1841Research Article

IntroductionChromatin structure regulation requires the concerted actionsof different histone-modifying enzymes and ATP-dependentchromatin remodeling complexes. The combined presence ofspecific histone modifications, such as acetylation,phosphorylation, methylation, ubiquitylation and sumoylation,on the four core histones (H2A, H2B, H3, H4) that constitutethe nucleosome, has been termed the histone code which is‘read’ by regulatory effector proteins (Jenuwein and Allis,2001).

Histone mono-ubiquitylation (Emre and Berger, 2006) andhistone sumoylation (Nathan et al., 2006) involve addition ofa peptide rather than a smaller organic group. Ubiquitin is apeptide with Mr 7000 that is attached to lysine residues ofsubstrates through the subsequent action of ubiquitin-activating (E1), ubiquitin-conjugating (E2) and ubiquitin-ligating (E3) enzymes. Poly-ubiquitylation usually targets asubstrate for degradation by the proteasome (Varshavsky,2005) whereas mono-ubiquitylation is involved in variousprocesses including DNA repair and regulation of geneexpression (Pickart and Fushman, 2004).

The ubiquitin-conjugating enzymes HR6A and HR6B aretwo very similar mouse homologs of the S. cerevisiae RAD6protein (Roest et al., 2004; Roest et al., 1996). In yeast, RAD6

is required for ubiquitylation of H2BK123, together with an E3named BRE1 (Hwang et al., 2003; Robzyk et al., 2000; Woodet al., 2003). H2AK119 is not ubiquitylated in yeast, but it is aprominent ubiquitylation substrate in mammalian cells,because as much as 10% of H2A, compared with 0.1-2% ofH2B, is ubiquitylated in most mammalian cell typesinvestigated (West and Bonner, 1980). To study the possiblerole of HR6A and HR6B in histone ubiquitylation inmammalian cells, knockout or knockdown approaches arerequired. In mouse, the Hr6a gene is located on the Xchromosome, and Hr6b localizes to chromosome 11. Knockoutmice for each individual gene were generated, but Hr6a-Hr6bdouble-knockouts are not viable, indicating that the twoencoded proteins perform essential redundant functions (Roestet al., 2004). In most cell types, HR6A and HR6B protein levelsare approximately equal, but oocytes contain a relatively highHR6A dose, explained by the presence of two active Xchromosomes (Roest et al., 2004). Conversely, male germlinecells show a relatively low HR6A expression associated withinactivation of the X and Y chromosomes during male meioticprophase (see below), whereas HR6B expression is maintainedat a high level (Koken et al., 1996). In the female and malegermlines, there is a specific requirement for Hr6a and Hr6b,respectively, as reflected by the infertility phenotypes of Hr6a-

Mono-ubiquitylated H2A marks the transcriptionallysilenced XY body during male meiotic prophase.Concomitant with H2AK119ub1, the ubiquitin-conjugatingenzyme HR6B is also enriched on the XY body. Weanalyzed H2A and H2B ubiquitylation in Hr6b-knockoutmouse spermatocytes, but no global changes were detected.Next, we analyzed phosphorylation of the threonineresidues T120 and T119 that are adjacent to the K119 andK120 target sites for ubiquitylation in H2A and H2B,respectively. In wild-type cells, H2AT120ph and H2BT119phmark meiotically unpaired and silenced chromatin,including the XY body. In Hr6b-knockout spermatocytes,the H2BT119ph signal was unchanged, but H2AT120ph wasenhanced from late pachytene until metaphase I.Furthermore, we found increased H3K4 dimethylation onthe X and Y chromosomes of diplotene Hr6b-knockout

spermatocytes, persisting into postmeiotic roundspermatids. In these cells, the X and Y chromosomesmaintained an unchanged H3K9m2 level, even when thismodification was lost from centromeric heterochromatin.Analysis of gene expression showed derepression of Xchromosome genes in postmeiotic Hr6b-knockoutspermatids. We conclude that HR6B exerts control overdifferent histone modifications in spermatocytes andspermatids, and that this function contributes to thepostmeiotic maintenance of X chromosome silencing.

Supplementary material available online athttp://jcs.biologists.org/cgi/content/full/120/11/1841/DC1

Key words: RAD6, HR6A, HR6B, Meiosis, XY body, Histonemodifications

Summary

Increased phosphorylation and dimethylation of XYbody histones in the Hr6b-knockout mouse isassociated with derepression of the X chromosomeWilly M. Baarends1,*, Evelyne Wassenaar1, Jos W. Hoogerbrugge1, Sam Schoenmakers1, Zu-Wen Sun2 andJ. Anton Grootegoed1

1Department of Reproduction and Development, Erasmus MC–University Medical Center, Rotterdam, The Netherlands2Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, TN, USA*Author for correspondence (e-mail: w.baarends@erasmusmc.nl)

Accepted 4 April 2007Journal of Cell Science 120, 1841-1851 Published by The Company of Biologists 2007doi:10.1242/jcs.03451

Jour

nal o

f Cel

l Sci

ence

1842

knockout females and Hr6b-knockout males (Roest et al.,2004; Roest et al., 1996).

During male meiotic prophase, the X and Y chromosomesremain largely unpaired, with the exception of the so-calledpseudoautosomal regions. The XY body is formed when the Xand Y chromosomes are transcriptionally inactivated, by amechanism named ‘meiotic silencing of unsynapsedchromatin’ (MSUC) (Schimenti, 2005). Proteins that arespecifically associated with the XY body during meioticprophase, may play a role in MSUC. In particular, recruitmentof the checkpoint kinase ATR by the BRCA1 protein andsubsequent phosphorylation of Ser139 of H2AX have beenshown to be essential for MSUC (Fernandez-Capetillo et al.,2003; Turner et al., 2004; Turner et al., 2005). Interestingly,H2AK119ub1 is also enriched on the XY body, concomitant withaccumulation of the HR6B enzyme (Baarends et al., 2005; vander Laan et al., 2004). However, HR6A- or HR6B-dependenthistone modifications in mammalian cells have not beendescribed.

Hr6b-knockout spermatocytes display an increasedfrequency of meiotic recombination, possibly related todisruption of the structural organization of the pairedchromosomes as a consequence of dysregulation of histonemodifications (Baarends et al., 2003). In yeast, RAD6-dependent H2BK123 ubiquitylation is required for H3K4 andH3K79 methylation in a trans-histone regulatory mechanism(Dover et al., 2002; Ng et al., 2002; Sun and Allis, 2002). Inaddition, neighboring amino acid residues can be modified bydifferent posttranslational modifications, and this wasproposed to function as a binary switch (Fischle et al., 2003).The existence of such a binary switch in H3 was recentlyshown to involve stable methylation on Lys9 and transientphosphorylation of Ser10 (Fischle et al., 2005). The H2A andH2B ubiquitin-accepting lysines together with their respective

adjacent threonine residues may also form binary switches(Fischle et al., 2003). It is not known whether H2BT119 isphosphorylated, but H2AT120 is phosphorylated bynucleosomal histone kinase-1 (NHK-1) in Drosophila (Aiharaet al., 2004). Based on the findings of trans-histone regulationin yeast and the binary switch model, we have analyzed histoneubiquitylation as well as H2AT120 and H2BT119phosphorylation, and H3K4 and H3K9 methylation in wild-typeand Hr6b-knockout animals. Finally, we have analyzedchanges in X chromosomal gene expression in wild-type andHr6b-knockout meiotic and postmeiotic spermatogenic cells.

ResultsHistone H2AK119 and H2BK120 ubiquitylationBy analogy to the function of RAD6 in yeast, ubiquitylationof H2BK120 is the most obvious candidate histone modificationthat could be affected in Hr6b-knockout mice. To study theeffect of loss of HR6B on H2BK120 ubiquitylation inspermatogenesis we analyzed H2BK120 ubiquitylation inspermatocytes and spermatids isolated from wild-type andHr6b-knockout testes. Antibodies that specifically recognizeubiquitylated H2BK120 are not available, and we used anti-H2Bto detect both H2B and H2BK120ub1 (Fig. 1A). In addition, theuse of antibodies against ubiquitin and H2AK119ub1 allowed usto compare the amounts of H2AK119ub1 and H2BK120ub1 (Fig.1B). The results show that the global levels of H2AK119 andH2BK120 ubiquitylation are not affected in Hr6b-knockoutspermatogenic cells (Fig. 1B).

Histone H2AT120 and H2BT119 phosphorylationThe binary switch model predicts that phosphorylation of thethreonines that are immediately adjacent to Lys119 and Lys120in H2A and H2B, respectively, would take part in a mechanismto regulate binding of effectors of the histone code (Fischle et

al., 2003). In this mechanism, the pattern ofubiquitylation and phosphorylation at theseneighboring residues may be interdependent. Toanalyze these modifications in wild-type and Hr6b-knockout spermatocytes, we performedimmunocytochemical analysis using specificantibodies against phosphorylated H2AT120 andH2BT119. To identify the different substages ofmeiotic prophase, we co-stained with an antibodythat recognizes SYCP3. This protein is a componentof the axial elements (before synapsis) or lateralelements (during synapsis) of the synaptonemalcomplex (SC) that forms between the chromosomalaxes of pairing homologous chromosomes duringmeiotic prophase (reviewed by Heyting, 1996).Round spermatids are recognized using DAPIstaining of DNA, which also visualizes thechromocenter, a heterochromatic dense-staininground area containing the centromeric DNA in thecenter of the spermatid nucleus.

The highest level of H2BT119ph was observed alongthe unpaired axial elements of the X and Ychromosomes of pachytene and diplotenespermatocytes, and a lower level extended over therest of the XY body chromatin (Fig. 2A).Interestingly, H2BT119ph was strongly reduced on afew foci along the unpaired axial elements of

Journal of Cell Science 120 (11)

Fig. 1. HR6B is not required for histone ubiquitylation in spermatocytes.(A) Basic nuclear proteins were isolated from purified spermatocytes, andanalyzed on western blots using anti-H2B antibody. The antibody recognizesunmodified H2B and H2BK120ub1 (as indicated by arrows). In the control lane(Ctr), the first antibody was omitted from the incubation mixture. The boxedarea is presented for each immunostaining in B. (B) Histone ubiquitylationwas analyzed in spermatocytes (spc) and spermatids (spt) isolated from wild-type (+/+) and Hr6b-knockout (–/–) mice. From top to bottom, antibodies weretargeting ubiquitin, H2AK119ub1 and H2B as indicated on the right of the blots,and the modified histones are indicated by arrows. Representative results areshown; each experiment was repeated at least twice with germ cellpreparations isolated from a different pool of mice. Equal amounts of proteinwere present in each lane, as verified by Ponceau S staining of the blot (notshown).

Jour

nal o

f Cel

l Sci

ence

1843Hr6b knockout affects XY body chromatin

pachytene nuclei. All other spermatogenic cell nuclei werenegative, except for metaphases of mitotic spermatogonia andmeiotic spermatocytes, where H2BT119ph was mainly detectedon centromeric DNA (Fig. 2B, and results not shown). In nucleiof Hr6b-knockout spermatocytes, the staining pattern and levelof H2BT119ph were not different from the wild type (not shown).In cultured human somatic cells (HeLa), H2BT119phosphorylation was restricted to centromeric DNA ofmetaphase nuclei (Fig. 2B). All observed signals could becompeted by the phosphorylated peptide that was used togenerate the antibody and not by similar amounts of non-phosphorylated peptide, indicating that the antibodyselectively recognized H2BT119ph on nuclei (data not shown).

Next, we analyzed H2AT120ph in spread nuclei of testes fromwild-type and Hr6b-knockout mice. In wild-type cells,H2AT120ph was found to be high in leptotene/zygotenespermatocyte nuclei, with the exception of regions containingcentromeric DNA. Most H2AT120ph is lost at early pachytene,but it remains present on the XY body. During late pachyteneand diplotene development, H2AT120 phosphorylationdecreases further, and the staining disappears also from the XYbody. Hereafter, H2AT120ph increases on centromeric DNAduring meiotic divisions. Then, early round spermatids show alow level of H2AT120ph, but an increased level of H2AT120ph inthe whole nucleus is detected at later stages of round spermatiddevelopment, with the highest signal in the chromocenter (Fig.3A). Antibody specificity was again demonstrated throughcompetition with phosphorylated and nonphosphorylatedpeptides (not shown). In Hr6b-knockout spermatogenic cells,we observed interesting alterations in the pattern of H2AT120phosphorylation. In late pachytene and diplotene spermatocytenuclei, phosphorylation of H2AT120 was increased comparedwith wild-type nuclei of the same stages (Fig. 3B). Most

strikingly, we observed enhanced signals on the XY body. Wealso found much higher H2AT120ph on metaphase Ichromosomes of Hr6b-knockout compared with wild-typecells. Following the meiotic divisions, H2AT120ph in Hr6b-knockout round spermatids was back to the wild-type level. Tosubstantiate these findings, the H2AT120ph signal wasquantified in wild-type and Hr6b-knockout diplotenespermatocytes (Fig. 3C). The results show a threefold increasein nuclear H2AT120ph of Hr6b-knockout diplotenespermatocytes compared to levels in the wild type, and afivefold increase in XY-body-associated H2AT120ph.

Previously, we reported accumulation of H2AK119ub1 on theXY body of pachytene spermatocytes of wild-type and Hr6b-knockout mice (Baarends et al., 1999; Baarends et al., 2005).The staining for H2AK119ub1 was repeated, and quantificationof the immunofluorescent signal confirmed that H2AK119ub1levels were similar in wild-type and Hr6b-knockoutspermatocytes (Fig. 3D). Next, we studied the developmentaltime course of H2AT120ph and H2AK119ub1 in wild-type andHr6b-knockout meiotic spread nuclei using tripleimmunocytochemical staining. In wild-type early pachytenespermatocytes, H2AT120ph precedes H2AK119ub1 on the XYbody. Then, H2AT120ph strongly decreases during mid-pachytene, as H2AK119ub1 increases to a high level that isreached during late pachytene (Fig. 4A). In Hr6b-knockoutpachytene spermatocyte nuclei, H2AT120ph also precedesH2AK119ub1, but remains present until diplotene, which resultsin high signals for the two modifications within the samenucleus (Fig. 4B).

To investigate whether H2A molecules are present thatcontain both the phosphorylation and the ubiquitylation marks,we performed western blot analysis for basic nuclear proteinextracts from testis. In addition to H2AT120ph, a faint but

Fig. 2. H2BT119ph on the XY body and on meiotic and mitotic metaphase chromosomes. (A) Double immunostaining of pachytene anddiplotene spermatocyte nuclei with anti-SYCP3 (red) and anti-H2BT119ph (green). The insert shows a larger magnification of the area containingthe XY body. Arrowheads, pseudoautosomal synapsed region; arrows, patches of synaptonemal complex lateral elements that are H2BT119phnegative. (B) H2BT119ph (green) and SYCP3 (red) on meiotic metaphase (left) and H2BT119ph (green) on DAPI-stained (blue) mitotic HeLa cellnucleus (right). Bars, 10 �m.

Jour

nal o

f Cel

l Sci

ence

1844

specific band with a size corresponding to H2AK119ub1 wasidentified, and this probably represents a small fraction of H2Athat is both ubiquitylated and phosphorylated at the adjacentLys119 and Thr120, respectively, in wild-type testis (Fig. 4C).Spermatocytes of Hr6b-knockout mice show a higher level ofboth H2AT120ph and H2AK119ub1T120ph compared with the wild

type (Fig. 4D). The H2AT120ph signal is higher in spermatidscompared with spermatocytes, but we observed no differencebetween wild-type and Hr6b-knockout spermatids. The patternof H2AT120ph resembles the known pattern of H2AXS139phosphorylation during meiotic prophase (Fernandez-Capetilloet al., 2003; Turner et al., 2004), but we detected no differences

Journal of Cell Science 120 (11)

Fig. 3. H2AT120ph is increased inHr6b-knockout spermatocytenuclei. Double immunostainingof wild-type (A) and Hr6b-knockout (B) spermatocyte andspermatid nuclei with anti-SYCP3 (red) and anti-H2AT120ph(green) antibodies. Forspermatids, separate images ofthe H2AT120ph (green) and DAPI(blue) staining are shown.Arrowhead, XY body; Z,zygotene; eP, early pachytene; lP,late pachytene; eD, earlydiplotene; lD, late diplotene; MI,Metaphase I; eT, early roundspermatid; lT, late roundspermatid. Bar, 10 �m.(C) Quantification of H2AT120phimmunofluorescent signal inearly and late diplotene nuclei ofwild-type (wt) and Hr6b-knockout (ko) mouse testes.Arbitrary units per �m2 werecalculated for the area coveringthe XY body and for the areacovering the autosomes. Errorbars represent the s.e.m. for 20nuclei that were measured foreach genotype from two differentanimals. (D) Quantification ofH2AK119ub1 immunofluorescentsignal in pachytene nuclei ofwild-type (wt) and Hr6b-knockout (ko) mouse testes.Arbitrary units per �m2 werecalculated for the area coveringthe XY body and for the areacovering the autosomes. Errorbars represent the s.e.m. for 20nuclei that were measured foreach genotype from two differentanimals.

Jour

nal o

f Cel

l Sci

ence

1845Hr6b knockout affects XY body chromatin

for the patterns of H2AXS139 phosphorylation in wild-type andHr6b-knockout spermatocytes (not shown).

H2AK119ub1 is associated not only with the XY body, but alsowith other chromatin areas that remain unsynapsed duringmeiotic prophase (Baarends et al., 2005). These findingsindicated that H2AK119 ubiquitylation could be important forMSUC, the silencing of this chromatin. To establish whetherH2BT119ph and H2AT120ph are also associated with MSUC, weinvestigated these modifications in T/T’ mice. These mice aredouble heterozygous for two very similar translocationsbetween chromosomes 1 and 13, and the small 113 bivalentoften shows regions of unsynapsed chromatin that are subject

to MSUC (Baarends et al., 2005). The results show that bothH2BT119ph and H2AT120ph localize not only to the XY body, butalso to the 113 translocation bivalent (see supplementarymaterial Fig. S1).

XY body nucleosome replacementHistone variant H3.1 is deposited on DNA during DNAreplication, whereas H3.3 is a replacement histone that can beincorporated into nucleosomes on DNA, independent of thecell cycle phase (Tagami et al., 2004). Using antibodies againstthese different histone variants, it was recently shown that allnucleosomes associated with the X and Y chromosomes are

Fig. 4. H2AT120 phosphorylation in association with H2AK119 ubiquitylation in Hr6b-knockout pachytene spermatocytes. Tripleimmunostaining of wild-type (A) and Hr6b-knockout (B) early (eP), mid (mP) and late (lP) spread pachytene nuclei with anti-H2AT120ph (blue),anti-H2AK119ub1 (green) and anti-SYCP3 (red). The left panels show the merge of the H2AT120ph signal and SYCP3 signal, and right panelsshow the merge of the H2AK119ub1 (green) signal and SYCP3 signal (red). The arrowheads indicate the XY body. Bar, 10 �m. (C) Western blotanalysis of H2AT120ph in basic nuclear protein extracts from total testis (C). Specificity of the antibody reaction is shown by competition of thesignal with the phosphorylated H2A peptide (+p) but not with the nonphosphorylated peptide (–p). The identities of protein bands are indicated.Equal amounts of protein were present in each lane, as verified by Ponceau S staining of the blot (not shown). (D) Western blot analyses ofH2AT120ph and ubiquitylated histones (ubi-his) in basic nuclear protein extracts from spermatocytes (spc) and spermatids (spt) isolated fromwild-type (wt) and Hr6b-knockout (ko) mice. Asterisk indicates a non-specific protein band enriched in germ cell extracts compared with totaltestis extracts; the localization of H2AK119ub1T120ph was verified using the localization of ubiquitylated histones visible on the same blot that wasstripped and reprobed with anti-ubiquitin antibody as shown. Equal amounts of protein were present in each lane, as verified by Ponceau Sstaining of the blot (not shown).

Jour

nal o

f Cel

l Sci

ence

1846

replaced during pachytene (van der Heijden et al., 2007).During this process, H3.1 gradually disappears from the XYbody, concomitant with a gradual increase of the H3.3 level(van der Heijden et al., 2007). We analyzed XY bodynucleosome replacement in Hr6b-knockout and wild-typespermatocytes, to assess whether the altered dynamics ofH2AT120ph in Hr6b-knockout spermatocytes could be causedby disturbances in the general replacement of nucleosomes.Triple immunofluorescent analyses of SYCP3, H2AT120ph andH3.1 show that the disappearance of H3.1 from the XY bodyin wild-type pachytene spermatocytes coincides with thedisappearance of H2AT120ph (see supplementary materialFig. S3A). However, in Hr6b-knockout late pachytenespermatocytes, the XY-body-associated H2AT120ph signal isstill high when H3.1 has disappeared from the XY body (seesupplementary material Fig. S3B). Thus, although H2AT120pdynamics have changed in Hr6b-knockout spermatocytes,H3.1 disappearance from the XY body follows the wild-typepattern.

H3K4 methylationSince H2BT119ph was not changed in Hr6b-knockoutspermatocytes, we next analyzed H3K4 methylation in spreadnuclei of spermatogenic cells as another possible indirectreadout of dynamic changes in H2B ubiquitylation. We haveused antibodies targeting H3K4m1, H3K4m2 and H3K4m3, andhere we focus on results obtained with anti-H3K4m2. Similarresults were obtained with anti-H3K4m1, but H3K4m3 levels werenot consistently different between spermatogenic cells of wild-type and Hr6b-knockout mice (not shown). In agreement withthe known general association of H3K4m2 with potentiated ortranscriptionally active chromatin, we observed a low level ofH3K4m2 in regions containing heterochromatic centromericDNA (Fig. 5A). In meiotic prophase, the overall level of H3K4dimethylation was highest on euchromatin of leptotene/zygotene spermatocytes. The overall H3K4m2 signal was verylow in pachytene and diplotene spermatocyte nuclei, followedby an increase during the meiotic divisions and post-meioticround spermatid development. The XY body shows an evenlower level of H3K4m2 compared with the rest of the pachytenenucleus. During diplotene and subsequent stages, H3K4m2 onthe XY body gradually increases to a level that exceeds theH3K4m2 signal on autosomal chromatin (Fig. 5A). In haploidround spermatids, either the X or the Y chromosome is locatedadjacent to the chromocenter. Localization of H3K4m2 on the Xor Y chromosomes in round spermatids was verified usingFISH (Fig. 5C). It should be noted that a significant fractionof round spermatids showed no increased H3K4m2 signal on Xor Y, and this most likely reflects H3K4m2 loss from the sexchromosomes in round spermatid at steps 6-7 (just prior tospermatid elongation), as verified by immunohistochemicalanalysis (not shown).

When we compared developmental H3K4 dimethylationpatterns in wild-type and Hr6b-knockout testis cellpreparations, we observed increased H3K4m2 on the X and Ychromosomes from diplotene onwards (Fig. 5A-C,supplementary material Fig. S2). This ~2.5-fold increase ofH3K4m2 was verified by quantification of the fluorescent signalin nuclei and XY bodies of wild-type and Hr6b-knockoutdiplotene spermatocytes (Fig. 5B). The increased H3K4m2signal persisted in metaphase I and metaphase/anaphase II

spermatocytes (see supplementary material Fig. S2) and roundspermatids (Fig. 5C).

H3K9 methylationPreviously, we have found that the synaptonemal complexes(SCs) of late pachytene Hr6b-knockout spermatocytes arelonger and thinner compared with the SCs of wild-type cells.In addition, we found a loss of SC components from neartelomeric regions in Hr6b-knockout late pachytene nuclei(Baarends et al., 2003). These findings probably reflect aglobal change in chromatin structure in late pachytene anddiplotene spermatocytes. To investigate this further, weanalyzed additional histone modifications generally associatedwith active (H4K16 and H2AK119 acetylation) or inactive

Journal of Cell Science 120 (11)

Fig. 5. Increased dimethylation of H3K4 on XY chromatin of Hr6b-knockout spermatocytes and spermatids. (A) Double immunostainingof wild-type and Hr6b-knockout diplotene nuclei with anti-H3K4m2(green) and anti-SYCP3 (red). Arrowhead indicates the XY body.(B) Quantification of H3K4m2 immunofluorescent signal onautosomal and XY body chromatin of wild-type (wt) and Hr6b-knockout (ko) diplotene spermatocytes. Arbitrary units per �m2 werecalculated for the area covering the XY body and for the areacovering the autosomes. Error bars represent the s.e.m. for 20 nucleithat were measured for each genotype from two different animals.(C) Immunostaining with anti-H3K4m2 (green) combined with Xchromosome FISH (red) on wild-type spermatocyte and spermatidnuclei (left panel). The right panels show immunostaining of wild-type and Hr6b-knockout spermatid nuclei with anti-H3K4m2(green). DNA is stained with DAPI (blue). White arrows in the leftpanel indicate the position of the X chromosome, and the pink arrowdenotes the Y chromosome. The arrowhead indicates an XY body ofa pachytene spermatocyte. Bars, 10 �m.

Jour

nal o

f Cel

l Sci

ence

1847Hr6b knockout affects XY body chromatin

(H3K9m1, H3K9m2, H3K9m3, H3K27m2 and H3K27m3) chromatinduring spermatogenesis in wild-type and Hr6b-knockout mice(not shown). Of these, only H3K9m2 appeared to be differentbetween wild-type and Hr6b-knockout spermatocytes. H3K9m2generally marks silent chromatin, and in wild-type diplotenespermatocytes the level is high on centromericheterochromatin and the XY body. In Hr6b-knockout diplotenespermatocytes, H3K9m2 is much lower on centromericheterochromatin compared with wild-type nuclei of the samestage, but a normal level is observed on the XY body (Fig.6A,B). Also, in round spermatids, H3K9m2 is lower on thechromocenter, but not on either X or Y (Fig. 6A,B).

MacroH2A1MacroH2A1 is also enriched on heterochromatin and the XYbody in late pachytene and diplotene spermatocytes (Hoyer-Fender et al., 2000). We found a small increase in the overalllevel of macroH2A1 in Hr6b-knockout diplotenespermatocytes, compared with wild-type cells. This is aglobal change, with the same relative increase on autosomaland sex chromosomal chromatin (see supplementary materialFig. S3C,D). In round spermatids, macroH2A1 is graduallylost from autosomes and sex chromosomes, in a pattern thatis not different between wild-type and Hr6b-knockoutcells (not shown). Western blot analyses for basic nuclearproteins extracted from wild-type and Hr6b-knockoutspermatocytes and spermatids, showed no effect of Hr6bmutation on macroH2A1 levels, and also not on H3K4m2 andH3K9m2 levels (see supplementary material Fig. S3E). Asdescribed in the legend to Figure S3E, the western blotsrepresent a mixed cell population in which subnuclearchanges that occur in germ cell substages that constitute asmall fraction of the total will go undetected. The westernblot results for these histone variants and modifications,therefore, confirm their presence, but cannot provideadditional detail about the sub-nuclear and temporal controlof these modifications.

Postmeiotic maintenance of X chromosome silencingThe relatively high level of H3K4m2 on the X and Ychromosomes in Hr6b-knockout spermatids may be relatedto changes in transcriptional activity. To investigate thisfurther, we analyzed the expression of several Xchromosomal and autosomal genes in cell preparations

isolated from wild-type and Hr6b-knockout mice. Geneswere selected based on data from Namekawa et al.(Namekawa et al., 2006) who showed that transcription fromthe X chromosome is largely repressed in meiotic andpostmeiotic cells (Namekawa et al., 2006). We selected fourgenes that were reported to remain repressed in thepostmeiotic spermatids (Chic1, Atp7a, Gla and Hprt) and twogenes that showed postmeiotic reactivation (Ube1x andPctk1) (Namekawa et al., 2006). In addition, we selected fourautosomal genes that are expressed at meiotic (Spo11 andSycp3) and postmeiotic (Tnp1 and Creb3l4) spermatogenicdevelopmental steps. Real-time RT-PCR expression datawere normalized to Actb (�-actin) mRNA, which showedequal expression in the different cell preparations (data notshown). For the autosomal genes, no significant differencesbetween wild-type and Hr6b-knockout cells were detected(Fig. 7A). However, five out of the six X chromosomal genesthat were tested show increased expression in Hr6b-knockoutcells compared with the wild type (Fig. 7B). This effect wasmost clear for round spermatids. Pctk1 is expressed at arelatively high level compared with the other tested X-chromosomal genes, and no further upregulation of itspostmeiotic expression was observed for the Hr6b-knockoutcells (Fig. 7B). Taken together, the results indicate thatpostmeiotic maintenance of X-chromosomal gene silencingis compromised in Hr6b-knockout spermatids.

DiscussionHR6A/B and histone ubiquitylationRAD6 is a protein that is highly conserved in evolution. It ismost well known for its pivotal function in replicative damagebypass, a pathway that allows replication to proceed in thepresence of a damaged template (van der Laan et al., 2005).RAD6 is also essential for sporulation, and this involves H2Bubiquitylation by RAD6, together with BRE1 (Hwang et al.,2003; Robzyk et al., 2000; Wood et al., 2003). The presentresults indicate that HR6A and HR6B do not act as maindeterminants of global histone ubiquitylation in mammaliancells, since we observe no detectable defects in H2A or H2Bubiquitylation in spermatocytes from Hr6b-knockout males.HR6A is still expressed in these cells, at a low level (Baarendset al., 2003), and we cannot exclude the possibility that thissmall amount of HR6A is responsible for the observedmaintenance of global histone ubiquitylation in Hr6b-

Fig. 6. Loss of H3K9m2 from centromericheterochromatin, but not from X and Y inHr6b-knockout diplotene spermatocytesand spermatids. Immunostaining withanti-H3K9m2 (green) and anti-SYCP3(red) of wild-type (A) and Hr6b-knockout (B) early (eD) and late (lD)diplotene spermatocytes (upper panels),and round spermatids (spt) (lowerpanels). DNA is stained with DAPI(blue). Arrowheads indicate the XYbody. Bar, 10 �m.

Jour

nal o

f Cel

l Sci

ence

1848

knockout germline cells. In addition, redundancy with otherE2 enzymes may prevent detection of some role of HR6B indynamic control of histone ubiquitylation. Ideally, Hr6a-Hr6bdouble-knockout cells should be used to address the role ofHR6A and HR6B in histone ubiquitylation in somatic andgermline cells, but these cells are not obtained (Roest et al.,2004).

Recently, the human E2 enzyme UBCH6 has been shown tobe able to ubiquitylate H2B in vitro, together with an E3complex consisting of RNF20 and RNF40 proteins (Zhu et al.,2005). RNF20 and RNF40 are orthologs of BRE1, the yeastE3 that ubiquitylates H2B. In addition to the evolutionaryconservation of these components, the pathway leading from

H2B ubiquitylation to H3K4 methylation also appears to beconserved (Zhu et al., 2005). Possibly, the role of RAD6 inhistone ubiquitylation has been taken over, at least in part, byUBCH6. Given the conservation of the trans-histone regulatorypathway, leading from H2BK120 ubiquitylation to H3K4methylation, our observation that H3K4 methylation in Hr6b-knockout spermatogenic cells is not reduced, provides furtherevidence that H2B ubiquitylation is not affected in HR6B-deficient spermatocytes. HR6B localizes primarily to the XYbody, and most likely is required to ubiquitylate certain XYbody chromatin components, but not H2A or H2B. Somehow,lack of HR6B affects H2AT120ph, and this may subsequentlylead to increased H3K4m1 and H3K4m2, specifically in the XYbody. Previously, Khalil and Driscoll (Khalil and Driscoll,2006), reported that H3K4m2 is upregulated on the silent XYbody of wild-type diplotene spermatocytes. Our data confirmtheir findings, and we show that in Hr6b-knockoutspermatocytes this modification is further upregulated on Xand Y. We did not detect a consistent increase in H3K4m3 levels,but the anti-H3K4m3 antibodies crossreact to some extent withH3K4m2. Therefore, we cannot exclude that in addition toH3K4m2, H3K4m3 is also increased.

Global versus XY specific chromatin regulationHR6A and HR6B probably exert multiple functions duringspermatogenesis. During meiotic prophase, HR6Bconcentrates on the XY body, but is also present on autosomalchromatin. Previously, we have shown that Hr6b-knockoutspermatocytes show a higher recombination frequencyassociated with some dysregulation of the structure of thesynaptonemal complex (Baarends et al., 2003). Changes in thesynaptonemal complex might follow after global changes inchromatin structure, and such global changes are indicated byincreased macroH2A1 and decreased H3K9m2 levels of meioticprophase chromatin. This provides a background for theobserved differential effects of HR6B deficiency on autosomalversus XY associated histone modifications. Interestingly,however, the loss of H3K9m2 signal in Hr6b-knockout diplotenespermatocytes and round spermatids occurs on allheterochromatin, but not on XY chromatin. This adds to ourobservations on the marked XY-associated increase inH2AT120p and H3K4m2 signals.

H2AT120ph and regulation of chromatin organizationIn Drosophila, nucleosomal histone kinase-1 (NHK-1)phosphorylates H2AT120 (Aihara et al., 2004). Female flies thatcarry a mutation in the gene encoding NHK-1 are infertile(Ivanovska et al., 2005). Loss of H2AT120ph was shown to beassociated with a failure to disassemble the synaptonemalcomplex and with impaired loading of condensin (Ivanovskaet al., 2005). H2AT120ph in mouse may also be associated withregulation at this level of chromatin organization. Duringmeiosis, we observed a very high level of H2AT120ph, not onlyat metaphase, but also in leptotene-zygotene spermatocytes.This indicates that H2AT120ph may be relevant not only fordisassembly of the synaptonemal complex (SC), but also forits assembly. Hr6b-knockout spermatocytes show SCs that arelonger, with some loss of SC proteins from near centromericregions (Baarends et al., 2003). Thus, in analogy to what isobserved in Drosophila, the modified level and pattern ofH2AT120ph in Hr6b-knockout spermatocytes may be related to

Journal of Cell Science 120 (11)

0

0.2

0.4

0.6

spc/spt spt

wt ko wt ko

Gla

0

0.2

0.4

0.6 Atp7a

0

0.01

0.02

0.03Chic1

0

1

2

3

4 Hprt

0

1

2

3

4

5 Ube1x

0

10

20

30

40Pctk1

spc/spt spt

wt ko wt ko

0

10

20Spo11

0

10

20

30

40Sycp2

0

1000

2000

3000 Tnp1

20

40

60

0

Creb3l4

spc/spt spt

wt ko wt ko

spc/spt spt

wt ko wt ko

B

A

Fig. 7. Derepression of X chromosomal genes in Hr6b-knockoutspermatids. Real-time RT-PCR quantification of mRNA levels offour autosomal genes (A) and six X chromosomal genes (B) in amixed spermatocyte/spermatid (spc/spt) and purified spermatid (spt)cell preparation from wild-type (wt) and Hr6b-knockout (ko) mice.The amount of PCR products was normalized to Actb (�-actin)mRNA (�100). Results from two independent experiments areshown. For each experiment, the value represents the average of aduplicate real-time PCR experiment.

Jour

nal o

f Cel

l Sci

ence

1849Hr6b knockout affects XY body chromatin

a role of HR6B in the maintenance of a normal SC structure.Such a relationship may also appear from the observed loss ofH3K9me2 from centromeric heterochromatin in Hr6b-knockoutdiplotene spermatocytes.

In wild-type spermatocytes going through meiotic prophase,H2AT120 phosphorylation decreases as H2AK119 ubiquitylationincreases. Also, during spermatid elongation, H2AT120phdecreases again when H2AK119ub1 increases (our unpublishedresults).

This indicates that H2AT120 phosphorylation isdownregulated prior to H2AK119 ubiquitylation. Loss of XY-body-associated H2AT120 phosphorylation occursconcomitantly with the exchange of all nucleosomes from theXY body, as visualized by the loss of H3.1. Therefore, noactive dephosphorylation may be required at this stage. InHr6b-knockout pachytene spermatocytes, H2AT120ph is notproperly removed, but H2AK119 ubiquitylation increases as inthe wild type. Apparently, H2AT120ph dephosphorylation is nota prerequisite for H2AK119 ubiquitylation.

In Hr6b-knockout pachytene and diplotene nuclei,H2AT120ph is increased throughout the nucleus, but thecombined H2AK119ub1T120ph modification is present mainly onthe XY body. This might lead to XY-body-restrictedrecruitment of complexes that recognize this combinatorycode, and such a mechanism would provide an explanation fora subsequent increase of H3K4me2 only on the XY body ofHr6b-knockout diplotene spermatocytes.

H2AT120 and H2BT119 phosphorylation and meioticsilencing of unpaired chromatin (MSUC)In meiotic prophase nuclei we detect H2BT119ph only onchromatin associated with the unpaired axial elements of theXY body. Then, when cells enter metaphase I, H2BT119phlocalizes on centromeric DNA. On western blots of basicnuclear proteins isolated from testis, no specific signal couldbe obtained with anti-H2BT119ph antibody (results not shown).This may be due to the fact that the percentage of H2BT119phis extremely low compared with the amount ofunphosphorylated H2B. The localization of H2BT119ph oncentromeric DNA of metaphase chromosomes of mitoticsomatic cells is similar to the reported localization ofH2AT120ph on metaphase chromosomes of mitotic cells fromDrosophila (Aihara et al., 2004) and human (our unpublishedobservations). However, during spermatogenesis, the twomodifications display different localization patterns andkinetics. H2AT120ph is first present on all chromatin duringzygotene, and then persists on unpaired chromatin. By contrast,H2BT119ph is absent during leptotene-zygotene, andsubsequently this phosphorylation is specifically induced onchromatin associated with unpaired axial elements. On the XYbody, H2AT120ph covers all chromatin, whereas H2BT119ph ismainly concentrated on the axial elements that are unpaired,and it is excluded from pseudoautosomal regions, and a fewunidentified small regions on the axial elements, which appearto show enhanced SYCP3 staining.

In spermatocytes from T/T’ mice, phosphorylation ofH2AT120 and H2BT119 is enhanced on the partially synapsed 113

bivalent. Taken together with the observations on thesemodifications for the unpaired and silenced XY chromatin, thisindicates that H2AT120ph and H2BT119ph may be functionallyrelevant for MSUC.

Postmeiotic derepression of X-chromosomal geneexpression in Hr6b-knockout spermatidsIn Hr6b-knockout spermatocytes, accumulation of specificXY-body-associated histone modifications and nucleosomereplacement all occur as in wild-type cells. The increase inH3K4m2 on X and Y chromatin becomes apparent in latemeiotic prophase spermatocytes, and remains present inpostmeiotic Hr6b-knockout cells. Therefore, we conclude thatXY body formation in Hr6b-knockout spermatocytes is notaffected; rather, late meiotic and postmeiotic regulation of XYchromatin appears to be disturbed. This is supported by ourfinding that the most obvious derepression of X-chromosomalgenes is detected in postmeiotic spermatids.

H3K4 methylation is generally found in association withactive genes, although recent data indicate that certainrepressors of gene expression can also bind methylated H3K4(reviewed by Becker, 2006). We find upregulation of five outof six tested X chromosomal genes in Hr6b-knockoutspermatids, and no downregulation. This effect points to a linkbetween H3K4 methylation and gene activation on thepostmeiotic X chromosome. The autosomal genes tested showwild-type mRNA levels in the Hr6b-knockout cells. Althoughwe do not exclude that autosomal gene expression is affectedto some extent, the loss of HR6B activity seems to exert a morepronounced effect on transcriptional activity of the Xchromosome.

The data presented herein provide evidence for a role ofHR6B in the regulation of histone modifications in mammaliancells. This has been revealed in Hr6b-knockout spermatocytes,a cell type with a relatively low level of HR6A. HR6A andHR6B show 96% amino acid similarity, and at present we haveno indications that HR6A and HR6B perform differentactivities, either in somatic or in germline cells. Inspermatocytes, HR6B localizes mainly on the XY body,together with the putative partner ubiquitin ligase RAD18 (vander Laan et al., 2004). Although H2AK119ub1 is also enrichedon the XY body, our findings indicate that HR6B activity isnot responsible for this modification. Moreover, HR6B is notrequired for global H2BK120 ubiquitylation. Instead, we haveestablished that loss of HR6B affects other aspects of histonemodifications associated with the XY body, in particularexerting an effect on H2AT120ph and H3K4m2, in associationwith derepression of X-chromosomal genes in postmeioticcells.

Materials and MethodsIsolation of different cell types from mouse testisSpermatocytes and round spermatids were isolated from 4- to 5-week-old wild-type(FVB) and Hr6b-knockout mouse testes after collagenase and trypsin treatment,followed by sedimentation at unit gravity (StaPut procedure) (Grootegoed et al.,1986). This yielded a fraction containing approximately equal amounts ofspermatocytes and round spermatids (spc/spt), with few other contaminating cells(<10%), and a fraction containing >90% pure spermatids (spt). These fractions wereused for analysis of RNA. For protein analysis, cells were further purified (>90%)by density gradient centrifugation through Percoll (Grootegoed et al., 1986)resulting in preparations of spermatocytes (spc) and spermatids (spt). Cells weresnap-frozen in liquid nitrogen and stored at –80°C.

Generation of antibodiesAntibody against peptide CPGGRKHSGKSGKPPL representing amino acids 22-37 of mouse SYCP3, with an added N-terminal cysteine, was generated atEurogentec (Seraing, Belgium) according to their protocols. Antibodies againstH2AT120ph, H2BT119ph, and H2AK119ac were generated in rabbits using peptidesGTKAVT*KYTSS, LLPKKT*ESHH, and QAVLLPKK*TESH (asterisk indicatesphosphorylated or acetylated residue), respectively, using standard protocols.

Jour

nal o

f Cel

l Sci

ence

1850

Phosphorylated and non-phosphorylated and acetylated and non-acetylated peptideswere used in competition experiments to test antibody specificity.

Isolation of acid-soluble nuclear proteins and western blottingNuclei and acid-soluble proteins were isolated from cell preparations or total testesaccording to Chen et al. (Chen et al., 1998). The isolated protein fraction wasprecipitated with 5% (w/v) trichloroacetic acid. 20 �g of protein per sample wasseparated on 12% SDS-polyacrylamide gels and the separated proteins weretransferred to nitrocellulose membranes, using the Bio-Rad miniprotean III systemand blot cells (Bio-Rad, Veenendaal, Netherlands). Membranes were stained withPonceau S (Sigma-Aldrich, Zwijndrecht, Netherlands) according to the supplier’sprotocol.

Modified histones were detected with mouse monoclonal IgM anti-H2AK119ub1

(Upstate, Waltham, MA), rabbit polyclonal anti-ubiquitin (DakoCytomation,Glostrup, Denmark), rabbit polyclonal anti-H2B (Upstate) and rabbit polyclonalanti-H2AT120ph.

Meiotic spread nuclei preparations and immunocytochemistryTestes were obtained from adult T(1;13)70H/T(1;13)1Wa (T/T’) mice (Swissrandom bred), and from 5-week-old wild-type and Hr6b-knockout mice (FVBbackground).

Testis tissues were processed to obtain spread nuclei for immunocytochemistryas described by Peters et al. (Peters et al., 1997), Spread nuclei of spermatocyteswere stained with rat polyclonal anti-Sycp3, mouse monoclonal IgM anti-ubi-H2A(Upstate, Waltham, MA), rabbit polyclonal anti-H3K4m1 (Upstate), rabbit polyclonalanti-H3K4m2 (Upstate and Abcam, Cambridge, UK with similar results), rabbitpolyclonal anti-H3K4m3 (Upstate and Abcam), rabbit polyclonal anti-H3K9m1

(Upstate), rabbit polyclonal anti-H3K9m2 (Upstate), mouse monoclonal anti-H3K9m2

(Abcam) (both anti-H3K9m2 antibodies yielded similar results), rabbit polyclonalanti-H3K27m2 (Upstate), mouse monoclonal anti-H3K27m3 (Abcam), rabbit polyclonalanti-H4K16ac (Abcam), rabbit polyclonal anti-macroH2A1 (Upstate), mousemonoclonal anti-H3.1 (van der Heijden et al., 2005), rabbit polyclonal anti-H2AT120ph, rabbit polyclonal anti-H2AK119ac, or rabbit polyclonal anti-H2BT119ph.Secondary antibodies were FITC- (Sigma, St Louis, MO), TRITC- (Sigma), AlexaFluor 350, Alexa Fluor 594 or Alexa Fluor 488 (Molecular Probes)-labeled goatanti-rabbit, goat anti-mouse or goat anti-rat IgG antibodies; FITC-labeled goat anti-mouse IgM (Sigma) was used as secondary antibody for anti-H2AK119ub1 (IgM).Before incubation with antibodies, slides were washed in PBS (3�10 minutes), andnon-specific sites were blocked with 0.5% w/v BSA and 0.5% w/v milk powder inPBS. First antibodies were diluted in 10% w/v BSA in PBS, and incubations wereovernight at room temperature in a humid chamber. Subsequently, slides werewashed (3�10 minutes) in PBS, blocked in 10% v/v normal goat serum (Sigma) inblocking buffer (supernatant of 5% w/v milk powder in PBS centrifuged at 14,000rpm for 10 minutes), and incubated with secondary antibodies in 10% normal goatserum in blocking buffer at room temperature for 2 hours. Finally, slides werewashed (3�10 minutes) in PBS (in the dark) and embedded in Vectashieldcontaining DAPI to counterstain the DNA (Vector Laboratories, Burlingame, CA)or in Prolong Gold (Molecular Probes) when Alexa Fluor-labeled secondaryantibodies were used. DAPI was omitted when triple immunostainings wereperformed. Fluorescent images from spread nuclei were observed using afluorescent microscope (Axioplan 2; Carl Zeiss, Jena, Germany) equipped with adigital camera (Coolsnap-Pro, Photometrics, Waterloo, Canada). Digital imageswere processed using Adobe Photoshop software (Adobe Systems). Forquantification of immunofluorescent signal, slides were analyzed on the same day.Fluorescent images were taken under identical conditions for all slides, and notfurther processed in Adobe. The signal present in the total nucleus and in the XYbody was measured using ImageJ software analysis (National Institutes of Health).

FISHFollowing immunocytochemistry, the position of selected nuclei on the slide wasdetermined, and FISH was performed to detect the X chromosome usingSTAR*FISH mouse whole chromosome-specific paints (1200XmCy3; Cambio,Cambridge, UK) according to the manufacturer’s protocol. If specific signal wasnot obtained, the procedure was performed for a second time, and this alwaysresulted in a positive signal in most nuclei. Specificity of hybridization wasconfirmed using male meiotic spread nuclei preparations; positive signalcolocalized with the XY body of pachytene spermatocytes. Digital images wereobtained and processed as above. FISH images were combined withimmunocytochemical images using Adobe Photoshop software (Adobe Systems).

Real-time RT-PCRFor real-time RT-PCR, RNA was prepared from the isolated germ cell preparationsby Trizol, DNase-treated and reverse transcribed using random hexamer primersand Superscript II reverse transcriptase (Invitrogen, Breda, The Netherlands). PCRwas carried out with the iQ SYBR green PCR mastermix (Applied Biosystems) inthe DNA engine Opticon 2 real-time PCR detection system (Bio-Rad). For Hprt,Pctk1 and Atp7a we used the following conditions: 3 minutes 95°C then 30 seconds95°C, 30 seconds 62°C, 30 seconds 72°C for 45 cycles. For Chic1, we used 3

minutes 95°C then 30 seconds 95°C, 30 seconds 65°C, 30 seconds 72°C, 30 seconds78°C for 45 cycles, For Gla we used 3 minutes 95°C then 30 seconds 95°C, 30seconds 65°C, 30 seconds 72°C for 45 cycles and for Ube1x conditions were: 3minutes 95°C then 30 seconds 95°C, 30 seconds 57°C, 30 seconds 72°C, 30 seconds80°C for 45 cycles. For Spo11, Sycp2, Tnp1 and Creb3l4 we used 3 minutes 95°Cthen 30 seconds 95°C, 30 seconds 60°C, 30 seconds 72°C for 45 cycles. �-actinwas included in each reaction and used to normalize the data. Two independentexperiments were performed and each real-time PCR was performed in duplicate.All –RT reactions were negative. Forward and reverse primers for Hprt, Pctk1,Atp7a, Gla, Chic1 and Actb were as described (Namekawa et al., 2006). Forwardand reverse primers (5� to 3�): Ube1x: TGTCCACACCCACTTACT and GCA -CTCTGCAACTCC; Spo11: GCTCCTGGACGACAACTTCT and ATCTGCAT -CGACCAGTGTGA; Sycp2: TGGATGTGATGACAGCAAGA and TGGGTC -TTGGTTGTCCTTTT; Tnp1: AAGAACCGAGCTCCTCACAA and CATCAC -AAGTGGGATCGGTA; Creb3l4: CCTCCGATTCGCATAGACAT and GCCAG -CAGTTGCTTTTCTTC.

We would like to thank Wiggert A. van Cappellen, Jan H. J.Hoeijmakers and Henk P. Roest (Erasmus MC, Rotterdam, TheNetherlands) for helpful discussions. We thank Peter de Boer andJohan van der Vlag (Radboud University Nijmegen Medical Center,Nijmegen, The Netherlands) for providing T/T’ mice and the H3.1antibody, respectively. We thank Upstate Biotechnology and DavidAllis (The Rockefeller University, New York, USA) for their role indeveloping the H2AT120ph, H2BT119ph and H2AK119ac antibodies andMahesh Chandrasekharan (Vanderbilt University School of Medicine,Nashville, USA) for the initial characterization of these antibodies.This work was supported by the Netherlands Organisation forScientific Research (NWO) through ALW (VIDI 864.05.003). Z.-W.S. is supported by NIH (RO1CA109355).

ReferencesAihara, H., Nakagawa, T., Yasui, K., Ohta, T., Hirose, S., Dhomae, N., Takio, K.,

Kaneko, M., Takeshima, Y., Muramatsu, M. et al. (2004). Nucleosomal histonekinase-1 phosphorylates H2A Thr 119 during mitosis in the early Drosophila embryo.Genes Dev. 18, 877-888.

Baarends, W. M., Hoogerbrugge, J. W., Roest, H. P., Ooms, M., Vreeburg, J.,Hoeijmakers, J. H. J. and Grootegoed, J. A. (1999). Histone ubiquitination andchromatin remodeling in mouse spermatogenesis. Dev. Biol. 207, 322-333.

Baarends, W. M., Wassenaar, E., Hoogerbrugge, J. W., van Cappellen, G., Roest, H.P., Vreeburg, J., Ooms, M., Hoeijmakers, J. H. and Grootegoed, J. A. (2003). Lossof HR6B ubiquitin-conjugating activity results in damaged synaptonemal complexstructure and increased crossing-over frequency during the male meiotic prophase.Mol. Cell. Biol. 23, 1151-1162.

Baarends, W. M., Wassenaar, E., van der Laan, R., Hoogerbrugge, J. W., Sleddens-Linkels, E., Hoeijmakers, J. H., de Boer, P. and Grootegoed, J. A. (2005). Silencingof unpaired chromatin and histone H2A ubiquitination in mammalian meiosis. Mol.Cell. Biol. 25, 1041-1053.

Becker, P. B. (2006). Gene regulation: a finger on the mark. Nature 442, 31-32.Chen, H. Y., Sun, J. M., Zhang, Y., Davie, J. R. and Meistrich, M. L. (1998).

Ubiquitination of histone H3 in elongating spermatids of rat testes. J. Biol. Chem. 273,13165-13169.

Dover, J., Schneider, J., Boateng, M. A., Wood, A., Dean, K., Johnston, M. andShilatifard, A. (2002). Methylation of histone H3 by COMPASS requiresubiquitination of histone H2B by RAD6. J. Biol. Chem. 277, 28368-28371.

Emre, N. C. and Berger, S. L. (2006). Histone post-translational modifications regulatetranscription and silent chromatin in Saccharomyces cerevisiae. Ernst Schering Res.Found. Workshop 57, 127-153.

Fernandez-Capetillo, O., Mahadevaiah, S. K., Celeste, A., Romanienko, P. J.,Camerini-Otero, R. D., Bonner, W. M., Manova, K., Burgoyne, P. andNussenzweig, A. (2003). H2AX is required for chromatin remodeling and inactivationof sex chromosomes in male mouse meiosis. Dev. Cell 4, 497-508.

Fischle, W., Wang, Y. and Allis, C. D. (2003). Binary switches and modificationcassettes in histone biology and beyond. Nature 425, 475-479.

Fischle, W., Tseng, B. S., Dormann, H. L., Ueberheide, B. M., Garcia, B. A.,Shabanowitz, J., Hunt, D. F., Funabiki, H. and Allis, C. D. (2005). Regulation ofHP1-chromatin binding by histone H3 methylation and phosphorylation. Nature 438,1116-1122.

Grootegoed, J. A., Jansen, R. and van der Molen, H. J. (1986). Effect of glucose onATP dephosphorylation in rat spermatids. J. Reprod. Fertil. 77, 99-107.

Heyting, C. (1996). Synaptonemal complexes: structure and function. Curr. Opin. CellBiol. 8, 389-396.

Hoyer-Fender, S., Costanzi, C. and Pehrson, J. R. (2000). Histone macroH2A1.2 isconcentrated in the XY-body by the early pachytene stage of spermatogenesis. Exp.Cell Res. 258, 254-260.

Hwang, W. W., Venkatasubrahmanyam, S., Ianculescu, A. G., Tong, A., Boone, C.and Madhani, H. D. (2003). A conserved RING finger protein required for histoneH2B monoubiquitination and cell size control. Mol. Cell 11, 261-266.

Journal of Cell Science 120 (11)

Jour

nal o

f Cel

l Sci

ence

1851Hr6b knockout affects XY body chromatin

Ivanovska, I., Khandan, T., Ito, T. and Orr-Weaver, T. L. (2005). A histone code inmeiosis: the histone kinase, NHK-1, is required for proper chromosomal architecturein Drosophila oocytes. Genes Dev. 19, 2571-2582.

Jenuwein, T. and Allis, C. D. (2001). Translating the histone code. Science 293, 1074-1080.

Khalil, A. M. and Driscoll, D. J. (2006). Histone H3 lysine 4 dimethylation is enrichedon the inactive sex chromosomes in male meiosis but absent on the inactive X in femalesomatic cells. Cytogenet. Genome Res. 112, 11-15.

Koken, M. H. M., Hoogerbrugge, J. W., Jaspers-Dekker, I., de Wit, J., Willemsen,R., Roest, H. P., Grootegoed, J. A. and Hoeijmakers, J. H. J. (1996). Expression ofthe ubiquitin-conjugating DNA repair enzymes HHR6A and B suggests a role inspermatogenesis and chromatin modification. Dev. Biol. 173, 119-132.

Namekawa, S. H., Park, P. J., Zhang, L. F., Shima, J. E., McCarrey, J. R., Griswold,M. D. and Lee, J. T. (2006). Postmeiotic sex chromatin in the male germline of mice.Curr. Biol. 16, 660-667.

Nathan, D., Ingvarsdottir, K., Sterner, D. E., Bylebyl, G. R., Dokmanovic, M.,Dorsey, J. A., Whelan, K. A., Krsmanovic, M., Lane, W. S., Meluh, P. B. et al.(2006). Histone sumoylation is a negative regulator in Saccharomyces cerevisiae andshows dynamic interplay with positive-acting histone modifications. Genes Dev. 20,966-976.

Ng, H. H., Xu, R. M., Zhang, Y. and Struhl, K. (2002). Ubiquitination of histone H2Bby Rad6 is required for efficient Dot1-mediated methylation of histone H3 lysine 79.J. Biol. Chem. 277, 34655-34657.

Peters, A. H., Plug, A. W., van Vugt, M. J. and de Boer, P. (1997). A drying-downtechnique for the spreading of mammalian meiocytes from the male and femalegermline. Chromosome Res. 5, 66-68.

Pickart, C. M. and Fushman, D. (2004). Polyubiquitin chains: polymeric protein signals.Curr. Opin. Chem. Biol. 8, 610-616.

Robzyk, K., Recht, J. and Osley, M. A. (2000). Rad6-dependent ubiquitination ofhistone H2B in yeast. Science 287, 501-504.

Roest, H. P., van Klaveren, J., de Wit, J., van Gurp, C. G., Koken, M. H. M., Vermey,M., van Roijen, J. H., Vreeburg, J. T. M., Baarends, W. M., Bootsma, D. et al.(1996). Inactivation of the HR6B ubiquitin-conjugating DNA repair enzyme in micecauses a defect in spermatogenesis associated with chromatin modification. Cell 86,799-810.

Roest, H. P., Baarends, W. M., de Wit, J., van Klaveren, J. W., Wassenaar, E.,Hoogerbrugge, J. W., van Cappellen, W. A., Hoeijmakers, J. H. and Grootegoed,J. A. (2004). The ubiquitin-conjugating DNA repair enzyme HR6A is a maternal factoressential for early embryonic development in mice. Mol. Cell. Biol. 24, 5485-5495.

Schimenti, J. (2005). Synapsis or silence. Nat. Genet. 37, 11-13.Sun, Z. W. and Allis, C. D. (2002). Ubiquitination of histone H2B regulates H3

methylation and gene silencing in yeast. Nature 418, 104-108.Tagami, H., Ray-Gallet, D., Almouzni, G. and Nakatani, Y. (2004). Histone H3.1 and

H3.3 complexes mediate nucleosome assembly pathways dependent or independent ofDNA synthesis. Cell 116, 51-61.

Turner, J. M., Aprelikova, O., Xu, X., Wang, R., Kim, S., Chandramouli, G. V.,Barrett, J. C., Burgoyne, P. S. and Deng, C. X. (2004). BRCA1, histone H2AXphosphorylation, and male meiotic sex chromosome inactivation. Curr. Biol. 14, 2135-2142.

Turner, J. M., Mahadevaiah, S. K., Fernandez-Capetillo, O., Nussenzweig, A., Xu,X., Deng, C. X. and Burgoyne, P. S. (2005). Silencing of unsynapsed meioticchromosomes in the mouse. Nat. Genet. 37, 41-47.

van der Heijden, G. W., Dieker, J. W., Derijck, A. A., Muller, S., Berden, J. H., Braat,D. D., van der Vlag, J. and de Boer, P. (2005). Asymmetry in histone H3 variantsand lysine methylation between paternal and maternal chromatin of early mousezygotes. Mech. Dev. 122, 1008-1022.

van der Heijden, G. W., Derijck, A., Pósfai, E., Ramos, L., Gielen, M., Pelczar, P.,Wansink, D., van der Vlag, J., Peters, A. and de Boer, P. (2007). Chromosome-widenucleosome replacement and H3.3 incorporation during mammalian meiotic sexchromosome inactivation. Nat. Genet. 39, 251-258.

van der Laan, R., Uringa, E. J., Wassenaar, E., Hoogerbrugge, J. W., Sleddens, E.,Odijk, H., Roest, H. P., de Boer, P., Hoeijmakers, J. H., Grootegoed, J. A. et al.(2004). Ubiquitin ligase Rad18Sc localizes to the XY body and to other chromosomalregions that are unpaired and transcriptionally silenced during male meiotic prophase.J. Cell Sci. 117, 5023-5033.

van der Laan, R., Baarends, W. M., Wassenaar, E., Roest, H. P., Hoeijmakers, J. H.and Grootegoed, J. A. (2005). Expression and possible functions of DNA lesionbypass proteins in spermatogenesis. Int. J. Androl. 28, 1-15.

Varshavsky, A. (2005). Regulated protein degradation. Trends Biochem. Sci. 30, 283-286.West, M. H. and Bonner, W. M. (1980). Histone 2B can be modified by the attachment

of ubiquitin. Nucleic Acids Res. 8, 4671-4680.Wood, A., Krogan, N. J., Dover, J., Schneider, J., Heidt, J., Boateng, M. A., Dean,

K., Golshani, A., Zhang, Y., Greenblatt, J. F. et al. (2003). Bre1, an e3 ubiquitinligase required for recruitment and substrate selection of rad6 at a promoter. Mol. Cell11, 267-274.

Zhu, B., Zheng, Y., Pham, A. D., Mandal, S. S., Erdjument-Bromage, H., Tempst, P.and Reinberg, D. (2005). Monoubiquitination of human histone H2B: the factorsinvolved and their roles in HOX gene regulation. Mol. Cell 20, 601-611.

Jour

nal o

f Cel

l Sci

ence