Molecular and Cellular Neuroscience 59 (2014) 57–62

Contents lists available at ScienceDirect

Molecular and Cellular Neuroscience

j ourna l homepage: www.e lsev ie r .com/ locate /ymcne

Increased BDNF expression in fetal brain in the valproic acid modelof autism

Luis E.F. Almeida a,1, Clinton D. Roby a, Bruce K. Krueger a,b,c,⁎a Department of Physiology, University of Maryland School of Medicine, Baltimore, MD 21201, USAb Department of Psychiatry, University of Maryland School of Medicine, Baltimore, MD 21201, USAc Program in Neuroscience, University of Maryland Baltimore, Baltimore, MD 21201, USA

Abbreviations: BDNF, brain-derived neurotrophic factonosorbent assay; NGF, nerve growth factor; NT3, neurotrtrkB, tropomyosin-related kinase B; VPA, valproic acid.⁎ Corresponding author at: Dept. of Physiology, Uni

Medicine, 655 W. Baltimore St., Baltimore, MD 21201, USE-mail address: bkrueger@umaryland.edu (B.K. Krueg

1 Present Address: The Sheikh Zayed Institute forChildren's National Medical Center, 111 Michigan AvenuUSA.

1044-7431/$ – see front matter © 2014 Elsevier Inc. All rihttp://dx.doi.org/10.1016/j.mcn.2014.01.007

a b s t r a c t

a r t i c l e i n f o

Article history:Received 10 July 2011Revised 20 January 2014Accepted 21 January 2014Available online 28 January 2014

Keywords:Autism spectrum disorderBrain-derived neurotrophic factorBrain developmentGene promotersNeurotrophinVPA

Human fetal exposure to valproic acid (VPA), a widely-used anti-epileptic andmood-stabilizing drug, leads to anincreased incidence of behavioral and intellectual impairments including autism;VPAadministration to pregnantrats and mice at gestational days 12.5 (E12.5) or E13.5 leads to autistic-like symptoms in the offspring and iswidely used as an animal model for autism.We report here that this VPA administration protocol transiently in-creased both BDNF mRNA and BDNF protein levels 5–6-fold in the fetal mouse brain. VPA exposure in utero in-duced smaller increases in the expression ofmRNAencoding the other neurotrophins, NT3 (2.5-fold) andNT4 (2-fold). Expression of the neurotrophin receptors, trkA, trkB and trkC were minimally affected, while levels of thelow-affinity neurotrophin receptor, p75NTR, doubled. Of the nine 5′-untranslated exons of themouse BDNF gene,only expression of exons I, IV and VI was stimulated by VPA in utero. In light of the well-established role of BDNFin regulating neurogenesis and the laminar fate of postmitotic neurons in the developing cortex, an aberrant in-crease in BDNF expression in the fetal brain may contribute to VPA-induced cognitive disorders by altering braindevelopment.

© 2014 Elsevier Inc. All rights reserved.

Introduction

Valproic acid (VPA) is a widely used anti-epileptic and mood-stabilizing drug; however, exposure to VPA in utero can adversely affectfetal brain development. Children of women taking VPA during preg-nancy have an increased risk of congenital malformations and impairedcognitive function including reduced IQ and autism (Bromley et al.,2008; Meador et al., 2009; Ornoy, 2009;Williams et al., 2001). The crit-ical time window for the induction of autistic symptoms occurs duringthe first trimester in humans (Surén et al., 2013) and gestational days11–14 (E11–14) in rodents (Arndt et al., 2005; Ploeger et al., 2010), dur-ing which time the first neurons of the cerebral cortex are generatedfromproliferating neural progenitors and begin to differentiate intoma-ture neurons. Consequently, a single administration of VPA to pregnantrats or mice during the second week of gestation has been extensivelyused as an animal model for autism (Arndt et al., 2005; Chomiak andHu, 2013; Foley et al., 2012; Gandal et al., 2010; Gogolla et al., 2009;

r; ELISA, enzyme-linked immu-ophin-3; NT4, neurotrophin-4;

versity of Maryland School ofA. Fax: +1 410 706 8341.er).Pediatric Surgical Innovation,e, NW, Washington, DC 20010,

ghts reserved.

Markram et al., 2007; Murcia et al., 2005; Rodier et al., 1997; Roulletet al., 2010; Schneider and Przewlocki, 2005; and see Patterson, 2011),with the offspring exhibiting increased cortical excitation, learningandmemory deficits aswell as abnormal fear conditioning and social in-teractions (reviewed in Markram et al., 2007). Recently, mice exposedto VPA in utero were found to exhibit impaired communicative func-tion, delayed auditory evoked potentials, and reduced γ-frequencyphase locking factor, all of which are observed in autism (Gandal et al.,2010). The mechanism by which fetal VPA exposure leads to theseendophenotypes is not known.

Several lines of evidence suggest that autism is associated with in-creased expression of theneurotrophin, brain-derived neurotrophic fac-tor (BDNF) (Connolly et al., 2006; Correia et al., 2010; Miyazaki et al.,2004;Nelson et al., 2001; Tsai, 2005).While BDNF is required for normalbrain function throughout the lifespan, enhanced BDNF signaling cansometimes be pathogenic. For example, adult transgenic mice overex-pressing BDNF are prone to seizures (Binder et al., 2001) and elevationof BDNF enhances pain sensitivity (Merighi et al., 2008). Moreover, dur-ing early embryonic brain development, the cell cycle parameters ofproliferating neuroblasts and the laminar fate of their progeny arehighly sensitive to either increased or decreased BDNF signaling(Bartkowska et al., 2007; Fukumitsu et al., 2006). Thus, BDNF signalingmust be tightly regulated to enable normal function in both the devel-oping and adult nervous system.

Based on these considerations, we investigated the possibility thataberrant BDNF signaling mediates the effects of VPA on the developing

58 L.E.F. Almeida et al. / Molecular and Cellular Neuroscience 59 (2014) 57–62

brain by measuring not only BDNF mRNA and protein but also mRNAsencoding the BDNF receptor, trkB, the other neurotrophins, nerve growthfactor (NGF), neurotrophin-3 (NT3) and neurotrophin-4 (NT4), aswell astheir receptors, using a VPA administration protocol that induces autisticbehavior in mice and rats. Our results demonstrate that in utero VPA ex-posure increases the expression of BDNF, and to a lesser extent, NT3 andNT4, in the fetal brain. Dysregulation of critical steps of prenatal corticaldevelopment occurring at the time of VPA exposure, which is predictedto result from increased BDNF signaling (Bartkowska et al., 2007;Fukumitsu et al., 2006), may contribute to postnatal behavioral and cog-nitive impairments.

Results

In utero VPA exposure stimulates BDNF expression in fetal brain

We investigated whether in utero exposure to VPA can modulateneurotrophin expression in the fetal brain. A single i.p. injection ofVPA (400 mg/kg) to pregnant females increased BDNF exon IX mRNAexpression 5.6-fold in the fetal brain as determined by qRT-PCR(Fig. 1A). Exon IX encodes the proBDNF protein, which is enzymaticallyprocessed to the mature, biologically active form subsequent to secre-tion. The BDNF primer pair used in Fig. 1 (Table A.1) amplified a se-quence entirely within the mature BDNF coding sequence. Virtuallyidentical results were obtained using a primer pair that amplified theN-terminal sequence, which is cleaved from proBDNF in the process ofgenerating mature BDNF (data not shown). BDNF exon IX mRNA fellto baseline levels by 24 h. Smaller (2–2.5-fold) transient increases in

Fig. 1. VPA injection induced a transient increase in BDNF mRNA in the E12.5 fetal brainbut not in the maternal brain. Pregnant mice received VPA (400 mg/kg, i.p.) at E12.5. 3or 24 h later, RNA was isolated from both whole fetal brain and maternal frontal cortexand reverse-transcribed for analysis of neurotrophin (and neurotrophin receptor) mRNAlevels by qRT-PCR. mRNA levels in VPA-treated brains are reported relative to those inbrains from mice that had received a PBS injection (1 = no effect of VPA). A. RelativeBDNF levels in fetal brain increased 5.6-fold at 3 h and returned to control levels by24 h. NT3 and NT4 mRNA levels were also transiently increased 2.5- and 2-fold. ForBDNF, 7 control (3 pregnancies) and 14 VPA-treated (3) fetal brains were analyzed at3 h; 7 control (3) and 10 VPA-treated (3) fetal brains were analyzed at 24 h. For NT3,NT4 and NGF, 18 control (4) and 17 VPA-treated (4) fetal brains were analyzed at 3 h;13 control (3) and 14 VPA-treated (3) fetal brains were analyzed at 24 h. ***, significantlydifferent from PBS-injected control, p b .001. B. VPA exposure at E12.5 had no effect onneurotrophin mRNA levels in the maternal brain at either time except for NT4, whichwas increased about 2.5-fold at 3 h. For BDNF, 3 control and 3 VPA-treatedmaternal brainswere analyzed at 3 h and at 24 h. For NT3, NT4 and NGF, 4 control and 4 VPA-treatedma-ternal brains were analyzed at 3 h and 3 control and 3 VPA-treated maternal brains wereanalyzed at 24 h. ***, significantly different from control, p b .001.

NT3 and NT4 expression were also observed in the fetal brain 3 h afterVPA administration, while NGF expression was unaffected at eithertime. Rapid metabolism of VPA in the mother (serum half-life in adultmouse ≈ 1 h) (Nau and Löscher, 1982) may account for the transientnature of the increase in fetal neurotrophin mRNAs.

We also measured the expression of BDNF mRNA in the frontal cor-tex of the VPA-injected pregnant females. Surprisingly, BDNFmRNA ex-pression in the maternal brain was not stimulated by VPA at either 3 or24 h (Fig. 1B); however, expression of NT4, which, like BDNF, activatestrkB, was increased 2.8-fold in the maternal brain at 3 h after VPA ad-ministration. Thus, the profile of neurotrophin mRNA responses to ad-ministration of VPA at E12.5 is different in fetal brain and maternalfrontal cortex (Fig. 1). We did not conduct a regional study of BDNFmRNA expression in either the fetal or thematernal brain and it remainspossible that VPAmay induce BDNF expression in areas of the maternalbrain other than the frontal cortex.

We also determined the effects of in utero VPA exposure on the levelsof mRNAs encoding the full-length, catalytically-active neurotrophinreceptors, trkA, trkB, and trkC, the dominant-negative, truncatedtrkB isoforms, trkB.T1 and trkB.shc, as well as the low-affinity, non-specific neurotrophin receptor, p75NTR, in the fetal brain (Fig. 2). At3 h, VPA exposure had induced only modest increases (b50%; trkA,trkB.FL) or decreases (b25%; trkB.shc; trkC) in the trk receptors; in-terestingly, p75NTR expression had doubled. As p75NTR mediatesneurotrophin signaling independently of the trk receptors (Schor,2005), enhanced p75NTR signaling may also contribute to the effectsof VPA on the fetal brain; however, the role of p75NTR signaling in braindevelopment has not been studied. By 24 h, increases in neurotrophin

Fig. 2. Effects of VPA on expression of neurotrophin receptors in E12.5 brain. Data areexpressed relative to the mRNA level in control (PBS treated) brains (1 = no effect ofVPA). These were the same fetal brain samples that were analyzed for NGF/NT3/NT4 inFig. 1. A. 3-hr treatmentwith 400mgVPA/kg increased the expression ofmRNAs encodingtrkA (≈50%), trkB.FL (≈25%) and p75NTR (≈100%), while an approximately 20% decreasewas observed for trkB.shc and trkCmRNAs; trkB.T1mRNA expressionwasunchanged. Sig-nificantly different from control: *** = p b .001 and * = p b .05. B. Neurotrophin receptormRNA expression in fetal brain 24 h after a single in utero VPA exposure (400 mg/kg) atE12.5. Levels of trkA, trkB.FL, and trkB.T1 mRNAwere unaffected 24 h after VPA exposure,while trkB.shc, trkC and p75NTRmRNA levels remained suppressed by 20–25%. Significant-ly different from control: ** = p b .01 and * = p b .05.

59L.E.F. Almeida et al. / Molecular and Cellular Neuroscience 59 (2014) 57–62

receptor mRNA levels had returned to levels at or slightly below base-line (Fig. 2B).

Fig. 4. VPA injection stimulated expression of BDNF 5′-untranslated exons I, IV and VI in

VPA increases expression of BDNF protein in fetal brain

To determine if the up-regulation of BDNF mRNA by in utero VPAexposure (Fig. 1A) is accompanied by an increase in BDNF protein ex-pression,we assayed total BDNF protein by ELISA in the fetal andmater-nal brains. There was no increase in BDNF levels in the fetal brains 3 hafter VPA administration but BDNF protein levels had increased 6-foldat 6 h after VPA administration and returned to control levels by 24 h(Fig. 3). Thus, the transient VPA-induced increase in BDNF mRNA pre-cedes the corresponding rise in BDNF protein by about 3 h in the fetalbrain. As expected from the results of BDNF mRNA determination(Fig. 1B), VPA injection did not stimulate expression of BDNF proteinin the maternal brain (Fig. 3).

fetal brain. Pregnant mice received VPA (400 mg/kg, i.p.) at E12.5. 3 h later, RNA was iso-lated from fetal brains and reverse transcribed for analysis of BDNF 5′-untranslated exonsI– IXamRNA expression by qRT-PCR. Only exon I-, IV- andVI-specificmRNAswere detect-ed in fetal brain following VPA administration and expression of those 5′-untranslatedexons was stimulated about 4-, 13- and 15-fold, respectively. These were the same fetalbrain samples analyzed for NT3, NT4 and NGF in Fig. 1. ***, significantly different fromPBS-injected control, p b .001, n = 14.

5′-Untranslated BDNF exons mediating the effects of VPA

BDNF expression is regulated by alternative splicing of one or more5′-untranslated exons, each of which has its own unique promoter. Inthe mouse and rat, there are nine 5′-untranslated exons (I–IXa) plus asingle common exon (IX) which encodes proBDNF protein (Aid et al.,2007). To investigate the mechanism of VPA-induced BDNF mRNA ex-pression,we used qRT-PCR tomeasure the expression of the nine 5′-un-translated exons of the mouse BDNF gene in the same fetal brainsamples used to analyze NGF, NT3 and NT4 expression in Fig. 1A.Whereas all nine exons were detected in the adult mouse brain byqRT-PCR (not shown), only BDNF exon I, IV and VI expression was de-tected in the fetal brains. VPA stimulated BDNF exons I, IV andVI expres-sion about 4-, 12.5- and 15-fold, respectively (Fig. 4). These data suggestthat the VPA-induced increase in BDNF expression probably resultsfrom activation of BDNF exons I, IV and/or VI.

Fig. 3. VPA injection induced a transient increase in BDNF protein in the E12.5 fetal brainbut not in the maternal brain. Pregnant mice received PBS (control) or VPA (400 mg/kg,i.p.) at E12.5. 3, 6 or 24 h later, fetal and maternal brains were removed and BDNF proteinexpression was quantified by ELISA. Each sample analyzed consisted of 4 pooled fetalbrains from one pregnancy. Four separate samples (4 pregnancies) plus a sample ofeachmaternal frontal cortex were analyzed± VPA at each time point; i.e., a total of 16 fe-tuses and 4 dams were analyzed ± VPA at each time point. BDNF protein levels in VPA-treated brains are reported relative to those in brains from mice that had received a PBSinjection (1 = no effect of VPA). Left. BDNF levels had increased 6-fold in fetal brains by6 h after VPA treatment following a delay of at least 3 h and returned to unstimulatedlevels by 24 h. Note that the level of BDNF mRNA was elevated 3 h following VPA admin-istration (Fig. 1). Right. Consistent with BDNFmRNA levels, therewas no increase in BDNFprotein expression in the maternal brains following VPA injection (right). BDNF proteinlevels in the fetal and maternal brains exposed to PBS were 11.7 ± 3.3 and 24.1 ±2.8 pg/mg total protein, respectively. Data were analyzed by ANOVA; F(2,9) = 200 (pb .001) for fetal brain and F(2,9)= 22 (p b .001) for maternal brain. ***, significantly differ-ent from PBS-injected control, p b .001. Statistical analysis was performedwith SigmaPlotv.12.3 (Systat Software, Chicago, IL).

VPA stimulates BDNF mRNA expression in brain cell cultures

Because VPA is rapidly metabolized in vivo and some of its metabo-lites might be biologically active (Nau and Löscher, 1982), we investi-gated whether VPA induces BDNF mRNA expression in a cell culturesystem where there is no drug metabolism by the maternal liver.Cultures were prepared from E12.5 mouse brain; after 2 days in vitro(DIV) cultures were stimulated with VPA (0.3–3 mM) for 7 h. This con-centration range was examined because it spans the circulating VPAlevels of patients undergoing VPA treatment (Löscher, 1981). RNA wasreverse-transcribed and analyzed by qRT-PCR. VPA stimulated the ex-pression ofmRNAencoding the BDNF protein (exon IX)with a 2-fold in-crease observed at 3mM, the highest concentration tested (Fig. 5A).Wealso assayed the expression of BDNF 5′-untranslated exons I–IXa in thecultures. Only exons I, II, IV andVIwere detectable. VPA (3mM) induceda 2–4-fold stimulation of BDNF exons I, IV and VI, while exon II was notaffected (Fig. 5B). Thus, aswas observed in the fetal brain in vivo (Fig. 4),VPA stimulates BDNF gene expression via exons I, IV and VI in fetal braincultures.

Discussion

Regulation of fetal brain development by BDNF

The development of the fetal cortex is tightly regulated by BDNF sig-naling. For example, BDNF injected into mouse cerebral ventricles inutero led to precocious neurogenesis with a shorter S-phase, prematureexit from the cell cycle of the proliferating neuroblasts and altered lam-inar fate of thepostmitotic cortical neurons (Fukumitsu et al., 2006). Ab-normal precursor proliferation and cortical development were alsoobserved by Bartkowska et al. (2007), who used an in utero electropo-ration approach to either increase or decrease BDNF signaling in the em-bryonic mouse brain. It should be noted that BDNF expression levels arenormally low in the fetal brain and gradually increase to a maximum inthe adult (Maisonpierre et al., 1990), however, a rapid, transient in-crease in BDNF in the fetal brain is clearly abnormal. Thus, a transientVPA-induced increase in BDNF expression in the fetal brain of the mag-nitudewe observed (Figs. 1A and 3)would be expected to both alter theproliferation and differentiation of neural progenitors and modify the

Fig. 5. VPA stimulated expression of BDNF mRNA (coding region, exon IX) (A) and 5′-untranslated exons I, II, IV and VI (B) in cultures of E12.5 fetal mouse brain. Brain cell cultures wereprepared from fetal brain at E12.5 as described in Experimentalmethods. Twodays after plating, fetalmouse brain cultureswere treated for 6 hwith 0.3, 1.0 or 3.0mM(A) or 3mMVPA (B)and then harvested for determination of BDNF coding region (exon IX)mRNA (A) or 5′-untranslated exon I, II, IV andVImRNA (B) byqRT-PCR. A. Four independent cultureswere analyzedfor each VPA concentration; all three concentrations of VPA significantly stimulated exon IXmRNA expression. Data were analyzed by ANOVA: F(3,12) = 50 (p b .001). Statistical analysiswas performed using SigmaPlot v.12.3 (Systat Software, Chicago, IL). ***, significantly different from untreated cultures (p b .001); **, significantly different from untreated cultures (pb .02); #, significantly different from0.3 μMVPA (p b .01). B. Only exon I, II, IV andVImRNAswere detected and of these only exon I, IV andVImRNAswere stimulated byVPA. Four controland 4 VPA stimulated cultures were analyzed for each BDNF 5′ untranslated exon. ***, significantly different from untreated cultures.

60 L.E.F. Almeida et al. / Molecular and Cellular Neuroscience 59 (2014) 57–62

laminar fate of their progeny, regardless of the levels achieved in thenormal postnatal and adult brain. Such errors in neurogenesis mayleave a “signature” that is not corrected during subsequent corticaldevelopment (Ben-Ari, 2008), thereby leading to permanent connectiv-ity defects that could impair cognition and behavior in the postnatalanimal.

Other modulators of brain development may be regulated by VPA

In this study, we focused on the expression of the neurotrophins andtheir receptors and found that BDNF is the principal neurotrophin targetof VPA in the fetal brain. However, BDNF is not the only potentialmodulator of brain development affected by VPA. For example, as re-vealed in Fig. 1A, NT3 and NT4 mRNA levels are also elevated, albeit tolesser extents than BDNF. NT3 acts at a different neurotrophin receptor(trkC) than do BDNF and NT4 (trkB), but little is known about its role inregulating fetal brain development. Thus, the effects of VPA on the de-veloping fetal brain could be due to the combined actions of elevatedBDNF, NT3 and NT4. Further conclusions regarding NT3 and NT4 mustawait protein measurements as was done for BDNF (Fig. 3).

Factors other than neurotrophins may also mediate the effects ofVPA on brain development. For example, mRNA encoding the homeoticgene, Hoxa1, is elevated in rat embryos after in utero VPA treatment(Stodgell et al., 2006); increased HoxA1 expression has the potentialto alter multiple developmental processes in the fetal brain, particularlyduring critical windows of vulnerability. Prenatal VPA exposure in micehas also been reported to reduce expression of the postsynaptic cell-adhesion molecule, neuroligin-3 (NLGN3), mutations in which havebeen reported in patients with autism (Kolozsi et al., 2009). Thus, expo-sure to VPA alters the expression ofmultiple genes encoding critical reg-ulators of brain development.

Although the findings reported here and by others (Kolozsi et al.,2009; Stodgell et al., 2006) suggest plausible mechanisms for the effectsof in utero exposure to VPA on brain development, they do not, by them-selves, demonstrate that altered expression of a single gene productcauses the developmental defects. The degree to which altered expres-sion of any one gene affects cortical neurogenesis and, consequently,cognition and behavior, could be studied using in utero viral-mediatedsiRNA gene silencing strategies (c.f., Bartkowska et al., 2007) or, forBDNF, using transgenic mice with genetically modified trkB, which is

sensitive to inhibition by systemically-administered pharmacologicalblockers (Chen et al., 2005).

Possible mechanism of VPA-induced stimulation of BDNF expression

Because VPA is a histone deacetylase (HDAC) inhibitor, our resultsraise the possibility that stimulation of BDNF transcription may be dueto increased acetylation of histones associated with the promoters of5′-untranslated exons I, IV and/or VI (Fig. 4). Indeed, histone modifica-tions at one or more of these BDNF promoters have been reported inadult animal models of epilepsy and depression (Huang et al., 2002;Tsankova et al., 2006) and stimulation of BDNF exon IV expression byVPA in neuron cultures has been attributed to HDAC inhibition(Yasuda et al., 2009). Our finding that expression of exons I, IV and VIis stimulated in fetal brain by administration of VPA to the pregnantdam (Fig. 4) and by direct application of VPA to fetal brain cultures(Fig. 5B), raises the possibility that epigenetic modulation of theseexons is also important for normal and pathological brain development.The use of fetal brain cultures (Fig. 5), in which responses to VPA wereobserved to be similar to those in fetal brain in vivo (Fig. 4), may facili-tate determination of the extent to which the promoters of exons I, IVand VI are modulated by histone acetylation.

Genes versus environment

Recent research has linked genetic variants of a number of genes toautism and several of those genes are known to play a role in eitherbrain development or synaptic function (Abrahams and Geschwind,2008; Berg and Geschwind, 2012; State and Levitt, 2011). Thosefindings are not incompatible with studies demonstrating that environ-mental influences such as in utero VPA exposure can also lead to autisticbehavior. Indeed, as has been previously suggested (Arndt et al., 2005),a combination of genetic and environmental influences may act syner-gistically to produce autism as has recently been discussed for schizo-phrenia (Kannan et al., 2013; Lipina et al., 2013), affective disorders(Renoir et al., 2013) and pre-term births (Cha et al., 2013). The resultsof the present study and others (Kolozsi et al., 2009; Stodgell et al.,2006) demonstrate that environmental stressors such as VPA can alterthe expression of genes that are critical for normal brain development.Such stressors may be more likely to induce autistic symptoms on abackground of inherited genetic abnormalities.

Table A.1List of primers used in qRT-PCR experiments. All primers were designed using the NCBIweb site, except for primers amplifying BDNF exons, which were obtained from Aidet al. (2007), and trkB.shc, which were obtained from Stoilov et al. (2002). Primers weresynthesized by Integrated DNA Technologies (Coralville, IA, USA). The efficiency (Eff) foreach primer pair is also indicated.

BDNF exon IX (coding region, mature protein)(Eff = 2.0)Forward AAAGTCCCGGTATCCAAAGGCCAAReverse TAGTTCGGCATTGCGAGTTCCAGT

BDNF all 5′ non-coding exonsReverse GAAGTGTACAAGTCCGCGTCCTTA

BDNF exon I (Eff = 2.1)Forward GTGTGACCTGAGCAGTGGGCAAAGGA

BDNF exon II (Eff = 2.0)Forward GGAAGTGGAAGAAACCGTCTAGAGCA

BDNF exon III (Eff = 2.0)Forward GCTTTCTATCATCCCTCCCCGAGAGT

BDNF exon IV (Eff = 2.0)Forward CTCTGCCTAGATCAAATGGAGCTTC

BDNF exon V (Eff = 1.9)Forward CTCTGTGTAGTTTCATTGTGTGTTC

BDNF exon VI (Eff = 1.8)Forward GCTGGCTGTCGCACGGTTCCCATT

BDNF exon VII (Eff = 2.1)Forward CCTGAAAGGGTCTGCGGAACTCCA

BDNF exon VIII (Eff = 1.9)Forward GTGTGTGTCTCTGCGCCTCAGTGGA

BDNF exon IXa (Eff = 2.0)Forward CCCAAAGCTGCTAAAGCGGGAGGAAG

NGF (Eff = 2.0)Forward CCAAGGACGCAGCTTTCTATACReverse CTGCCTGTACGCCGATCAAAA

NT3 (Eff = 2.0)Forward GGAGTTTGCCGGAAGACTCTC

(continued on next page)

61L.E.F. Almeida et al. / Molecular and Cellular Neuroscience 59 (2014) 57–62

Experimental methods

Animals

C57BL/6J mice were paired overnight; the day following the pairingwas designated E0.5. Pregnant mice were injected at E12.5 with400 mg/kg i.p. of VPA (sodium salt; Sigma-Aldrich, St. Louis, MO) insterile phosphate-buffered saline (PBS) or PBS only. Administration of600 mg/kg VPA resulted in an approximately 50% reduction in the num-ber of viable fetuses 24 h later (data not shown); consequently, the doseof VPA was limited to 400 mg/kg in this study. Fetal and maternal brainswere removed 3, 6 or 24 h after the injection.

All procedures using mice were carried out in compliance with theNIH Guide for the Care and Use of Laboratory Animals and the AVMAGuidelines on Euthanasia and were approved by the University ofMaryland School of Medicine Institutional Animal Care and UseCommittee.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Whole fetal brains or 50 mg samples of maternal frontal cortexwere agitated (600 Hz, 1 min) with 1 mm zirconia/silica beads(Biospec, Bartlesville, OK) in 1 ml of QIAzol lysis reagent (Qiagen,Germantown, MD). Total RNA was purified with RNeasy lipid tissuemini kit (Qiagen) including the on-column DNA digestion step.RNA (1 μg) was reverse-transcribed with Transcriptor High Fidelity(Roche, Indianapolis, IN). Primers were synthesized by IntegratedDNA Technologies (Coralville, IA, USA). Primer sequences and qRT-PCR parameters are provided in Appendix, Table A.1. Geneexpression for each target mRNA was normalized to GAPDH mRNAassayed in the same sample as described by Pfaffl (2001). mRNAlevels in VPA-treated brains are reported relative to those in brainsfrom mice that had received a PBS injection (1 = no effect of VPA).

BDNF ELISA

Each sample analyzed consisted of four pooled fetal brains from onepregnancy or 50 mg of the maternal frontal cortex; four different sam-ples (4 pregnancies) were analyzed for BDNF protein expression at 3,6, and 24 h after VPA administration. Tissue was placed in 400 μl or1 ml of freshly prepared lysis buffer (Szapacs et al., 2004) containing100 mM pipes (pH 7.0), 500 mM NaCl, 0.2% Triton X-100, 0.1% NaN3,2 mM EDTA-Na2·2H2O, 200 μM PMSF, 10 μM leupeptin, 0.3 μMaprotinin and 1 μM pepstatin (all reagents from Sigma-Aldrich), ho-mogenized as described above and stored at −80 °C. Total proteinwas assayed by the BCA method (Pierce, Rockford, IL). BDNF wasassayed in triplicate by enzyme-linked immunosorbent assay (ELISA)following the manufacturer's instructions (Promega, Madison, WI)omitting the optional acid pretreatment; bovine serum albumin (2%)was added to enhance sensitivity. Approximately 0.2 mg of fetal brainprotein or 0.25mg of maternal brain protein was loaded in each samplewell.

Cell culture

Six fetal brains fromone pregnancy obtained at E12.5were placed in1 ml of Liebowitz L15 medium without L-glutamine (Invitrogen, Carls-bad, CA), triturated with a narrow bore Pasteur pipette and suspendedin Neurobasal medium supplemented with 2% B27, 1 mM L-glutamineand penicillin/streptomycin (Invitrogen). Cells were seeded at 3 × 105

cells/well in 24-well plates (0.5 ml/well) coated with poly-ornithine(Sigma-Aldrich) and laminin (Invitrogen). Two days after plating, cul-tures were treated for 7 hwith VPA and lysed by the addition of RNeasylysis buffer (150 μl/well). Lysates from three wells in each plate werecombined and processed for total RNAusing an RNeasymini kit (Qiagen).

Four different cultures, each fromadifferent pregnancywere analyzed foreach VPA concentration.

Statistical analysis

In Figs. 1, 2, 4, and 5B, each bar represents a different PCR reactionshowing the VPA-induced change in mRNA expression relative to thePBS-injected controls ± sem (1 = no effect of VPA); asterisks indicateexpression levels significantly different from control by t-test. InFigs. 3 and 5A, BDNF mRNA or protein expression is shown relative tocontrols ± sem (1 = no effect of VPA); asterisks indicate expressionlevels significantly different from control by one-way ANOVA withpairwise multiple comparison by Tukey's method. Unless otherwisestated, statistical analysis was performed using GraphPad InStat version3.06 (GraphPad Software, San Diego, CA).

Conflict of interest

The authors declare no conflicts of interest.

Acknowledgments

This work was supported by Ruth L. Kirschstein National ResearchService Award (NRSA) 5T32DE007309-12 (LEFA) and NIH grantsR01NS048095 (BKK) and R01HD067135 (BKK and E.M. Powell). Theauthors would like to thank Drs. M. Bond, S.G. Dorsey, A. Keller, T.J.Kingsbury and E.M. Powell (University of Maryland Baltimore) fortheir critiques of the manuscript.

Appendix A

Reverse GGGTGCTCTGGTAATTTTCCTTANT4 (Eff = 1.9)Forward TGAGCTGGCAGTATGCGACReverse CAGCGCGTCTCGAAGAAGT

trkA (Eff = 2.2)Forward CCTTCCGTTTCACCCCTCGGCReverse GGTCAGGTCCTGTAGGGAGAGGC

trkB.FL (Eff = 2.0)Forward TTTCCTTGCCGAGTGCTACAACCTReverse TGAAAGTCCTTGCGTGCATTGTCG

trkB.T1 (Eff = 1.9)Forward ATAAGATCCCACTGGATGGGReverse CGTATAGTCAAACAGCTCGC

trkB.shc (Eff = 2.0)Forward GGAATGACCAAGATTCCTGTTATTGAAReverse GAACCTCTGGGCCATGTGTCT

trkC (Eff = 2.0)Forward CTGAGTGCTACAATCTAAGCCCReverse CACACCCCATAGAACTTGACAAT

p75NTR (Eff = 1.9)Forward CTAGGGGTGTCCTTTGGAGGTReverse CAGGGTTCACACACGGTCT

GAPDH (Eff = 1.9)Forward TGATGACATCAAGAAGGTGGTGAAGReverse TCCTTGGAGGCCATGTAGGCCAT

Table A.1 (continued)

62 L.E.F. Almeida et al. / Molecular and Cellular Neuroscience 59 (2014) 57–62

References

Abrahams, B.S., Geschwind, D.H., 2008. Advances in autism genetics: on the threshold of anew neurobiology. Nat. Rev. Genet. 9, 341–355.

Aid, T., Kazantseva, A., Piirsoo, M., Palm, K., Timmusk, T., 2007. Mouse and rat BDNF genestructure and expression revisited. J. Neurosci. Res. 85, 525–535.

Arndt, T.L., Stodgell, C.J., Rodier, P.M., 2005. The teratology of autism. Int. J. Dev. Neurosci.23, 189–199.

Bartkowska, K., Paquin, A., Gauthier, A.S., Kaplan, D.R., Miller, F.D., 2007. Trk signaling reg-ulates neural precursor cell proliferation and differentiation during cortical develop-ment. Development 134, 4369–4380.

Ben-Ari, Y., 2008. Neuro-archaeology: pre-symptomatic architecture and signature ofneurological disorders. Trends Neurosci. 31, 626–636.

Berg, J.M., Geschwind, D.H., 2012. Autism genetics: searching for specificity and conver-gence. Genome Biol. 13, 247–263.

Binder, D.K., Croll, S.D., Gall, C.M., Scharfman, H.E., 2001. BDNF and epilepsy: toomuch of agood thing? Trends Neurosci. 24, 47–53.

Bromley, R.L., Mawer, G., Clayton-Smith, J., Baker, G.A., 2008. Autism spectrum disordersfollowing in utero exposure to antiepileptic drugs. Neurology 71, 1923–1924.

Cha, J., Bartos, A., Egasira, M., Hafraguchi, H., Saito-Fugita, T., Leishman, E., Bradshaw, G.,Dey, S.K., Hirota, Y., 2013. Combinatory approaches prevent preterm birth profoundlyexacerbated by gene–environment interactions. J. Clin. Invest. 123, 4063–4075.

Chen, X., Ye, H., Kuruvilla, R., Ramanan, N., Scangos, K.W., Zhang, C., Johnson, N.M.,England, P.M., Shokat, K.M., Ginty, D.D., 2005. A chemical-genetic approach to study-ing neurotrophin signaling. Neuron 46, 13–21.

Chomiak, T., Hu, B., 2013. Alterations of neocortical development and maturation in au-tism: insight from valproic acid exposure and animal models of autism. Neurotoxicol.Teratol. 36, 57–66.

Connolly, A.M., Chez, M., Streif, E.M., Keeling, R.M., Golumbek, P.T., Kwon, J.M., Riviello, J.J.,Robinson, R.G., Neuman, R.J., Deuel, R.M., 2006. Brain-derived neurotrophic factor andautoantibodies to neural antigens in sera of childrenwith autistic spectrum disorders,Landau–Kleffner syndrome, and epilepsy. Biol. Psychiatry 59, 354–363.

Correia, C.T., Coutinho, A.M., Sequeira, A.F., Sousa, I.G., Lourenco, Venda L., Almeida, J.P.,Abreu, R.L., Lobo, C., Miguel, T.S., Conroy, J., Cochrane, L., Gallagher, L., Gill, M.,Ennis, S., Oliveira, G.G., Vicente, A.M., 2010. Increased BDNF levels and NTRK2 geneassociation suggest a disruption of BDNF/TrkB signaling in autism. Genes BrainBehav. 9, 841–848.

Foley, A.G., Gannon, S., Rombach-Mullan, N., Prendergast, A., Barry, C., Cassidy, A.W.,Regan, C.M., 2012. Class I histone deacetylase inhibition ameliorates social cognitionand cell adhesion molecule plasticity deficits in a rodent model of autism spectrumdisorder. Neuropharmacology 63, 750–760.

Fukumitsu, H., Ohtsuka, M., Murai, R., Nakamura, H., Itoh, K., Furukawa, S., 2006. Brain-derived neurotrophic factor participates in determination of neuronal laminar fatein the developing mouse cerebral cortex. J. Neurosci. 26, 13218–13230.

Gandal, M.J., Edgar, J.E., Ehrlichman, R.S., Mehta, M., Roberts, T.P.L., Siegel, S.J., 2010. Vali-dating γ oscillations and delayed auditory responses as translational biomarkers ofautism. Biol. Psychiatry 68, 1100–1106.

Gogolla, N., Leblanc, J.J., Quast, K.B., Südhof, T.C., Fagiolini, M., Hensch, T.K., 2009. Commoncircuit defect of excitatory-inhibitory balance inmousemodels of autism. J. Neurodev.Disord. 1, 172–181.

Huang, Y., Doherty, J.J., Dingledine, R., 2002. Altered histone acetylation at glutamate re-ceptor 2 and brain-derived neurotrophic factor genes is an early event triggered bystatus epilepticus. J. Neurosci. 22, 8422–8428.

Kannan, G., Sawa, A., Pletnikov, 2013. Mouse models of gene–environment interactions inschizophrenia. Neurobiol. Dis. 57, 5–11.

Kolozsi, E., Mackenzie, R.N., Roullet, F.I., Decatanzaro, D., Foster, J.A., 2009. Prenatal expo-sure to valproic acid leads to reduced expression of synaptic adhesion moleculeneuroligin 3 in mice. Neuroscience 163, 1201–1210.

Lipina, T.V., Zai, C., Hlousek, D., Roder, J.C., Wong, A.H.C., 2013. Maternal immune activationduring gestation interacts with Disc1 point mutation to exacerbate schizophrenia-related behaviors in mice. J. Neurosci. 3, 7654–7666.

Löscher, W., 1981. Concentration of metabolites of valproic acid in plasma of epileptic pa-tients. Epilepsia 22, 169–178.

Maisonpierre, P.C., Belluscio, L., Friedman, B., Alderson, R.F., Wiegand, S.J., Furth, M.E.,Lindsay, R.M., Yancopoulos, G.D., 1990. NT-3, BDNF, andNGF in the developing rat ner-vous system: parallel as well as reciprocal patterns of expression. Neuron 5, 501–509.

Markram, H., Rinaldi, T., Markram, K., 2007. The intense world syndrome: an alternativehypothesis for autism. Front. Neurosci. 1, 77–96.

Meador, K.J., Baker, G.A., Browning, N., Clayton-smith, J., Combs-Cantrell, D.T., Cohen, M.,Kalayjian, L.A., Kanner, A., Liporace, J.D., Pennell, P.B., Privitera, M., Loring, D.W., 2009.Cognitive function at 3 years of age after fetal exposure to antiepileptic drugs. N. Engl.J. Med. 360, 1597–1605.

Merighi, A., Salio, C., Ghirri, A., Lossi, L., Ferrini, F., Betelli, C., Bardoni, R., 2008. BDNF as apain modulator. Prog. Neurobiol. 85, 297–317.

Miyazaki, K., Narita, N., Sakuta, R., Miyahara, T., Naruse, H., Okado, N., Narita, M., 2004.Serum neurotrophin concentrations in autism and mental retardation: a pilotstudy. Brain Dev. 26, 292–295.

Murcia, C.L., Gulden, F., Herrup, K., 2005. A question of balance: a proposal for newmousemodels of autism. Int. J. Dev. Neurosci. 23, 265–275.

Nau, H., Löscher, W., 1982. Valproic acid: brain and plasma levels of the drug and its me-tabolites, anticonvulsant effects and γ-aminobutyric acid (GABA) metabolism in themouse. J. Pharmacol. Exp. Ther. 220, 654–659.

Nelson, K.B., Grether, J.K., Croen, L.A., Dambrosia, J.M., Dickens, B.F., Jelliffe, L.L., Hansen,R.L., Phillips, T.M., 2001. Neuropeptides and neurotrophins in neonatal blood ofchildren with autism or mental retardation. Ann. Neurol. 49, 597–606.

Ornoy, A., 2009. Valproic acid in pregnancy: how much are we endangering the embryoand fetus? Reprod. Toxicol. 28, 1–10.

Patterson, P.H., 2011. Modeling autistic features in animals. Pediatr. Res. 69, 34R–40R.Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-

PCR. Nucleic Acids Res. 29, e45.Ploeger, A., Rajimakers, M.E., van der Maas, H.L., Galis, F., 2010. The association between

autism and errors in early embryogenesis: what is the causal mechanism? Biol. Psy-chiatry 67, 602–607.

Renoir, T., Pang, T.Y., Hannan, A.J., 2013. Effects of environmental manipulations in genet-ically targeted animal models of affective disorders. Neurobiol. Dis. 57, 12–27.

Rodier, P.M., Ingram, J.L., Tisdale, B., Croog, V.J., 1997. Linking etiologies in humans andanimal models: studies of autism. Reprod. Toxicol. 11, 417–422.

Roullet, F.I., Wollaston, L., deCatanzaro, D., Foster, J.A., 2010. Behavioral and molecularchanges in the mouse in response to prenatal exposure to the anti-epileptic drugvalproic acid. Neuroscience 170, 514–522.

Schneider, T., Przewlocki, R., 2005. Behavioral alterations in rats prenatally exposed tovalproic acid: animal model of autism. Neuropsychopharmacology 30, 80–89.

Schor, N.F., 2005. The p75 neurotrophin receptor in human development and disease.Prog. Neurobiol. 77, 201–214.

State, M.W., Levitt, P., 2011. The conundrums of understanding genetic risks for autismspectrum disorders. Nat. Neurosci. 14, 1499–1506.

Stodgell, C.J., Ingram, J.L., O'Bara, M., Tisdale, B.K., Nau, H., Rodier, P.M., 2006. Induction ofhomeotic gene Hoxa1 through valproic acid's teratogenic mechanism of action.Neurotoxicol. Teratol. 28, 617–624.

Stoilov, P., Castren, E., Stamm, S., 2002. Analysis of the human TrkB gene genomic organi-zation reveals novel TrkB isoforms, unusual gene length, and splicing mechanism.Biochem. Biophys. Res. Comm. 290, 1054–1065.

Surén, P., Roth, C., Bresnahan, M., Haugen, M., Hornig, M., Hirtz, D., Lie, K.K., Lipkn, W.I.,Magnus, P., Reichborn-Kjennerud, T.R., Schjølberg, S., Smith, G.D., Øyen, A.-S., Susser,E., Stolterberg, C., 2013. Associate between maternal use of folic acid supplementsand risk of autism spectrum disorders in children. J. Am. Med. Assoc. 309, 570–577.

Szapacs, M.E., Mathews, T.A., Tessarollo, L., ErnestLyons, W., Mamounas, L.A., Andrews,A.M., 2004. Exploring the relationship between serotonin and brain-derived neuro-trophic factor: analysis of BDNF protein and extraneuronal 5-HT in mice with re-duced serotonin transporter or BDNF expression. J. Neurosci. Methods 140, 81–92.

Tsai, S.-J., 2005. Is autism caused by early hyperactivity of brain-derived neurotrophic fac-tor? Med. Hypotheses 65, 79–82.

Tsankova, N.M., Berton, O., Renthal, W., Kumar, A., Neve, R.L., Nestler, E.J., 2006. Sustainedhippocampal chromatin regulation in a mouse model of depression and antidepres-sant action. Nat. Neurosci. 9, 519–525.

Williams, G., King, J., Cunningham, M., Stephan, M., Kerr, B., Hersh, J.H., 2001. Fetalvalproate syndrome and autism: additional evidence of an association. Dev. Med.Child Neurol. 43, 202–206.

Yasuda, S., Liang, M.-H., Marinova, Z., Yahyavi, A., Chuang, D.-M., 2009. The mood stabi-lizers lithium and valproate selectively activate the promoter IV of brain-derived neu-rotrophic factor in neurons. Mol. Psychiatry 14, 51–59.