lit 53.8 (47.2) 50.7 (45.4) 79.1 (62.8) 86.4 (68.4)

3. Azadirachtin 10000 PPM 1ml/lit (fb) Spinosad 45 SC 0.22 ml/lit 51.4 (45.8) 57.0 (49.0) 87.5 (69.3) 91.5 (73.0) 4. Azadirachtin 10000 PPM 1ml/lit (fb) Indoxacarb 14.5 SC 0.55 ml/lit 48.3 (44.0) 53.0 (46.7) 85.8 (67.9) 87.0 (68.9) 5. Azadirachtin 10000 PPM 1ml/lit (fb) Emamectin benzoate 5 SG 0.3 g/lit 51.9 (46.1) 57.1 (49.1) 89.6 (71.2) 94.9 (76.9) 6. Profenophos 50 EC 2.5 ml/lit (fb) Spinosad 45 SC 0.22 ml/lit 69.6 (56.5) 68.7 (56.0) 92.0 (73.6) 94.7 (76.7) 7. Profenophos 50 EC 2.5 ml/lit (fb) Indoxacarb 14.5 SC 0.55 ml/lit 71.8 (57.9) 74.5 (59.7) 90.5 (72.0) 92.6 (74.2) 8. Profenophos 50 EC 2.5 ml/lit (fb) Emamectin benzoate 5 SG 0.3 g/lit 73.3 (58.9) 72.1 (58.1) 97.9 (81.7) 99.6 (86.4)

9. Deltamethrin 1 EC + Triazophos 35 EC 2.5 ml/lit (fb) Spinosad 45 SC 0.22 ml/lit 76.8 (61.2) 74.3 (59.5) 95.8 (78.2) 97.7 (81.3)

10. Deltamethrin 1 EC + Triazophos 35 EC 2.5 ml/lit (fb) Indoxacarb 14.5 SC 0.55 ml/lit 99.1 (84.6) 88.2 (69.9) 99.8 (87.4) 99.1 (84.6)

11. Deltamethrin 1 EC + Triazophos 35 EC 2.5 ml/lit (fb) Emamectin benzoate 5 SG 0.3 g/lit - 73.2 (58.8) 79.7 (63.2) 91.4 (72.9) 99.8 (87.4)

12. Control 0.0 (0.6) 0.0 (4.4) 0.0 (0.6) 0.0 (3.9) SE(+m) 2.51 3.90 2.87 2.63 CD (P = 0.05) 7.81 11.14 8.94 7.71 CV % 10.03 22.97 8.53 11.06 Interaction (Season X Treatment) SE+m 4.61 5.30 3.12 3.91 CD (P = 0.05) NS NS NS NS

l Pooled mean data of trial at Pulses Research Unit, Dr. PDKV, Akola (2009-10 & 2010-11 ) and Zonal Agriculture Research Station, Yavatmal(2010-11)*Data subjected to Arc sine transformation for the analysis. {0 values = 0 + (1/4)*n and 100 = 100 - (1/4)*n} where n = no. of larvae in control plot.fb - followed by


cent pod damage (1.1%). The descending bio-efficacy trendof modules in terms of lower per cent pod damage by grampod borer was profenophos 2.5 ml/lit - emamectin benzoate0.3 ml/lit (Module 8) with 2.6% pod damage and it was at parwith Module 9 (Deltamethrin + triazophos 2.5 ml/lit - spinosad0.22 ml/lit) with 3.0% pod damage and Module 10 (Deltamethrin+ triazophos 2.5 ml/lit - indoxacarb 0.55 ml/lit) with 3.2% poddamage, respectively whereas, the untreated control plot hadpod damage of 20.2% (Table 2).

Reports of the lowest pod damage due to application ofemamectin benzoate (Ahmed and Ashraf 2004, Patil et al.2007, Duraimurugan et al. 2007), spinosad (Ahmed et al. 2004)and indoxacarb (Ahmed et al. 2004, Gowda et al. 2007, Singhand Yadav (2007) in respective study on pod borer in chickpeadepicts the potency of these chemistries. The inferences ofthe reviews about superiority trend of emamectin benzoatefollowed by spinosad and indoxacarb were in line with thefindings of the present study.Yield: The data on yield trends as a result of modulesintervention indicated highest yield due to application ofModule 11 (Deltamethrin + triazophos 2.5 ml/lit - emamectinbenzoate 0.3 g/lit) with yield level of 20.9 q/ha and was at parwith application of Module 8 (Profenophos 2.5 ml/lit -emamectin benzoate 0.3 g/lit) with yield of 19.5 q/ha, Module

9 (Deltamethrin + triazophos 2.5 ml/lit - spinosad 0.22 ml/lit)with yield of 19.5 q/ha and Module 6 (Profenophos 2.5 ml/lit –spinosad 0.22 ml/lit) with yield realization of 18.6 q/ha. Amongstthe treatments, the lowest yield was observed due toapplication of Module 1 (Azadirachtin 10000 PPM 1ml/lit -HaNPV @250 LE/ha) with 14.9 q/ha in turn significantlysuperior over untreated control with 12.7 q/ha (Table 2).

Higher ability of emamectin benzoate to prevent croplosses through lower pod damage and its translation intorealization of higher yield was evident in present study.Findings of Ahmed and Ashraf (2004) and Patil et al. (2007)corroborated the present findings. The next effective treatmentof spinosad (Ahmed et al. 2004) and indoxacarb (Ahmed etal. 2004, Gowda et al. 2007, Singh and Yadav 2007) were alsowell supported by the earlier workers.Economics: The highest monetary return of Rs. 16172 / hawas observed due to application of Module 11 (Deltamethrin+ triazophos 2.5 ml/lit - emamectin benzoate 0.3g/lit).Application of Module 8 (Profenophos 2.5 ml/lit - emamectinbenzoate 0.3 ml/lit), Module 9 (Deltamethrin + triazophos 2.5ml/lit - spinosad 0.22 ml/lit), Module 6 (Profenophos 2.5 ml/lit- spinosad 0.22 ml/lit), Module 10 (Deltamethrin + triazophos2.5 ml/lit - indoxacarb 0.55 ml/lit) and Module 5 (Azadirachtin10000 PPM 1ml/lit - emamectin benzoate 0.3 g/lit) also gave

Table 2. Mean per cent pod damage and chickpea grain yield

Pod damage (%) Yield q/ha Module Treatment Details PRU

2009 PRU 2010

YTL 2010

Pooled Mean

PRU 2009

PRU 2010

YTL 2010

Pooled Mean

1 Azadirachtin 10000 PPM 1ml/lit (fb) HaNPV @250 LE/ha 19.1 (4.4)

6.4 (2.5)

18.8 (4.3)

14.7 (3.7) 14.0 19.1 11.7 14.9

2 Azadirachtin 10000 PPM 1ml/lit + Endosulfan 35 EC 1ml/lit (fb) HaNPV @250 LE/ha + Endosulfan 35 EC 1ml/lit

12.3 (3.5)

4.8 (2.2)

13.0 (3.6)

10.0 (3.1) 15.4 19.3 12.0 15.6

3 Azadirachtin 10000 PPM 1ml/lit (fb) Spinosad 45 SC 0.22 ml/lit 9.8 (3.1)

3.0 (1.7)

8.7 (3.0)

7.2 (2.6) 15.9 23.9 12.6 17.5

4 Azadirachtin 10000 PPM 1ml/lit (fb) Indoxacarb 14.5 SC 0.55 ml/lit 11.1 (3.3)

4.2 (2.0)

10.4 (3.2)

8.5 (2.9) 15.5 19.7 12.2 15.8

5 Azadirachtin 10000 PPM 1ml/lit (fb) Emamectin benzoate 5 SG 0.3 g/lit

8.5 (2.9)

3.0 (1.7)

7.5 (2.7)

6.3 (2.5) 16.3 24.1 13.0 17.8

6 Profenophos 50 EC 2.5 ml/lit (fb) Spinosad 45 SC 0.22 ml/lit 8.1 (2.9)

2.9 (1.7)

7.7 (2.8)

6.2 (2.4) 17.1 24.8 13.9 18.6

7 Profenophos 50 EC 2.5 ml/lit (fb) Indoxacarb 14.5 SC 0.55 ml/lit 8.3 (2.9)

3.1 (1.7)

6.4 (2.5)

5.9 (2.4) 16.6 22.4 13.4 17.5

8 Profenophos 50 EC 2.5 ml/lit (fb) Emamectin benzoate 5 SG 0.3 g/lit 3.3 (1.8)

2.0 (1.4)

2.4 (1.6)

2.6 (1.6) 17.9 25.4 15.2 19.5

9 Deltamethrin 1 EC + Triazophos 35 EC 2.5 ml/lit (fb) Spinosad 45 SC 0.22 ml/lit

3.7 (1.9)

1.8 (1.4)

3.6 (1.9)

3.0 (1.7) 17.7 26.1 14.6 19.5

10 Deltamethrin 1 EC + Triazophos 35 EC 2.5 ml/lit (fb) Indoxacarb 14.5 SC 0.55 ml/lit

3.8 (2.0)

2.5 (1.6)

3.3 (1.8)

3.2 (1.8) 17.3 22.8 14.3 18.1

11 Deltamethrin 1 EC + Triazophos 35 EC 2.5 ml/lit (fb) Emamectin benzoate 5 SG 0.3 g/lit

1.9 (1.4)

0.6 (0.8)

0.8 (0.9)

1.1 (1.0) 19.7 26.2 16.8 20.9

12 Control 21.8 (4.7)

13.4 (3.7)

25.4 (5.0)

20.2 (4.5) 10.5 18.5 9.1 12.7

SE(+m) 0.09 0.09 0.13 0.13 0.71 0.94 0.65 0.91 CD (P = 0.05) 0.28 0.26 0.38 0.38 2.08 2.74 1.92 2.67 CV % 9.77 14.20 14.25 15.60 13.13 12.36 14.82 15.79 Interaction (Season X Treatment) SE+m 0.95 1.32 CD (P = 0.05) 2.79 NS

Data subjected to Square root transformations for the analysisPRU - Pulses Research Unit, Dr. PDKV, Akola, YTL - Zonal Agriculture Research Station, Yavatmal , fb - followed by

Wadaskar et al. : Calendar based application of newer insecticides for the management of gram pod borer in chickpea 145

higher monetary returns of Rs. 12752, 12570, 10377, 9980 and9432/ha, respectively (Table 3).

Incremental Cost Benefit Ratio referring to economicfeasibility of module arranged in descending trend was Module11 (Deltamethrin + triazophos 2.5 ml/lit - emamectin benzoate0.3 g/lit) – 1 : 6.0 followed by Module 8 (Profenophos 2.5 ml/lit- emamectin benzoate 0.3 g/lit) – 1 : 4.4, Module 9 (Deltamethrin+ triazophos 2.5 ml/lit - spinosad 0.22 ml/lit) – 1 : 4.2, Module5 (Azadirachtin 10000ppm 1ml/lit - emamectin benzoate 0.3 g/lit) – 1 : 4.1 and Module 10 (Deltamethrin + triazophos 2.5 ml/lit - indoxacarb 0.55 ml/lit) – 1 : 4.0 (Table 3).

Despite of the fact that for want of literature, presentfindings could not be compared on application of insecticideas a module that to on a calendar based approach, it is evidentfrom the present study that application of Module 11(Deltamethrin + triazophos 2.5 ml/lit - emamectin benzoate 0.3g/lit), Module 8 (Profenophos 2.5 ml/lit - emamectin benzoate0.3 g/lit) and Module 9 (Deltamethrin + triazophos 2.5 ml/lit -spinosad 0.22 ml/lit) were most economic and effective in termsof higher larval reduction, lower pod damage translating intohigher yield and monetary returns.

REFERENCES

Abdullah K, Khattak MK and Munir W. 2001. Laboratory bioassay ofthree doses of Deltamethrin + Triazophos (Detaphos 10 + 350 EC)on field collected medium to large sized Helicoverpa sp. larvaeinfesting gram pods. Online Journal of Biological Sciences 1: 155-157.

Ahmed S and Ashraf M. 2004. Comparative efficacy of Arrivo 10EC,Lannate 40SP and Timer (Emmamectin benzoate) 1.9EC indifferent doses against Helicoverpa armigera Hub. PakistanEntomologist 26: 95-99.

Ahmed S, Zia K and Shah NUR. 2004. Validation of chemical controlof gram pod borer, Helicoverpa armigera (Hub.) with newinsecticides. International Journal of Agriculture and Biology 6:978-980.

Barve HS and Patil SK. 2000. Efficacy of sole, strip and staggeredsprays of some insecticides against gram pod borer, Helicoverpaarmigera (Hubner) on chickpea. Insect Environment 6: 119-120.

Chandrakar HK and Shrivastava SK. 2001. Effect of insecticides oncontrol of Helicoverpa armigera (Hubn.) and their subsequentresurgence on chickpea. Environment and Ecology 19: 477-478.

Chaudhry JP and Sharma SK. 1982. Feeding behavior and larvalpopulation levels of Helicoverpa armigera (Hb.) causing economicthreshold damage to the gram crop. Haryana Agricultural UniversityJournal of Research 12: 462–466.

Deepa M and Srivastava CP. 2011. Genetic diversity in Helicoverpaarmigera (Hubner) from different agroclimatic zones of India usingRAPD markers. Journal of Food Legumes 24: 313-316.

Deshmukh SG, Sureja BV, Jethva, DM and Chatar VP. 2010. Field efficacyof different insecticides against Helicoverpa armigera (Hubner)infesting chickpea. Legume Research 33: 269 – 273.

Duraimurugan P, Kanna SS, Chandrasekaran S and Regupathy A. 2007.Field evaluation of emamectin 5SG against cotton bollworm,Helicoverpa armigera (Hübner). Pesticide Research Journal 19:186 -189.

Fitt GP. 1989. The ecology of Heliothis species in relation toagroecosystems. Annual Review of Entomology 34: 17-52.

Table 3. Economics for different modules under evaluation (Pooled mean)

Module Cost of

insecticide/ kg/l(Rs)

Cost of insecticide per ha (Rs)

Cost of Module per

ha (Rs)

Mean Increase in yield over control (q)

Cost of Increased yield @ 2300 Rs/q

Cost of Insecticide

(Rs/ha)

Plant protection application cost

(Rs/ha)

Net Profit (Rs/Ha) ICBR

Module 1 420 1600

210 400 610 2.2 5137 610 1603 3534 1 : 2.2

Module 2 420+280 1600+280

210+140 400+140 890 2.9 6593 890 1883 4710 1 : 2.5

Module 3 420 12730

210 1400 1610 4.8 10963 1610 2603 8360 1 : 3.2

Module 4 420 3360

210 924 1134 3.1 7130 1134 2127 5003 1 : 2.4

Module 5 420 7300

210 1095 1305 5.1 11730 1305 2298 9432 1 : 4.1

Module 6 640 12730

800 1400 2200 5.9 13570 2200 3193 10377 1 : 3.2

Module 7 640 3360

800 924 1724 4.8 10963 1724 2717 8246 1 : 3.0

Module 8 640 7300

800 1095 1895 6.8 15640 1895 2888 12752 1 : 4.4

Module 9 480 12730

600 1400 2000 6.8 15563 2000 2993 12570 1 : 4.2

Module 10 480 3360

600 924 1524 5.4 12497 1524 2517 9980 1 : 4.0

Module 11 480 7300

600 1095 1695 8.2 18860 1695 2688 16172 1 : 6.0

Module 12 - - - 0.0 - - - - - l Standard spray volume : 500 lit of water/ha * Average Market price of chickpea: Rs 2300 per quintal.

l Labour charges for spraying : 4 labour @ Rs 80 per day (2009-10) and Rs 120 per day (2010-11).l Knapsack spray pump rent : @ Rs 20/day (2009-10) and Rs. 25/day (2010-11) * Application cost Rs. 760 (09-10) and 1110/ha (10-11).


Gowda, DKS, Patil, BV and Yelshetty S. 2007. Performance of differentsprayers against gram pod borer, Helicoverpa armigera (Hubner)on chickpea. Karnataka Journal of Agriculture Sciences 20: 261-264.

Haware MP, 1998. Diseases of chickpea. In: DJ Allen and JM Lenne(Eds). The Pathology of Food and Pasture Legumes, CABInternational, Wallingford, UK. Pp 473-516.

Pal SK, Das VSR, and Armes NJ. 1996. Evaluation of insecticide mixturesfor controlling Helicoverpa armigera on chickpea. InternationalChickpea and Pigeonpea Newsletter 3: 44-46.

Patil SK, Ingle MB and Jamadagni BM. 2007. Bio-efficacy andeconomics of insecticides for management of Helicoverpa armigera(Hubner) in chickpea. Annals of Plant Protection Science 15: 307-311.

Puri SN, Murthy KS and Sharma OP. 1998. Integrated management ofinsect pests in chickpea and pigeonpea. In: Proceedings of NationalSymposium on Management of Biotic and Abiotic Stresses in PulsesCrops, 26-28 June 1998, Kanpur, India.

Rahman AUS, Noora J and Ahmad M. 2006. Efficacy of some newinsecticides against gram pod borer Helicoverpa armigera (Hub.) in

Peshawar. Sarhad Journal of Agriculture 22: 293-295.

Rashid A, Saeed HA, Akhtar LH, Siddiqi SZ and Arshad M. 2003.Comparative efficacy of various insecticides to control gram podborer Helicoverpa armigera (Hubner) on chickpea. Asian Journalof Plant Sciences 2: 403-405

Sharma HC. 2005. Heliothis/Helicoverpa Management: EmergingTrends and Strategies for Future Research. (ed. Sharma HC). Oxfordand IBH Publishers, New Delhi, India. Pp 469.

Singh SS and Yadav SK. 2007. Comparative efficacy of insecticides,biopesticides and neem formulations against Helicoverpa armigera(Hubner) on chickpea. Annals of Plant Protection Science 15:299-302.

Stanley J, Chandrasekaran S and Regupathy A. 2009. Baseline toxicityof emamectin and Spinosad to Helicoverpa armigera (Lepidoptera:Noctuidae) for resistance monitoring. Entomological Research 39:321–325.

Ujagir R, Chaubey AK, Sehgal VK, Saini GC and Singh JP. 1997.Evaluation of some insecticides against Helicoverpa armigera onchickpea at Badaun, Uttar Pradesh, India. International Chickpeaand Pigeonpea Newsletter 4: 22-24.


Short Communication

Genetic and molecular diversity analysis of chickpea (Cicer arietinum L.) genotypesgrown under rice fallow conditionA. SHRIVASTAVA, A. BABBAR, V. PRAKASH, N. TRIPATHI and M.A. IQUEBAL1

Department of Plant Breeding and Genetics, JNKVV, Jabalpur-482004 (MP), India; 1Indian Agricultural StatisticalResearch Institute, New Delhi-110012; E-Mail: [email protected](Received: November 30, 2011; Accepted : June 05, 2012)

ABSTRACT

Fifteen agro-morphological traits and seventeen SSR primerswere used in sixteen chickpea cultivars to study geneticdiversity among the accessions and their subsequentclassification. Sixteen genotypes were grouped into 5 clusters,out of which cluster I was the largest comprising 11 genotypes.Out of 17 primers screened, 15 showed polymorphism with anaverage 0.16 hetrozygocity and 0.763 similarity coefficients.Cluster analysis revealed two and five groups based onmorphological and molecular markers, respectively. Geneticdiversity assessment with different methods and theircomparison could provide complementary information forimprovement of chickpea.

Key words: Chickpea, Cluster analysis, Genetic diversity,Molecular markers

Chickpea is one of the most important pulse crop ofIndia grown in 7.89 million ha area with 7.06 million tonnesproduction and 895kg per ha productivity (DAC 2011). Asubstantial part of Kharif rice area remains fallow (11.65 m ha)during the Rabi season in India. Of this 82% of the rice fallowsare located in the states viz., Bihar, Madhya Pradesh,Chhattisgarh, Orissa and Assam (Subbarao et al. 2001).Chickpea is most suitable crop that can be grown profitablyon residual soil moisture in rice fallow with minimum irrigation.There is ample scope for expansion of high yielding, diseaseresistant and short duration chickpea varieties in rice fallowlands.

Knowledge of genetic variation is important tounderstand the genetic variability available and its potentialuse in breeding program. Morphological traits, despite theproblems associated with this method, continue to play a majorrole in studying and characterizing germplasm since it requiresno complicated laboratory facilities and procedures. Molecularanalyses in conjunction with morphological and agronomicevaluation of germplasm are recommended to increase theresolving power of genetic diversity analyses and providecomplementary information (Singh et al. 1991). In recent years,more sensitive DNA-based techniques like SSRs are developedwhich are most suitable because of easy in handling,reproducibility, multiallelic nature, co-dominant inheritance,relative abundance and genomic wide coverage (Powell et al.,1996). Therefore, present investigation was carried out to

assess the genetic variability and interrelationship of the traitsusing morphological and molecular markers among chickpeavarieties/genotypes grown under rice fallow condition.

Sixteen genotypes including 12 cultivars of chickpearecommended for central zone and 4 promising lines fromICRISAT were evaluated in rice fallow fields in RandomizedBlock Design (RBD) with three replications during Rabi 2010-11 at Seed Breeding Farm, JNKVV, Jabalpur (MP). Eachgenotype was comprised of 12 rows plot of 4m length withspacing of 30x10cm. The assessment of divergence for a setof characters using multivariate analysis (D2) was done (Table1). The intra cluster distance was higher in cluster I (11.40)which is having the higher number of genotypes followed bycluster II (9.00). The inter cluster distance is highest betweenthe cluster III and cluster IV (32.70) followed by between clusterII and cluster III (28.57) and cluster III and cluster IV (27.83).The lowest inter cluster distance were found in cluster I andcluster III (15.83). Clustering pattern of chickpea genotypesconfirmed the quantum of diversity present in material. Thecluster I was the largest among all the clusters, consisting 11genotypes. It was closest to cluster III followed by cluster II.Cluster II comprised of 2 genotypes viz., ‘ICCV 05106’, ‘ICCV06107’ and was nearest to cluster IV (‘AIG21’) followed bycluster V. Cluster III consisting of one genotype ‘DCP 92-3’was closest to cluster V which contained ‘Subhra’ (Table 2).These results indicate existence of some homology betweenclosely situated clusters. Therefore, crossing genotypes fromdifferent clusters would produce more genetic variability.

Maximum contribution towards genetic divergence wasby 100 seed weight followed by harvest index, total pods perplant, days to pod initiation, days to maturity and primarybranches per plant. However, seeds per pod did not show anycontribution towards genetic divergence (Table 3). The crossesamong genotypes of the cluster IV and V are likely to producedesirable recombinants for phenological traits, while crossingbetween cluster III (‘DCP 92-3’) and cluster IV (‘AIG 21’) mightprovide more pods/plant and better seed traits. These resultsare in conformity with the findings of Dwivedi and Gaibriyal(2009). Different clusters have higher mean values for differenttraits indicating that none of the cluster contained genotypeswith all the desirable characters, therefore recombinationbreeding between genotypes of different clusters issuggested.


For molecular characterization, DNA extraction was donefrom young leaves collected from randomly sampled individualplants of each cultivar. Total genomic DNA was isolated usinga modified cetyl trimethyl ammonium bromide (CTAB)extraction technique (Borsch et al., 2003). Determination ofthe quantity and quality of DNA was done by comparingDNA samples with Lambda Hind III ladder. A total of 17 SSRprimers were used (Table 4). The optimum reaction componentswere 6.5 ìl dH2O, 100 ìM of each dNTP 1 ìl of 10X Taq buffer,0.5 U Taq polymerase, 5 pmol each forward and reverse primerand 20 ng template DNA. The final reaction volume per samplewas 10 ìl. PCR amplification conditions were set as: Initialdenaturing at 94°C for 4 min followed by 40 cycles of 94°C for30s, 45-60°C for 30s, and 72°C for 45s and ended with extensionphase of 72°C for 5 min. Amplification products of all the 17SSR markers were denatured and resolved on 4% denaturedpolyacrylamide gel as described by Chen et al. (1997).Electrophoresis (PAGE) was run at 2000 V for about 2:00 hoursin 0.5X TBE buffer. The resultant gel was visualized afterstaining with silver nitrate. The PCR products were scoredqualitatively by comparing with the 20bp ladder. Power Markerversion 3.25 (Liu & Muse, 2005) was used to calculate theaverage number of alleles, gene diversity, and polymorphicinformation content (PIC) values. Genetic similarities betweenthe genotypes were measured by Similarity Coefficient basedon the proportion of shared alleles using ‘simqual’ sub-program of NTSYS-PC version 1.8 (Exeter Software, Setauket,NY, U.S.A.) software package (Rohlf, 1993). The resultantsimilarity matrix data was used to construct dendrograms byusing the un-weighted pair-group method with an arithmeticaverage (UPGMA) subprogram of NTSYS-PC. Based on

Out of 17 SSR markers screened, fifteen markers werefound polymorphic and two monomorphic. The maximumnumbers of alleles (nine) were found in primer TA2 followedby eight alleles by primers TA194 and TA72. The size ofamplified markers ranged from 120bp (TA194) to 421bp (TA200)(Table 4). The average numbers of allele were 6.52 which issimilar to findings of Sethy et al. (2006). Besides, a very lowhetrozygocity was detected with an average of 0.025 which issimilar to findings of Chaudhary et al. (2009). The range ofpolymorphic information content of SSR markers rangedbetween 0.000 to 0.835 with an average 0.693 where the rangeof PIC was 0.04 to 0.92 and the markers detected 71% genediversity in the investigated materials.

Some SSR markers were found to have higherdiscriminating power for differentiation of genotypes, 36

Table 1. Intra and inter distance of chickpea genotypesCluster I II III IV V I 11.40 18.89 15.83 21.28 20.32 II 9.00 28.57 18.86 18.88 III 0.00 32.70 27.83 IV 0.00 15.49 V 0.00 Table 2. Distribution of chickpea genotypes in different

clusters based on morphological charactersCluster

no No. of

genotypes Genotype

I 11 Rajas, JG 14, JG 11, PUSA 547, Vaibhav, GCP 105, ICCV 07111, PG 186, PUSA 372, JAKI 9218, JG 16

II 2 ICCV 05106, ICCV 06107 III 1 DCP 92-3 IV 1 AIG 21 V 1 Subhra

Table 3. Contribution of different characters towardsclustering of chickpea

S. No.

Character Time ranked Percentage contribution towards divergence (%)

1. DFF 0 0.00 2. DFI 0 0.00 3. PI 0 0.00 4. DM 0 0.00 5. PH (cm) 1 0.83 6. PB 0 0.00 7. SB 1 0.83 8. TP 17 14.17 9. EP 1 0.83 10. 100SW (g) 59 49.17 11. S/P 0 0.00 12. SY/plant (g) 2 1.67 13. BY(g) 1 0.83 14. HI (%) 31 25.83 15. Seed yield (kg/ha) 7 5.83

DFI= Days to flower initiation, DFF= Days to 50% flowering, PI= PodInitiationDM= Days to maturity, PH= Plant Height, PB= Primary Branches,SB= Secondary Branches, TP= Total Pods/plant EP= Effective Pods/plant, 100 SW= Hundred Seed Weight, S/P= Seeds/Pod, SY= Seed Yield/plant, BY (g)= Biological Yield, HI (%)= Harvest Index

Table 4. Details of SSR markers, number of bands, majorallele frequency, gene diversity, hetrozygocity, andPIC values obtained using SSR markers

Marker Total allele

Polymor-phic allele

Unique allele

Range Gene diversity

Heterozygocity

PIC

STMS 11 1 0 0 261-281 0 0 0 GAA 47 1 0 0 160186 0 0 0 TA 72 8 8 3 259-292 0.843 0 0.825 TA 2 9 9 5 140-176 0.851 0 0.835 TA 146 8 8 1 143-195 0.835 0 0.814 TR 20 6 6 1 156-169 0.767 0.312 0.73 TS 72 6 6 2 288-315 0.734 0 0.702 TS 54 7 7 4 267-320 0.773 0 0.741 ICCM 0293 6 6 1 278-320 0.83 0.062 0.809 ICCM 0127 6 6 1 320-375 0.818 0.062 0.792 TA 103 7 7 1 196-225 0.82 0 0.796 TA 194 8 8 4 120-169 0.82 0 0.799 TA 200 6 6 4 389-421 0.742 0 0.713 TR 58 7 7 2 248-280 0.835 0 0.814 TA 96 7 7 1 264-300 0.843 0 0.823 GA 16 7 7 2 238-267 0.828 0 0.805 GA 20 7 7 4 167-187 0.812 0 0.789 Mean 6.294 6.176 2.117 160 0.714 0.025 0.693

standardized morphological traits value, Euclidian distancesbetween chickpea genotypes were calculated. The Manteltest of significance (Mantel, 1967) was also used to comparethe molecular and morphological traits matrices producedabove.

Shrivastava et al. : Genetic and molecular diversity analysis of chickpea genotypes 149

specific alleles (Table 5) were amplified by fifteen primers.These primers separated specific chickpea genotype fromremainings which is similar to findings of Joshi et al., (2010).Multiple alleles were amplified by three primers viz, TR20,ICCM0127 and ICCM0293 (Table 6). Vurul and Akcin (2010)also found multiple alleles in five primers. Based on bandingpattern of SSR markers, all the genotypes of chickpea weregrouped into two clusters. The first cluster consisted of fourgenotypes namely Rajas, JG 14, JG 11 and GCP105. Secondcluster divided into four subgroups. Subgroup A containedPUSA 372, DCP92-3, PG 186 and PUSA 547, whereas subgroupB contained Vaibhav, ICCV06107, ICCV05106 and ICCV 07111genotypes. Subgroup C consisted Subhra, JG 16 and JAKI9218, whereas subgroup D contained a single genotypenamely AIG21. UPGMA cluster analysis showed all ICCVgenotypes in same subcluster that indicated higher geneticsimilarity among them, similarly both PUSA genotypes were

Table 5. SSR markers amplified specific alleles in chickpeaPrimers Genotypes Alleles Size (bp) TA 103 PUSA 372 E 218

JG 11 C 139 JAKI 9218 D 149 JG 14 E 152

TA 194

Rajas F 154 Rajas A 389 JG 11 B 393 Vaibhav E 407

TA 200

AIG 21 F 421 DCP 92-3 D 262 TR 58 AIG 21 G 280

TR 96 Rajas D 276 JG 11 A 238 GA 16 PUSA 547 C 248 DCP 92-3 B 169 PUSA 547 C 173 Subhra D 178

GA 20

GCP 105 E 180 DCP 92-3 D 271 GCP 105 E 275

TA 72

AIG 21 H 292 PUSA 547 A 140 AIG 21 B 142 PUSA 372 E 160 JG 14 F 162

TA 2

GCP 105 H 172 TA 146 JAKI 9218 F 180 TR 20 Subhra A 156

AIG 21 A 288 TS 72 GCP 105 F 315 AIG 21 A 267 ICCV 07111 B 280 Vaibhav F 312

TS 54

GCP 105 G 320 ICCM 0293 Rajas B 285 ICCM 0127 Rajas A 320 Table 6. SSR markers amplified multiple alleles in chickpeaPrimers Genotypes Size (bp)

JG 16 160/163 PG 186 163/166 DCP 92-3 163/166 PUSA 372 163/166

TR 20

AIG 21 166/169 ICCM 0293 ICCV 06107 278/301 ICCM 0127 JG 16 356/375

in same cluster and JG11 and JG14 were also together in anothercluster.

The correlation between morphological similarity matrixand molecular similarity matrix (GS) were not significant(Mantel test, r = -0.057; P = 0.2728). There was also nocorrelation between dendrograms generated by morphologicaland molecular data except that both the dendrogram placedthe two genotypes ICCV 05106 and ICCV 06107 in the samegroup. The reason may be that the very few markers wereused in the present study. There was close relationshipbetween some of the genotypes, presumably they might havebeen collected from similar locations. The present studysuggested that genotypes which were found to be diversebased on both morphological and molecular diversity analysiscan be used for making crosses for getting better recombinantsto develop chickpea varieties suitable for rice fallow situationof Madhya Pradesh, India.

REFERENCES

Anonymous .2011. Directorate of Economics and Statistics, DAC,Govt. Of India.

Borsch T, Hilu KW, Quandt D, Wilde V, Neinhuis C and Barthlott W.2003. Noncoding plastid trnT-trnF sequences reveal a well resolvedphylogeny of basal angiosperms. Evolutionary Biology 16: 558-76.

Chaudhary S, Sethy NK, Shokeen B and Bhatia S. 2009. Developmentof chickpea EST-SSR marker and analysis of allelic variation acrossrelated species. Theoretical and Applied Genetics 118: 591-608.

Chen X, Temnykh S, Xu Y, Cho YG and McCouch SR. 1997.Development of a microsatellite framework map providing genomewide coverage in rice (Oryza sativa L.). Theoretical and AppliedGenetics 95: 553–567.

Dwevedi KK and Gaibriyal ML. 2009. Assessment of genetic diversityof cultivated chickpea (Cicer arietinum L.). Asian Journal ofAgricultural Sciences 1: 7-8.

Joshi N, Rawat A, Subramanian RB and Rao KS. 2010. DNA isolationfrom chickpea. Indian Journal of science and technology 3:1214-17.

Liu K and Muse SV. 2005. PowerMarker: an integrated analysisenvironment for genetic marker analysis. Bioinformatics 21: 2128–2129.

Mantel NA. 1967. The detection of disease clustering and a generalizedregression approach. Cancer Research 27: 209–220.

Powell W, Marchray GC and Provan J. 1996. Polymorphism revealedby simple sequence repeats. Trends in Plant Science 1: 215-22.

Rohlf, F J. 1993. NT-SYS-pc: Numerical Taxonomy and MultivariateAnalysis System. Version 2.11V, Exteer Software, Setauket, NY, USA.

Sethy N K, Shokeen B, Edwards KJ and Bhatia S. 2006. Developmentof microsatellite markers and analysis of intra specific geneticvariability in chickpea (Cicer arietinum L.). Theoretical and AppliedGenetics 112: 1416-1428.

Singh SP, Gutiérrez JA, Molina A and Gepts P. 1991. Genetic diversityin cultivated common bean: II. Marker-based analysis ofmorphological and agronomic traits. Crop Science 31: 23-29.

Subbarao GV, Rao JVDK, Kumar J, Johenson C, Ahmed I, Rao MVK,Ventatraman L, Hebbar KR, Sesha SAI and Harris D.2001. Spatialdistribution and quantification of rice fallow in South Asia Potentialfor legumes. ICRISAT Patancheru (AP), Indai. Pp 316.

Vural HC and Akcin A. 2010. Molecular analysis of chickpea speciesthrough molecular marker. Biotechnology 24:1828-32.


Short Communication

Assessment of genetic diversity among interspecific derivatives in chickpeaRUPINDER PAL SINGH1, INDERJIT SINGH1, SARVJEET SINGH1 and J S SANDHU2

1Department of Plant Breeding and Genetics, Punjab Agricultural University, Ludhiana, Punjab, India; 2 ICAR, NewDelhi, India; Email: [email protected](Received: November 30, 2011; Accepted: May 26, 2012)

ABSTRACT

Assessment of genetic diversity existing in and betweengermplasm groups for yield and its components is veryimportant for selecting parental combinations to obtainsuperior recombinants which will help understanding patternof variation for planning future breeding programme. Aninvestigation was carried out among the 64 genotypes ofchickpea that included 60 interspecific derivatives, their parentsand two standard checks, to study the nature and magnitude ofgenetic divergence using Mahalanobis D2 statistics. The datawere recorded on 11 morphological traits from the genotypesraised in Simple Lattice Design having three replications. The64 genotypes were grouped into 9 clusters. Cluster II was thelargest with 14 genotypes. Highest inter-cluster distance wasrecorded between cluster VI and IX while highest intra clusterdistance was found among the genotypes of cluster VIII.Characters like biological yield per plot, seed yield per plotand days to 50 per cent flowering contributed maximum towardsthe genetic diversity. The genotypes GL29009, GL29012,GL29013, GL29017, GL29019, GL29034, GL29042, GL29046,GL29069, GL29072 and GL29078 were identified as geneticallydiverse parents which can be used for future crop improvementprogramme.

Key words: Chickpea, Genetic divergence, Interspecificderivatives, Mahalanobis D2 statistics

Chickpea (Cicer arietinum L.) is third most importantgrain legumes in the world cultivated on 11.55 million hectareswith production of 10.46 million tons (FAO STAT 2010). Indiais the largest producer of chickpea in the world with a share ofabout 72% of area and production (FAO STAT 2010). It iscultivated on 8.75 million hectares with production of 8.25million tons (Singh 2011). Due to limited genetic variabilitywithin the primary gene pool, the genetic improvement ofchickpea by classical breeding involving inter-varietal crosseshas met with limited success (Singh and Ocampo 1993) andthus, the use of interspecific hybridization was advocated tobroaden the genetic base of cultivated species (van Rheenenet al 1993 and Singh et al 2005). Utilization of exotic germplasmin breeding programmes is needed to enhance the productivityand diversity of cultivars (Duvick 1995 and Cox et al 1988).However, exploitation of wild species has remained confinedto major cereals and cash crops. Quantification of geneticdiversity in existing groups of germplasm for yield and itscomponents is very important in planning breeding programme

of crop plants. It not only helps in selection of parents to getsuperior recombinants but also in understanding the patternof variation for different characters and hence improvingchoices of selecting better segregants for various importanttraits. Crosses involving genetically diverse parents are likelyto produce high variability in segregating generations. But,no attempt has been made possibly to assess the geneticdivergence in interspecific derivatives. A number of techniquessuch as Metroglyph analysis (Anderson 1957), MahalanobisD2 technique (Mahalanobis 1936) and Non hierarchialEuclidian cluster analysis (Beale 1969) are in vogue forassessing genetic diversity. The D2 statistics is a powerfultool for quantifying the genetic divergence in the germplasm(Rao 1952). Therefore, the present study was undertaken tostudy genetic divergence among the interspecific derivativesof chickpea and to identify potentially divergent parents forfuture hybridization programmes for yield traits.

An interspecific cross involving ICCV96030 (Cicerarietinum) and Acc. No. 188 (Cicer pinnatifidum) wasgenerated and advanced to isolate 193 derivatives. The femaleparent ICCV96030 is an early maturing line, while male parentAcc. No. 188 is derivative of cross with Cicer pinnatifidumand possessing some desirable traits like higher number offruiting branches, pods per plant and high degree of resistanceto Botrytis grey mould and Ascochyta blight. Thesederivatives were evaluated for various morphological traitsduring rabi 2009-10. Sixty derivatives were short listed for theassessment of genetic diversity. For the present study, theexperimental material comprised of 60 derivatives, their parentsand two standard checks PBG 1 and GPF 2. The material wasgrown during rabi (winter) season 2010-11 in a Simple LatticeDesign with three replications at experimental field area ofPulses Section, Department of Plant Breeding and Genetics,Punjab Agricultural University, Ludhiana. All the genotypeswere sown in 30 cm wide paired rows of 1.5 m length. Standardpackage of practices was followed to raise the crop. Datawere recorded for the morphological traits i.e. days to flowering,days to maturity, seed yield per plot, biological yield per plotand harvest index on whole plot basis whereas, five plants ofeach genotype were randomly tagged for characters likeprimary branches, secondary branches, plant height, podsper plant, seeds per pod and 100-seed weight. Genetic diversitywas studied using D2 statistic proposed by Mahalanobis (1936)and clustering of genotypes was done according to Tocher’smethod (Rao 1952).

Singh et al.: Assessment of genetic diversity among interspecific derivatives in chickpea 151

The pooled analysis of variance for the experimentaldesign showed highly significant differences among thegenotypes for all the characters studied indicating presenceof genetic variability that has been generated from aninterspecific cross. Based on D2 values, genotypes weregrouped into 9 clusters (Table 1). Cluster II contained maximumnumber of genotypes (14) followed by cluster V and clusterVII (9), cluster III (8), cluster I and cluster VIII (6), while clusterIV, VI and IX each had four genotypes indicating greateramount of diversity of the respective genotypes from theothers. Similar results for clustering of cultivated genotypeswere obtained by Dwevedi and Lal (2009) and Wadikar (2010).Both the parents fell into different clusters suggesting thatthey were diverse from each other, though the distancebetween cluster V (ICCV96030) and VI (Acc. No. 188) wasmoderate.

The intra cluster distance based on D2 values (Table 2)was maximum in cluster VIII (60.89) and minimum in cluster III(31.44) indicating that genotypes in cluster VIII were mostdiverse. Regarding the inter-cluster distance, the maximumdivergence was noticed between cluster VI and IX (551.09)followed by cluster V and IX (444.40), cluster VI and VII(414.32), cluster VI and VIII (371.60), cluster I and IX (356.36),cluster III and VI (327.24) and cluster V and VII (308.77). Themembers of cluster II and III were least divergent as revealedby their inter-cluster distance (74.87). Higher inter-clusterdistance between cluster VI and IX revealed the existence ofmaximum diversity among the genotypes which can be usedin recombination breeding programme for obtaining desirablesegregants. Earlier, Lal et al (2001) and Lokare (2007) havealso conducted similar studies on cultivated chickpea

genotypes and suggested to use diverse parents forhybridization.

A perusal of Table 3 indicated considerable variation incluster mean values for all the 11 characters. Cluster III showedhighest mean performance for seeds per pod while genotypesin cluster V were early in 50 per cent flowering and maturity.Genotypes in cluster VI possessed the highest meanperformance for primary branches, whereas genotypes incluster VII showed high values for pods per plant, seed yieldper plot and harvest index. The tall genotypes were groupedin cluster VIII whereas genotypes in cluster IX possessedhigher number of secondary branches, higher biological yieldand more 100-seed weight. With respect to the contributionof individual character, biological yield per plot contributedthe maximum (82.19%) towards the observed diversityfollowed by seed yield per plot (14.98%) and days to 50 percent flowering (1.93%). Characters like plant height (0.45%),pods per plant (0.25%), days to maturity (0.15%) and 100-seed weight (0.05%) had very little contribution towards thedivergence (Table 3).

On the basis of above observations, it is quite obviousthat clustering pattern should be utilized in identifying thepromising genotypes for different characters which will serveas good donors for exploitation in further breeding programme.The higher inter-cluster distances than intra-cluster distancesindicated wider genetic diversity between genotypes ofdifferent clusters with respect to the traits studied. On thebasis of inter-cluster distances and cluster means in the presentstudy, genotypes GL29009, GL29012, GL29013, GL29017,GL29019, GL29034, GL29042, GL29069, GL29248, GL29272,

Table 1. Grouping of 64 chickpea genotypes into different clusters on the basis of D2 analysis

S. No. Cluster number

Number of genotypes in cluster Genotypes

1 I 6 GL29004, GL29006, GL29008, GL29017, GL29063, GL29232

2 II 14 GL29013, GL29019, GL29026, GL29031, GL29039, GL29058, GL29076, GL29079, GL29083, GL29243, GL29244, GL29267, GL29272, GPF 2

3 III 8 GL29012, GL29023, GL29036, GL29057, GL29080, GL29095, GL29099, GL29259 4 IV 4 GL29068, GL29093, GL29096, GL29213 5 V 9 GL29009, GL29015, GL29059, GL29065, GL29066, GL29072, GL29088, GL29248, ICCV96030 6 VI 4 GL29045, GL29061, GL29064, C. pinnatifidum Acc No. 188 7 VII 9 GL29020, GL29022, GL29034, GL29042, GL29046, GL29047, GL29098, GL29221, GL29278 8 VIII 6 GL29067, GL29069, GL29071, GL29198, GL29206, PBG 1 9 IX 4 GL29021, GL29052, GL29204, GL29224

Table 2. The Inter and Intra (underlined) cluster distances (vD2) among 64 chickpea genotypes

Cluster No. Cluster I Cluster II Cluster III Cluster IV Cluster V Cluster VI Cluster VII Cluster VIII Cluster IX Cluster I 49.34 76.53 137.01 118.48 96.36 199.56 223.40 179.53 356.36 Cluster II 37.99 74.87 87.13 153.99 258.47 159.69 129.80 299.25 Cluster III 31.44 75.82 221.90 327.24 94.78 76.21 231.32 Cluster IV 38.41 201.95 306.33 143.22 80.32 251.36 Cluster V 44.55 114.96 308.77 266.27 444.40 Cluster VI 45.51 414.32 371.61 551.09 Cluster VII 49.69 95.97 155.18 Cluster VIII 60.89 184.93 Cluster IX 56.75


GL29278 and ICCV96030 were found to be suitable forhybridization programme (Table 4). To create wide spectrumof variability and to isolate desirable segregants, thegenotypes of clusters having moderate to high distancesshould be intermated. A large amount of variability has beengenerated among the progenies derived from one cross. Theseresults indicated that large amount of variability can begenerated by selecting diverse parents specially through pre-breeding efforts by involving wild Cicer species inhybridization. These types of efforts will not only generatevariability for yield components but may also contribute usefultraits for various biotic and abiotic stresses.

REFERENCES

Anderson E. 1957. A semi graphic method for the analysis of complexproblems. Naional Acadamy Science, Washington 43: 923-27.

Beale EML. 1969. Euclidean cluster analysis. A paper contributed to37th session of the International Statistical Institute.

Cox TS, Murphy JP and Goodman M. 1988. The contribution of exoticgermplasm to American agriculture. In: Kloppenburg J R (ed.),Seeds and Sovereignty: The Use and Control of Plant GeneticResources. Duke University Press, Durham, NC. Pp 114.

Dwevedi KK and Lal GM 2009. Assessment of genetic diversity ofcultivated chickpea (Cicer arietinum L.). Asian Journal ofAgricultural Science 1: 7-8.

Table 3. Mean performances of different clusters for different morphological traits of 64 chickpea genotypes and contribution ofdifferent traits towards genetic divergence

Cluster No. Days to 50 % flowering

Days to Maturity

Plant height (cm)

Primary branches

Secondary branches

Pods per plant

Seeds per pod

Seed Yield per plot (g)

Biological Yield per plot (g)

100-seed weight (g)

Harvest Index

Cluster I 89.67 146.67 49.89 1.89 7.94 17.50 1.22 91.32 274.39 16.81 0.35 Cluster II 92.88 146.64 44.86 2.00 10.23 22.59 1.43 135.29 322.62 14.88 0.43 Cluster III 100.91 146.37 52.16 2.00 8.83 22.00 1.58 158.15 387.91 15.60 0.42 Cluster IV 95.75 149.25 49.91 2.00 9.75 16.83 1.00 86.30 387.50 17.74 0.23 Cluster V 82.00 144.40 41.48 1.89 7.37 14.26 1.00 64.69 190.40 15.93 0.36 Cluster VI 95.16 150.41 33.83 2.08 9.25 15.50 1.00 30.32 89.00 13.18 0.34 Cluster VII 94.00 146.11 46.78 2.03 8.74 29.89 1.29 199.97 464.63 17.90 0.44 Cluster VIII 105.22 150.78 58.33 2.00 8.61 21.78 1.33 122.42 446.00 14.23 0.28 Cluster IX 97.91 147.75 52.58 2.00 11.50 26.00 1.16 185.14 616.67 20.44 0.30 Percent contribution towards divergence 1.93 0.15 0.45 0.00 0.00 0.25 0.00 14.98 82.19 0.05 0.00 Table 4. Promising genotypes in each cluster for specific traitsGenotype Cluster No. Trait for which it may be used GL29017 I Moderately early to 50 percent flowering and maturity GL29013, GL29019, GL29272 II Moderate to maturity, More number of primary branches GL29012 III High number of seeds per pod GL29068 IV Moderate 100-seed weight GL29009, ICCV 96030 V Early to 50 percent flowering and maturity GL29045 VI Highest number of primary branches GL29034, GL29042, GL29278 VII Higher seed yield and harvest index GL29069 VIII Maximum plant height, More number of primary branches GL29021 IX Higher number of secondary branches, more pods per plant, higher biological yield

and high 100-seed weight

Duvick D. 1995. Security and long-term prospects for conservation of

genetic resources. Research Domes International AgribusinessManage 11: 33-45.

Food and Agricultural Organisation of the United Nations. 2010. FAOStatistical Database. Available at http://faostat.fao.org/FAO,Rome.

Lal D, Ram Krishna and Singh G. 2001. Genetic divergence in chickpea.Indian Journal of Pulses Research 14: 63-64.

Lokare YA, Patil JV and Chavan UD. 2007. Genetic analysis of yieldand quality traits in kabuli chickpea. Journal of Food Legumes 20:147-49.

Mahalanobis PC. 1936. On the generalized distances in statistics.Proceedings of the National Institute of Sciences of India 2: 49-55.

Rao CR. 1952. Advanced Statistical Methods In Biomedical Research.John Wiley and Sons, Inc. New York. 390 Pp.

Singh NP. 2011. Project Coordinator’s Report, 2010-11. All IndiaCoordinated Research Project on Chickpea, Indian Institute ofPulses Research, Kanpur, 208 024.

Singh KB and Ocampo B. 1993. Interspecific Hybridization in annualCicer species. Indian Journal of Genetics and Plant Breeding 47:199-204.

Singh S, Gumber RK, Joshi N and Singh K. 2005. Introgression fromwild Cicer reticulatum to cultivated chickpea for productivity anddisease resistance. Plant Breeding 124: 477-80.

Van Rheenen HA, Pundir RPS and Miranda JH. 1993. How to acceleratethe genetic improvement of a recalcitrant crop species such aschickpea. Current Science 65: 414-17.

Wadikar PB, Ghodke MK and Pole SK. 2010. Genetic divergence forproductivity traits in chickpea. Journal of Food Legumes 23: 245-46.


Short communication

Effect of nitrogen management on soil fertility and NPK uptake in soybeanK.S. RATHOD, R.K. PANNU and S.S. DAHIYA

Department of Agronomy, CCS Haryana Agricultural University, Hisar-125004, Haryana, India;E-mail: [email protected](Received: April 19, 2011; Accepted: April 04, 2012)

ABSTRACT

A field experiment was carried out to study the effect of Nmanagement on soil fertility and nutrient uptake in soybean.The study revealed that both seed and straw yield weresignificantly increased with increase in N dose with decliningyield response at higher level. However, NPK uptake by soybeanincreased significantly with increasing levels of nitrogen.Integration of chemical fertilizer with Rhizobium increasedseed yield and NPK uptake. Splitting half of N at 50 days aftersowing (DAS) was found significantly better over 80 DAS.

Key words: N management, NPK uptake, Soil fertility, Soybean

Soybean [Glycine max (L.) Merr] is an importantleguminous crop grown to augment protein and oil supply.Being a leguminous crop it is expected to improve soil fertilityespecially nitrogen status of soil through biological N fixation(BNF). However, several studies have shown that thesymbiotic N-fixation is not able to meet out the high nitrogenrequirement in this crop due to its high yield potential andhigh protein content in seeds. Application of excessive basalN promotes vegetative growth that can lead to reduction indevelopment of nitrogen fixing nodules and BNF. To assurecontinuous N supply to the crop and to improve its efficiency,split application of N may be helpful for raising crop yield andreduce soil and water pollution due to leaching. Soybean hasa relatively high N requirement, especially at later growthstages for the formation of amino acids needed to produceseeds with high protein content. Furthermore, supplementinginorganic nitrogenous fertilizers with biofertilizers may sustainsoil fertility and crop productivity (Behera et al. 2007). Keepingthis in view, a field investigation was carried out to improveproduction of soybean while maintaining soil fertility by wayof integrated N management.

A field experiment was conducted at AgronomyResearch Farm of Choudhary Charan Singh HaryanaAgricultural University, Hisar, India (290 10’N, 750 48’E and215 M above mean sea level) during kharif 2009. Theexperiment was laid out in randomized block design (RBD)involving 17 treatments (Table 1) with three replications. Theslightly alkaline (pH 7.7) sandy loam soil of experimental fieldwas low in available N (155.4 kg/ha), medium in available P2O5(20.3 kg/ha) and available K2O (254.8 kg/ha) and low in soilorganic carbon (0.40%). The seed was inoculated with

Rhizobium japonicum by adopting standard procedure asper treatments. The recommended doses of P and Zn wereapplied at 80 kg P2O5 and 25 kg ZnSO4 per hectare, respectively.Full dose of P and Zn in form of single super phosphate (SSP)and zinc sulphate (ZnSO4), respectively was furrow placed atthe time of sowing. The quantity of urea was calculated andapplied as per treatments. Yellow mosaic resistant and highyielding soybean (yellow seeded) variety ‘JS-335’ of 120 daysduration released in 1994 by JNKVV, Jabalpur was sown in thethird week of July at a seed rate of 80 kg/ha at a row spacing of30 cm in line. Thinning was made at 15 days of sowing tomaintain a uniform plant to plant spacing of 10 cm. The totalrainfall received during crop growing season at Hisar was320.7 mm in 21 rainy days. The crop was raised with standardagronomic practices. The crop was harvested on November8, 2009. NPK analysis of plant and soil samples at harvestwere analysed following the standard procedures.

Study revealed that seed yield was increased withincreasing levels of nitrogen. Inoculation as well as its combinedapplication along with N also influenced seed yield of soybean(Table 1). Seed yield was increased by 14.5, 23.1, 29.2 and34.5% over control following application of 20, 40, 60 and 80kg N/ha, respectively. It was further increased by 10.1, 5.3, 9.4and 8.5% with inoculation alone and with combinedapplication of N @ 20, 40 and 60 kg/ha and inoculation overuninoculated control and at their respective N levels appliedalone at sowing (20, 40 & 60 kg N/ha), respectively. Seed yieldwas highest at 60 kg N/ha along with Rhizobium inoculation,but it was statistically at par with 80kg N/ha alone appliedeither in full as basal or in two splits (basal and at 50 or 80DAS). This might be due to higher growth of the crop andlonger crop growth period. Inoculation provided favourableconditions for the multiplication of nodule bacteria which inturn produced more number of nodules and thereby more Nwas fixed for use by the plants. All this enabled crop plants toutilize sufficient N during its growth and development thatresulted in better fruiting (pods per plant) and higher seedyield. These results were in conformity with the findings ofShivakumar and Ahlawat (2008) on soybean.

N, P and K uptake by soybean also increasedsignificantly with increasing levels of N as all the N levelsrecorded significantly higher N uptake over control. Inaddition, both N and P content in soybean seed were 7.4 and


5.5 times higher than that in its straw, respectively (data notgiven). But, K content was 1.7 times higher in straw than thatin seed. Higher N and P content in seed may be due to more Naccumulation as the constituent of protein, whereas higher Kcontent in straw was due to more K accumulation in theformation of cell wall. The ratio of N, P and K content in seedand straw of soybean also narrowed down at higher level of Napplication. This was mainly attributed to the fact that higherN availability reduced translocation of these nutrients due topoor sink development under fertilized crop. These resultsconfirmed the findings of Vijayapriya et al. (2006).

Inoculation of seed also resulted in significant increasein N, P and K content and uptake over uninoculation.Combined application of N along with inoculation recordedsignificantly higher uptake of N, P and K over their applicationalone at all the N levels. It might be due to higher amount of Nwas added to soil by fertilizer as well as by symbiotic N fixationby these treatments that increased its availability to the plants.Higher N availability at higher doses and responsiveness ofcrop increased meristematic activities in different plant partswhich also required more P and K for fulfilling their energyand tissue requirement. Tahir et al. (2009) also reported similarresults in soybean in the sub-humid hilly region of Pakistan.

Thus, N, P and K uptake was significantly higher withincreased dose of N either applied as basal dose or splitted orintegrated with Rhizobium due to significant increase in seedand straw yield in these treatments (Table 1). The quantum ofuptake of these nutrients followed similar trend as those ofseed and straw yield. However, the uptake of N reduced witheach increase in N dose, whereas, P and K uptake increasedcontinuously at the same pace. N being an essentialconstituent of chlorophyll, protoplasm and various enzymes,it governs the utilization of P and K. Thus, ample availability

of N in these treatments involving fertilizer and inoculationresulted in increase in N content and uptake by crop; and thisin part was also attributed to higher biological yield in thesetreatments. These results are in conformity with those reportedby Dashora and Solanki (2010).

Available N status of soil also increased with increasinglevels of N and the highest available N was found at highestdose of N i.e., 80 kg/ha. However, available P and K status ofsoil decreased non-significantly with increasing dose of N.This may be due to fact that removal of nutrients from soilwas more in these treatments and higher amount of nutrientswere required to produce higher yield. Unfertilized controlrecorded highest available P and K in soil, which weresignificantly higher over those at 40 kg N/ha and above.Inoculation as well as its combined application with N alsodecreased available P and K status of soil but it was found atpar with both uninoculated control and with their respectivelevels of N, respectively. For residual P and K status, splittingof half of N to 50 or 80 DAS was also found at par with all theN levels. Walia and Kler (2007) and Shivkumar and Ahlawat(2008) too reported the positive non-significant balance of Pand K with inoculation and N application.

Thus, the status of available N, P and K in soil afterharvest of soybean was improved due to combined applicationof N and inoculation; and also in part due to decaying rootsand leaf falls. The improvement in N status of soil with higherN dose indicated that whole of N applied was not utilized bycrop as partial requirement might have been fulfilled byRhizobium inoculation. Hence, the decline in P and K statusunder higher dose of N could have been because of higheryield and higher uptake of these nutrients. These results werein conformity with the findings of Vijayapriya et al. (2006) andTahir et al. (2009).

Table 1. Effect of N management on soybean seed yield, NPK uptake and residual soil fertilityTotal Uptake

(kg/ha) NPK status of soil at harvest (kg/ha)* Treatments Seed yield (kg/ha)

Straw yield (kg/ha)

N P K Available N Available P2O5 Available K2O Control 1405 4333 98.4 13.6 94.3 150.6 20.3 265.3 20 kg N/ha as basal 1610 4724 121.7 18.1 117.1 159.6 19.0 261.0 40 kg N/ha as basal 1730 4828 135.1 20.5 132.7 167.6 16.6 255.3 60 kg N/ha as basal 1813 4971 145.0 23.2 142.8 174.6 17.6 253.0 80 kg N/ha as basal 1891 5143 160.5 27.1 155.1 182.6 14.3 239.6 Rhizobium alone as basal 1547 4611 112.0 16.9 110.0 157.6 19.0 262.3 20 kg N + Rhizobium as basal 1696 4758 132.1 21.7 131.2 165.0 18.6 259.0 40 kg N + Rhizobium as basal 1893 4890 152.7 26.2 145.1 175.3 18.0 254.6 60 kg N + Rhizobium as basal 1968 5075 174.6 28.8 159.9 180.6 17.6 249.0 10+10 kg N/ha (basal & 50 DAS) 1620 4577 124.0 18.3 119.2 155.3 19.0 261.0 20+20 kg N/ha (basal & 50 DAS) 1735 4725 138.2 21.0 131.7 160.0 16.6 255.3 30+30 kg N/ha (basal & 50 DAS) 1843 4810 150.3 23.7 139.8 163.0 17.6 251.6 40+40 kg N/ha (basal & 50 DAS) 1915 4916 165.0 27.2 151.5 164.6 14.3 239.6 10+10 kg N/ha (basal & 80 DAS) 1548 4602 119.0 16.5 115.8 170.0 20.6 264.0 20+20 kg N/ha (basal & 80 DAS) 1656 4885 130.9 19.7 129.0 174.0 19.6 258.6 30 +30 kg N/ha (basal & 80 DAS) 1796 5103 146.6 23.0 140.3 184.3 17.6 253.0 40 +40 kg N/ha (basal & 80 DAS) 1880 5289 157.3 25.8 150.5 194.3 16.6 242.6 SE (±m) 39 85 3.4 0.5 3.6 2.8 0.7 2.7 CD (P = 0.05) 115 246 9.8 1.5 10.4 8.2 2.1 8.0 *Initial fertility status of soil: 155.4, 20.3, 254.8 kg N, P2O5 and K2O/ha, respectively

Rathod et al. : Effect of nitrogen management on soil fertility and NPK uptake in soybean 155

It is inferred from the above that increase in both seedand straw yield was due to increase in N dose with decliningresponse at higher levels. Integration of chemical fertilizeralong with Rhizobium increased seed yield and NPK uptake.Similarly split application of N (half as basal and half at 50DAS) also increased NPK uptake.

REFERENCES

Behera UK, Sharma AR and Pandey HN. 2007. Sustaining productivityof wheat-soybean cropping system through integrated managementpractices on the vertisols of central India. Plant and Soil 297: 185-199.

Dashora LN and Solanki NS. 2010. Effect of integrated nutrientmanagement on productivity of urdbean under rainfed conditions.Journal of Food Legumes 23: 249-250.

Shivakumar BG and Ahlawat IPS. 2008. Integrated nutrient managementin soybean–wheat cropping system. Indian Journal of Agronomy53: 273-278.

Tahir MM, Abbasi MK, Rahim N, Khaliq A and Kazmi AK. 2009. Effectof Rhizobium inoculation and NP fertilization on growth, yield andnodulation of soybean (Glycine max L.) in the sub-humid hillyregion of Rawalakot Azad Jammu and Kashmir, Pakistan. AfricanJournal of Biotechnology 8: 6191-6200.

Vijayapriya M, Muthukkaruppan SM and Sriramachandrasekharan MV.2006. Effect of sulphur and Rhizobium inoculation on nutrientuptake by soybean and soil fertility. Advances in Plant Sciences 14:30-32.

Walia SS and Kler DS. 2007. Effects of organic and inorganic sources ofnutrition on growth and yield of soybean in soybean-wheat sequence.Journal of Oilseeds Research 24: 251-254.


Short communication

Effect of zinc and vermicompost on fenugreek (Trigonella foenum graecum L.) underirrigation with different RSC waterS.R. KUMAWAT and B.L. YADAV

Department of Soil Science and Agricultural Chemistry, S.K.N. College of Agriculture, Jobner -303329, Rajasthan;E-mail: [email protected](Received: August 8, 2011; Accepted: May 18, 2012)

ABSTRACT

A pot experiment was conducted in fenugreek (Trigonellafoenum graecum L.) during Rabi to evaluate the effect ofdifferent levels of residual sodium carbonate (RSC) water, zincand vermicompost at SKN College of Agriculture, Jobner,Rajasthan. Four levels of RSC water (0, 2.5, 5.0 and 7.5 mmol L-

1), three levels of zinc (0, 10 and 20 mg ZnSO4 kg-1 soil) and twolevels of vermicompost (0 and 1.25 g kg-1 soil) were taken up.Study revealed that yield attributes, yield of seed and straw,and zinc mobility ratios in seed and straw decreasedsignif icantly with increasing level of RSC water, whileapplication of zinc and vermicompost significantly increasedthe yield attributes, seed yield and zinc mobility ratio in seedand straw.

Key wards: Fenugreek, RSC water, Seed yield, Vermicompost,Zn mobility ratio

Scarcity of good quality water in arid and semiarid regionoften forces the farmers to use available poor quality waterfor irrigation. Quality of irrigation water plays a vital role incrop production. The use of sodic water for irrigation adverselyaffects the crop productivity through influencing the uptakeof nutrients and soil properties (Chauhan et al. 1988). Thiswater is characterized by low total salt concentration and therelative proportion of calcium and magnesium is much loweras compared to sodium salt. Zinc deficiency generally occursin soil having poor fertility, high pH and low organic carboncontent (Sakal 2001). The increased exchangeable sodiumpercentage (ESP) resulting from long term use of residualsodium carbonate (RSC) rich water leads to breakdown of soilstructure due to swelling and dispersion of clay particleswhich in turn reduces nutrient availability affecting cropproductivity in the long run.

As an organic fertilizer, vermicompost acts as asubstitute for chemical fertilizer. Vermicompost contains plantgrowth regulators and nutrients in available form that resultsin reduction in soil pH and ESP (More 1994). Zinc also helpsin inducing alkalinity tolerance in crop by enhancing itsefficiency in utilizing K, Ca and Mg. Therefore, the currentstudy was undertaken to optimize the dose of zinc andvermicompost in fenugreek under irrigation with different RSCwater.

10 kg loamy sand soil was filled in ceramic pots. Thesoil was alkaline (pH 8.4), low in organic carbon (0.18%),medium in available P (13.25 kg/ha) and K (152 kg/ha). The potexperiment was conducted with four levels of RSC water (7.5,5.0, 2.5 and 0 mmol L-1), three levels of Zn (0, 10 and 20mgZnSO4 kg-1 soil) and two levels of vermicompost (0 and 1.25 gkg-1) in a completely randomized block design with threereplications during Rabi 2007-08.

Ten seeds of fenugreek (variety RMt-1) were sown andafter germination, three plants per pots were maintained. RDFof N at 9 mg kg-1 and P at 13.4 mg kg-1 were applied basally.The different RSC water were artificially prepared by dissolvingrequired amount of different salt in base (control) water asmentioned in Table 1. The tap water used for first irrigation inall the pots and later on crop was irrigated 8 times with waterof varying RSC.

*Base water

Table 1. Composition of base water and synthetic irrigationwater

Ionic composition (mmol L-1) RSC (mmol L-1)

EC (dSm-1)

SAR Na+ Ca2+ Mg2+ CO3

2- HCO3- Cl- SO4

2- 0* 1.31 8.2 10.0 1.5 1.5 0.5 3.5 7.5 1.5 2.5 3.2 16.7 26.4 2.5 2.5 1.0 6.5 12.4 12.7 5.0 3.2 16.7 26.4 2.5 2.5 1.5 8.5 11.0 11.0 7.5 3.2 16.7 26.4 2.5 2.5 2.0 10.5 9.7 9.7

Study revealed that increased level of RSC in water

decreased plant height, pods per plant, seed index and seedand straw yield significantly. It is well known fact that use ofhigh RSC water contains Na salts in relatively greaterproportion than Ca and Mg and prolonged use of such waterimmobilizes soluble Ca and Mg by precipitating them. Thisattributed to an increased sodicity in soil solution thatdecreased plant height, pods per plant, seeds per pod, seedindex and seed and straw yield of fenugreek significantly(Table 2).

Significant improvement was also recorded in plantheight, pods per plant, seed index, seed and straw yield by Znapplication. The favourable influence of applied Zn on thesecharacters may be explained to its catalytic or stimulating effecton most of the physiological and metabolic processes in plant.The increase in yield attributes might be due to its role ininitiation of primordial for reproductive parts and partitioning

Kumawat and Yadav : Effect of zinc and vermicompost on fenugreek 157

Table 2. Effect of different RSC water, zinc and vermicompost levels on yield attributes and Zn mobility ratio in fenugreek seedand straw

Zn mobility ratio Treatments Plant height (cm) Pods/plant Seed index Seed Straw

RSC water RSC0 39.02 30.90 1.15 41.23 28.62 RSC2.5 38.52 30.35 1.10 39.76 27.66 RSC5.0 33.96 28.65 0.97 37.13 26.00 RSC7.5 32.00 27.47 0.92 34.58 24.08 SEm+ 0.35 0.33 0.01 0.46 0.19 CD (P=0.05) 0.98 0.93 0.02 1.30 0.54 Zinc levels Zn0 34.42 25.67 0.94 35.78 24.61 Zn10 35.84 30.04 1.05 38.82 26.32 Zn20 37.36 32.31 1.11 39.92 28.85 SEm+ 0.30 0.28 0.01 0.39 0.17 CD (P=0.05) 0.85 0.81 0.02 1.12 0.47 Vermicompost levels VC0 35.25 27.22 1.02 37.52 25.78 VC1.25 36.50 31.46 1.05 38.83 27.40 SEm+ 0.24 0.23 0.01 0.32 0.14 CD (P=0.05) 0.70 0.66 0.02 0.92 0.38

of photosynthates towards them (Singh and Yadav 2006).Besides this, Zn is also known to enhance the absorption ofessential nutrients by increasing the CEC of roots. Theinteraction of RSC water and Zn on seed and straw yield wassignificant (Table 3). This indicated that harmful effect of RSCwater can be mitigated by applying higher dose of Zn.Addition of Zn increased the availability of Zn to plant. Theresults of the present investigation are in agreement with Laland Lal (1980) and Pathan (2001).

Application of vermicompost had also a significanteffect on yield attributes (plant height and pod/plant) andseed and straw yield of fenugreek. Vermicompost is a richsource of available nutrients and contains certain growthpromoting substances like auxins and enzymes (produced bymicrobes present in vermicompost) responsible for increasein yield attributes and yield (Davidayal and Agarwal 1998).

Seed yield of fenugreek was significantly increasedunder combined application of Zn at 20 mg kg-1 + 1.25 g kg-1

vermicompost (Table 3). Balanced supply of nutrients throughvermicompost and stimulating effect of zinc on most of thephysiological and metabolic processes of plant might havecaused higher nutrient uptake and better growth anddevelopment of plant thereby resulting in higher seed yield(Kumar et al. 2001 and Singh and Yadav 2008).

Increasing level of RSC in water also decreased Znmobility ratio in seed and straw significantly. The reductiontrend in this ratio indicated decreased translocation of Zn athigher levels of RSC water in upper plant part due tophysiological disorder induced by excessive accumulation ofHCO3

- in soil as a consequence of irrigation with high RSCwater (Singh and Mittal 1986). Application of Zn to soil alsosignificantly increased Zn mobility ratio both in seed andstraw. This could be explained on the basis of higher Zn

NS = Non significant

Table 3: Interactive effect of different RSC water, zinc and vermicompost levels on fenugreek seed and straw yield (g pot-1)Treatments Seed yield

V0 V1.25 Zn0 Zn10 Zn20 Mean Zn0 Zn10 Zn20 Mean RSC0 10.07 13.65 14.96 12.89 12.16 14.20 15.55 13.97 RSC2.5 9.30 13.58 14.45 12.44 12.20 14.09 14.88 13.72 RSC5.0 8.11 10.76 11.95 10.27 9.86 11.30 12.60 11.25 RSC7.5 6.30 7.37 9.74 7.80 7.47 8.90 10.27 8.88 Mean 8.45 11.34 12.78 10.42 12.12 13.33 V Zn Zn X V RSC X Zn RSC X VC SEm+ 0.088 0.108 0.153 0.216 0.176 CD (P=0.05) 0.251 0.308 0.436 0.616 0.503

Straw yield RSC0 19.30 23.60 31.30 24.73 23.40 26.60 33.60 24.73 RSC2.5 17.02 21.60 28.36 22.33 20.83 24.86 29.83 22.33 RSC5.0 13.93 19.20 23.39 18.84 17.06 21.16 25.56 18.84 RSC7.5 9.21 12.70 15.75 12.55 11.71 14.89 17.11 12.55 Mean 14.87 19.28 24.70 18.25 21.88 26.53 V Zn Zn X V RSC X Zn RSC X V SEm+ 0.179 0.220 0.310 0.439 0.358 CD (P=0.05) 0.510 0.625 NS 1.249 NS


concentration in seed and straw at higher level compared toits lower level. Increased Zn mobility ratio in seed and strawby the application of vermicompost could also be due to thesteady supply of essential nutrients for plant growth anddevelopment and increased availability of nutrients on accountof enhanced level of enzymes in soil (Yadav and Jha 1988).

The magnitude of decrease in seed and straw yield offenugreek with increasing level of RSC water was less evidentfollowing application of ZnSO4 and vermicompost. Thus, it isinferred from the present study that seed yield of fenugreekcan be compensated to some extent by applying zinc andvermicompost together under irrigation with high RSC water.

REFERENCES

Chauhan RPS, Bhudayal and Chauhan CPS. 1988. Effect of residualsodium carbonate in irrigation water on soil and bread wheat (Triticumaestivum L.). Indian Journal of Agricultural Sciences 58: 454-458.

Devidayal and Agrawal SK. 1998. Response of sunflower (Helianthusannus) to organic manures and fertilizers. Indian Journal of Agronomy43: 462-473.

Kumar N, Verma LP, Singh R and Prasad K. 2001. Soil properties,nutrients uptake and productivity of rice under integrated nutrientmanagement system. Annals of Plant and Soil Research 3: 54-57.

Lal P and Lal F. 1980. A study on response and utilization of zinc bywheat under different qualities of irrigation water. In: Proceedingsof International Symposium of Salt Affected Soils, Karnal, India.Pp 404-408.

More SD. 1994. Effect of farm waste and organic manures on soilproperties, nutrient availability and yield of rice-wheat grown onsodic vertiso. Journal of the Indian Society of Soil Science 42: 253-256.

Pathan ARK. 2001. Effect of zinc application on tolerant and sensitivevarieties of wheat grown on sodic soil. Ph. D. Thesis, RAU, Bikaner,India.

Sakal R. 2001. Efficient management of micro-nutrients for sustainablecrop production. Journal of the Indian Society of Soil Science 49:593-608.

Singh M and Mittal S. 1986. Zinc, iron and phosphorus relationship incowpea as affected by their application. Indian Journal of PlantPhysiology 29: 144-151.

Singh M and Yadav BL. 2006. Effect of organic materials and zinc ongrowth and yield of wheat (Triticum aestivum L.) under irrigationwith high RSC water. Haryana Journal of Agronomy 22: 142-144.

Singh M and Yadav BL. 2008. Response of organic materials and zincon yield of wheat and zinc optimization under high RSC waterirrigation. Environment and Ecology 26: 553-556.

Yadav K and Jha KK. 1988. Effect of poultry manure and sewage sludgeon the humification and functional groups of humic substances.Journal of the Indian Society of Soil Science 36: 439-449.


Short communication

Effect of sowing dates and fertility levels on grain yield and its component traits inlentilR.K. GILL, MANPREET SINGH, SARVJEET SINGH and JOHAR SINGH

Department of Plant Breeding and Genetics, Punjab Agricultural University, Ludhiana 141004, India;E-mail: [email protected](Received: August 18, 2011 ; Accepted: 02 June, 2012)

ABSTRACT

Sixteen lentil genotypes including seven small seeded and ninelarge seeded were evaluated for seed yield and its componenttraits under two sowing dates (timely & late sown) and twofertilizer (NP) levels (recommended & 33 percent higher dose)during rabi 2007-08 and 2008-09. Results revealed that dates ofsowing (DOS), levels of fertilizers (LOF) and genotypesinteracted significantly with almost all the traits under study.Timely sown crop increased fruiting branches per plant(NFBPP), pods per plant (NPPP), biological yield (BY), seedyield (SY), days to 50% flowering (DF) and maturity (DM),whereas late sown crop increased HI significantly. Higherfertilizer dose also significantly increased NFBPP, NPPP, BYand SY, while DF, DM and HI remained unaffected. Genotypeswere least affected due to DOS or LOF.

Key words: Fertilizer level, Harvest index, Lentil genotypes,Sowing dates

Lentil (Lens culinaris Medikus) is an important Rabipulse crop grown primarily in central parts of India. It occupies1.53 m ha in India with an average production of 0.95 m tonnes.It has the ability to thrive well on relatively poor soils andunder adverse environmental conditions as it is relativelytolerant to drought and harsh winters. Productivity potentialand protein content in lentil are important from commercialpoint of view as higher yields give better returns to the farmer,while higher seed protein content provides energy rich diet.Seed yield is a complex trait as it is a combination of manyrelated traits.

Time of sowing exerts a considerable influence on plantpopulation, yield attributes and seed yield in lentil. Therefore,the desirable yield level can be achieved even under lateplanting by applying higher dose of fertilizers especially whenthe genotype is input responsive. However, differentgenotypes show variable responses to sowing dates andfertilizer levels. Keeping these factors in view, the presentstudy was undertaken to study the yield response of differentgenotypes of lentil under different planting dates and fertilizerlevels.

The treatments comprised of two dates of sowing (timelysown, D1 and late sown, D2) and two levels of N and P (normalfertility, N1 and high fertility, N2) in the main plots and sixteen

genetically diverse lentil genotypes in sub plots were laid outin a Split Plot with three replications. Among the genotypes,seven genotypes (‘LL 1020’, ‘LL 1023’, ‘LL 1024’, ‘LL 699’,‘LL 147’, ‘PL 4’ and ‘L 4147’) were small seeded (100 seedweight < 2.5 g) while nine genotypes (‘LL 986’, ‘LL 991’, ‘LL992’, ‘LL 999’, ‘LL 921’, ‘LL 932’, ‘LL 1036’, ‘LL 1049’ and ‘LL1031’) were large seeded (100 seed weight > 2.5 g). Thisexperiment was conducted in the experimental farm of PunjabAgricultural University, Ludhiana during rabi 2007-08 (Y1)and 2008-09 (YII). Each genotype was accommodated in aplot of four rows of 3 m length, keeping row to row spacing of22.5 cm. The experiment was planted during first week ofNovember (D1) and first week of December (D2) withrecommended dose of N and P (N1 at 12.5 and 20 kg/ha,respectively) and with 33% more N and P (N2 at 16.6 and 26.6kg/ha, respectively). Observations were recorded on fiverandom plants from each genotype in each environment onfruiting branches per plant (NFBPP) and pods per plant (NPPP).Data on days to 50% flowering (DF), biological yield (BY),seed yield (SY) and harvest index (HI) was recorded on perplot basis. The data was subjected to statistical analysis forall parameters in each year following standard methods.

Results revealed that significant decrease (by 8 days)was observed in average number of days to 50% floweringunder December planting (D2) as compared to Novemberplanting (D1) (data not given) during both the years. Aziz(1992) also observed that days to flowering declined linearlyfollowing delayed sowing. Crop response to levels of fertilizerwas significant during both the years but the interactionbetween dates of sowing and fertilizer level was significantonly during YI. Early flowering was also observed with higherdose of phosphorus in lentil. Thus, overall, ‘LL 1031’ was theearliest (89 days) and ‘LL 999’ was the latest (92.8 days)genotype so far as days to 50% flowering was concernedconsidering all the environments.

It was observed that timely sown crop grew taller andhad more number of fruiting branches and pods per plant ascompared to late sown crop as more time period was availablefor vegetative growth of plants. Sepat et al (2006) recordedincreased number of fruiting branches per plant under normalsowing. The number of fruiting branches per plant wassignificantly higher in N2 as compared to N1 during both the


years (Table 1). Zeidan (2007) also reported the similar trend.These results suggest that fruiting branches per plant, a majoryield component can be increased by timely planting andapplying higher fertilizer dose for realizing higher yield. Undernormal sown conditions, the genotypes ‘LL 1049’ (19.54) and‘LL 992’ (19.06) recorded maximum number of fruiting branchesduring YI. However, under late sown conditions, the genotypes‘LL 991’ (17.30) and ‘LL 999’ (15.92) recorded maximum numberof fruiting branches. Higher fertilizer dose (N2) alsosignificantly increased number of fruiting branches as themaximum number of these branches was observed in ‘PL 4’

(19.53 and 17.78) during both the years, respectively(Table 1). These results suggest that specific genotypes canbe recommended for normal and late planting. Accordingly,fertilizer doses may vary for different genotypes.

The number of pods per plant was significantly higherin D1 and N2 as compared to D2 and N1 during both the years(Sepat et al. 2006). Increase in number of pods per plantunder higher fertilizer level was also observed by Zeidan2007. The positive effect of N and P application on number ofpods per plant might be due to better enzymatic activities

Table 1. Performance of different lentil genotypes for number of fruiting branches and pods per plant in various environmentsFruiting branches/plant Pods/plant

2007-08 2008-09 2007-08 2008-09 2007-08 2008-09 2007-08 2008-09 Genotypes D1 D2 D1 D2 N1 N2 N1 N2 D1 D2 D1 D2 N1 N2 N1 N2

LL1020 17.77 15.40 14.73 14.22 15.40 18.33 14.23 14.72 79.23 59.50 76.17 62.28 64.45 74.28 64.05 74.40 LL1023 16.91 13.57 13.05 14.10 14.93 16.10 13.20 13.95 79.13 69.93 79.18 64.35 78.75 70.32 69.37 74.17 LL1024 18.47 15.57 16.45 15.57 15.80 18.80 14.98 17.03 91.63 67.65 100.75 69.28 75.42 83.87 78.53 91.50 LL986 13.01 13.20 13.73 12.15 13.07 13.70 12.22 13.67 79.25 59.12 75.55 58.38 66.37 72.01 66.83 67.10 LL991 15.31 17.30 13.32 15.75 14.07 19.10 14.13 14.93 82.47 60.03 75.58 65.40 68.82 73.65 69.80 71.18 LL992 19.06 16.15 14.35 12.78 16.38 19.38 12.73 14.40 85.40 59.83 80.23 59.93 72.8 72.43 70.02 70.17 LL999 15.14 14.60 14.47 15.92 15.07 15.23 14.55 15.83 85.30 66.52 82.63 63.55 72.45 79.37 70.95 75.23 LL931 15.69 14.88 14.48 14.98 15.08 16.05 15.13 14.33 74.17 63.25 71.32 71.07 66.27 71.15 70.40 71.98 LL932 15.14 14.95 17.95 14.78 14.62 16.03 15.25 17.48 82.75 57.08 87.03 58.50 66.60 73.23 64.70 80.83 LL1036 18.01 14.53 18.00 14.18 14.62 18.48 15.63 16.55 78.85 67.33 77.82 68.45 71.92 74.27 71.83 74.43 LL1049 19.54 15.75 16.60 15.57 18.08 17.77 14.93 17.23 85.38 64.53 95.27 70.20 74.25 75.67 80.58 84.88 LL1031 17.44 15.13 15.48 14.92 16.18 16.95 14.23 16.17 76.63 66.57 76.77 66.88 70.07 73.13 70.77 72.88 PL4 19.04 15.50 18.25 13.72 15.57 19.53 14.18 17.78 82.65 67.01 77.50 56.78 72.88 76.77 66.27 68.02 L4147 17.84 15.13 15.40 13.98 16.23 17.30 14.68 14.70 74.22 65.87 85.57 68.80 72.05 68.03 75.52 78.85 LL147 18.21 16.20 18.80 13.88 16.67 18.30 15.02 17.68 85.33 63.32 92.27 62.83 67.98 80.67 70.13 84.97 LL699 16.54 16.48 17.67 15.47 15.70 17.88 15.50 17.63 88.70 63.15 87.95 60.60 73.75 78.10 70.38 78.17 MEAN 17.07 15.27 15.80 14.50 15.47 17.43 14.41 15.88 81.94 63.79 82.60 64.21 70.93 74.81 70.63 76.17 CD (5%) 0.93 0.82 1.01 0.82 3.32 4.04 3.32 4.04

Table 2. Performance of different lentil genotypes for seed yield and biological yield in various environments

Seed yield (x ’00 kg/ha) Biological yield (x ’00 kg/ha) 2007-08 2008-09 2007-08 2008-09 2007-08 2008-09 2007-08 2008-09 Genotypes

D1 D2 D1 D2 N1 N2 N1 N2 D1 D2 D1 D2 N1 N2 N1 N2 LL1020 10.97 6.61 9.62 8.83 8.68 8.90 8.92 9.52 35.25 21.48 31.60 28.80 27.7 29.02 29.10 31.30 LL1023 11.35 7.95 10.60 9.18 10.20 9.1 10.03 9.75 35.71 24.54 33.30 27.62 31.05 29.20 31.51 29.41 LL1024 9.85 8.77 11.47 8.14 9.07 9.54 9.54 10.07 31.33 27.81 36.39 24.78 28.33 30.80 30.12 31.05 LL986 9.10 9.04 10.62 8.62 8.39 9.75 9.09 10.16 30.31 25.93 34.69 24.65 25.86 30.37 28.26 31.08 LL991 11.27 9.77 9.71 7.36 10.73 10.31 8.28 8.78 37.90 30.37 29.78 22.98 33.77 34.51 24.64 28.12 LL992 11.43 8.01 10.95 6.89 9.30 10.14 9.06 8.78 36.70 24.94 32.93 20.46 29.54 32.1 26.02 27.38 LL999 11.71 9.32 9.75 7.25 10.56 10.47 7.68 9.32 37.62 27.72 31.14 22.56 33.67 31.67 22.31 31.38 LL931 9.54 9.28 9.48 7.07 9.28 9.54 6.92 9.63 31.94 27.50 29.26 20.71 27.62 31.82 19.78 30.19 LL932 9.90 7.82 9.26 7.64 7.89 9.82 7.60 9.30 31.70 23.30 27.25 23.73 25.25 29.75 23.43 27.56

LL1036 11.56 9.06 10.70 7.33 10.24 10.37 8.17 9.86 36.79 28.21 32.62 22.41 32.16 32.84 23.89 31.14 LL1049 11.40 10.17 12.11 7.57 10.25 11.33 8.94 10.74 37.13 30.28 36.36 23.49 32.50 34.91 27.56 32.28 LL1031 12.24 8.11 12.17 7.70 9.74 10.61 9.37 10.50 40.62 26.51 36.70 21.70 32.31 34.81 27.69 30.71

PL4 10.15 6.84 10.20 8.95 7.48 9.51 8.81 10.34 32.28 21.11 32.90 25.83 23.70 29.69 26.17 32.56 L4147 9.43 7.88 9.01 7.37 7.35 9.96 7.72 8.66 29.63 23.73 28.33 22.24 23.24 30.12 23.88 26.70 LL147 10.17 8.02 10.07 7.28 8.10 10.09 7.99 9.37 29.91 25.02 30.19 22.19 24.91 30.01 24.38 27.99 LL699 11.40 7.99 9.81 8.67 9.58 9.82 8.36 10.13 35.99 25.03 30.59 26.20 29.97 31.05 25.52 31.27 MEAN 10.72 8.42 10.35 7.87 9.18 9.95 8.53 9.68 34.43 25.84 32.13 23.77 28.85 31.42 25.89 30.01

CD (5%) 0.36 0.31 0.36 0.31 0.76 0.95 0.76 0.95

Gill et al. : Effect of sowing dates and fertility levels on grain yield and its component traits in lentil 161

which controlled flowering and pod formation (Singh et al.2011). A perusal of Table 1 also showed that the effect of DOSwas least in ‘LL 931’ in YII whereas, the effect of LOF wasleast in ‘LL 992’ in YI and YII. The genotype ‘LL 1024’ recordedthe highest number of pods per plant (91.63 and 100.75) underD1 (normal sowing) during both the years, respectively. Thus,the number of pods per plant can be increased by timelyplanting and by applying higher fertilizer dose.

Biological yield was significantly higher under D1 ascompared to D2 during both the years (Table 2). The decreasein biological yield under late sowing could be attributed to ashorter vegetative period as timely sowing possibly caused astrong root system and vigorous plants (Kayan 2010).Response to higher fertilizer dose was also significant duringboth the years (Zeidan 2007). The genotype ‘LL 1031’ recordedhighest biological yield (4062 and 3670 kg/ha) in D1 duringboth the years, while ‘LL 991’ had the highest value in D2(3037 kg/ha) and N1 (3377 kg/ha) in YI. All the genotypes,except ‘LL 999’ in YI and ‘LL 1023’ in YII, showed an increasein biological yield under higher fertilizer dose during both theyears. After flowering, since N availability from soil to theplant system decreases following degeneration of nodules,application of N after flowering enhances crop growth andbiological yield. Thus, under late sown conditions, higherfertilizer dose may be used to increase biological yield whichis also an important trait contributing towards seed yield.

The mean seed yield was significantly higher in D1 (1072and 1035 kg/ha) as compared to D2 (842 and 787 kg/ha) as wellas in N2 (995 and 968 kg/ha) as compared to N1 (918 and 853kg/ha) during both the years (Table 2). The increase in seedyield might be due to higher number of fruiting branches,pods per plant and biological yield as seed yield is known tohave positive association with these characters. Mishra andKhan (2006) suggested that October 15 to November 15 asthe best time for sowing lentil in India. The increased seedyield at higher N and P level was also reported by Samadi et al(2001) and Sardana et al (2006). All the interactions except,DOS x LOF in YII, were significant. It was also observed thathigher seed yield under late sown conditions can be realizedwith high dose of N.

The genotype ‘LL 1031’ recorded highest seed yield(1224 and 1217 kg/ha) in D1 during both the years, while, ‘LL1049’ and ‘LL 1023’ were the best to yield higher (1017 and 918kg/ha) in D2 during YI and YII, respectively (Table 2). ‘LL1049’ also performed best in N2 during both the years. It

indicates the fact that this genotype is responsive to fertilizer.The effect of DOS was least in ‘LL 986’ in YI, whereas all thegenotypes were significantly influenced in YII. The effect ofLOF was least in ‘LL 999’ in YI and ‘LL 1023’ in YII. Theseresults suggest that maximum yield in lentil can be obtainedby timely sowing and applying an optimum dose of fertilizer.However, under late planting, the yield losses can also becompensated by giving higher doses of N and P. Samadi et al(2001) reported that N and P at 50 kg/ha each were optimumfor lentil.

In comparison to seed yield, harvest index wassignificantly higher in D2 as compared to D1 in YI only (datanot given). Effect of LOF was not significant during both theyears, while the interaction LOF x DOS was significant in YII.Sepat et al (2006) also observed increase in harvest indexunder higher N dose.

The results of the study suggested that differentgenotypes should be recommended for different sowingconditions with different levels of fertilizers. In case of lateplanting, higher doses of fertilizers can be applied forrealization of optimum yield.

REFERENCES

Aziz M A. 1992. Response of lentil to different sowing dates. LensNewsletter 19: 18-23.

Kayan N. 2010. Response of lentil to sowing date and timing of nitrogenapplication. Journal of Food Agriculture and Environment 8: 422-426.

Mishra DK and Khan RA. 2006. Stability analysis of lentil varietiesunder rainfed ecosystem. Indian Journal of Pulses Research 19: 59-60.

Samadi YB, Peighambari SA and Hosseini NM. 2001. Effect ofapplication of nitrogen and phosphorus fertilizers on agronomictraits of lentil in Karaj region. Iranian Journal of AgriculturalSciences 32: 415-23.

Sardana V, Sheoran P and Singh S. 2006. Effect of seed rate, rowspacing, Rhizobium and nutrient application on yield of lentil underdryland conditions. Indian Journal of Pulses Research 19: 216-18.

Sepat NK, Singh NP and Sepat RN. 2006. Response of varieties andplanting dates on growth and yield behaviour of lentil. Annals ofAgricultural Research 27: 96-98.

Singh G, Ram H, Sekhon HS, Aggarwal N, Kumar M, Kaur P and SharmaP. 2011. Effect of nitrogen and phosphorus application onproductivity of summer mungbean sown after wheat. Journal ofFood Legumes 24: 327-329.

Zeidan MS. 2007. Effect of organic manure and phosphorus fertilizerson growth, yield and quality of lentil in sandy soil. Journal ofAgricultural and Biological Sciences. 3: 748-52.


Short Communication

Evaluation of Rynaxypyr 20SC against pigeonpea pod borer complexN.S. SATPUTE and U.P. BARKHADE

Department of Entomology, Dr. Panjabrao Deshmukh Krishi Vidyapeeth, Akola - 444 104, Maharashtra, India;E-mail: [email protected](Received: July 21, 2011; Accepted: May 3, 2012)

ABSTRACT

Field evaluation of different doses of Rynaxypyr 20SC againstthe pod borer complex (Helicoverpa armigera, Melangromyzaobtusa and Exelastis atmosa) of pigeonpea revealed significantdifferences among the treatments and the higher doses ofRynaxypyr 20SC (30 and 40 g a.i./ha) were found most effectivein reducing the pod damage as well as the pest population. Asfar as the yield of pigeonpea was concerned, the conventionalinsecticides were found at par with the higher doses ofRynaxypyr 20SC.

Key words: Pigeonpea, Pod borer complex, Rynaxypyr

Pigeonpea is one of the major pulse crops of the tropicsand subtropics. Though India is largest producer ofpigeonpea, the productivity has always been a concern.Pigeonpea yields have remained stagnant for the past 3 to 4decades, largely due to insect pests’ damage (Basandrai et al.2010). Although number of insect pests were reported to attackthis crop, the pod borer complex including Gram pod borer,Helicoverpa armigera Hub., plume moth, Exelastis atmosaWalshingham and pod fly, Melanagromyza obtusa Mollochcause considerable losses in grain yield ranging 30 to 100%by attacking the reproductive parts of the plant. The loss dueto H. armigera alone contributes up to 50% (Thakare 2001,Dodia et al. 2009). Insecticide application has been one of themost effective and quick method of reducing insect populationin the field. But due to the repeated use of conventionalinsecticides, the results are not as per the expectations andhence, there is always a need of a new insecticidal moleculewith a unique mode of action. Rynaxypyr chemically aschlorantraniliprole is one such compound which can providean effective chemical treatment for the management of podborer complex in pigeonpea (Temple et al. 2009). As insectpests of pigeonpea specially pod borer complex is the majorlimiting factor in getting higher yield, it becomes veryimportant to study tactics dealing with management of podborer complex and therefore, the experiment was planned toevaluate a new molecule with unique mode of action namelyRynaxypyr 20SC against the pod borer complex of pigeonpea.

Field experiment was conducted at Research Farm,Department of Entomology, Dr. Panjabrao Deshmukh KrishiVidyapeeth, Akola during kharif 2007-08. Seven treatmentswere studied for their efficacy against the pod borer complex

(Heliothis armigera, Exelastis atmosa and Melangromyzaobtusa) on pigeonpea variety ‘C-11’ in a Randomized BlockDesign (RBD) with three replications. The seeds of ‘C-11’were sown at a spacing of 60 x 30 cm and each net plot sizewas 9.0 x 6.0 m2. Rynaxypyr was provided by E.I.DuPont IndiaPvt. Ltd., Gurgaon which contained 20% active ingredientweight/volume basis. Seven treatments were evaluated fortheir efficacy which included four different doses of Rynaxypyr20SC @ 10, 20, 30 and 40 g a.i./ha, Endosulfan 35EC @ 0.07%,Quinalphos 25EC @ 0.04% and control (water spray). Fiveplants were randomly selected for taking the observationsfrom each of the net plot. Three sprayings were undertakenand the observations on larval count per five branches, percent pod damage at 10 days after each spraying along withyield data were recorded.

The data on effect of Rynaxypyr 20SC againstHelicoverpa armigera revealed significant differences amongthe treatments during all the three sprays (Table 1). After firstspray, lowest larval count was recorded in Rynaxypyr @ 40 ga.i./ha followed by Rynaxypyr @ 30 g a.i./ha and Endosulfan35 EC 0.07%, being at par with each other and superior overrest of the treatments at 3 and 10 days after all the threesprayings. Larval count of Melangromyza obtusa revealedthat the treatments Rynaxypyr @ 40 g a.i./ha, Endosulfan0.07%, Rynaxypyr @ 30 g a.i./ha and Quinalphos 0.04% werefound at par with each other showing lower larval count andwere significantly superior over the lower doses of Rynaxypyrand control at 3 days after first spray. Although, Endosulfanshowed good results after first spray, it could not match withRynaxypyr @ 30 and 40 g a.i./ha as far as efficacy wasconcerned after second spray. Similar trend in the larval countat 3 and 10 DAS after second and third spray was observedwhere treatment, Rynaxypyr @ 40 g a.i./ha was found bestand was at par as compared to other treatments (Table 1). Thedata on effect of Rynaxypyr 20SC against plume moth, Exelastisatmosa revealed that the treatments, Rynaxypyr @ 30 g a.i./haand Rynaxypyr @ 40 g a.i./ha were found at par with theconventional insecticides showing good control of plumemoth and were significantly superior over control (Table 2).Results on pod borer damage due to pod borer complexrecorded significant differences among the treatments duringall the three sprays. Rynaxypyr 20SC @ 40 g a.i./ha was foundmost effective showing lowest pod damage and was followedby Rynaxypyr @ 30 g a.i./ha and Endosulfan 0.07%, being at

Satpute and Barkhade : Evaluation of Rynaxypyr 20SC against pigeonpea pod borer complex 163

par with each other. As far as yield of pigeonpea grains wasconcerned, Rynaxypyr 20SC @ 40 g a.i./ha was found to bethe best showing maximum grain yield of 17.52 q/ha. The grainyield in the conventional insecticides viz., Endosulfan 35ECand Quinalphos 25EC were found at par with the higher dosesof Rynaxypyr 20SC (Table 2). The superior efficacy ofRynaxypyr over the conventional insecticides may beattributed to the unique mode of action of this molecule andalso the rapid cessation of feeding and strong residual activity(DuPont 2007). These results are in close agreement with thatof Hardke et al. (2006), who reported that the Rynaxypyrperformed statistically better than traditional insecticides forcontrolling Heliothines in conventional non-Bt as regard toseasonal total damage and seasonal total larvae. Thus, fromthe above study it can be inferred that application ofRynaxypyr 20SC (30 and 40 g a.i./ha) will be helpful in reducingthe pod damage as well as the pest population of pod borercomplex in pigeonpea.

Table 1. Efficacy of Rynaxypyr 20SC on Helicoverpa armigera and Melangromyza obtusa in pigeonpea

DAS – days after spraying Note: Presently endosulfan has been banned

Helicoverpa armigera (larval count per five branches) Melangromyza obtusa (larval count per five branches) I spray II spray III spray I spray II spray III spray

Treatments

3 DAS 10 DAS 3 DAS 10 DAS 3 DAS 10 DAS 3 DAS 10 DAS 3 DAS 10 DAS 3 DAS 10 DAS Rynaxypyr 20SC @ 10 g a.i./ha

0.87 (1.17)

0.73 (1.10)

0.53 (1.01)

0.53 (1.01)

0.53 (1.01)

0.20 (0.83)

0.33 (0.91)

0.33 (0.91)

0.40 (0.94)

0.40 (0.94)

0.53 (1.01)

0.33 (0.91)

Rynaxypyr 20SC @ 20 g a.i./ha

0.73 (1.10)

0.60 (1.04)

0.47 (0.98)

0.47 (0.98)

0.47 (0.98)

0.27 (0.87)

0.20 (0.83)

0.33 (0.91)

0.40 (0.94)

0.33 (0.91)

0.40 (0.94)

0.33 (0.91)


0.27 (0.87)

0.47 (0.98)

0.20 (0.83)

0.40 (0.94)

0.13 (0.79)

0.13 (0.79)

0.07 (0.75)

0.20 (0.83)

0.00 (0.70)

0.20 (0.83)

0.13 (0.79)

0.13 (0.79)


0.20 (0.83)

0.53 (1.01)

0.20 (0.83)

0.27 (0.87)

0.07 (0.79)

0.13 (0.79)

0.00 (0.70)

0.13 (0.79)

0.07 (0.75)

0.07 (0.75)

0.07 (0.75)

0.07 (0.75)

Endosulfan 35EC @ 0.07 %

0.40 (0.94)

0.60 (1.04)

0.27 (0.87)

0.33 (0.91)

0.27 (0.87)

0.27 (0.87)

0.00 (0.70)

0.13 (0.79)

0.20 (0.83)

0.27 (0.87)

0.13 (0.79)

0.13 (0.79)

Quinalphos 25EC @ 0.04 %

0.53 (1.01)

0.53 (1.01)

0.40 (0.94)

0.47 (0.98)

0.33 (0.91)

0.27 (0.87)

0.13 (0.79)

0.20 (0.83)

0.27 (0.87)

0.33 (0.91)

0.27 (0.87)

0.13 (0.79)

Control 1.40 (1.37)

1.27 (1.33)

1.00 (1.22)

0.73 (1.10)

0.87 (1.17)

0.60 (1.04)

0.47 (0.98)

0.67 (1.08)

0.73 (1.10)

0.67 (1.08)

0.87 (1.17)

0.47 (0.98)

SEm (+) 0.04 0.07 0.03 0.04 0.03 0.04 0.03 0.04 0.04 0.04 0.03 0.03 CD (P = 0.05) 0.12 0.21 0.08 0.12 0.10 0.11 0.09 0.12 0.12 0.12 0.10 0.10

REFERENCES

Basandrai AK, Basandrai D, Duraimurugan P and Srinivasan T. 2011.Breeding for biotic stresses. In: A Pratap and J Kumar (Eds), Biologyand Breeding of Food Legumes, CAB International, Oxfordshire,UK. Pp 220-240.

Dodia DA, Prajapati BG and Acharya S. 2009. Efficacy of insecticidesagainst gram pod borer, Helicoverpa armigera infesting pigeonpea.Journal of Food Legumes 22: 144-145.

DuPont. 2007. Rynaxypyr - insect control: Technical Bulletin. (http://www2.dup ont.com/Production _Agriculture/en_U S/assets/downloads/pdfs/Rynaxypyr_Tech_Bulletin. pp 1-11. pdf, accessedon June 20, 2011).

Hardke JT, Lorenz GM, Colwell K, Shelton C and Edmund R. 2006.Rynaxypyr: a novel insecticide for control of Heliothines inconventional and Bollgard cotton. Summaries of Arkansas CottonResearch. Pp 156-160.

Temple JH, Pommireddy PL, Cook DR, Marçon P and Leonard BR.2009. Susceptibility of selected lepidopteran pests to rynaxypyr, anovel insecticide. The Journal of Cotton Science 13: 23–31.

Thakare SM. 2001. Evaluation of some management tactics againstpod borer complex of pigeonpea. Ph.D. Thesis, Dr. PanjabraoDeshmukh Krishi Vidyapeeth, Akola, India.

Exelastis atmosa (larval count per five branches) % Pod damage at 10 DAS I spray II spray III spray

Treatments

3 DAS 10 DAS 3 DAS 10 DAS 3 DAS 10 DAS I spray II spray III spray

Yield (q/ha)

Rynaxypyr 20 SC @ 10 g a.i./ha

0.27 (0.87)

0.27 (0.87)

0.27 (0.87)

0.27 (0.87)

0.13 (0.79)

0.07 (0.75)

16.53 (23.97)

17.27 (24.50)

21.77 (27.76)

8.71


0.20 (0.83)

0.20 (0.83)

0.20 (0.83)

0.27 (0.87)

0.13 (0.79)

0.07 (0.75)

15.47 (23.11)

17.00 (24.35)

20.53 (26.92)

10.40


0.13 (0.79)

0.13 (0.79)

0.13 (0.79)

0.13 (0.79)

0.07 (0.75)

0.07 (0.75)

12.30 (20.53)

11.23 (19.55)

9.57 (17.95)

16.15


0.00 (0.70)

0.20 (0.83)

0.07 (0.75)

0.13 (0.79)

0.00 (0.70)

0.00 (0.70)

10.67 (19.00)

10.60 (19.00)

9.40 (17.85)

17.52

Endosulfan 35 EC @ 0.07 %

0.07 (0.75)

0.13 (0.79)

0.00 (0.70)

0.13 (0.79)

0.00 (0.70)

0.07 (0.75)

10.90 (19.28)

14.83 (22.63)

12.17 (20.36)

16.84

Quinalphos25 EC @ 0.04 %

0.20 (0.83)

0.27 (0.87)

0.13 (0.79)

0.27 (0.87)

0.00 (0.70)

0.00 (0.70)

14.47 (22.13)

15.30 (23.03)

15.60 (23.26)

15.44

Control 0.40 (0.94)

0.67 (1.08)

0.53 (1.01)

0.33 (0.91)

0.27 (0.87)

0.13 (0.91)

21.36 (27.49)

33.90 (35.61)

30.50 (33.52)

8.02

SEm (±) 0.03 0.04 0.05 0.04 0.03 0.03 0.82 1.95 0.91 1.75 CD (P = 0.05) 0.11 0.11 0.14 N. S. 0.09 0.09 2.31 5.49 2.65 4.91 DAS – days after spraying Note: Presently endosulfan has been banned

Table 2. Efficacy of Rynaxypyr 20SC on Exelastis atmosa, pod damage due to pod borer complex and yield in pigeonpea


Choudhary Dr A KSenior Scientist (Plant Breeding)IIPR, Kanpur 208024

Choudhary Dr R GPrincipal Scientist (Plant Pathology)IIPR, Kanpur 208024

Choudhary Dr V PScientist, PDFSRModipuram, Meerut 250110

Datta Dr SSenior Scientist (Plant Biotechnology)IIPR, Kanpur 208024

Dillon Dr M KSenior Scientist (Entomology)IARI, New Delhi 110012

Gabhane Dr V VAssociate Professor (Soil Science)PDKV, Akola 444104

Gupta Dr SanjeevProject Coordinator (MULLaRP)IIPR, Kanpur 208024

Kandan Dr ASenior Scientist (Plant Pathology)NBPGR, New Delhi 110012

Kumar Dr NarendraSenior Scientist (Agronomy)IIPR, Kanpur 208024

Kumar Dr JitendraSenior Scientist (Plant Breeding)IIPR, Kanpur 208024

Mudalagiriyappa DrSenior Scientist (Agronomy), UAS,GKVK, Bangalore 560065

Naimuddin DrSenior Scientist (Plant Pathology) IIPR,Kanpur 208024

Patil Mr PrakashScientist (Biotechnology)IIPR, Kanpur 208024

Praharaj Dr C SPrincipal Scientist (Agronomy)IIPR, Kanpur 208024

Pratap Dr AdityaSenior Scientist (Plant Breeding)IIPR, Kanpur 208024

Raghvani Dr B RResearch Scientist (Entomology)JAU, Junagadh 362001

Raje Dr R SSenior Scientist, Division of GeneticsIARI, New Delhi 110012

Singh Dr (Mrs) ArchanaSenior Scientist, GSM DivisionIGFRI, Jhansi 284128

Singh Dr I PPrincipal Scientist (Plant Breeding)IIPR, Kanpur 208024

Singh Dr JagdishHead, Division of CPBM, IIPRKanpur 208024

LIST OF REFEREES FOR JFL 25 (2): 2012

Singh Dr R CPrincipal Scientist & HeadCIAE, Bhopal 462 038

Singh Dr SarvjeetPrincipal ScientistDepart. of Plant Breeding, PAULudhiana 141004

Solanki Dr I S,Head, IARI Regional Research Station,Pusa, Samastipur 848125

Subramanian Dr SPrincipal Scientist (Entomology) IARINew Delhi -110012

Tiwari Dr Sunil KumarHead, Crop Production Division,IGFRI, Jhansi, India 284128

Tripathy Dr A KAssociate Professor (Agronomy)CSAUT, Kanpur 208002

Vashney Dr Rajeev KPrincipal Scientist, ICRISATPatancheru 502324

Yadav Dr R CProfessor, Department of MBBCCS HAU, Hisar 125004

Yadav Dr RasmiSenior Scientist (Agronomy)NBPGR, New Delhi-110012

The Editorial Board gratefully acknowledges the help rendered by following referees in reviewingmanuscripts for the Vol. 25(2) June 2012.

Journal of Food Legumes (formerly Indian Journal of PulsesResearch) publishes original papers, short communicationsand review articles by renowned scientists, covering all areasof food legumes research. The paper should not have beenpublished or communicated elsewhere. Authors will be solelyresponsible for the factual accuracy of their contribution.Language of publication is English (British).Please send your manuscript to following address:SecretaryISPRDIndian Institute of Pulses ResearchKalyanpur, Kanpur 208 024, IndiaEmail: [email protected] must be submitted through e-mail. You shouldalso submit a hard copy of your manuscript for our officialrecord. Besides author(s) is required to submit a certificatethat the paper is exclusive for Journal of Food Legumes.Manuscripts must conform to the Journal style (see the latestissue). Correct language is the responsibility of the author.After having received your contribution (date of submission),there will be a review process before the editorial board takesdecision regarding acceptance for publication. One copy ofthe revision together with the original manuscript must bereturned to the subject editor or Secretary. The submittedpaper must be one complete word document file comprising atitle page, abstract, text, references, tables, figure legends andfigures. When preparing your text file, please use only TimesNew Roman for text (12 point, double spacing) and Symbolfont for Greek letters to avoid inadvertent charactersubstitutions.FormatEvery original paper should be divided into the following fivesections: ABSTRACT, Key words, INTRODUCTION,MATERIALS AND METHODS, RESULTS ANDDISCUSSION, and REFERENCES. The manuscript should betyped on one side of the paper only, double spaced, and with4-cm margins with page and line numbers. The main title mustbe capital bold. Subheading must be bold italic and Sub-subheading normal italic.At the head of the manuscript, the following informationshould be given: the title of the paper, the name(s) of theauthor(s), the institute where the research was carried out,the present addresses of the authors (foot note) and of thecorresponding author (if different from above Institute).Authors are required to provide running title of the paper.You must supply an E-mail address for the correspondingauthor.The abstract should contain at least one sentence on each ofthe following: objective of investigation (hypothesis, purpose,aim), experimental material, method of investigation, datacollection, result and conclusions. Maximum length of abstractis 175 words. Up to 10 key words should be added at the endof the abstract and separated by comma. Key words must bearranged alphabatically (e.g., EMS, Gamma ray, Mungbean,Mutations, Path coefficient, ......).Each figure, table, and bibliographic entry must have areference in the text. Any correction requested by the reviewershould also be integrated into the file.Manuscript file including tables must be in MS Word andWindows-compatible and must not contain any files otherthan those for the current manuscript. Please do not importthe figures into the text file. The text should be prepared usingstandard software (Microsoft Word); do not use automatedor manual hyphenation.

Length

Manuscripts should not exceed a final length of 15 printedpages, i.e., 5,000 words, including spaces required for figures,tables and list of references. Manuscripts for shortcommunications should not exceed 3000 words (3 printedpages, with not more than a total of 2 figures or tables).

Units, abbreviations and nomenclature

For physical units, unit names and symbols, the SI-systemshould be employed. Biological names should be givenaccording to the latest international nomenclature. Botanicaland zoological names, gene designations and gene symbolsare italicised. Yield data should be reported in kg/ha. The nameof varieties or genotypes must start and end with singleinverted comma (e.g., ‘Priya’, ‘IPA 204’, ......).

Tables and Figures

Tables and figures should be limited to the necessary minimum.Please submit reproducible artwork. For printing of colouredphotograph, authors will be charged Rs. 4000/- perphotograph. It is essential that figures are submitted as high-resolution scans.

ReferencesThe list of references should only include publications citedin the text. They should be cited in alphabetical order underthe first author’s name, listing all authors, the year ofpublication and the complete title, according to the followingexamples:Becker HC, Lin SC and Leon J. 1988. Stability analysis in plantbreeding. Plant Breeding 101: 1-23.Sokal RR and Rholf FJ. 1981. Biometry, 2nd Ed. Freeman, SanFrancisco.Tandon HLS. 1993. Methods of Analysis of Soils, Plants, Waterand Fertilizers (ed). Fertilizer Development and ConsultationOrganization, New Delhi, India. 143 pp.Singh DP. 1989. Mutation breeding in blackgram. In: SA Farookand IA Khan (Eds), Breeding Food Legumes. PremierPublishing House, Hyderabad, India. Pp 103-109.Takkar PN and Randhawa NS. 1980. Zinc deficiency in Indiansoils and plants. In: Proceedings of Seminar on Zinc Wastesand their Utilization, 15-16 October 1980, Indian Lead-ZincInformation Centre, Fertilizer Association of India, New Delhi,India. Pp 13-15.Satyanarayan Y. 1953. Photosociological studies on calcariousplants of Bombay. Ph.D. Thesis, Bombay University, Mumbai,India.In the text, the bibliographical reference is made by giving thename of the author(s) with the year of publication. If there aretwo references, then it should be separated by placing ‘comma’(e.g., Becker et al. 1988, Tandon 1993). If references are of thesame year, arrange them in alphabatic order, otherwise arrangethem in ascending order of the years.While preparing manuscripts, authors are requested to gothrough the latest issue of the journal. Authors are alsorequired to send the names & E-mail address of at least 3-4reviewers appropriate to their articles.

Instructions to Authors

gfgfgfgf

Documents

INDIAN SOCIETY OF PULSES RESEARCH AND DEVELOPMENTisprd.in/pdf/june_final_8nov12.pdfMr Brahm Prakash Treasurer Dr KK Singh Vice President Dr JS Sandhu Editors Dr MA Iquebal, IASRI,