Proc. Natl. Acad. Sci. USAVol. 84, pp. 2858-2862, May 1987Genetics

Mutation to male fertility and toxin insensitivity in Texas(T)-cytoplasm maize is associated,with a frameshift in amitochondrial open reading frame

(Cochliobolus heterostrophus toxin/cytoplasmic male sterility/tissue culture)

ROGER P. WISE*, DARYL R. PRING*t, AND BURLE G. GENGENBACHt*Department of Plant Pathology, University of Florida, Gainesville, FL 32611; and tU.S. Department of Agriculture, Agriculture Research Service andtDepartment of Agronomy and Plant Genetics, University of Minnesota, St. Paul, MN 55108

Communicated by Major M. Goodman, December 29, 1986 (received for review September 2, 1986)

ABSTRACT Tissue culture-derived mutants of male-ster-ile and disease toxin-sensitive Texas (T)-cytoplasm maize thatexhibit male fertility and toxin insensitivity carry numerousalterations in mitochondrial DNA. In these mutants, a 6.7-kilobase Xho I fragment characteristic of parental T cytoplasmhas been rearranged. In the mutant T-4, the parental 6.7-kilobase Xho I fragment contains a guanine to adenine tran-sition adjacent to a 5-base-pair insertion not found in Tcytoplasm. The insertion, internal to a 345-base-pair openreading frame (T ORF13), generates a frameshift, resulting ina premature stop codon that terminates the open reading frameat base pair 222. In other mutants, the 345-base-pair ORF ispart of a 3-kilobase deletion, which extends into a 5-kilobaserepeat characteristic of mtDNA from T but not N male-fertilecytoplasm. Clones specific to T ORF13 hybridize to eighttranscripts in T and T-4, yet only hybridize to three transcriptsin T-7, a deletion mutant. Transcription of the T ORF13 regionappears not to be altered in T-4, but the frameshift mutationin the T ORF13 reading frame indicates that a biologicallyinactive gene product could be associated with the mutationalevents. The results suggest that cytoplasmic male sterility anddisease toxin sensitivity may be associated with presence of TORF13 in T-cytoplasm maize.

Cytoplasmic male sterility of higher plants is a phenotypeidentified by failure to produce functional pollen. In maize(Zea mays Linnaeus), there are three major groups ofmale-sterile cytoplasms, S (USDA), C (Charrua), and T(Texas), that are distinguished by the genetics of fertilityrestoration (1) and by mitochondrial DNA (mtDNA) restric-tion profiles (2). The T source of cytoplasmic male sterilitywas widely used in the United States until 1970, whenepiphytotics of race T of Cochliobolus heterostrophusDrechsler and Phyllosticta maydis Arny and Nelson wereshown to be associated with this male-sterile cytoplasm (3).Both pathogens produce host-selective toxins, secondarymetabolites that are virulence determinants (4-6). Thesetoxins preferentially affect T-cytoplasm mitochondria (4, 6,7).One approach useful in identifying the molecular basis of

male sterility and disease toxin sensitivity was the regener-ation of T-cytoplasm maize plants from tissue culture, eitherin the presence or absence of T toxin (8-12). At significantfrequency, plants regenerated from tissue cultures displayedmutation to male fertility and insensitivity to both toxins.Resistance to the toxins and to the pathogens, as well as themale fertility trait, were usually stable and were inherited ina maternal manner. Examination of at least 20 such mutants(9, 12, 13) revealed that 19 carried mtDNA with restriction-

pattern differences compared to parental T-cytoplasmmtDNA. Consistent among these rearrangements was theabsence of a 6.7-kilobase (kb) Xho I restriction fragment. The6.7-kb Xho I fragment was retained in all of 34 regeneratedmale-sterile, toxin-sensitive control plants.One interesting mutant, T-4, retained the 6.7-kb Xho I

fragment yet was male fertile and insensitive to the toxins.These observations led us to suspect that some subtle changewithin the 6.7-kb Xho I fragment might account for thephenotype changes. In this paper we present evidence ofdeletion or a frameshift mutation in a T-specific mitochon-drial open reading frame (ORF) of the mutants.

MATERIALS AND METHODSSeed Lines. The maize inbred line A188(T) (rflrfl;Rf2Rf2)

served as the progenitor control for these experiments. Thisline has recessive alleles for the nuclear fertility restorerlocus rfl and is male sterile. The T-4 and T-7 fertile mutantswere recovered from plants regenerated from tissue culturesof A188(T) as described by Umbeck and Gengenbach (12).

Preparation and Analysis of mtDNA. Preparation ofmtDNA, restriction endonuclease digestion, electrophoresis,blotting, and hybridization were performed as described (14).

Preparation of Mitochondrial RNA. Mitochondria wereprepared as described (14) without DNase and proteinase K.Organelles were lysed in 6M guanidium thiocyanate (15), andnucleic acids were purified by phenol/chloroform extraction.One gram of CsCl was added to a 2.5-ml suspension, andmitochondrial RNA (mtRNA) was pelleted through a 1.5-mlcushion of 5.7 M CsCl/0.1 M Na2EDTA for 12 hr at 32,000x g at 20°C in a Beckman SW50.1 rotor (15).Construction of Cosmid Libraries. Cosmid libraries of

A188(T) and the T-4 mutant were constructed by ligation ofthe 33- to 50-kb partial Sau3A digestion products into theBamHI site of pHC79 treated with phosphatase (17).RNA Electrophoresis, Transfer, and Hybridization. mtRNA

was denatured with glyoxal, fractionated through 1.0%agarose gels in 10 mM Na2HPO4 (pH 7.0), and transferred tonitrocellose filters (18). The filters were prehybridized at 67°Cin 6x SSC/5X Denhardt's solution/20 mM Na2HPO4, pH6.5/denatured salmon sperm DNA at 100 ug/ml followed byhybridization for 16 hr at 50°C in 6x SSC/1x Denhardt'ssolution/20 mM Na2HPO4, pH 6.5/salmon sperm DNA at100 ,ug/ml. (1x SSC = 0.15 M NaCl/0.015 M sodium citrate,pH 7.0; 1x Denhardt's solution = 0.02% polyvinylpyr-rolidone/0.02% Ficoll/0.02% bovine serum albumin.) Thefilters were washed according to Thomas (18).DNA Sequence Analysis. Cloning for sequence analysis was

carried out using the M13 vectors mpl8 and mpl9 (19).

Abbreviations: mtDNA and mtRNA, mitochondrial DNA and RNA;T, Texas; ORF, open reading frame.

2858

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 22

, 202

1

Proc. Natl. Acad. Sci. USA 84 (1987) 2859

Sequences for all clones were determined in both directionsby the dideoxynucleotide chain-termination method of San-ger et al. (20) with a universal primer. Chain-terminationreactions were performed with dATP[35S] (New EnglandNuclear), and the reaction products were fractionated on 6%acrylamide sequencing gels.

RESULTS

Mapping of the 6.7-kb Xho I Fragment and FlankingRegions. The T and T-4 cosmid libraries were probed with a6.5-kb BamHI fragment from the cosmid 2C11 (16), whichshares homology with the 6.7-kb Xho I fragment. Hybridizingcosmids, representing each of four configurations, werealigned and mapped (Fig. 1) (21). Prominent among thefeatures of this region is a 5-kb repeat that extends into the6.7- and 4.5-kb Xho I junction fragments. The AB configura-tion represents a portion homologous to the master circle inthe wf9(N) male-fertile maize mitochondrial genome and is asingle copy region in this cytoplasm (20). The ATPase subunit6 gene is located in this region (22). The CD configurationrepresents another copy of the repeat in T cytoplasm. AD andCB configurations result from recombination within therepeat and are probably present on subgenomic circles.Rearrangements of the T-4 Mutant mtDNA. The 6.7- and

4.5-kb Xho I fragments from T and T-4 were recovered fromcosmids and examined with a series of restriction endonu-cleases. Alu I digestion of these fragments revealed a slightlylarger fragment in T-4 in the single copy region of the 6.7-kbXho I fragment (21, 23). A series of HindIII, Taq I, and AluI clones from T and T-4 were then constructed and used inDNADNA reciprocal hybridizations, which in addition to

restriction endonuclease digestion with 11 enzymes, wereused to map the 6.7-kb Xho I fragment. The portion of the6.7-kb Xho I fragment carrying the alteration in T-4 isincluded in a 3.7-kb Xho I-Sal I fragment and is shown in Fig.2. T-a102, a 188-base-pair (bp) Alu I clone from T-cytoplasmmtDNA was identified as the smallest altered fragment.T-a102 was used to identify the corresponding Alu I clonefrom T-4 and overlapping Taq I clones in T and T-4. Wesequenced two overlapping clones, T-t221 and T-a102 (Fig. 2)and their corresponding clones in T-4 (T4-t202 and T4-a68).Examination of the T sequence revealed a 345-bp ORF, TORF13, as described by Dewey et al. (24) (Fig. 3). The aminoacid sequence derived from T ORF13 predicts a polypeptideof 12.9 kDa. Computer retrieval of matching sequence dataon the Intelligenetics program revealed homology with 26Sribosomal DNA (25) and with a region on the 3' side ofthe 26SrDNA (24).The T-4 sequence is characterized by a guanine to adenine

transition 213 bp from the ATG initiation codon in T-cytoplasm mtDNA, and a 5-bp insertion beginning at 214 bp.These changes in the T-4 mutant result in 86 bp of perfecthomology with a region on the 3' side of 26S rDNA (23, 25),including a tandem 5-bp repeat. This suggests that the alteredsequences in the T-4 mutant arose by homologous recombi-nation or gene conversion with the region on the 3' side of 26SrDNA. The most important consequence of the insertion,however, is that it generates a frameshift placing a TGA stopcodon in frame four nucleotides after the insertion, truncatingthe predicted polypeptide from 12.9 kDa to 8.3 kDa. The T-4open reading frame is, therefore, designated T4 ORF8.3.

Organization of mtDNA from Deletion Mutants-. Mutantsthat had lost the 6.7-kb Xho I fragment were examined byhybridizing T-mtDNA clones to BamHI, Xho I, and HindIII

4.5 kb Xhol

1 5 kb

x a aHit I 'i7 7i

repeat

x xH

X B B x x

H H HI

H

NH HH HII 11

kb0 .5 1

xH

X B

iB

H x a DI/

-~~~~~~~~~~~~~~L-

C H X B X a B X X X B xHH NjjH 1771 1H 7 1 .6t

X B B X XI H H I7

B

~IiAP

NH HH H1 1

x a DH HI1,

6.7 kb Xhol

FIG. 1. Restriction map of the 6.7-Xho I fragment and flanking regions including the 5-kb repeat in A188(T) and T-4. The AB configuration,represented by T-cosmid 19H10, is colinear with a region of the master circle in the wf9(N) male-fertile maize mitochondrial genome. The CDconfiguration, represented by T-cosmid lOA5, is another copy of the 5-kb repeat and flanking regions. The CB (T cosmid 13G10) and AD (Tcosmid 3C8) configurations represent products of recombination through the 5-kb repeat. All four configurations were also recovered as cosmidsfrom the T-4 library. Slash lines above the AD configuration indicate the approximate position of deleted or absent sequences in T-7 or N,respectively. The same sequences are deleted or absent from the CD configuration. B, BamHI; H, HindIII; X, Xho I.

A

c

H

X BH'I 7H

A HL

Genetics: Wise et al.

}H13if

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 22

, 202

1

2860 Genetics: Wise et al. Proc. Natl. Acad. Sci. USA 84 (1987)

500 bpI

xH Hc H HSm St

a taa at a t at a a ta a aI_.\1 111I 1 1I I I II I I

T . .F| ORF25 IT4 ORF8.3

T-a43 T-t221 T-a106T-st3O8

T-a102 T-a107

T-H18

FIG. 2. Restriction map of T ORF13/T4 ORF8.3 region from A188(T) and T-4 maize mtDNA. ORF25 as described by Dewey et al. (24) isindicated. Taq I sites were mapped in only the 2.0-kb HindIII fragment T-H18. a, Alu I; Hc, HincII; H, HindIII; S, Sal I; Sm, Sma I; St, SstII; t, Taq I; X, Xho I.

digests of total mtDNA. Sixteen Alu I clones derived from the on the direction of transcription of T ORF13 thus 5' to 3'6.7-kb Xho I fragment as well as eight HindIII, Taq I, Xho I, indicates left to right on the restriction maps (Figs. 1 and 2).and BamHI clones from this region were utilized. Repre- Hybridization with T-a43, a 625-bp Alu I clone from withinsentative data from five Alu I clones, hybridized to HindIII the 5-kb repeat, showed that HindIII junction fragments ofdigests of T, T-4, T-7 (a mutant that had lost the 6.7-kb Xho I 2.7 and 2 kb in T and T-4 are represented as only the 2.7-kbfragment), and A188(N) demonstrate the salient features of the fragment in T-7 or N cytoplasm, indicating deletion of thisorganization ofthis region (Fig. 4). Maps ofthis region are based part of the repeat in T-7 and absence in N (Fig. 4A).

3' to 26S rONA

T-4 TCGAGATTGT GTGGGTGTTC AGTTCATGAA++++++++++ ++++++++++ ++++++++++

T TCGAGATTlIT GTGGGTGTTC AGTTCATGAA-90 -70

4170 AG TCTCTTTCAA CAAAAGAGCG GAGCGG----++ ++++++++++ ++++++++ +++ ++

ATGGGTGAAG TCTCTTTCAA GAAAAGAGCA GAG-GGAGCG++++++++++ ++++++++++ ++++++++++ +++ ++++++

ATGGGTGAAG TCTCTTTCAA GAAAAGAGCA GAG-GGAGCG-50 -30

-AAAGGAAAAGAAAG++A+

GAAAGGAAAA++++++++++

GAAAGGAAAA

AACTTTTTCG TCAATGATCA+++++++++ ++++++++++

CACTTTTTCG TCAATGATCA++++++++++ ++++++++++

CACTTTTTCG TCAATGATCA-10 1

ATTTTTCGGT TCTATTTTTG GTTCATTTTT++++++++++ +++++++++ ++ +++++

ATTTTTCGGT TCTATTTTTA TTTTTTTTTT++++++++++ ++++++++++ ++++++++++

ATTTTTCGGT TCTATTTTTA TTTTTTTTTT50 70

GAGAGCTATT++ +++++

GATTCCTATTGATTCCTATTGATTCCTATT

TGACTCAACT++ +++++++

TGGCTCAACT++++++++++

TGGCTCAACT130

ATCTGAGTTT++ +++++

CTCCGAGTTA

CGACTTTCTT+ ++++++++

CTACTTTCTT

CTACTTTCTT10

TTCATTAGGC+ ++

GTGCATATTA

GTGCATATTA

GCCAACCACAGCCAACCACAGCCAACCACA

++++++++++ ++++++++++

CTCCGAGTTA GCCAACCACA150

AAACCTTCCT CCCTTTGATA++++++++++ +++++++++

AAACCTTCCT CCCTTTGATC++++++++++ ++++++++++

AAACCTTCCT CCCTTTGATC30

AGATTAAAGG ATATCTAAGT

TTGATAAAGG GATATCTCCG++++++++++ ++++++++++

TTGATAAAGG GATATCTCCG90

ATAGAGTGGA AGCGGCAAAA++++++++++ ++++++++++

ATAGAGTGGA AGCGGCAAAA++++++++++ ++++++++++

ATAGAGTGGA AGCGGCAAAA170

TTCTCATCTC ATGGTTGAGG++++++++++ ++++++++++

TTCTCATCTC ATGGTTGAGG

TTCTCG.--- -TGGTTGAGG210

GGGGTTAAAA TGAGGGTGAA++++++ +++.+ +++++++

GGGGTTCAAA TTAGGGTGAG++++.++++++ ++++++++++

GGGGTTCAAA TTAGGGTGAG230

ATACAACGGA AGGGGT++++++++++ + +

ATACAACGGA ATGAAGGAGG++++++++++ ++++++++++

ATACAACGGA ATGAAGGAGG270

26S 1055 CCACCCTCT- -AAGCCTAAG++++ ++++ +++++++++

GGGTCGAAGC AACGACCAAT CCACTCTCTC TAAGCCTAAG++++++++++ ++++++++++ ++++++++++ ++++++++++

GGGTCGAAGC AACGACCAAT CCACTCTCTC TAAGCCTAAG290 310

CCGTGAGGAA AGGTGAAAAG++++++++ +

CCGTGAGGGA CCAAAGTCTC++++++++++ ++++++++++

CCGTGAGGGA CCAAAGTCTC350

AACCCCAATC+ +

CCTTTCTCTT TTGGGGTGGG GGCGGAGCT++++++++++ +++++++T++ +++++++++

CCTTTCTCTT TTOGOGTOOO OOCOGAOCT

FIG. 3. The nucleotide sequence of the T ORF13/T4 ORF8.3 regions of maize mtDNA. T cytoplasm (Bottom); T-4 mutant (Middle); regionsofhomology to 26s rDNA and a region on the 3' side of the 26S rDNA (Top). ATG start codons and TGA stop codons forT and T-4 are underlined,as are the tandem 5-bp repeats of the 3' 26S and analogous T-4 regions. Coordinates are for T cytoplasm. +, homology.

Sm H S H

laHc

T-a22

T-H41

AAGGTTTGGT++++++++++

AAGGTTTGGT++++++++++

AAGGTTTGGT

AAGATAGACG+ + +

TAAAATGGAT++++++++++

TAAAATGGAT110

GCGGGCCACG

GCGGGCCACG

GCGOGCCACG

TGGCCCTGCA++++++++++

TGGCCCTGCA++++++++++

TGGCCCTGCA190

TGAGCTATCCT++GCTATCCTGAGCTATCC++++++++++

TGAGCTATCC

GACCTTCCCT++++++ +++-

GACCTTACCT

GACCTTACCT250

TGACCGATAG++++++++++

TGACCGATAG

TGACCGATAG330

TATTCCTCAA++++++++++

TATTCCTCAA++++++++++

TATTCCTC~A'

CGTACAAGTA

CGTACAAGTA++++++++++

COGTACAAGTA

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 22

, 202

1

Proc. Natl. Acad. Sci. USA 84 (1987) 2861

A

T T-4 7. I

B C

T -47T I Tx -4 7T UI

D

T T-4 T-7 N

E

T T74 T77 N

5.1 _

2.7 ___n _

2.0 _-

T-a43

3.2 __m

2.0_ 2.0 __

1.35___ _ 1.35 _ __i_

0.6T-a 102 T-a 107 T-a 106 T-a22

FIG. 4. Southern blot analysis ofT ORF13 and flanking regions. mtDNAs from A188(T), T4, T-7, and A188(N) were digested with HindIII,electrophoresed on 0.8% agarose gels, and transferred to nitrocellulose. (A) T-a43. (B) T-a102. (C) T-a107. (D) T-a106. (E) T-a22. Clone positionsare designated in Fig, 2. Approximate sizes are in kilobase pairs.

Sequences homologous to T-a102, a 188-bp Alu I cloneincluding part of T ORF13, are similarly deleted in T-7 andabsent in N (Fig. 4B). Homology of T-a102 at 5.1 kb (Fig. 4B)indicates homology to the 26S rRNA-encoding DNA region.Sequences homologous to T-t221, a 367-bp Taq I cloneincluding a larger portion of T ORF13, were similarly notpresent in T-7 and N (data not shown). T-a107, a 178-bp AluI clone internal to an ORF designated ORF25 (24) (Fig. 2),hybridized to a 3.2-kb fragment in T-7 and N (Fig. 4C).Hybridization with T-a104, a 151-bp Alu I clone betweenT-a102 and T-a107, including the 5' end of ORF25, displayedan identical pattern to T-a107 (data not shown), suggestingthat the 5' end of ORF25 is retained in the mutant lines.Mapping of T, T-4, T-7, and N through this region with AluI, Taq I, and Sau3A confirmed this interpretation. The T-a107Alu I fragment was retained in all lines. The T-a104 Alu Ifragment was reduced from 151 bp to an estimated 146 bp inT-7. It should be noted that all of the clones within the regionshown in Fig. 2 revealed that the T-7 configuration, and thatofthree other deletion mutants (data not shown), matched theconfiguration of A188(N) mtDNA. Clones including the 3'end ofORF25 (T-a106) and sequences on the 3' side ofORF25(T-a22) showed no differences in all mtDNAs examined (Fig.4D and E). Most notably, there were no differences betweenT and T-4 except the 5-bp insertion, or among T and themutants that had lost the 6.7-kb Xho I fragment except for thedeleted region.The extent of deletion in the CD and AD parental T

configurations of these mutants is 3 kb, beginning betweenthe two BamHI sites within the repeat (data not shown), and

terminating on the 3' side of T-a102 (Figs. 1 and 2). Thedeletion included the T ORF13 region, which is also absentin N mtDNA. ORF25, 77 bp on the 3' side of T ORF13, wasretained in all male-fertile, toxin-insensitive mutants weassayed.

Transcript Analysis of the T ORF13 Region. An analysis oftranscription through the T ORF13 region was accomplishedby hybridizing nick-translated mtDNA clones to totalmtRNA from A188(T), T-4, T-7, and A188(N). Repre-sentative data are shown in Fig. 5. Hybridization ofthe 2.0-kbT-H18 clone (Fig. SA) revealed at least nine transcripts in Tand T-4 and three transcripts in T-7 or N. Also evident washomology to 26S rRNA at 3.6 kb although it was more visiblein T-7 or N. The most predominant transcripts were 3.9, 2.0,1.8, and 1.5 kb. Three major transcripts and one minortranscript hybridized to T-a43, a 625-bp clone specific to the5-kb repeat (Fig. SB). One major transcript (2.3 kb) homol-ogous to T-a43 does not hybridize to clones further in the 3'direction into the single copy region of the 6.7-kb Xho Ifragment. T-t221, a 367-bp Taq I clone extending from therepeat junction into T ORF13, and T-st308, a 274-bpSau3A-Taq I clone internal to T ORF13, hybridized to fourmajor transcripts and four minor transcripts (Fig. 5 C and D).T-H41, a 1.35-kb HindIII clone on the 3' side of T ORF13,hybridized to four major transcripts in-Taid T-4 and to twoother transcripts of 3.1 and 0.6 kb in T-7 (Fig. 5E). Alterna-tively, in N-cytoplasm mtRNA, T-H41 detected the 3.1-kbtranscript and an N-specific 1.4-kb traunscript, but not the0.6-kb transcript. The 3.9-kb transcript appears to beginwithin the two Xho I sites at the right end of the 5-kb repeat

A

r T-4 1-7 N

3.0

1.5_1.1_5

0.S

B

r 1-4r-7

3. 6 3.9 4w4 3. 93.1 3 3

2.3 -OaZ0

151.1*0.0

C D

r 14r-7 T T-4 T7

T-H18 T-a43 T-t221 T-st308 T-H41

FIG. 5. RNA gel blot analysis of T ORF13 and flanking regions. mtRNA (15 ,ug) from A188(T), T-4, T-7, and A188(N) were denatured withglyoxal, electrophoresed on L.0o agarose gels, and transferred to nitrocellulose. Transcription is from left to right. (A) T-H18. (B) T-a43. (C)T-t221. (D) T-st308. (E) T-H41. Clone positions are designated in Fig. 2. Approximate sizes are in kb.

E

T T-4 T-7 N

_ 3.9 W

if I'!!

0.51

3 1

0.6

Genetics: Wise et al.

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 22

, 202

1

Proc. Natl. Acad. Sci. USA 84 (1987)

and ends within the region included in the T-H41 clone. Total5'-end labeled mtRNA only hybridized to the sense strand ofthe single-stranded M13 templates that carry the ORF asshown in Fig. 3, indicating that RNA was only beingtranscribed from one strand. Most importantly, T and T-4displayed no differences in their hybridization patterns usingprobes carrying or flanking the insertion. There was, how-ever, a marked difference in hybridization patterns whenthese probes were hybridized to T-7 or N mtRNA. This canbest be explained by the deletion through part of this regionin T-7 and the absence of these sequences in N mtDNA.

DISCUSSIONTissue-culture derived mutants of T cytoplasm maize arecharacterized by two distinct mitochondrial rearrangements;a deletion of 3 kb including T ORF13 in mutants such as T-7and the insertion event of the T-4 mutant. We show here thatthe 6.7-kb Xho I fragment from T-4 carries a guanine toadenine transition and a 5-base insertion internal to T ORF13.A polypeptide of 12.9 kDa has been predicted from the TORF13 sequence (24), correlated with a 13-kDa mitochon-drial translation product seen in T- but not N-cytoplasmmaize (26). The insertion event in the T-4 mutant results in aframeshift that generates a premature stop codon, truncatingthe predicted polypeptide at 8.3 kDa. That the 13-kDa proteinis indeed the gene product of T ORF13 was shown byimmunoprecipitation of the protein by antibody to a syntheticpeptide derived from the T ORF13 sequence; this protein isnot synthesized by the mutants, but T-4 synthesizes apolypeptide of 8 kDa (R.P.W., A. Fliss, D.R.P., K. Storey,and B.G.G., unpublished results).Toxin sensitivity ofT-cytoplasm maize could involve a role

for the 13-kDa polypeptide in processes associated withrecognition, binding, and disruption of membrane integrity.The truncated T-4 product may be biologically inactive inthese roles, although there are no data to support theseinterpretations. The deletion mutants and the T-4 mutantresult in the coordinate change in phenotype from malesterility to male fertility and from susceptibility to resistance.Changes in the two traits could be related to mutation of asingle gene with pleiotropic effects or by simultaneousalterations in the expression of two genes. Because bothphenotype changes occur in T-4, which is altered only in theT ORF13 region, a single translation product responsible formale sterility and toxin sensitivity would seem to indicatepleiotropy. T ORF13 is T-cytoplasm specific, but ORF25 iswidespread. Sequences homologous to ORF25 are present inthe tissue culture mutants, other maize cytoplasms, and in anumber of other higher plants (ref. 24; R.P.W., D.R.P., andG.B.B., unpublished results). Although T ORF13 is deletedor truncated in the mutants, ORF25 is retained. Until more isknown about the mature transcripts of ORF25 and thepossible interdependence with T ORF13 in T maize, howev-er, we cannot rule out the possibility of a role of ORF25 inthese phenomena.The 193-bp Alu I fragment from T-4 is detected as only a

188-bp fragment in mtDNA genomic digests of parental Tcytoplasm, indicating that the insertion event does not occurin nonregenerated plants. It is unclear why the deletion andconversion events occur in tissue culture and why thedeletion event occurs more frequently than conversion.Clearly the most frequent event associated with the alteredphenotype results from a deletion immediately on the 3' sideof T ORF13 and extending into part of the 5-kb repeat.The rearrangement in T-4, which duplicates an additional

5 bp of the apparent progenitor sequence on the 3' side of 26SrDNA, could result from a gene conversion event or homol-ogous recombination. As described by Dewey et al. (24),

evolution of the T ORF13 region involved a number ofunusual recombination events. Duplication of a single copyregion colinear with N-cytoplasm mtDNA, generating the5-kb repeat, may have fortuitously placed regulatory/pro-moter sequences of the ATPase subunit 6 gene (22) on the 5'side ofthe potential T ORF. The 3'junction ofthe 5-kb repeatis 444 bp from the ATG initiation codon of ATPase subunit6 (24), and 69 bp from the ATG initiation codon ofT ORF13.Since T ORF8.3 more precisely duplicates sequences on the3' side of 26S rDNA, the T-4 configuration could also beconsidered a primitive intermediate preceding an adenine toguanine transition and 5-bp deletion, which would generate TORF13.Recombination events, which are involved in evolution of

the unique T ORF13 gene, similarly seem involved in dis-ruption of the gene in plants regenerated from tissue culture.The consistent loss of an intact T ORF13 among mutantssuggests that cytoplasmic male sterility and disease suscep-tibility ofT cytoplasm may be associated with the generationof this unusual ORF.

We thank C. D. Chase, A. G. Smith, and J. C. Kennell for adviceand technical assistance.

1. Laughnan, J. R. & Gabay-Laughnan, S. (1983) Annu. Rev.Genet. 17, 27-48.

2. Pring, D. R. & Levings, C. S., III (1978) Genetics 89, 121-136.3. Ullstrup, A. J. (1972) Annu. Rev. Phytopathol. 10, 37-50.4. Comstock, J. C., Martinson, C. A. & Gengenbach, B. G.

(1973) Phytopathology 63, 1357-1361.5. Hooker, A. L., Smith, D. R., Lim, S. M. & Beckett, J. B.

(1970) Plant Dis. Rep. 54, 708-712.6. Yoder, 0. C. (1973) Phytopathology 63, 1361-1366.7. Miller, R. J. & Koeppe, D. E. (1971) Science 173, 67-69.8. Brettell, R. I. S., Thomas, E. & Ingram, D. S. (1980) Theor.

Appl. Genet. 58, 55-58.9. Gengenbach, B. G., Connelly, J. A., Pring, D. R. & Conde,

M. F. (1981) Theor. Appl. Genet. 59, 161-167.10. Gengenbach, B. G., Green, C. E. & Donovan, C. D. (1977)

Proc. Natl. Acad. Sci. USA 74, 5113-5117.11. Gengenbach, B. G. & Umbeck, P. (1982) Maize Genet. Coop.

Newslett. 56, 140.12. Umbeck, P. F. & Gengenbach, B. G. (1983) Crop Sci. 23,

584-588.13. Kemble, R. J., Flavell, R. B. & Brettell, R. I. S. (1982) Theor.

Appl. Genet. 62, 213-217.14. McNay, J. W., Chourey, P. S. & Pring, D. R. (1984) Theor.

Appl. Genet. 67, 433-437.15. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular

Cloning: A Laboratory Manual (Cold Spring Harbor Labora-tory, Cold Spring Harbor, NY).

16. Lonsdale, D. M., Thompson, R. D. & Hodge, T. P. (1981)Nucleic Acids Res. 9, 3657-3669.

17. Lonsdale, D. M., Hodge, T. P. & Stoehr, P. J. (1986) MethodsEnzymol. 118, 453-470.

18. Thomas, P. S. (1980) Proc. Natl. Acad. Sci. USA 77,5201-5205.

19. Yannish-Perron, C., Vieira, J. & Messing, J. (1985) Gene 33,103-119.

20. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl.Acad. Sci. USA 74, 5463-5467.

21. Wise, R. P., Pring, D. R. & Gengenbach, B. G. (1985) MaizeGenet. Coop. Newslett. 59, 50.

22. Dewey, R. E., Levings, C. S., III, & Timothy, D. H. (1985)Plant Physiol. 79, 914-919.

23. Wise, R. P., Pring, D. R. & Gengenbach, B. G. (1986) inMolecular Strategies for Crop Protection, UCLA Symposia onMolecular and Cellular Biology, eds. Arntzen, C. & Ryan, C.(Liss, New York), New Series, Vol. 78, in press.

24. Dewey, R. E., Levings, C. S., III, & Timothy, D. H. (1986)Cell 44, 439-449.

25. Dale, R. M. K., Mendu, N., Ginsburg, H. & Kridl, J. C.(1984) Plasmid 11, 141-150.

26. Forde, B. G., Oliver, R. J. C. & Leaver, C. J. (1978) Proc.Natl. Acad. Sci. USA 75, 3841-3845.

2862 Genetics: Wise et al.

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 22

, 202

1