Research Collection

Doctoral Thesis

Improving protein content in cassava storage roots

Author(s): Stupak, Martin

Publication Date: 2008

Permanent Link: https://doi.org/10.3929/ethz-a-005555839

Rights / License: In Copyright - Non-Commercial Use Permitted

This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.

ETH Library

Diss. ETH No. 17557

Improving protein content in cassava storage roots

A dissertation submitted to

ETH Zurich

For the degree of

Doctor of Sciences

Presented by

Martin Stupak

Diplom-Lebensmittelchemiker Universität Karlsruhe (TH), Germany

Born January 2nd, 1978 Citizen of Germany

Accepted on the recommendation of:

Professor W. Gruissem, examiner Professor R. Amadò, co-examiner Professor P. Zhang, co-examiner

1

2008

I. Table of contents

I. TABLE OF CONTENTS 2

II. ABSTRACT 4

III. ZUSAMMENFASSUNG 5

IV. ABBREVIATIONS 6

V. INTRODUCTION 8

CASSAVA AND NUTRITION 8 BIOTECHNOLOGICAL APPROACHES TO CASSAVA PROTEIN IMPROVEMENT 11 AIMS OF THE THESIS 30

VI. X-RAY FLUORESCENCE SPECTROSCOPY AS A NEW METHOD TO DETERMINE SULFUR AMINO ACIDS IN CASSAVA STORAGE ROOTS 31

ABSTRACT 31 INTRODUCTION 31 MATERIAL AND METHODS 32 RESULTS 34 DISCUSSION 37 ACKNOWLEDGEMENTS 39 REFERENCES 39 FIGURES AND TABLES 41

VII. ER-RETAINED ASP1 INCREASES PROTEIN CONTENT IN CASSAVA STORAGE ROOTS 44

ABSTRACT 44 INTRODUCTION 44 RESULTS 46 DISCUSSION 49 EXPERIMENTAL PROCEDURES 53 ACKNOWLEDGEMENTS 55 REFERENCES 56 FIGURES AND TABLES 59

2

VIII. IMPORT OF A STORAGE PROTEIN INTO PLASTIDAL STROMA IS INHIBITED IN CASSAVA 66

ABSTRACT 66 INTRODUCTION 66 MATERIAL AND METHODS 67 RESULTS 68 DISCUSSION 71 REFERENCES 72 FIGURES AND TABLES 74

IX. EVALUATION OF VACUOLES AS A SUITABLE PROTEIN STORAGE PLACE IN CASSAVA 78

INTRODUCTION 78 MATERIAL AND METHODS 79 RESULTS 81 DISCUSSION 82 ACKNOWLEDGEMENTS 83 REFERENCES 84 FIGURES AND TABLES 86

X. DISCUSSION AND PERSPECTIVES 88

XI. VECTOR OVERVIEW 93

XII. ACKNOWLEDGMENTS 94

XIII. CURRICULUM VITAE 95

3

II. Abstract Cassava is one of the most important crops in tropical and sub-tropical developing

countries, providing a vital source of calories for over 600 million people. Despite the

high starch content, cassava roots are deficient in nutritional value, lacking significant

amounts of vitamins and protein. Here we show that Agrobacterium-directed

transformation of cassava with the heterologous storage proteins ASP1 and

sporamin leads to increases up to 3.2-fold in root total protein content and increases

in certain amino acids up to 9.6-fold, respectively, when retained within the

endoplasmic reticulum. Transient over-expression of zeolin in vitro resulted in stable

protein accumulation in vacuoles and ER. Furthermore, we demonstrate using

constructs of sporamin tagged to a signal sequence that the endoplasmic reticulum

and vacuoles are likely to be suitable organelles for protein storage, yet similar

experiments using ASP1 showed a lack of import into the plastids. We propose that

this is due to structural properties of the protein or otherwise construct derived.

These findings significantly enhance our understanding of protein content in cassava

roots and, moreover, offer scope for the development of cassava varieties to aid in

overcoming malnutrition in developing countries.

4

III. Zusammenfassung Cassava ist eine der wichtigsten Nahrungsmittelpflanzen in Entwicklungsländern der

Tropen und Subtropen und dient für mehr als 600 Millionen Menschen als

lebensnotwendige Kalorienquelle. Trotz des hohen Stärkegehalts haben

Cassavawurzeln einen verminderten Nährwert, da die vorhandenen Mengen an

Vitaminen und Proteinen die Schwellenwerte deutlich unterschreiten. Wir können hier

erstmals zeigen, dass die Agrobacterium-vermittelte Cassavatransformation der

beiden heterologen Speicherproteine ASP1 und Sporamin zu einer Steigerung des

Gesamtproteingehaltes um das bis zu 3.2-fache und einzelner Aminosäuren um das

bis zu 9.6-fache führt, wenn Proteinretention im Endoplasmatischen Retikulum (ER)

angewendet wird. Bei Überexpression des Proteins Zeolin in vitro konnte eine stabile

Proteinakkumulation in Vakuolen und im ER festgestellt werden. Ausserdem können

wir hier durch den Einsatz von Konstrukten, bei denen Sporamin mit

Signalsequenzen gekoppelt wurde, aufzeigen, dass das ER und die Vakuolen

höchstwahrscheinlich geeignete Organellen zur Proteinspeicherung darstellen.

Ähnliche Versuche mit ASP1 führten allerdings zu einem inhibierten Plastidimport,

vemutlich aufgrund struktureller Eigenschaften des Proteins oder durch andere

Nebeneffekte des Konstruktes. Diese Ergebnisse verbessern unser Verständnis der

Proteinspeicherung in Cassavawurzeln erheblich und eröffnen uns darüberhinaus

neue Möglichkeiten, die Mangelernährung in Entwicklungsländern erfolgreich zu

bekämpfen.

5

IV. Abbreviations

AA Amino Acid

AAA Amino Acid Analysis / Aromatic Amino Acids

AmA1 Amaranth Seed Albumin

ASP1 Artificial Storage Protein 1

AOAC Association of Official Analytical Chemists

BW Body Weight

BiP Immunoglobulin Heavy Chain Binding Protein

CLSM Confocal Laser Scanning Microscopy

DHPS Dihydrodipicolinate Synthase

EAA Essential Amino Acid

ER Endoplasmic Reticulum

FAO Food and Agriculture Organisation

FEC Friable Embryogenic Callus

FRAP Fluorescence Recovery after Photobleaching

GFP Green Fluorescent Protein

GUS β-glucuronidase reporter gene

KDEL Tetrapeptide comprised of Lys-Asp-Glu-Leu

PCR Polymerase Chain Reaction

PEM Protein-Energy-Malnutrition

PP2A Serine/Threonine protein phosphatase catalytic subunit 2A

PSV Protein Storage Vacuole

rbcS Ribulose Bisphosphate Carboxylase Small Subunit

RDI Recommended Daily Intake

RER Rough Endoplasmic Reticulum

RFP Red Fluorescent Protein

RNAi RNA Interference

RT Room Temperature

RV A series of transformation constructs “Ready Vectors”

SAA Sulfur-containing Amino Acid

SAM S-Adenosyl-Methionine

SAMS S-Adenosyl-Methionine Synthetase

6

SKL Tripeptide comprised of Ser-Lys-Leu

SS Signal sequence

SSA Sunflower Seed Albumin

TP Transit peptide

TS Threonine Synthase

USDA United States Department of Agriculture

WD-XRF Wave-length dispersive X-ray fluorescence

WHO World Health Organisation

WT Wildtype

XRFS X-ray Fluorescence Spectroscopy

7

V. Introduction

Cassava and Nutrition Cassava (genus Manihot; family Euphorbiaceae) is a shrub that is commonly known

as manioc, tapioca, mandioca and yucca. The genus comprises about 100 species

but only Manihot esculenta Crantz is commercially cultivated and is widely grown for

its starchy storage roots as a source of food. In 2004 more than 195 million tonnes

were harvested from approximately 17 million hectares of land, providing a staple

food for more than 600 million people living in tropical and sub-tropical developing

countries (FAO, 2005). Cassava plays a major role in food security due to its high

tolerance towards poor soil conditions, its flexible harvesting time throughout the year

and its easy vegetative propagation via stem cuttings (Cock, 1982).

The storage root of cassava - a true root and therefore cannot be propagated –

comprises the bark (periderm), peel (cortex) and parenchyma, which is the edible

part (Ceballos et al., 2004). A report from the United States Department of

Agriculture showed that an average storage root contains about 60% water, 38%

carbohydrates, but only about 1% lipids and 1% total protein (USDA, 2005). Other

reports have supported this finding, showing protein levels varying from below 1% to

8% dry weight (Ceballos et al., 2006). This low abundance of protein can lead in the

long term to severe problems, such as Protein-Energy-Malnutrition (PEM). This

occurs particularly in areas where consumers rely primarily on cassava as a food

source and where high-protein foods are not readily available for complementation

and diversification of their diet. The human body cannot synthesize all amino acids

itself so therefore requires uptake in our daily diet. In general, 8 out of 20 natural

amino acids are considered essential, including isoleucine, leucine, lysine, threonine,

tryptophan and valine. The sulfur amino acids (SAA) methionine and cysteine and

the aromatic amino acids (AAA) phenylalanine and tyrosine, are to a certain degree

interconvertible but nevertheless essential (FAO, 1991). Under certain clinical

conditions like prematurity or illness even histidine or other dispensable amino acids

can be considered essential (Laidlaw and Kopple, 1987). Unfortunately, cassava

storage roots are particularly deficient in lysine, leucine and SAA, which has major

implications on their nutritional value. However, the abundance of cyanogenic

glycosides results in the production of the poisonous hydrogen cyanide and needs to

8

be considered. Ordinarily, consumers overcome this problem by washing, drying or

boiling the roots but these processes also degrade labile amino acids (Ngudi et al.,

2002, 2003). Additionally, ingested compounds derived from remaining cyanogenic

glycosides in food require the presence of SAA for physiological detoxification and

consequently secretion of the metabolic compounds in humans (Cliff et al., 1985;

Rosling, 1994). So particularly SAA levels are crucial because they are generally low,

degraded during processing, and depleted for physiological detoxification thus

resulting in very low amounts available for essential body functions.

Currently, a number of approaches could be adopted to tackle the problems

associated with protein deficiency in cassava roots. Firstly, a general improvement in

the nutritional situation through the broadening of the daily diet would be most

desirable. This is a global objective that could, in part, be achieved via the

establishment of other crops or food sources to complement dietary protein

deficiency derived from excessive cassava consumption. Secondly, food fortification

programs could tackle specifically the problem of PEM in those areas affected by

malnutrition. The distribution of concentrated protein additives would be one of the

program options.

Thirdly, the introduction of elite cassava cultivars with increased protein content in

cassava storage roots (Biofortification) is a promising strategy. This approach has

been followed using both classical breeding programs and biotechnological tools. In

cassava breeding, some progress has recently been made with the generation of an

interspecific hybrid which shows elevated levels of amino acids such as methionine

and lysine, and an increased total protein content (Ceballos et al., 2004; Nassar and

Sousa, 2007). The ongoing characterisation of this hybrid will provide further

information in order to assess its real potential to counterbalance malnutrition. A

biotechnological breakthrough instead has still not been found although the resulting

high-protein cassava cultivar would have a significant impact on the nutritional quality

of consumers (Taylor et al., 2004). The research presented in this thesis should

contribute to such a breakthrough, with the ultimate aim to generate awareness of

nutritional problems associated with cassava consumption and to enhance protein

content in cassava storage roots.

9

Ceballos H, Iglesias CA, Perez JC, Dixon AG (2004) Cassava breeding: opportunities and challenges. Plant Molecular Biology 56: 503-516

Ceballos H, Sanchez T, Chavez AL, Iglesias C, Debouck D, Mafla G, Tohme J (2006) Variation in crude protein content in cassava (Manihot esculenta Crantz) roots. Journal of Food Composition and Analysis 19: 589-593

Cliff J, Lundqvist P, Martensson J, Rosling H, Sorbo B (1985) Association of high cyanide and low sulphur intake in cassava-induced spastic paraparesis. Lancet 2: 1211-1213

Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762

FAO (1991) Protein quality evaluation. Joint FAO/WHO. FAO Food and Nutrition Paper 51: 1-66

FAO (2005) FAOSTAT data. In, Vol 2006 Laidlaw SA, Kopple JD (1987) Newer concepts of the indispensable amino acids.

American Journal of Clinical Nutrition 46: 593-605 Nassar NM, Sousa MV (2007) Amino acid profile in cassava and its interspecific

hybrid. Genetics and Molecular Research 6: 192-197 Ngudi DD, Kuo YH, Lambein F (2002) Food safety and amino acid balance in

processed cassava "Cossettes". Journal of Agricultural and Food Chemistry 50: 3042-3049

Ngudi DD, Kuo YH, Lambein F (2003) Amino acid profiles and protein quality of cooked cassava leaves or 'saka-saka'. Journal of the Science of Food and Agriculture 83: 529-534

Rosling H (1994) Measuring effects in humans of dietary cyanide exposure from cassava. Acta Horticulturae 375: 271-284

Taylor N, Chavarriaga P, Raemakers K, Siritunga D, Zhang P (2004) Development and application of transgenic technologies in cassava. Plant Molecular Biology 56: 671-688

USDA (2005) U.S. Department of Agriculture, Agricultural Research Service. National Nutrient Database for Standard Reference, Release 18. In Nutrient Data Laboratory Home Page, http://www.nal.usda.gov/fnic/foodcomp,

10

Biotechnological approaches to cassava protein improvement

Published in:

Trends in Food Science and Technology (2006) 17, 634-641

Authors’ contribution: M.S. wrote the review

H.V. edited and corrected the manuscript

W.G. edited and corrected the manuscript

P.Z. edited, corrected and submitted the manuscript

11

Biotechnological approaches to cassava protein improvement

Martin Stupaka, Hervé Vanderschurena, Wilhelm Gruissema and Peng Zhanga, b,*

a Institute of Plant Sciences, ETH Zurich, Universitätstrasse 2, 8092 Zurich,

Switzerland

b Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, 300

Fenglin Road, 200032 Shanghai, China

* To whom correspondence should be addressed, e-mail: pzhang@ethz.ch;

Correspondence may also be addressed to Martin Stupak, e-mail: mstupak@ethz.ch

Abstract Cassava starchy storage roots are an excellent source of carbohydrates but lacking

in protein. To enhance their nutritional quality, here we discuss several

biotechnological strategies that might be used to increase protein levels as well as

improved essential amino acid content in transgenic cassava. Application of such

strategies in this major crop could, in the long term, help to fight against malnutrition

in those regions which depend heavily on cassava consumption.

Keywords: Manihot esculenta Crantz; protein improvement; essential amino acids;

genetic engineering; metabolic pathway

Introduction Cassava (Manihot esculenta Crantz), also called manioc, tapioca or yucca, is

one of the most important food crops in tropical developing countries. Because of its

high drought tolerance and low demand for nutrients, it can produce acceptable

yields even under marginal environmental conditions (Cock, 1982). Vegetative

propagation via stem cuttings as well as a flexible harvesting time make cassava an

excellent famine reserve which is highly appreciated among subsistence farmers,

particularly in sub-Saharan African countries (FAO, 2004). The annual production of

this cheap food source has been constantly rising and increased by nearly 19% over

the last ten years. In 2004, more than 195 million tonnes were harvested from more

than 17 million hectares (FAO, 2005) so that at present, more than 600 million people

12

rely on cassava as a vital food source. Unfortunately, many developing countries

suffer from Protein-Energy-Malnutrition (PEM), while relying on cassava as an

important energy source in their daily diet (Fig. 1), Especially in these countries the

elevation of cassava’s protein content could play a crucial role in the fight against

PEM.

Figure 1 Impact of improving protein content in cassava storage roots on Protein-Energy-Malnutrition (PEM) (FAO, 2005). Y-axes: energy gained from cassava per day in relation to total daily energy intake. X-Axes: PEM Severity calculated for a 75kg person as ratio of total daily protein intake to recommended daily intake of 1g protein /kg bodyweight /day. Most recent available data used (2003).

The Key-Problem: Low protein content High levels of cyanogenic glucosides like linamarin are present within the whole

plant which can trigger toxic responses in consumers (reviewed in Siritunga & Sayre,

2004). Thus proper processing is absolutely required to render cassava storage roots

and leaves edible. The large storage root provides a rich source for carbohydrates

but is low in vitamins and proteins (Fig. 2). Depending on cultivars, the protein

content in cassava storage roots ranges from below 1 to 5% (dry weight). The

nutritional value of this very low protein amount is further reduced by the particularly

low levels of the essential amino acids (EAA) lysine and leucine and of the sulfur-

containing EAA (SAAs) methionine and cysteine (Yeoh and Chew, 1977; Gomez and

Noma, 1986; Ngudi et al., 2002). According to the U.S. Department of Agriculture, a

60 kg person has to consume at least 1.3 kg cassava storage roots per day to meet

13

Figure 2 Fully developed cassava plant with its edible parts. Top: Leaves are relatively rich in protein but poor in terms of nutritionally relevant quantities. Bottom: Storage roots provide large amounts of carbohydrates but do not offer enough protein to consumers to meet minimum requirements. the recommended daily requirement of all essential amino acids (Fig. 4) (USDA,

2005). Regionally, cassava leaves are used as a dietary supplement for proteins and

vitamins (Eggum, 1970; Bokanga, 1994). The total protein content of leaves ranges

from 23 to 35% of dry weight (Yeoh and Chew, 1976; Yeoh and Paul, 1989;

Awoyinka et al., 1995). The non-essential amino acids alanine, aspartic acid and

glutamic acid are most prominent and account for more than 10% of the dry weight.

Also in leaves, the levels of EAAs lysine, leucine and histidine are low (Lancaster and

Brooks, 1983) and SAAs are limiting with a maximum amino acid score of 0.5

compared to the Food and Agriculture Organisation reference values (FAO, 1991;

Ngudi et al., 2003). With these amino acid contents, a 60 kg adult has to consume

140 to 211 g of raw cassava leaves per day to meet the minimum requirements for

limiting amino acids such as lysine, cysteine and methionine (Gomez and Noma,

1986; Friedman, 1996; Millward, 1999).

Prolonged cooking of cassava leaves is essential to minimize toxic

concentrations of emerging cyanide, but EAAs and SAA (such as cysteine) are

14

degraded during this processing. These oxidative processes generally effect the

nutritional quality of any food but in the case of cassava this is particularly detrimental

since cysteine is also required for the conversion of remaining dietary cyanide to

isothiocyanate by rhodanese in the detoxification process (Cliff et al., 1985; Rosling,

1994). To compensate for low EAA and SAA levels and loss during cooking

processing, more leaves need to be consumed. However, due to the fact that

cassava is cultivated for its storage roots, leaves can only be harvested every two to

three months without affecting storage root production significantly, which constrains

the amount of available leaves for consumption (Bokanga, 1994). In addition, the

short lifespan of cassava leaves, especially during the dry season, restrains the

usage of cassava leaves as a food source (El-Sharkawy et al., 1992). Recently, we

had successfully produced transgenic cassava showing prolonged leaf life by

cytokinin-mediated inhibition of leaf senescence (Zhang et al., unpublished data).

This technology may allow us to consume more leaves from cassava plants.

Although cassava leaves may serve as an important source of proteins, the

above described compositional and agricultural constraints make it impossible to

provide a sustained, adequate daily intake level of all essential amino acids, as long

as other high-protein sources such as meat, fish, or soybean are not readily available

for supplementation (Friedman, 1996; Ngudi et al., 2003).

Due to the genetic nature of cassava, classical breeding could not offer a

promising strategy to alleviate this problem. Recently, cassava transformation

technology has been developed in several laboratories (Taylor et al., 2004). In the

following discussion, we review several biotechnological strategies that could be

used to improve the nutritional value of cassava via transgenesis with a focus on

elevating protein levels and quality.

Exogenous storage proteins Because cassava roots have a low protein and EAA content in comparison with

other root crops, the identification of an endogenous protein with a typical storage

function is a challenging task. Various proteins involved in storage organ formation

have been already identified using sophisticated proteomics approaches (De Souza

et al., 2002; Zhang et al., 2003; De Souza et al., 2004; Sheffield et al., 2006).

Isolation of corresponding genes and promoters as well as unraveling of their

physiological functions will help to understand and possibly overcome the low protein

15

content. But so far endogenous storage proteins could not be pinpointed.

Consequently, strategies to overexpress and/or nutritionally optimize such proteins

(Wallace et al., 1988; e.g. De Clercq et al., 1990) or altering their relative expression

levels (Segal et al., 2003), as demonstrated in other crops, are not feasible for

cassava, yet. At present, expression of valuable storage proteins from other plants

appears to be the most practical strategy to accomplish nutritional biofortification of

cassava roots. Reliable transformation systems have been established in cassava for

this purpose (reviewed in Zhang and Gruissem, 2004).

Plant storage proteins Transfer and expression of heterologous plant storage proteins has been widely

applied already for improving protein quality in crop plants. When choosing a putative

storage protein for cassava storage roots, several important factors need to be

considered, such as allergenicity, nutritional value, stability and storability in target

tissues. For example, Acha (Digitaria exilis), commonly known as “hungry rice”,

contains several seed storage proteins with a particularly high SAA content that could

be used for nutritional enhancement of various crops (Delumen et al., 1993; Jideani,

1999). The sunflower seed albumin (SSA) could be a suitable candidate since it does

not show any allergenic effects and is rich in SAAs (Kortt et al., 1991). The gene has

been already transferred and expressed in narrow leaf lupin (Molvig et al., 1997), rice

endosperm (Hagan et al., 2003; Islam et al., 2005), and chickpea seeds (Chiaiese et

al., 2004). Surprisingly, transgenic plants showed no or only little increase in total

seed sulfur probably because grain legumes and cereals are able to modulate their

seed storage protein composition in response to sulfur and nitrogen availability

(reviewed in Tabe et al., 2002). The protein has not been tested yet in those crops

with larger starchy storage organs like tubers of potato and yam, or roots of sweet

potato and cassava and might be a putative storage protein for cassava storage

roots. Another promising seed storage protein is the nonallergenic amaranth seed

albumin (AmA1) from Amaranthus hypochondriacus. The protein exhibits AA scores

above 1.0 for all EAAs when compared to the standards of WHO (Raina and Datta,

1992) and has been already successfully expressed in the starchy tissue of potato

tubers (Chakraborty et al., 2000). An increase of total protein and of most EAAs up to

8 fold was observed in transgenic potato and, thus, its suitability as a heterologous

storage protein for cassava roots should be considered.

16

In addition, a number of storage proteins from starch-rich organs have been

identified and might prove useful such as patatin, sporamin and dioscorin (Shewry,

2003). Sporamin contributes to more than 80% of the total protein content in sweet

potato roots (Maeshima et al., 1985). No allergenicity has been reported for this

protein, thus making it a suitable candidate for cassava roots. Sporamin represents a

family of proteins that is composed of two major classes termed A and B, which differ

mainly in their protein mass. Sporamin A has a high content of sulfur-containing

EAAs with a score of more than 1.8 for SAAs (FAO, 1991). Nevertheless, its protein

score for lysine covers only 60% of FAO’s reference values for 2-5 year old children.

It was shown that the protein is active as Kunitz-type trypsin inhibitor with a protective

function for the plant against herbivores (Yeh et al., 1997; Ding et al., 1998; Cai et al.,

2003) and its expression is stimulated by wounding (Wang et al., 2002). The trypsin

inhibitor activity can be readily inactivated during heat processing (van den Hout et

al., 1998). Due to this property, sporamin could protect cassava cultivars, particularly

those with reduced levels of cyanogenic glucosides, as a potential pest deterrent

from pests like root weevils.

Another suitable protein candidate can be found in the tuberous storage organ of

yam. Dioscorin contributes to more than 80% of the total protein content (Conlan et

al., 1995). Its two subclasses A and B differ mainly in the presence or absence of a

single disulfide bond (Conlan et al., 1998). The protein size of dioscorin A and its

function as storage protein in yam tubers has been confirmed recently

(Gaidamashvili et al., 2004). Dioscorin has antioxidative properties (Hou et al., 2001)

with radical scavenging activity, which is similar to glutathione at the same protein

concentrations (Liu et al., 2004). Lysine is the only limiting amino acid in dioscorin

with an amino acid score of 0.9 (FAO, 1991). Because cassava and yam storage

organs show structural similarities, putative expression of this valuable protein in

cassava storage roots could provide a significant health benefit to consumers.

Proteins optimized for EAAs Although many storage proteins have been identified in plants, most of them

have an inadequate amino acid composition when compared to reference proteins

from e.g., egg, bovine milk, or beef (FAO, 1991; Millward, 1999). However, such

proteins could be adapted to human or animal nutritional needs by mutagenesis or

even by a complete re-design of novel proteins with a ratio of EAAs according to

17

WHO nutritional recommendations. Expression of such proteins in crop plants would

provide a safe and effective means to increase their nutritional value.

Such a kind of protein has been de novo designed, based on the structure of

maize zein proteins and optimized for human EAAs needs (Kim et al., 1992). After

design and DNA synthesis, this artificial storage protein (ASP1) has been shown to

be expressed in E. coli and tobacco at high levels. Recently, we reported expression

of ASP1 in cassava (Zhang et al., 2003), in which expression levels were higher in

leaves than in primary roots. While these plants did not show a significant increase in

total protein content in storage roots compared to the wild-type plants, post-

hydrolysis measurements revealed that the levels of amino acids like Hyp, Pro, and

Ser were increased and those of Asn, Ala, and Met were decreased. We concluded

that expression of ASP1 seems to have an indirect effect on AA metabolism because

of its high EAA content.

Interestingly, the semi-artificial storage protein “Zeolin”, a recombinant storage

protein constructed using maize γ-zein and bean phaseolin, could accumulate to very

high amounts in leaves of transgenic tobacco (Mainieri et al., 2004). This chimeric

storage protein complements the set of putative nutritionally optimized candidates,

hence, providing a new tool for genetic improvement of those crops which are

characterized by a low abundance of endogenous storage proteins.

Specific expression of EAA-optimized proteins Tissue specific expression, especially root-specific expression can be an

important aspect for nutritional improvement of cassava. Exclusive expression of the

transgene in storage roots would limit facultative side-effects on untargeted tissues,

therefore, resulting in a normal phenotype development of cassava plants.

The choice of the most suitable promoters is important for efficient expression of

EAA rich proteins in cassava storage roots. The most widely used promoter for

expression of genes in transgenic plants is the cauliflower CaMV 35S promoter,

which is strongly and constitutively expressed in most tissues (Odell et al., 1985).

Many cassava transformation vectors were constructed using this promoter for the

expression of reporter genes (e.g. Franche et al., 1991; Raemakers et al., 1996;

Zhang et al., 2000) and functional genes (Zhang et al., 2003; Siritunga et al., 2004).

Tissue-specific expression in cassava has been achieved in leaves with the cab1

promoter from Arabidopsis (Siritunga and Sayre, 2003), and in roots with a patatin

18

promoter from potato (Siritunga and Sayre, 2004). We have isolated two endogenous

cassava promoters from a genomic library after differential screening of a storage

root cDNA library with cassava leaf- and root-transcripts (Zhang et al., 2003).

Expression of the GUS gene under control of these promoters in transgenic cassava

plants showed that their activity is strongest in vascular tissues and in parenchyma

cells of storage roots. Their expression scenario suggests that they are important

candidates for regulating transgene expression in cassava storage roots.

The importance of subcellular targeting So far the expression of ASP1 is the only reported transgenic approach to

increase the nutritional value of cassava. If N- or C-terminal signal sequences for

subcellular targeting are fused to ASP1 it could most likely be deposited within their

corresponding organelles instead of cytosolic accumulation (Hadlington and

Denecke, 2000). Recently, an endogenous maize storage protein, which usually

accumulates within the ER, was targeted both to the cytosol and to the chloroplasts

using the transit peptide from tobacco ribulose bisphosphate carboxylase small

subunit (rbcS) (Bellucci et al., 2005). However, their data suggest that both locations

are rather unsuitable for accumulation of this protein. This is not the case in other

studies (Yang et al., 2005; Glenz et al., 2006). Furthermore, the vacuole (Streatfield

et al., 2003) or retention within the ER (Denecke et al., 1992; De Jaeger et al., 2002)

were suggested to be the best subcellular locations for storage proteins.

Based on information from the current literature, we believe that for expression of

an exogenous storage protein in cassava storage roots the most suitable subcellular

localization still needs to be determined empirically. We have already confirmed the

functionality of several signal sequences that target to plastids or vacuoles or trigger

ER retention in cassava BY2-like protoplasts (unpublished data) and are presently

testing whether localization to these compartments may increase protein levels in

cassava storage roots.

Engineering amino acid metabolism Protein accumulation in storage roots might not only depend on promoter

strength and protein stability but also on protein synthesis capacity. It is generally

assumed that low levels of certain free amino acids in cassava storage roots leads to

their low protein content. Therefore, engineering amino acid metabolism might offer

19

an alternative or additive strategy to promote storage protein expression in cassava

roots, thus finally resulting in increased protein content.

The aspartate family pathway Lysine, methionine and cysteine are limiting amino acids in cassava storage roots

(Ngudi et al., 2002) . These EAAs are synthesized via the aspartate family pathway

(Fig. 3). It has been proposed that certain key EAAs can be enriched by regulating

appropriate steps in the pathway through molecular engineering (Galili et al., 2005),

however, due to the complexity of the biochemical pathway no breakthrough has

been reported so far.

Figure 3 Aspartate metabolism pathway in planta. Not all enzymes and intermediates are shown. Used colours: EAAs (light yellow), negative feedback regulation (red), positive feedback regulation (green), metabolites (blue). Used abbreviations: aspartate kinase (AK), homoserine dehydrogenase (HSD), dihydrodipicolinate synthase (DHPS), threonine synthase (TS), cystathionine γ-synthase (CgS), S-adenosylmethionine synthetase (SAMS). * found in A. thaliana but not in S. tuberosum L.

20

Lysine biosynthesis is of primary interest in metabolic engineering. It requires the

formation of 2,3 dihydrodipicolinate from aspartate-β-semialdehyde by

dihydrodipicolinate synthase (DHPS) as illustrated in Fig. 3. This enzyme is lysine-

feedback sensitive and regulates lysine formation in plants (Galili, 1995). However,

DHPS from bacteria is less sensitive to lysine (Cohen and Saint-Girons, 1987) and

strategies could be developed to increase lysine levels in transgenic plants through

constitutive expression of the bacterial enzyme. Other approaches, such as inhibition

of key enzymes involved in lysine catabolism may also be considered (Capell and

Christou, 2004). The successful expression of bacterial DHPS has been reported for

several plants, but has not yet been attempted in cassava (Shaul and Galili, 1992;

Karchi et al., 1994; Falco et al., 1995; Mazur et al., 1999). Lysine levels could even

be increased by up to 100 fold, but this enormous lysine production triggered severe

phenotypic changes, e.g. an arrest of seed germination (Galili and Hofgen, 2002). To

solve this problem, plants with moderate DHPS expression could develop normally

(Zhu and Galili, 2003; Zhu and Galili, 2004). These data suggest that amino acid

levels in plants need to be carefully adjusted. A potential solution to boost lysine

accumulation without reduced fertility might be achieved with the co-expression of a

protein rich in lysine that serves in plants as a lysine sink (Keeler et al., 1997).

Biosynthesis of methionine is the second potential target for the engineering of

cassava’s aspartate family pathway. Similar to lysine, no research has been done in

cassava so far, but results from other plants are available and could be applicable to

cassava. The carbon skeleton for the sulfur-containing amino acids is derived from

the intermediate metabolite o-phospho-homoserine and hence from aspartate. The

sulfur-group is donated by cysteine, which is itself subjected to metabolic regulations

during its own biosynthesis from sulfate and serine. The methionine content in

cassava might be increased by modifying the speed of formation of the carbon

skeleton, as shown in potato (Nikiforova et al., 2002; Hesse et al., 2004), if sulfur

uptake (as SO42-), processing, and integration into the cysteine precursor is not rate-

limiting for methionine formation.

O-phospho-homoserine is also an intermediate in threonine synthesis (Bryan, 1980;

Anderson, 1990; Matthews, 1999; Galili and Hofgen, 2002). The substrate

competition between cystathionine γ-synthase and threonine synthase (TS) for the

common branch point intermediate (Fig. 3) can be used to redirect carbon flux in the

direction of methionine (Karchi et al., 1993; Galili, 1995). Reduction of threonine

21

synthase led to increased methionine levels in potato and Arabidopsis (Bartlem et al.,

2000; Zeh et al., 2001). The efficacy of this approach is compromised by the

feedback inhibition of cystathionine γ-synthase by methionine in Arabidopsis

(Nikiforova et al., 2002). Threonine synthase can be reduced directly with antisense

or RNAi approaches (Bartlem et al., 2000; Zeh et al., 2001) or indirectly by inhibiting

the production of S-adenosyl-methionine (SAM) from methionine (Boerjan et al.,

1994; Shen et al., 2002) since SAM strongly stimulates its activity (Curien et al.,

1996).

Potential applications Metabolic engineering of the aspartate pathway in cassava has not been

reported yet. To increase lysine accumulation, the DHPS strategy can be adapted to

cassava. At the same time, the inhibition of TS or SAMS coupled with a root-specific

expression has the potential to influence the pool size of free amino acids thus

increasing the nutritional value.

To minimize the chance of any phenotypic disorders in transgenic plants, a

synergistic biotechnological approach can be tested (Hesse et al., 2004). This means

that certain key steps in the aspartate metabolism are engineered to create a “push”

force into EAAs while at the same time some proteins with a high content of EAAs

are expressed to create a “pull” force on the pathway. This would eliminate the

negative effects associated with e.g. high lysine levels by packing and storing excess

lysine within appropriate proteins. For targeted interference with cassava amino acid

synthesis pathways, increased knowledge about the involved genes and proteins will

be required.

With ongoing research in cassava genomics, proteomics and metabolomics,

development of a strategy based on the modification of transcription factors becomes

possible in order to increase the pool of certain amino acids. The maize opaque-2

mutant (Schmidt et al., 1992) is a well-studied example for improving a plants

nutritional value by modifying its expression of a transcription factor which itself

controls the expression of endogenous storage proteins. This elegant approach

opens the opportunity to control several genes simultaneously with only one single

trigger.

22

Summary and outlook Cassava is a staple crop in tropical developing countries. Low protein content of

its storage roots can lead to qualitative Protein-Energy-Malnutrition (PEM) among

consumers in areas where their diet is based predominantly on cassava (as shown in

Fig. 1). Therefore, protein-improved cassava provides a useful tool in the fight

against PEM in these regions. To reach this goal, several biotechnological tools are

available for cassava. Firstly, expression or over-expression of plant derived storage

protein genes can be tested, from either cassava itself or other plants with similar

starch-rich organs like sweet potato or yam. Secondly, artificially designed proteins

with an optimized EAA composition should be considered, such as ASP1. By the

adaptation of optimized tissue-specific expression and intracellular targeting, the

protein content can be improved by at least 1%. This would reduce the minimal

amount of cassava that needs to be consumed to get all EAAs by up to 64% (Fig. 4).

Figure 4 Minimum amount of cassava storage roots that need to be consumed to obtain recommended levels of all EAAs (FAO, 1991; USDA, 2005). The proposed impact of transgenic cassava on available EAA levels is visible at moderate and elevated levels of ASP1. As comparison protein-values for egg and beef are shown.

As a final option, a combined approach of storage protein expression, cellular

targeting and metabolic engineering of key enzymes of the aspartate pathway like

DHPS, TS, or SAMS might even lead to cassava storage roots with levels of up to

5% dry weight. These levels are already present in some South American cassava

23

cultivars and would reduce the threshold by even 86% to a minimal amount of 150g

cassava per day that needs to be consumed to be not deficient (Fig. 4).

As a consequence, cassava biotechnology has the potential to reduce PEM

severity e.g. in Democratic Republic of Congo from 67% to 18% and in Sub-Sahara

Africa (average) from 29% to 12% (compare to Fig. 1) thus helping consumers to

approach recommended daily protein intake levels.

Acknowledgements We thank Dr. Johannes Fütterer for helpful discussions. This work was funded by

a grant from the Bill & Melinda Gates Foundation through the Grand Challenges in

Global Health Initiative and by a grant from the Swiss Centre for International

Agriculture (ZIL).

Literature cited Anderson JW (1990) Sulfur metabolism in plants. In B Miflin, P Lea, P Conn, W

Stumpf, eds, Biochemistry of Plants, Vol 16. Academic Press, San Diego, pp 327-381

Awoyinka AF, Abegunde VO, Adewusi SR (1995) Nutrient content of young cassava leaves and assessment of their acceptance as a green vegetable in Nigeria. Plant Foods for Human Nutrition 47: 21-28

Bartlem D, Lambein I, Okamoto T, Itaya A, Uda Y, Kijima F, Tamaki Y, Nambara E, Naito S (2000) Mutation in the threonine synthase gene results in an over-accumulation of soluble methionine in Arabidopsis. Plant Physiology 123: 101-110

Bellucci M, De Marchis F, Mannucci R, Bock R, Arcioni S (2005) Cytoplasm and chloroplasts are not suitable subcellular locations for beta-zein accumulation in transgenic plants. Journal of Experimental Botany 56: 1205-1212

Boerjan W, Bauw G, Van Montagu M, Inze D (1994) Distinct phenotypes generated by overexpression and suppression of S-adenosyl-L-methionine synthetase reveal developmental patterns of gene silencing in tobacco. Plant Cell 6: 1401-1414

Bokanga M (1994) Processing of Cassava Leaves for Human Consumption. Acta Horticulturae 375: 203-208

Bryan J (1980) Synthesis of the aspartate family and branched-chain amino acids. In B Miflin, ed, The biochemistry of plants: a comprehensive treatise, Vol 5. Academic Press, New York, p 403–452

Cai DG, Thurau T, Tian YY, Lange T, Yeh KW, Jung C (2003) Sporamin-mediated resistance to beet cyst nematodes (Heterodera schachtii Schm.) is dependent on trypsin inhibitory activity in sugar beet (Beta vulgaris L.) hairy roots. Plant Molecular Biology 51: 839-849

Capell T, Christou P (2004) Progress in plant metabolic engineering. Current Opinion in Biotechnology 15: 148-154

Chakraborty S, Chakraborty N, Datta A (2000) Increased nutritive value of transgenic potato by expressing a nonallergenic seed albumin gene from

24

Amaranthus hypochondriacus. Proceedings of the National Academy of Sciences of the United States of America 97: 3724-3729

Chiaiese P, Ohkama-Ohtsu N, Molvig L, Godfree R, Dove H, Hocart C, Fujiwara T, Higgins TJ, Tabe LM (2004) Sulphur and nitrogen nutrition influence the response of chickpea seeds to an added, transgenic sink for organic sulphur. Journal of Experimental Botany 55: 1889-1901

Cliff J, Lundqvist P, Martensson J, Rosling H, Sorbo B (1985) Association of high cyanide and low sulphur intake in cassava-induced spastic paraparesis. Lancet 2: 1211-1213

Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762

Cohen GN, Saint-Girons I (1987) Biosynthesis of threonine, lysine and methionine. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society of Microbiology, Washington, pp 429-444

Conlan RS, Griffiths LA, Napier JA, Shewry PR, Mantell S, Ainsworth C (1995) Isolation and Characterization of Cdna Clones Representing the Genes Encoding the Major Tuber Storage Protein (Dioscorin) of Yam (Dioscorea-Cayenensis Lam). Plant Molecular Biology 28: 369-380

Conlan S, Griffiths LA, Turner M, Fido R, Tatham A, Ainsworth C, Shewry P (1998) Characterisation of the yam tuber storage protein dioscorin. Journal of Plant Physiology 153: 25-31

Curien G, Dumas R, Ravanel S, Douce R (1996) Characterization of an Arabidopsis thaliana cDNA encoding an S-adenosylmethionine-sensitive threonine synthase. Threonine synthase from higher plants. FEBS Letters 390: 85-90

De Clercq A, Vandewiele M, Van Damme J, Guerche P, Van Montagu M, Vandekerckhove J, Krebbers E (1990) Stable accumulation of modified 2S albumin seed storage proteins with higher methionine contents in transgenic plants. Plant Physiology 94: 970-979

De Jaeger G, Scheffer S, Jacobs A, Zambre M, Zobell O, Goossens A, Depicker A, Angenon G (2002) Boosting heterologous protein production in transgenic dicotyledonous seeds using Phaseolus vulgaris regulatory sequences. Nature Biotechnology 20: 1265-1268

De Souza CR, Carvalho LJ, De Almeida ER, Gander ES (2002) Towards the identification of cassava root protein genes. Plant Foods for Human Nutrition 57: 353-363

De Souza CR, Carvalho LJ, de Mattos Cascardo JC (2004) Comparative gene expression study to identify genes possibly related to storage root formation in cassava. Protein and Peptide Letters 11: 577-582

Delumen BO, Thompson S, Odegard WJ (1993) Sulfur Amino Acid-Rich Proteins in Acha (Digitaria-Exilis), a Promising Underutilized African Cereal. Journal of Agricultural and Food Chemistry 41: 1045-1047

Denecke J, De Rycke R, Botterman J (1992) Plant and mammalian sorting signals for protein retention in the endoplasmic reticulum contain a conserved epitope. EMBO Journal 11: 2345-2355

Ding LC, Hu CY, Yeh KW, Wang PJ (1998) Development of insect-resistant transgenic cauliflower plants expressing the trypsin inhibitor gene isolated from local sweet potato. Plant Cell Reports 17: 854-860

Eggum BO (1970) Protein Quality of Cassava Leaves. British Journal of Nutrition 24: 761-768

25

El-Sharkawy MA, Hernandez AD, Hershey C (1992) Yield Stability of Cassava During Prolonged Mid-Season Water-Stress. Experimental Agriculture 28: 165-174

Falco SC, Guida T, Locke M, Mauvais J, Sanders C, Ward RT, Webber P (1995) Transgenic Canola and Soybean Seeds with Increased Lysine. Bio-Technology 13: 577-582

FAO (1991) Protein quality evaluation. Joint FAO/WHO. FAO Food and Nutrition Paper 51: 1-66

FAO (2004) Agricultural biotechnology Meeting the needs of the poor? Food and Agriculture Organization of the United Nations FAO, Rome

FAO (2005) FAOSTAT data. In, Vol 2006 Franche C, Bogusz D, Schopke C, Fauquet C, Beachy RN (1991) Transient Gene-

Expression in Cassava Using High-Velocity Microprojectiles. Plant Molecular Biology 17: 493-498

Friedman M (1996) Nutritional value of proteins from different food sources. A review. Journal of Agricultural and Food Chemistry 44: 6-29

Gaidamashvili M, Ohizumi Y, Iijima S, Takayama T, Ogawa T, Muramoto K (2004) Characterization of the yam tuber storage proteins from Dioscorea batatas exhibiting unique lectin activities. Journal of Biological Chemistry 279: 26028-26035

Galili G (1995) Regulation of Lysine and Threonine Synthesis. Plant Cell 7: 899-906 Galili G, Amir R, Hoefgen R, Hesse H (2005) Improving the levels of essential

amino acids and sulfur metabolites in plants. Biological Chemistry 386: 817-831 Galili G, Hofgen R (2002) Metabolic engineering of amino acids and storage

proteins in plants. Metabolic Engineering 4: 3-11 Glenz K, Bouchon B, Stehle T, Wallich R, Simon MM, Warzecha H (2006)

Production of a recombinant bacterial lipoprotein in higher plant chloroplasts. Nature Biotechnology 24: 76-77

Gomez G, Noma AT (1986) The Amino-Acid-Composition of Cassava Leaves, Foliage, Root Tissues and Whole-Root Chips. Nutrition Reports International 33: 595-601

Hadlington JL, Denecke J (2000) Sorting of soluble proteins in the secretory pathway of plants. Current Opinion in Plant Biology 3: 461-468

Hagan ND, Upadhyaya N, Tabe LM, Higgins TJ (2003) The redistribution of protein sulfur in transgenic rice expressing a gene for a foreign, sulfur-rich protein. Plant Journal 34: 1-11

Hesse H, Kreft O, Maimann S, Zeh M, Hoefgen R (2004) Current understanding of the regulation of methionine biosynthesis in plants. Journal of Experimental Botany 55: 1799-1808

Hou WC, Lee MH, Chen HJ, Liang WL, Han CH, Liu YW, Lin YH (2001) Antioxidant activities of dioscorin, the storage protein of yam (Dioscorea batatas Deene) tuber. Journal of Agricultural and Food Chemistry 49: 4956-4960

Islam N, Upadhyaya NM, Campbell PM, Akhurst R, Hagan N, Higgins TJ (2005) Decreased accumulation of glutelin types in rice grains constitutively expressing a sunflower seed albumin gene. Phytochemistry 66: 2534-2539

Jideani IA (1999) Traditional and possible technological uses of Digitaria exilis (acha) and Digitaria iburua (iburu): a review. Plant Foods for Human Nutrition 54: 363-374

26

Karchi H, Shaul O, Galili G (1993) Seed-Specific Expression of a Bacterial Desensitized Aspartate Kinase Increases the Production of Seed Threonine and Methionine in Transgenic Tobacco. Plant Journal 3: 721-727

Karchi H, Shaul O, Galili G (1994) Lysine Synthesis and Catabolism Are Coordinately Regulated During Tobacco Seed Development. Proceedings of the National Academy of Sciences of the United States of America 91: 2577-2581

Keeler SJ, Maloney CL, Webber PY, Patterson C, Hirata LT, Falco SC, Rice JA (1997) Expression of de novo high-lysine alpha-helical coiled-coil proteins may significantly increase the accumulated levels of lysine in mature seeds of transgenic tobacco plants. Plant Molecular Biology 34: 15-29

Kim J, Cetiner S, Jaynes JM (1992) Enhancing the nutritional quality of crop plants: design, contruction and expression of an artificial plant storage protein gene. In D Bhatnagar, TE Cleveland, eds, Molecular approaches to improving food quality and safety. Van Nostrand Reinhold, New York, pp 1-36

Kortt AA, Caldwell JB, Lilley GG, Higgins TJ (1991) Amino acid and cDNA sequences of a methionine-rich 2S protein from sunflower seed (Helianthus annuus L.). European Journal of Biochemistry 195: 329-334

Lancaster PA, Brooks JE (1983) Cassava Leaves as Human Food. Economic Botany 37: 331-348

Liu DZ, Lin YS, Hou WC (2004) Monohydroxamates of aspartic acid and glutamic acid exhibit antioxidant and angiotensin converting enzyme inhibitory activities. Journal of Agricultural and Food Chemistry 52: 2386-2390

Maeshima M, Sasaki T, Asahi T (1985) Characterization of Major Proteins in Sweet-Potato Tuberous Roots. Phytochemistry 24: 1899-1902

Mainieri D, Rossi M, Archinti M, Bellucci M, De Marchis F, Vavassori S, Pompa A, Arcioni S, Vitale A (2004) Zeolin. A new recombinant storage protein constructed using maize gamma-zein and bean phaseolin. Plant Physiology 136: 3447-3456

Matthews B (1999) Lysine, threonine, and methionine biosynthesis. In B Singh, ed, Plant Amino Acids: Biochemistry and Biotechnology. Marcel Dekker, New York, pp 205-225

Mazur B, Krebbers E, Tingey S (1999) Gene discovery and product development for grain quality traits. Science 285: 372-375

Millward DJ (1999) The nutritional value of plant-based diets in relation to human amino acid and protein requirements. Proceedings of the Nutrition Society 58: 249-260

Molvig L, Tabe LM, Eggum BO, Moore AE, Craig S, Spencer D, Higgins TJV (1997) Enhanced methionine levels and increased nutritive value of seeds of transgenic lupins (Lupinus angustifolius L) expressing a sunflower seed albumin gene. Proceedings of the National Academy of Sciences of the United States of America 94: 8393-8398

Ngudi DD, Kuo YH, Lambein F (2002) Food safety and amino acid balance in processed cassava "Cossettes". Journal of Agricultural and Food Chemistry 50: 3042-3049

Ngudi DD, Kuo YH, Lambein F (2003) Amino acid profiles and protein quality of cooked cassava leaves or 'saka-saka'. Journal of the Science of Food and Agriculture 83: 529-534

Nikiforova V, Kempa S, Zeh M, Maimann S, Kreft O, Casazza AP, Riedel K, Tauberger E, Hoefgen R, Hesse H (2002) Engineering of cysteine and methionine biosynthesis in potato. Amino Acids 22: 259-278

27

Odell JT, Nagy F, Chua NH (1985) Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313: 810-812

Raemakers CJJM, Sofiari E, Taylor N, Henshaw G, Jacobsen E, Visser RGF (1996) Production of transgenic cassava (Manihot esculenta Crantz) plants by particle bombardment using luciferase activity as selection marker. Molecular Breeding 2: 339-349

Raina A, Datta A (1992) Molecular cloning of a gene encoding a seed-specific protein with nutritionally balanced amino acid composition from Amaranthus. Proceedings of the National Academy of Sciences of the United States of America 89: 11774-11778

Rosling H (1994) Measuring effects in humans of dietary cyanide exposure from cassava. Acta Horticulturae 375: 271-284

Schmidt RJ, Ketudat M, Aukerman MJ, Hoschek G (1992) Opaque-2 Is a Transcriptional Activator That Recognizes a Specific Target Site in 22-Kd-Zein Genes. Plant Cell 4: 689-700

Segal G, Song R, Messing J (2003) A new opaque variant of maize by a single dominant RNA-interference-inducing transgene. Genetics 165: 387-397

Shaul O, Galili G (1992) Increased Lysine Synthesis in Tobacco Plants That Express High-Levels of Bacterial Dihydrodipicolinate Synthase in Their Chloroplasts. Plant Journal 2: 203-209

Sheffield J, Taylor N, Fauquet C, Chen S (2006) The cassava (Manihot esculenta Crantz) root proteome: Protein identification and differential expression. Proteomics

Shen B, Li C, Tarczynski MC (2002) High free-methionine and decreased lignin content result from a mutation in the Arabidopsis S-adenosyl-L-methionine synthetase 3 gene. Plant Journal 29: 371-380

Shewry PR (2003) Tuber storage proteins. Annals of Botany 91: 755-769 Siritunga D, Arias-Garzon D, White W, Sayre RT (2004) Over-expression of

hydroxynitrile lyase in transgenic cassava roots accelerates cyanogenesis and food detoxification. Plant Biotechnology Journal 2: 37-43

Siritunga D, Sayre R (2004) Engineering cyanogen synthesis and turnover in cassava (Manihot esculenta). Plant Molecular Biology 56: 661-669

Siritunga D, Sayre RT (2003) Generation of cyanogen-free transgenic cassava. Planta 217: 367-373

Streatfield SJ, Lane JR, Brooks CA, Barker DK, Poage ML, Mayor JM, Lamphear BJ, Drees CF, Jilka JM, Hood EE, Howard JA (2003) Corn as a production system for human and animal vaccines. Vaccine 21: 812-815

Tabe L, Hagan N, Higgins TJ (2002) Plasticity of seed protein composition in response to nitrogen and sulfur availability. Current Opinion in Plant Biology 5: 212-217

Taylor N, Chavarriaga P, Raemakers K, Siritunga D, Zhang P (2004) Development and application of transgenic technologies in cassava. Plant Molecular Biology 56: 671-688

USDA (2005) U.S. Department of Agriculture, Agricultural Research Service. National Nutrient Database for Standard Reference, Release 18. In Nutrient Data Laboratory Home Page, http://www.nal.usda.gov/fnic/foodcomp,

van den Hout R, Pouw M, Gruppen H, van't Riet K (1998) Inactivation Kinetics Study of the Kunitz Soybean Trypsin Inhibitor and the Bowman-Birk Inhibitor. Journal of Agricultural and Food Chemistry 46: 281-285

28

Wallace JC, Galili G, Kawata EE, Cuellar RE, Shotwell MA, Larkins BA (1988) Aggregation of lysine-containing zeins into protein bodies in Xenopus oocytes. Science 240: 662-664

Wang SJ, Lan YC, Chen SF, Chen YM, Yeh KW (2002) Wound-response regulation of the sweet potato sporamin gene promoter region. Plant Molecular Biology 48: 223-231

Yang J, Barr LA, Fahnestock SR, Liu ZB (2005) High yield recombinant silk-like protein production in transgenic plants through protein targeting. Transgenic Research 14: 313-324

Yeh KW, Lin MI, Tuan SJ, Chen YM, Lin CY, Kao SS (1997) Sweet potato (Ipomoea batatas) trypsin inhibitors expressed in transgenic tobacco plants confer resistance against Spodoptera litura. Plant Cell Reports 16: 696-699

Yeoh HH, Chew MY (1976) Protein-Content and Amino-Acid Composition of Cassava Leaf. Phytochemistry 15: 1597-1599

Yeoh HH, Chew MY (1977) Protein content and acid composition of cassava seed and tuber. Malaysian Agricultural Journal 51: 1-6

Yeoh HH, Paul K (1989) Variation in Leaf Protein Contents and Amino-Acid Compositions of Cassava Cultivars. Biochemical Systematics and Ecology 17: 199-202

Zeh M, Casazza AP, Kreft O, Roessner U, Bieberich K, Willmitzer L, Hoefgen R, Hesse H (2001) Antisense inhibition of threonine synthase leads to high methionine content in transgenic potato plants. Plant Physiology 127: 792-802

Zhang P, Bohl-Zenger S, Puonti-Kaerlas J, Potrykus I, Gruissem W (2003) Two cassava promoters related to vascular expression and storage root formation. Planta 218: 192-203

Zhang P, Gruissem W (2004) Production of transgenic cassava (Manihot esculenta Crantz). In Transgenic Crops of the World - Essential Protocols. Curtis, Ian S., pp 301-319

Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250

Zhang P, Legris G, Coulin P, Puonti-Kaerlas J (2000) Production of stably transformed cassava plants via particle bombardment. Plant Cell Reports 19: 939-945

Zhu X, Galili G (2003) Increased lysine synthesis coupled with a knockout of its catabolism synergistically boosts lysine content and also transregulates the metabolism of other amino acids in Arabidopsis seeds. Plant Cell 15: 845-853

Zhu XH, Galili G (2004) Lysine metabolism is concurrently regulated by synthesis and catabolism in both reproductive and vegetative tissues. Plant Physiology 135: 129-136

29

Aims of the thesis The aim of the research was to increase the total protein content in cassava storage

roots via the expression of ASP1 (an artificial storage protein based on the structure

of a maize zein protein that has an increased content of essential amino acids) and

sporamin (storage protein of sweet potato) in cassava. Despite the considerable

importance regarding protein malnutrition in developing countries, there is only

sparse information and scientific data pertaining to strategies aimed at relieving the

problem. The use of biotechnological applications was deemed a key approach and

used as the basis of my research.

Cassava plants transformed with ASP1 as part of an earlier investigation were

analysed using molecular and biochemical techniques to identify and quantify

changes in protein and amino acid content in leaves and storage roots compared

with untransformed plants. This study formed a vital platform for our understanding of

the effect of introduced storage protein genes in cassava. This data further enabled

experiments for ASP1 and sporamin to be coupled to targeting signals to direct

protein accumulation in plastids, vacuoles and the endoplasmic reticulum in

transformed cassava. To supplement this work, visualisation of the accumulation

patterns was achieved through the development of a cassava protoplast

transformation assay that used fluorescently labelled transgenes. In addition,

transformation vectors that comprised the endogenous cassava promoter p54/1.0

were designed to explore the root expression potential of the promoter. Storage root

composition was quantified using amino acid analyzing techniques. The sum of these

aims and experiments provides a significant advancement in tackling the problems

associated with protein malnutrition.

30

VI. X-ray fluorescence spectroscopy as a new method to determine sulfur amino acids in cassava storage roots

Target Journal: Journal of Food Composition and Analysis Authors: Stupak M, Gruissem W, Zhang P

Abstract Cassava is the fifth most important staple crop in the world. Therefore, improvement

of its nutritional quality will be of great importance. Especially the enhancement of

protein quantity and quality in storage roots of this crop is currently a major target in

cassava research programs. In this context reliable determination of protein and

amino acid composition is required to determine the impact of improved varieties.

Here we demonstrate that determination of sulfur amino acids (SAA) using

conventional ion exchange chromatography without pre-oxidation results in a

significant underestimation of their amount in cassava. We therefore developed an

efficient and reliable alternative method based on X-ray fluorescence spectroscopy

(XRFS). Applying this method to cassava revealed 4-8 times higher levels of SAA

than previously reported. We propose that XRFS should be used in the cassava

community to facilitate the assessment of the nutritional value of cassava storage

roots.

Introduction Cassava (Manihot esculenta Crantz) is the most important staple crop of the tropics

and is mainly appreciated by farmers and consumers for its flexible harvesting time

and its high tolerance to drought and poor soil conditions (Cock, 1982). More than

600 million people rely on it as a staple food source (FAO, 2005) since it serves as

an excellent famine reserve particularly for subsistence farmers in sub-Saharan

African countries (FAO, 2004). Unfortunately, protein levels in cassava storage roots

are extremely low, which reduces the nutritional value of this food source. True

protein contents, meaning the sum of all amino acids, range from below 1 to 5% (dry

weight) depending on the cultivar. In particular lysine, leucine and the sulfur-

containing essential amino acids methionine and cysteine are limiting. Reliable

measurements of these amino acids are crucial for the assessment of the nutritional

31

value of cassava cultivars and the evaluation of approaches for its improvement

(Yeoh and Chew, 1977; Gomez and Noma, 1986; Ngudi et al., 2002).

In order to define the protein and amino acid composition in cassava storage roots

robust results are needed that take biological variation into account. Within this paper

the magnitude of biological variation in cassava was determined and discussed for

the first time by analysing leaves and storage roots of cassava plants from both

transgenic and non transgenic background (Zhang et al., 2003). For this purpose

samples were harvested at two time-points in order to identify time-dependent

changes. Consequently, this illustrated the importance of multiple sample analysis to

compensate for biological variation.

The reliable measurement of methionine and cysteine, the carriers of organic sulfur

in cassava storage roots, is particularly demanding. Two cysteine monomers

additionally can be oxidised to a sulphide-bridged dimer called cystine. Chemical

stability of many amino acid monomers during analysis is rather low due to non-

quantitative oxidation or acidic degradation. Thus SAA currently need to be indirectly

quantified in amino acid analysis via their oxidation products methionine sulfoxide,

methionine sulfone, and cysteic acid (AOAC, 1997). However, this method requires a

separate oxidation step using performic acid which doubles the costs of analysis and

the method can be subject to variation coefficients exceeding 20% (Parvy et al.,

1993). For this reason, a new routine screening method based on X-ray fluorescence

spectroscopy (XRFS) was evaluated here for its reproducibility and usefulness.

Material and Methods Plant Material Cassava plants of cultivar TMS60444 (Nig11) and of transgenic lines expressing an artificial storage protein (Zhang et al., 2003) were used in this study. For mature leaf analysis 3 week old in vitro plants were transferred to soil and grown in a growth chamber at constant conditions for 3 months (30º C, 80-90% humidity, 100.000 Lux, Day/Night Cyclus: 16/8h). After three months all leaves of transgenic ASP1 cassava lines 1-5 (n=2), 1-8 (n=3), 1-13 (n=3), 1-11 (n=7), and wildtype TMS60444 (n=3) were collected, pooled for each plant, and analyzed for their protein and amino acid content. Cassava storage roots were harvested from greenhouse grown plants after 16 and 26 months. At the first time-point transgenic ASP1 cassava lines 1-1, 1-3, 1-5, 1-8, 1-11, and 1-13 were harvested (n=2 each), at the second time point lines 1-1 (n=2), 1-3 (n=2), 1-5 (n=2), 1-8 (n=3), 1-11 (n=3), 1-13 (n=3), 1-16 (n=2) and wildtype plants (n=3) were harvested and prepared for amino acid analysis. For spiking experiments one wildtype plant (35R6) was harvested after 12 month. One cassava plant was grown in Ivory Coast under field conditions for 15 months (F35R1). Three of its storage roots were harvested and a central, lateral cut of each root was prepared for amino acid analysis.

32

More transgenic cassava plants of lines 1-11, RV3-R1, RV3-R6, and RV9-R5 were harvested after 5 months growth in the green-house (n=2 each) together with WT plants (n=3) and their storage roots were prepared for amino acid analysis. Amino Acid Analysis Storage roots were peeled at the root cortex, sliced and freeze-dried for 24h while leaves were lyophilized directly. All plant material was ground afterwards to a homogenous powder and stored at -80◦C until use. Samples containing 1mg total protein were weighed and hydrolyzed with 2ml of 6M HCl for 24h at 110◦C in an oil bath using Argon as inert gas. After hydrolysis samples were evaporated (Rotavapor, BÜCHI Labortechnik AG, Switzerland) at ≤ 50°C, resuspended in 5ml sample buffer (0.16M Li-acetate-buffer, pH 2.20; No. 5.403.047, Laborservice Onken GmbH, Gründau-Breitenborn, Germany) and filtered through a 0.45-µm PVDF membrane (Millipore AG, Switzerland). 50µl of the solution were injected into an automated Biochrom30 Analyser (Laborservice Onken) and separated afterwards by ion exchange chromatography (Lithium High Resolution Column, 4.0x125mm, No. 5.503.611, Laborservice Onken) based on a 5 buffer system. Following separation, amino acids were derivatized with ninhydrin and detected at 570nm and 440nm. Quantification was based on external standards (Cat-No. 20088ZZ, Pierce, Perbio Science Switzerland SA, Lausanne, Switzerland) consisting of a mixture of 5.0nmol of each amino acid in 50µl loading buffer. Each analysis was performed with two technical replicates and several biological replicates (as described in section “plant material“). Spiking Experiment 50mg of pure methionine (Sigma-Aldrich Chemie GmbH, Switzerland) was weighed exactly in a 50ml volumetric flask which was filled with 6M HCl (25◦C). This solution (c=1mg/ml) was diluted 40x using the same solvent (c=25µg/ml). From the latter solution 2ml, 1ml, and 0.2ml were used for amino acid hydrolysis and spiked samples were treated as above. For XRFS, 5mg methionine and 5mg cysteine (Sigma-Aldrich Chemie GmbH, Switzerland) were added to 10g pure cellulose powder (Merck KgaA, Darmstadt, Germany). Powder was mixed in a mortar and treated as described below. XRFS Sample and standard treatment was mainly performed according to (Pinkerton et al., 1989). Pure cysteine (Sigma-Aldrich Chemie GmbH, Switzerland) was dissolved in water (c=20mg/ml). Amounts equivalent to 10, 50, 100, 200, and 500mg/kg sulfur were pipetted to 10g cellulose powder. The damp powder was shaken thoroughly and freeze-dried overnight. 10g of each reference powder and cassava sample powder were weighed exactly into a beaker. 2ml of a 10% Elvacite solution dissolved in acetone (ICI Acrylics Inc, Cordova, USA) was added in four parts of 500µl each. After addition of each part powder was stirred with a thick glass rod until acetone had evaporated. Dried powders were compressed to pills using a hydraulic press (400bar, 1min) and stored in an exsiccator until use. For analysis a wave-length dispersive X-ray fluorescence spectrometer (WD-XRF, Axios, PANalytical B.V., The Netherlands) was used (Start:110.000°0.535nm, End:111.500°0.540nm, Step width:0.002°, Time/point: 2.00s, Scan speed: 0.001°/s, Intensity: 0.1-1.9kcps, kV:24, mA:100, Collimator.:1/150µm, X-tal:Ge, Order:1, 2d:0.6532nm, Detector:Flow, Pulse height distribution (PHD) levels:25-75). Data was analyzed using Microsoft Excel and final values at wavelengths of interest (SKα lines) were obtained by averaging corresponding intervals ±0.010°. In order to calibrate our instrument a sample containing 1% sulfur (as pure cysteine from above) in oxidation state 6+ (S6+) was measured and found to have a fluorescence intensity maximum at 110.655 º2θ. The corresponding sample with 1% carbon-bonded sulfur (SC, as pure Na2SO4, Sigma-Aldrich Chemie GmbH, Switzerland) peaked at 110.745 º2θ. Measuring count rates at these two SKα lines in both samples resulted in background noise factors k1=0.743 and k2=0.838 that were subsequently used in order to calculate the true part of the

33

signal of carbon-bonded sulfur in all samples of interest (Table 2). A linear calibration line was established between 10-500mg/kg SC (r2=0.993) and reliability was confirmed in an F-test (α<0.01) and t-test (α<0.001).

Results

The magnitude of biological variation In a previous analysis of transgenic plants we reported significant changes in levels

of certain amino acids but not in total protein in leaves of plants grown in vitro (Zhang

et al., 2003). Here we extended this analysis using conventional ion-exchange

chromatography to a larger sample set of mature leaves of greenhouse grown plants

and could show that biological variation is too large to detect any differences

between lines, no matter if they were transgenic or not (p>0.05). The average protein

content of all 18 biological samples was 8.8(±1.4)g per 100g dried leaf material

corresponding to 16% variation (Table 1). Levels of most amino acids varied between

15% and 20%. Three amino acids varied exceptionally high, methionine (25%),

cystine (44%), and hydroxyproline (146%), respectively.

In order to extend the experiment to storage roots 18 plants of several transgenic and

non transgenic cassava lines were harvested and their amino acid profile was

determined after a growth period of 26 months in the greenhouse (the sum of all 18

plants was referred to as “set 1”). Differences between individual lines in protein or

amino acid content were not significant (p>0.05). Interestingly, the average protein

content of set 1 was measured to be 0.55(±0.08)g per 100g dried cassava flour which

is lower than expected. This variation of 14% is comparable to protein variation in

leaves (see above). Levels of most amino acids in roots were determined with

variation coefficients between 13% and 25% (Table 1). Again, three amino acids

varied considerably, methionine (35%), cystine (61%), and hydroxyproline (77%).

We concluded that biological variation can explain minor differences between

independent lines in leaves and roots for both true protein and most individual amino

acids. Exceptionally high variation was observed in particular in sulfur amino acids

and hydroxyproline when using conventional amino acid determination.

34

Time-dependent changes By extending our experiment to a temporal parameter we wanted to find out if

biological variation is different at an earlier time-point and if absolute values of protein

and amino acids remain constant. For this purpose 12 more storage roots (set 2)

were harvested at the age of 16 months (Table 1). We measured in set 2

0.94(±0.21)g total protein in 100g flour of storage roots corresponding to 22%

variation thus being slightly higher than variation in set 1. Most amino acids were

quantified with variation coefficients between 12% and 30% resulting in a biological

variation comparable to set 1. Here values of three amino acids showed significantly

higher variation than the others such as hydroxyproline (37%), arginine (74%), and

methionine (88%). Cystine was not detectable in any sample of set 2.

Regarding absolute values for total protein content as well as for most amino acids

set 2 differed significantly from set 1 (Figure 1). For protein we found an increase of

42% (p<0.001) compared to set 1 while most amino acids were increased by 14-

35%. Only aspartate/asparagine, glutamate/glutamine, arginine and histidine were

increased strongly by 42-81% in set 2.

Biological variation does not seem to be considerably affected by the age of cassava

storage roots. We could show that in particular methionine is difficult to quantify and

that cystine levels are probably below detection limits in younger storage roots.

External supplementation of methionine was considered in order to determine the

extent of destroyed methionine.

Recovery of methionine in spiked samples Methionine quantification without performic acid pre-oxidation led not only to a high

biological variation between plants but also to large technical errors when analysing

the sample repeatedly. These errors between analytical duplicates ranged from 1-

87% of each mean value thus weakening reliability of the measured result. The

lowest level of methionine determined in a single sample was 0.94mg/100g sample

while the highest was 15mg/100g sample (individual samples not shown). The

difference of average methionine content in set 1 [4.19(±1.49)mg/100g sample] was

not significant (p>0.05) compared to set 2 [4.83(±4.26)mg/100g sample] because

35

both confidence intervals were too large (α=0.05) which makes it impossible to detect

small but significant differences between sample groups.

In order to evaluate the reliability of methionine quantification based on the standard

protocol, one cassava storage root sample (35R6) was spiked with pure methionine

before acid hydrolysis in amounts of 5, 25, and 50mg per 100g sample. In the

unspiked sample 5.90(±1.38)mg methionine per 100g sample were found. After

addition of 5, 25 and 100mg methionine only 2.53(±0.97)mg, 12.05(±3.96)mg and

37.55(±1.84)mg per 100g sample, respectively, could be recovered. Thus recovery

rates of methionine were calculated as 23%, 39%, and 67%. As a consequence the

calculation of a correction factor seems inappropriate, in particular at low methionine

concentrations, and would require more points of measurement and repetitions.

Alternative determination of sulfur amino acids As an alternative to the standard protocol, we used X-Ray Fluorescence

Spectrometry (XRFS) for a spectroscopic and non-destructive determination of sulfur

amino acids in cassava storage roots thus bypassing partial degradation in acid

hydrolysis. The system required calibration of the instrument (see Material and

Methods) and measured carbon-bonded sulfur in powder pills made of cassava flour

which has been shown to correlate directly to sulfur present in methionine, cysteine,

and cystine (Pinkerton et al., 1989).

Root sample 35R6 which was previously used for spiking experiments was spiked

here, too, with 50mg methionine and 50mg cysteine per 100g sample and revealed a

recovery rate exceeding 90%. Compared to the previously determined SAA content

of sample 35R6 XRFS values were more than 5 times higher (Figure 2).

Another single sample (F35R1) contained 95mg/kg sulfur, which is equivalent to

40.28mg SAA in 100g sample, resulting in a value 8 times higher than previously

determined with conventional AAA.

Four more independent transgenic cassava lines (1-11, RV3-R1, RV3-R6, RV9-5)

and wildtype (WT) were measured as biological replicates in order to check for

variability of the method and its comparability to standard AAA. Errors between all

biological replicates of these lines (in above order) for SAA were decreased from 45,

5, 26, 45, and 43% to 13, 10, 4, 3 and 6% when subjecting the same samples first to

the standard protocol and then to XRFS (Figure 2). Remarkably, absolute SAA levels

36

calculated here from XRFS measured sulfur were 4-6 times higher than those levels

measured with standard AAA.

Our XRFS data suggests that true SAA levels might be much higher in cassava

samples than previously assumed and that with XRFS these values can be detected

and quantified reliably regardless which SAA is predominant.

Discussion We have adapted XRFS for a more accurate and reliable determination of SAA in a

large cassava sample set of cultivar TMS60444. Additionally, protein levels and

amino acids were determined and revealed the importance of biological variation in

cassava leaves and roots. Average protein contents measured in this study are

determined as sum of all individual amino acids obtained after acid hydrolysis

(AOAC, 1997). This method is seen as one of the most reliable ways of protein

determination in contrast to faster spectroscopic methods (Crabb et al., 1997; FAO,

2003). To date, studies have not applied uniformed standards for protein

determination, often opting to determine crude protein content using the Kjeldahl

Nitrogen method (Yeoh and Chew, 1977; Gomez and Noma, 1986; Velmurugu,

1993; Awoyinka et al., 1995; Akinfala et al., 2002; Ceballos et al., 2006). This

provides only an estimate since nitrogen to protein conversion factors have been

shown to vary significantly in cassava (Yeoh and Truong, 1996). But even those

protein values determined as sum of amino acids are obtained using non-

standardized procedures. For example, Ngudi et al. (2002) and our own lab

subjected lyophilized cassava flour to acid hydrolysis, whereas Nassar and Sousa

(2007) first extracted root proteins that were then hydrolyzed. It is apparent that a

standardized protocol describing protein analysis which is based on established

protocols (AOAC, 1997) is critical to normalize results obtained from different

laboratories.

For the analysis of individual amino acids hydroxyproline determination resulted in

high variation coefficients. This is due to the measurement of hydroxyproline being

close to technical detection limits (Fountoulakis and Lahm, 1998). It is known that

plants contain only minimal amounts of hydroxyproline (mainly in cell wall proteins) in

contrast to animal derived tissue (e.g. collagen in connective tissue) rendering

37

determination of this amino acid difficult in cassava (Showalter, 1993). Variation

during determination of SAA has been described already before when using

conventional analysis of amino acids by ion-exchange chromatography after acidic

hydrolysis (Ozols, 1990; Darragh et al., 1996). However, in this paper cysteine

signals could never be recorded as such or as cysteic acid even when pure cysteine

in amounts of up to 50mg /100g sample were added to the hydrolysis solution (data

not shown) which is not in accordance to the literature (Fountoulakis and Lahm,

1998). It seems that cysteine oxidative degradation besides partial dimerisation to

cystine happens quickly and quantitatively resulting in a loss of cysteine signal.

Our data further supports the results of Ngudi et al. (2002) who found high cysteine

levels in African cassava cultivars. Compared to methionine cysteine levels in their

cultivars were up to 10 times higher. Here, 4-8 times higher values of SAA were

detected with XRFS than with AAA while our recovery rate experiments suggest that

only a minor part of this increase is due to destroyed methionine. Consequently, we

interpret our XRFS results in a way that cassava storage roots in fact contain

significant amounts of cysteine.

After dimerisation cystine was more resistant to oxidative degradation in our AAA

experiments. This was in particular evident for storage roots of set 1 where

abundance of cystine was confirmed. Currently, we can only speculate whether the

age of plants at harvest is related to cystine levels but it is a fact that in 10 month

younger storage roots (set 2) cystine could not be detected. This finding is contrary to

the fact that all other amino acids show higher levels in these younger storage roots

of set 2 compared to set 1. We think this anti-correlation could be further clarified in

the future by determination of monomeric cysteine levels in both sets because we

hypothesize that cysteine levels are lower when cystine levels are higher due to an

increased dimerisation. XRFS is not suitable for this purpose because only the sum

of all SAA can be detected. Furthermore XRFS leads to a slight overestimation of

SAA since some other sulfur-containing molecules like enzymes or thioglucosides

are detected, too. And in terms of processing and shelf life of cassava derived

products knowledge of the specific levels of methionine and cysteine would provide

an even better estimation due to unequal chemical properties of these amino acids.

However, XRFS is superior to conventional determination of amino acids from a

nutritional point of view because there the sum of all SAA is more important than

individual levels due to their metabolic inter-convertibility.

38

Based on limitations discussed here during determination of SAA we would like to

indicate the need for new approaches and XRFS has been evaluated here as a fast,

easy and reliable alternative suitable for nutritional characterisation of cassava

storage roots. We could show that analytical specificity of the method and linearity of

the signal is given according to the recovery rate of >90% and the statistical

robustness of the calibration line used. So far only one laboratory reported use of this

method for analysis of plant material (Tabe and Droux, 2001, 2002; Chiaiese et al.,

2004) achieving a similar high specificity (Tabe, pers. Comm.).

Consequently, in particular cassava researchers should consider complementing

their protein and amino acid determination with XRFS in order to bypass losses of

SAA due to hydrolysis.

Acknowledgements We would like to thank Dr. Zohouri Pierre & Mr. Boni Nzué (Centre National de

Recherches Agronomiques, CNRA, Abidjan Côte d'Ivoire) for providing us with field-

grown storage roots of TMS60444, Hanna Schneider for her technical help with the

Amino acid analyses, Lydia Zehnder for her support in XRFS.

References Akinfala EO, Aderibigbe AO, Matanmi O (2002) Evaluation of the nutritive value of

whole cassava plant as replacement for maize in the starter diets for broiler chicken. Livestock Research for Rural Development 14

AOAC (1997) Official methods of analysis of AOAC international, Ed 16 Vol 3. Elsevier, Amsterdam

Awoyinka AF, Abegunde VO, Adewusi SR (1995) Nutrient content of young cassava leaves and assessment of their acceptance as a green vegetable in Nigeria. Plant Foods for Human Nutrition 47: 21-28

Ceballos H, Sanchez T, Chavez AL, Iglesias C, Debouck D, Mafla G, Tohme J (2006) Variation in crude protein content in cassava (Manihot esculenta Crantz) roots. Journal of Food Composition and Analysis 19: 589-593

Chiaiese P, Ohkama-Ohtsu N, Molvig L, Godfree R, Dove H, Hocart C, Fujiwara T, Higgins TJV, Tabe LM (2004) Sulphur and nitrogen nutrition influence the response of chickpea seeds to an added, transgenic sink for organic sulphur. Journal of Experimental Botany 55: 1889-1901

Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762

Crabb JW, West KA, Dodson WS, Hulmes JD (1997) Amino Acid Analysis. In JE Coligan, ed, Current Protocols in Protein Science. Wiley-Interscience, pp 11.19.11-11.19.42

39

Darragh AJ, Garrick DJ, Moughan PJ, Hendriks WH (1996) Correction for amino acid loss during acid hydrolysis of a purified protein. Analytical Biochemistry 236: 199-207

FAO (2003) Food energy - methods of analysis and conversion factors: Report of a technical workshop - Rome, 3–6 December 2002, Vol 77. Food and Agriculture Organization of the United Nations, Rome

FAO (2004) Agricultural biotechnology Meeting the needs of the poor? Food and Agriculture Organization of the United Nations FAO, Rome

FAO (2005) FAOSTAT data. In, Vol 2006 Fountoulakis M, Lahm HW (1998) Hydrolysis and amino acid composition analysis

of proteins. Journal of Chromatography A 826: 109-134 Gomez G, Noma AT (1986) The Amino-Acid-Composition of Cassava Leaves,

Foliage, Root Tissues and Whole-Root Chips. Nutrition Reports International 33: 595-601

Nassar NM, Sousa MV (2007) Amino acid profile in cassava and its interspecific hybrid. Genetics and Molecular Research 6: 192-197

Ngudi DD, Kuo YH, Lambein F (2002) Food safety and amino acid balance in processed cassava "Cossettes". Journal of Agricultural and Food Chemistry 50: 3042-3049

Ozols J (1990) Amino-Acid-Analysis. Methods in Enzymology 182: 587-601 Parvy P, Bardet J, Rabier D, Gasquet M, Kamoun P (1993) Intra- and

interlaboratory quality control for assay of amino acids in biological fluids: 14 years of the French experience. Clinical Chemistry 39: 1831-1836

Pinkerton A, Randall PJ, Norrish K (1989) Estimation of Sulfate and Amino-Acid Sulfur in Plant-Material by X-Ray Spectrometry. Communications in Soil Science and Plant Analysis 20: 1557-1574

Showalter AM (1993) Structure and function of plant cell wall proteins. Plant Cell 5: 9-23

Tabe LM, Droux M (2001) Sulfur assimilation in developing lupin cotyledons could contribute significantly to the accumulation of organic sulfur reserves in the seed. Plant Physiology 126: 176-187

Tabe LM, Droux M (2002) Limits to sulfur accumulation in transgenic lupin seeds expressing a foreign sulfur-rich protein. Plant Physiology 128: 1137-1148

USDA (2005) U.S. Department of Agriculture, Agricultural Research Service. National Nutrient Database for Standard Reference, Release 18. In Nutrient Data Laboratory Home Page, http://www.nal.usda.gov/fnic/foodcomp,

Velmurugu R (1993) Cassava leaves as animal feed: Potential and limitations. Journal of the Science of Food and Agriculture 61: 141-150

Yeoh HH, Chew MY (1977) Protein content and acid composition of cassava seed and tuber. Malaysian Agricultural Journal 51: 1-6

Yeoh HH, Truong VD (1996) Protein contents, amino acid compositions and nitrogen-to-protein conversion factors for cassava roots. Journal of the Science of Food and Agriculture 70: 51-54

Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250

40

Figures and Tables Table 1

Tabl

e 1:

Am

ino

acid

ana

lysi

s of

cas

sava

leav

es a

nd s

tora

ge ro

ots.

Ave

rage

val

ues

(in g

/100

g sa

mpl

e) c

onsi

st o

f sev

eral

in

depe

nden

t lin

es b

eing

bio

logi

cal

repl

icat

es (

n).

All

sam

ples

wer

e ad

ditio

nally

ana

lyze

d as

tec

hnic

al d

uplic

ates

. S

tand

ard

devi

atio

n is

sho

wn

as a

bsol

ute

valu

e (S

D)

and

rela

tive

to a

vera

ge (

varia

tion)

. S

ome

amin

o ac

ids

wer

e no

t de

tect

able

(ND

). Tr

ypto

phan

e w

as n

ot d

eter

min

ed (n

.det

.)

41

Figure 1

Figu

re 1

: G

raph

ical

com

paris

on o

f am

ino

acid

pro

files

in c

assa

va s

tora

ge r

oots

har

vest

ed a

fter

26 m

onth

(se

t 1)

and

afte

r 16

mon

th (

set

2) g

row

th.

Leve

ls o

f al

l am

ino

acid

s ar

e in

crea

sed

in s

et 2

com

pare

d to

set

1 e

xcep

t C

ys-C

ys.

Ave

rage

tota

l pro

tein

is il

lust

rate

d as

frac

tion

repr

esen

ting

one

tent

h of

real

val

ue (P

/10)

.

42

Figure 2

Figu

re 2

: Gra

phic

al c

ompa

rison

of S

AA

det

erm

inat

ion

in s

ever

al c

assa

va s

ampl

es u

sing

XR

FS a

nd c

onve

ntio

nal A

AA. F

or d

escr

iptio

n of

sa

mpl

es r

efer

to te

xt. E

rror

bar

s re

pres

ent s

tand

ard

devi

atio

n of

bio

logi

cal r

eplic

ates

whe

re a

vaila

ble.

Sam

ple

“spi

ke”

depi

cts

mea

sure

d va

lues

of s

piki

ng e

xper

imen

t whi

le b

lue

bar i

n sa

mpl

e “r

efer

ence

” dep

icts

cor

resp

ondi

ng e

xpec

ted

valu

e. G

reen

bar

in s

ampl

e “r

efer

ence

” w

as o

btai

ned

usin

g co

nven

tiona

l AA

A a

nd p

erfo

rmic

-aci

d pr

etre

atm

ent

as r

elia

ble

liter

atur

e re

fere

nce

valu

e fo

r ca

ssav

a flo

ur.

(U

SDA,

43

VII. ER-retained ASP1 increases protein content in cassava storage roots

Target Journal: Plant Biotechnology Journal Authors: Stupak M, Faso C, Gruissem W, Zhang P

Abstract Cassava is regarded as a food crop of global relevance for human nutrition. Millions

of consumers rely on its storage roots as a good source of carbohydrates but they

may develop severe protein deficiency because endogenous root protein levels are

very low. In this report we present a significant improvement of cassava root protein

and amino acid content by gene transfer and expression of the following

heterologous storage proteins: ASP1, sporamin, and zeolin. All proteins were

coupled to an endoplasmic reticulum retention signal and successfully accumulated

in this organelle. We could observe this by using a newly established transient

protoplast expression system for cassava. Finally, analysis of transgenic plants stably

expressing the ASP1 protein showed significant increases in levels of essential

amino acids, up to 35%. Our data suggests that ER retention is more efficient than

cytosolic protein accumulation in cassava storage roots and that this approach

should be adopted in the near future for the nutritionally most relevant protein

candidate.

Introduction Cassava (Manihot esculenta Crantz) is one of the most important food crops in

tropical developing countries since more than 600 million people rely on it as a staple

food source (FAO, 2005). It is highly tolerant to drought and poor soil conditions while

producing acceptable yields (Cock, 1982). Cassava serves as an excellent famine

reserve particularly for subsistence farmers in sub-Saharan African countries (FAO,

2004). Unfortunately, many communities relying on a cassava-based diet suffer from

Protein-Energy-Malnutrition (PEM) because their daily food intake does not contain

enough protein with essential amino acids (EAAs). PEM most likely leads to

Kwashiorkor or Marasmus - two of the most severe malnutrition-derived medical

conditions (Scrimshaw, 2007). Disturbance of growth, amyosthenia, fermentation-

44

induced diarrhoea, and fatty liver are common symptoms but far more attention has

been given to symptomatic children with a swollen belly and a senile facial

expression. A correlation between nutritional cassava dependency and PEM has

been found to be due to the very low protein content of cassava storage roots and

therefore strategies have been recently considered to increase its protein levels.

Such approaches could impact and in the long term reduce prevalence of PEM in

areas where cassava is the main staple crop (Stupak et al., 2006).

In our laboratory we have adopted heterologous expression of nutritional storage

proteins as a strategy to increase protein content and our previous results have

already provided a proof of concept for the feasibility of expression and accumulation

in cassava (Zhang et al., 2003).

Within this paper we make use of a well established transient GFP reporter system

and apply it to cassava allowing confirmation of functional targeting in cassava

protoplasts in a quick and easy way. We report the transient transformation of

cassava callus-derived protoplasts with several constructs. Their expression profile is

discussed with the aim to understand if certain cassava cellular compartments can

be suitable for storage protein accumulation. We investigated the accumulation

pattern of 3 proteins, namely ASP1 (Kim et al., 1992), sporamin (Maeshima et al.,

1985), and zeolin (Mainieri et al., 2004).

The rough endoplasmic reticulum (RER) has been successfully used in the past

years for protein storage and accumulation (Denecke et al., 1992; De Jaeger et al.,

2002; Mainieri et al., 2004). We also decided to target the cassava RER to

understand if this organelle in cassava can be used for the same purpose. High

protein levels in cassava storage roots have been achieved by accumulating one of

our chosen storage proteins (ASP1) within the RER. All our constructs include the

p54 promoter, an endogenous cassava promoter which is stronger than the

constitutive CaMV 35S promoter in directing gene expression in cassava roots

(Zhang et al., 2003). Our combined data provides evidence that protein targeting to

the RER in cassava is more efficient than untargeted cytosolic protein deposition for

protein accumulation in planta.

45

Results

Functional ER retention can be visualized in cassava protoplasts using GPF reporter fusions

Transformation vectors were generated with a prolamin signal sequence preceding

the storage protein coding sequence at its 5’ and a KDEL endoplasmic reticulum

retention signal (Denecke et al., 1992) at the 3’ end. The first 20 amino acids of the

signal sequence were predicted to trigger entrance into the secretory pathway and to

be cleaved off by peptidases co-translationally (Nielsen et al., 1997; Emanuelsson et

al., 2000). In order to visualize storage protein deposition within cassava cells we

generated N-terminal eGFP fusions. We decided to integrate the reporter gene

between the signal sequence and storage protein-gene to minimize disturbance of

protein-KDEL tertiary structure and thus putative influence on ER-retention (see

chapter XI for vector maps). After transforming protoplasts with vector RV3

containing ASP1 Confocal Laser Scanning Microscopy (CLSM) detected green

fluorescence in filament-like structures surrounding the nucleus and expanding

throughout the cytosol (Figure 1, A1-E1). Fluorescence co-localized with an ER-

resident chaperone (BiP) fused to RFP when co-transforming protoplasts with both

plasmids.

In order to find out whether the C-terminal retention signal is mandatory for protein

accumulation or ASP1 alone would be able to form stable protein aggregates within

the ER lumen, a TAG stop codon was cloned between ASP1 and KDEL genetic

sequences. The control vector (RV3-) was repeatedly used for cassava protoplast

transformation together with the BiP-RFP control plasmid and this protoplast

suspension was split in two parts. Prior to microscopic observation one half of the

suspension was treated with Brefeldin A in order to disrupt the Golgi apparatus while

the other half remained untreated. Protoplasts in the untreated half never resulted in

a positive green fluorescence signal though RFP fluorescence could be observed

(data not shown). Those protoplasts subjected to Brefeldin A treatment had restored

a green signal that co-localized with BiP-RFP (Figure 1, A2-E2).

In order to check whether the storage protein itself had a significant impact on protein

retention and accumulation we exchanged ASP1 with sporamin and zeolin,

respectively. Sporamin (RV6) co-localized with our BiP-RFP control indicating ER

retention comparable to ASP1 (Figure 1, A3-E3). Since zeolin had been reported to

46

exhibit a cryptic ER retention signal we omitted in this vector the C-terminal KDEL

sequence. After transient protoplast expression of this vector (RV14) significant

levels of green fluorescence were detected both in ER lumen and in the vacuole

(Figure 1, A4-E4).

Stable cassava transformation and transgene integration Following transient expression, one of the successful constructs (RV3) was used for

stable cassava transformation in order to obtain functional ER retention of a

heterologous storage protein in planta. We managed to regenerate 7 independent

transgenic lines that had stably integrated the transgene (Figure 2). Lines RV3-1a, -

1b, and -R4 had the cassette integrated once while RV3-6 and -R5 obtained two

copies. Lines RV3-R1 and -R6 showed integration of multiple (>3) or partial copies.

As a control, one of our previously regenerated lines (1-11) was included.

ASP1 gene has a higher expression in leaves than in roots in vitro After confirming that all lines had integrated the cassette into their genome we

wanted to quantify expression levels of the transgene. Relative ASP1 expression of

all 7 lines normalized to an internal reference gene (PP2A) was quantified using

Real-time PCR (Figure 3). Lines RV3-R1 and RV3-R6 showed no significant ASP1

expression both in roots and in leaves. All other transgenic lines showed ASP1

expression in both leaves and roots at various levels. Four lines showed higher ASP1

expression in leaves than in roots and one line (RV3-R5) had ASP1 expressed

equally in both organs. Leaf-expression in general was found to be significantly

higher (p<0.05) than root-expression in the same line in a paired two-tailed t-test.

Technical reproducibility of these results was achieved with a confidence interval of

<6%.

ER retention constructs trigger increased ASP1 Protein accumulation

Protein levels of transgenic cassava roots were visualized and compared on a

Western blot (Figure 4). Integrated densities of the bands were measured (ImageJ)

and are displayed in the same figure to ease semi-quantitative conclusions. Lines

RV3-R1 and RV3-R6 showed no detectable protein levels of ASP1 which correlates

with transcript levels. Root levels of our control line 1-11 expressing ASP1 without

47

any targeting signals and being driven by a CaMV 35s promoter instead of p54

(Zhang et al., 2003) were below the sensitivity of our assay. Compared to that control

all lines expressing the transgene (RV3-1a, -1b, -6, -R4, -R5) showed increased

protein abundance with RV3-R5 and RV3-1b having the highest level of ASP1.

A phenotypic disorder could be observed When mature plants of transgenic and wildtype cassava lines were analysed five out

of seven transgenic lines exhibited a distinct phenotypic difference in their

morphology. In these transgenic lines average leaf-size was reduced, leaf shape was

wrinkled, plants were stunted and total root weight was reduced (Figure 5). At

harvest some plants had not developed storage roots. Out of six plants of line RV3-

1b only three had developed storage roots (50% storage root formation frequency),

for lines RV3-1a, -6, -R4, and -R5 frequency of storage root formation was even

lower than for line RV3-1b (38%, 20%, 0%, 0%). Lines RV3-R1 and RV3-R6 were the

only transgenic lines having formed storage roots in all observed plants (frequency of

100%) like wildtype and control line 1-11.

Total root weight (fresh) of all plants was determined after harvest and was ranging

from 1g to 325g. Fresh weight of fibrous roots was quite low and never exceeded

14g. We observed a significant difference between the root weight of three lines

(RV3-1a, -1b, -6) which were all lighter than 72 g, and the root weight of two lines

(RV3-R1 and –R6) which were all heavier than 79 g. These two lines RV3-R1 and –

R6 were morphologically indifferent to wildtype plants.

Leaf size of five transgenic lines (RV3-1a, 1b, -6, -R4, and -R5) was smaller than WT

with a wrinkled leaf shape while in two lines (RV3-R1 and –R6) leaf size and shape

was indifferent to WT (Figure 5).

Plant height was measured at 25cm intervals. RV3-R5 was less than 25cm in height

and thus much shorter than all other lines. RV3-1a, -1b, and

-R4 had heights of less than 75cm. RV3-6, -R1, and -R6 were less than 125cm high

and thus comparable in plant size to wildtype and control line 1-11.

48

Total protein content of storage roots is changed In order to check for improvements, protein content and amino acid composition was

determined in all available storage roots using an amino acid analyser. We

discovered major differences in total protein content at two different time-points of

harvest (Figure 6). Storage roots of five month old WT plants contained 1.33(±0.16)g

total protein in 100g freeze-dried flour and control line 1-11 contained

1.40(±0.09)g/100g. The three transgenic lines analysed here (RV3-1b, -R1, -R6)

contained significantly more protein ranging from 1.55g/100g to 5.62g/100g thus

representing a relative protein increase of 38% (RV3-R1), 82% (RV3-R6), and 3.2

fold (RV3-1b) compared to WT. We checked the same lines 3 months later (after

eight months total growth in the green-house) and discovered a reduction in total

protein content in both transgenic and control lines. Total protein content in WT and

control plants was slightly reduced to 0.79(±0.13)g protein per 100g cassava flour

while protein in all transgenic lines was now ranging from 0.89g/100g to 1.29g/100g.

Compared to control lines these transgenic lines contained slightly more total protein,

in detail 14% (RV3-1A), 64% (RV3-6), 10% (RV3-R1), and 7% (RV3-1B).

Analysis of all amino acids in our samples revealed major differences between

transgenic and control lines. After 5 months arginine content in line RV3-1b was 14-

fold increased compared to WT but 3 month later no significant difference could be

seen anymore. All remaining amino acids in this line were initially increased (after five

months growth) by 1.7 to 9.6-fold compared to controls and showed later (after eight

months) still some improvement compared to controls though less significant with

increases ranging from 5% for tyrosine to 31% for aspartate/asparagine. For lines

RV3-1A and RV3-1B the increase in each amino acid can be seen in Figure 7. Taken

together our data suggests that the point of harvest is critical for relative

measurements of protein and amino acids. So far improvements seem to be

pertinent in transgenic lines but analysis of storage roots at a later time-point might

give us more information about the reasons behind these changes.

Discussion The ER has already been used in many crops for storage protein accumulation (De

Jaeger et al., 2002; Mainieri et al., 2004; Yang et al., 2005). Here we wanted to test

this cellular compartment in cassava for protein accumulation using three different

storage proteins. Since cassava stable transformation is known to require long

49

periods of tissue culture (e.g. Zhang and Gruissem, 2004), establishment of a

functional transient expression system was reasonable in order to process different

transformation constructs in parallel and to screen for the most suitable one. The

system we present here revealed functional targeting of three storage proteins to the

ER as well as to vacuoles and plastids (chapters eight and nine). One of our

candidates (ASP1) was subsequently used for stable transformation. So far, only

qualitative differences in fluorescence could be observed between protein candidates

because the GFP signal could not be normalized to any reference and showed

variation probably due to transformation efficiency or signal stability towards photo-

bleaching. To improve signal quantification the utilization of available quantitative

fluorescence methods like FRAP would be helpful together with the introduction of a

fluorescent reference gene into the same vector (e.g. nuclear-targeted RFP) in order

to compensate for variable transformation efficiency.

Of all three ER-targeted constructs only zeolin (RV14) revealed dual targeting to

vacuoles and ER. But since we could provide evidence (by using RV3- with and

without Brefeldin A) that the prolamin signal sequence triggers secretion unless a

KDEL signal is present, a vacuolar protein deposition was not expected. It has been

reported that both γ-zein in maize and phaseolin in beans, which are the two proteins

zeolin is comprised of, are found in protein storage vacuoles and ER. Only the fusion

protein zeolin appeared to induce protein aggregation and subsequently formation of

insoluble and stable protein bodies in the ER of transgenic tobacco leaves (Mainieri

et al., 2004). This seems not to have happened in cassava. Currently, we do not

know whether this is a transient effect or cassava in general is not able to form

protein bodies. Analysis of stably transformed cassava plants expressing zeolin

would provide further evidence.

Sporamin has never been expressed in cassava so far. In this transient protoplast

system we could show that it forms a stable protein, no matter if targeted to ER,

vacuoles, or plastids (partly discussed in chapters eight and nine). We think that this

protein remains a suitable candidate for stable transformation trials.

ASP1 fused to GFP gave us a very reliable and stable signal. Clearly, only ER was

used as protein storage location and no other cellular organ was affected. This

together with the fact that we had ASP1 already expressed in cassava previously,

convinced us to use this vector for stable transformation trials.

50

Several of these established cassava lines presented here were shown to express

ASP1 constitutively after genomic integration of the transgene. However, two lines

out of 7 (RV3-R1 and RV3-R6) had no detectable expression both on a

transcriptional and a translational level. Although the relationship between transgene

induced gene-silencing and copy numbers is still not fully understood it is generally

assumed that multiple copies can be associated with low expression levels (Flavell,

1994; Vaucheret et al., 1998; Muskens et al., 2000). The two lines showed genomic

integration of multiple copies (>3) which could be the reason for the absence of ASP1

expression. Although a single gene insertion does not guarantee predictable

expression levels either (Elmayan and Vaucheret, 1996; De Wilde et al., 2001; Meza

et al., 2002) a reduced amount of integrated copies should reduce silencing

probability. Besides these two, our transgenic lines did not show any correlation

between expression levels and number of inserts.

We checked the levels of expression in leaves and roots of all our transgenic lines

using Real-time PCR and in order to achieve comparable results we used

Serine/Threonine protein phosphatase catalytic subunit 2A (PP2A) as a

housekeeping gene that was predicted to have equal expression levels in both

organs in A. thaliana according to Genevestigator (Zimmermann et al., 2004;

Zimmermann et al., 2005) and proved to be superior to variable tubulin expression

(Czechowski et al., 2005). After normalization ASP1 expression could be shown to

be significantly stronger in leaves than in roots in 3 week-old in vitro plants. This is in

contrast to our previous findings where gene expression of promoter p54 fused to the

uidA reporter gene was reported to be weaker in leaves than in primary roots (Zhang

et al., 2003). Since this study here is the first and only report where promoter p54

was used for a functional gene we currently cannot conclude whether ASP1 had an

influence on this altered expression pattern, e.g. via mRNA stability, or PP2A

expression behaviour is significantly different between Arabidopsis and cassava. The

ongoing generation of cassava plants with other functional genes driven by p54 will

provide further inside into this question.

At a translational level, semi-quantified protein bands seemed to be comparable to

transcript abundance. Lines RV3-R4 and RV3-R5 showed similar expression levels

both in leaves and roots on a Western blot and thus are in accordance with our Real-

time PCR data (data not shown). Compared to our untargeted control line 1-11

51

protein levels in those two lines were slightly higher in leaves and much higher in

roots.

Unexpectedly, regeneration of our transgenic cassava lines was accompanied by a

morphological phenotypic disorder. Five out of seven regenerated lines (71%)

showed this alteration at variable extent. Because cassava is subjected to a long

period of tissue culture for generation of transformable material and regeneration of

the transformed cells into plantlets, somaclonal variation (Larkin and Scowcroft,

1981) could explain the abnormal phenotype observed in the transgenic lines. From

other plant species low values are reported (0.05%-67%) for somaclonal variation (Li

et al.; Munthali et al., 1996; Polanco and Ruiz, 2002; Bednarek et al., 2007) but they

are probably difficult to compare because of the length of cassava transformation

which goes up to 9 months. Results regarding somaclonal variation directly obtained

from cassava are therefore needed but rather rare. Raemakers et al. (2001) reported

both a genotypic and temporal dependency of abnormal regeneration with cultivar

TMS60444 (the same we used in this study here) showing the best genetic stability.

On a time scale they observed some changes in this cultivar, depending on dwell

time of FECs in liquid cultures. After 6 months 100% of regenerated plants were

found with a normal phenotype. After 24 months the share of normal regeneration

dropped to 85% and reached even 0% after 30 months in one particular case

(Schreuder et al., 2001). Interestingly, the phenotype of these abnormal plants could

be partly restored after greenhouse propagation via stem-cuttings. Recently, the

same group published some more results with cultivar TMS60444 where they claim

to have regenerated even 95% of their plants with a normal phenotype although their

calli were in liquid cultures for 14-18 months (Raemakers et al., 2007). The

transgenic lines we present in this study have been kept in tissue culture for an

average of 5-6 months (Zhang and Gruissem, 2004) and thus a share of tissue

culture derived phenotypic disorder of 71% seems unlikely. Instead we examined

those two out of seven lines with a normal morphology closer and found them to

coincide with those lines that had our transgene silenced (RV3-R1 and RV3-R6).

Further green-house propagation via stem cuttings of all lines did not cause any

morphological improvement (data not shown).

Regardless of the altered phenotype, amino acid analysis could show improvements

in total protein content and most amino acids. Results regarding SAA should be

analysed with care since we could show elsewhere that absolute values are probably

52

more than four times higher (chapter six). Nevertheless, SAA levels might be

improved here, too. The high abundance of arginine in many transgenic plants was

not expected but could be related to the fact that in many plants, arginine serves as a

major nitrogen source preferably for storage. E.g. in Arabidopsis thaliana arginine

accounts for 11% of total seed nitrogen (Vanetten et al., 1967; Polacco and Holland,

1993). We think that our transgenic plants were probably more efficient in nitrogen

storage than our control plants and this consequently led to increased true protein

contents in young storage roots. However, 3 months later roots did not show this

tendency for nitrogen storage anymore leading most probably to the reduced protein

levels we observed. Currently, we do not fully understand the mechanism behind

these observations and need to wait for the regeneration and analysis of more

transgenic plants. Nevertheless, our plants showed at any time of harvest superior

abundance of essential amino acids with increases of up to 35% indicating the

importance of our approach for improving the nutritional value of cassava storage

roots.

Experimental procedures Vector construction Transformation vectors were designed using pCAMBIA1301 (Cambia, Australia) as a backbone (for vector maps see chapter XI). A synthetic oligo (“KDEL oligo”) containing a KDEL sequence followed by a Stop-codon, was digested with PstI and BstEII and cloned into our pCAMBIA backbone. ASP1 gene was amplified from pCASP1 (Zhang et al., 2003) using primers “ASP1 Fwd” and “ASP1 Rev” and cloned into our KDEL-backbone using SmaI/SalI. The 5’-targeting signal of the prolamin gene (Acc.Nr.: NM_001061752) was amplified from genomic DNA of O. Sativa using primers “ProlSS Fwd” and “ProlSS Rev” and cloned into the cassette using KpnI/SmaI. The endogenous cassava promoter p54 was amplified with PCR from pCP54GUS (Zhang et al., 2003) using primers “p54 Fwd” and “p54 Rev” and cloned into the cassette using EcoRI/NcoI (RV3). The sporamin gene was amplified on the plasmid PspoAF-1 (Matsuoka and Nakamura, 1991) (primers “Spor Fwd” and “Spor Rev”) and inserted into the vector backbone RV3 using SmaI/PstI thus replacing ASP1 (RV6). The gene coding for zeolin was amplified from a pDHA vector (Mainieri et al., 2004) (primers “Zeolin Fwd” and “Zeolin Rev”) and cloned into RV3 using SmaI/SalI. The 5’ signal sequence of the sporamin gene (Acc.Nr.: DQ195772) was amplified using PCR (primers “SporSS Fwd” and “SporSS Rev”) on the plasmid PspoAF-1. The PCR product was digested with BspHI/SmaI and cloned into the zeolin containing vector digested with NcoI/SmaI thus replacing the prolamin signal sequence (RV14). Primers Name sequence (5’-3’) KDEL oligo GCCTGCAGGAAGGACGAGCTCTAGAGGTCACCGCG ASP1 Fwd CAGCGCCTCTCCATGGCCCGGGATGCTTGAAG

53

ASP1 Rev CTATGTCGACATTCCCGATCGTTCAAAC ProlSS Fwd GATAGGTACCATGGGGATGAAGATCATTTTCG ProlSS Rev CGCCTCTGCGCCCGGGATAT p54 Fwd TAGAATTCGGATCCACGGGTGTGGGCCAACTC p54 Rev CTATTTCATTTTCTCTTGCTTTCGCCACCATGGAG Spor Fwd AACCCGGGTCCTCTGAAACTCCAGTAC Spor Rev GTCATCAAACCTACCGATGTCTGCAGTG Zeolin Fwd TCACCCGGGACTTCACTCCGGGAGGAGGAAG Zeolin Rev CATCCAAGCCCGTGCCAGTAGTCGACGGC SporSS Fwd CATCATGAAAGCCCTCACACTGG SporSS Rev CCCCACCACACACGAACCCGGGTC Hpt II Fwd TCTCGATGAGCTGATGCTTTGG Hpt II Rev AGTACTTCTACACAGCCATCGG PP2A-RT Fwd TGTGGAAATATGGCATCAATTTTGG PP2A-RT Rev GCAACAGAAAGCCGTGTCAC ASP1-RT Fwd CCCGGGATGCTTGAAGAGC ASP1-RT Rev CTAGAGCTCGTCCTTCCTGC Plant Material Transformation of cassava (cultivar TMS60444) was conducted using Agrobacterium-mediated gene transfer into friable embryogenic callus (FEC) tissue essentially as described by (Zhang and Gruissem, 2004). Hygromycin-resistant transformants were regenerated in vitro. Three-week old plantlets were transplanted to pots and transferred to the greenhouse. Leaves, roots and storage roots were harvested after 5 months and 9 months. Experimental setup included previously established transgenic plants expressing cytosolic ASP1 (Zhang et al., 2003). Protoplast experiments Cell content of one jar cassava callus tissue (1-2g) was treated with 50ml of enzyme solution A under sterile conditions and incubated at 26°C in the dark for 16h (shaking at ~80rpm). Digested solution was filtered (50µm) and filter was washed with 10ml wash solution B. Protoplasts in flow-through were pelleted (15ml Falcon tubes, 70g, 10min) and washed twice with solution B. Protoplasts were counted (Jessen chamber) and resuspended in salt solution C depending on yield (1 to 3x106 protoplasts /ml). To 1ml of protoplast solution 20µg of plasmid DNA were added and gently mixed. Then 1ml of PEG solution D was added slowly and samples were incubated while gently shaking (RT, 5min).Then 6ml of nutrient solution E were added and samples were incubated for recovery (RT, dark, ~80rpm, 40-48h). Protoplasts were concentrated, warmed to 30°C and mixed with an equal part of low-melting-point agarose (2%, 45°C). Final solution was spread on microscopic slides (warmed to 33°C) and cooled to RT. Samples were observed using Confocal Laser Scanning Microscopy (Leica SP1-2) and images were processed using Imaris software (Bitplane AG, Zurich, Switzerland). Each vector was used in at least three independent tranformations and within each batch of transformation several protoplasts were checked for homogenicity and reproducibility of GFP pattern. Solution A (pH=5.7, filter-sterilized) Cellulase RS Onozuka (10g/l), Macerozyme (200mg/l), Pectolyase Y-23 (10mg/l), NAA (1mg/l), 2,4-D (1mg/l), Zeatin (1mg/l), D-Mannitol (91g/l), MES (0.5g/l), Na2 -EDTA (19.3mg/l), FeSO4x7H2O (14mg/l), MgSO4x7H2O (492mg/l), KNO3 (740mg/l), KH2PO4 (34mg/l), CaCl2x2H2O (487.4mg/l). Solution B (pH=5.6-5.8, autoclaved) CaCl2x2H2O (487.4mg/l), KH2PO4 (34mg/l), KNO3 (740mg/l), MgSO4x7H2O (492mg/l), Mannitol (45.5g/l), NaCl (7.3g/l).

54

Solution C (pH=5.8, autoclaved) MgCl2x2H2O (3.05g/l), MES (1g/l), Mannitol (91.1g/l). Solution D (pH=8.0-9.0, autoclaved) PEG 4000 (400g/l), D-Mannitol (72.9g/l), Ca(NO3)2x4H2O (23.6g/l). Solution E (autoclaved) Picloram (10mg/l), MS salts +Vit. (4.4g/l), Glucose (102.6g/l), Mannitol (4.56g/l), Xylitol (30.8g/l), Sorbitol (4.56g/l), Myo-inositol (976mg/l). Molecular analysis Cassava genomic DNA was extracted from freeze-dried leaves according to (Soni and Murray, 1994).Genomic integration was confirmed in cassava plantlets using Southern blot standard protocols (Sambrook et al., 1989) after digestion with HindIII. As probe a genomic region of the HptII gene (450bp) was amplified (pimers “Hpt II Fwd” and “Hpt II Rev”) and labeled with DIGdUTP (F. Hoffmann-La Roche Ltd, Basel, Switzerland) according to the manufacturer’s instructions. Total cassava RNA and protein were extracted from leaves and roots of in vitro plantlets using the TRIZOL extraction protocol (Invitrogen). 2µg total RNA per sample was further treated with Super Script II Reverse Transcriptase (Invitrogen) according to manufacturer’s instructions. Real-time PCR on cassava cDNA samples was carried out on a LightCycler 2.0 machine (F. Hoffmann-La Roche Ltd, Basel, Switzerland) using Serine/Threonine protein phosphatase PP2A catalytic subunit 2A (Acc.Nr. BM259718) as reference gene (primers “PP2A-RT Fwd” and “PP2A-RT Rev”) with ASP1 as gene of interest (primers “ASP1-RT Fwd” and “ASP1-RT Rev”). Results were processed for normalization using Microsoft Excel. Protein extracts were quantified according to (Bradford, 1976) and 10µg total protein were loaded per lane on a Tricine SDS gel (Schagger and von Jagow, 1987). Western blot was performed (Sambrook et al., 1989) and ASP1 bands were detected using a polyclonal antibody and ECL detection kits (Amersham Biosciences, Piscataway, USA). Amino Acid Analysis Storage roots were peeled at the root cortex, sliced and freeze-dried for 24h while leaves were lyophilized directly. All plant material was ground afterwards to a homogenous powder and stored at -80◦C until use. Samples containing 1mg total protein were weighed and hydrolyzed with 2ml of 6M HCl for 24h at 110◦C in an oil bath using Argon as inert gas. After hydrolysis samples were evaporated (Rotavapor, BÜCHI Labortechnik AG, Switzerland) at ≤ 50°C, resuspended in 5ml sample buffer (0.16M Li-acetate-buffer, pH 2.20; No. 5.403.047, Laborservice Onken GmbH, Gründau-Breitenborn, Germany) and filtered through a 0.45-µm PVDF membrane (Millipore AG, Switzerland). 50µl of the solution were injected into an automated Biochrom30 Analyser (Laborservice Onken) and separated afterwards by ion exchange chromatography (Lithium High Resolution Column, 4.0x125mm, No. 5.503.611, Laborservice Onken) based on a 5 buffer system. Following separation, amino acids were derivatized with ninhydrin and detected at 570nm and 440nm. Quantification was based on external standards (Cat-No. 20088ZZ, Pierce, Perbio Science Switzerland SA, Lausanne, Switzerland) consisting of a mixture of 5.0nmol of each amino acid in 50µl loading buffer. Each analysis was performed with two technical replicates and several biological replicates (as described in section “plant material“).

Acknowledgements We would like to thank Prof. Vitale for providing us with the zeolin donor plasmid, Prof. Brandizzi and Prof. Hwang for the BiP::RFP control vector. Hanna Schneider is acknowledged for assistance with amino acid analysis.

55

References Bednarek PT, Orlowska R, Koebner RM, Zimny J (2007) Quantification of the

tissue-culture induced variation in barley (Hordeum vulgare L.). BMC Plant Biology 7: 10

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72: 248-254

Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762

Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR (2005) Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiology 139: 5-17

De Jaeger G, Scheffer S, Jacobs A, Zambre M, Zobell O, Goossens A, Depicker A, Angenon G (2002) Boosting heterologous protein production in transgenic dicotyledonous seeds using Phaseolus vulgaris regulatory sequences. Nature Biotechnology 20: 1265-1268

De Wilde C, Podevin N, Windels P, Depicker A (2001) Silencing of antibody genes in plants with single-copy transgene inserts as a result of gene dosage effects. Molecular Genetics and Genomics 265: 647-653

Denecke J, De Rycke R, Botterman J (1992) Plant and mammalian sorting signals for protein retention in the endoplasmic reticulum contain a conserved epitope. EMBO Journal 11: 2345-2355

Elmayan T, Vaucheret H (1996) Expression of single copies of a strongly expressed 35S transgene can be silenced post-transcriptionally. Plant Journal 9: 787-797

Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. Journal of Molecular Biology 300: 1005-1016

FAO (2004) Agricultural biotechnology Meeting the needs of the poor? Food and Agriculture Organization of the United Nations FAO, Rome

FAO (2005) FAOSTAT data. In, Vol 2006 Flavell RB (1994) Inactivation of gene expression in plants as a consequence of

specific sequence duplication. Proceedings of the National Academy of Sciences of the United States of America 91: 3490-3496

Kim J, Cetiner S, Jaynes JM (1992) Enhancing the nutritional quality of crop plants: design, contruction and expression of an artificial plant storage protein gene. In D Bhatnagar, TE Cleveland, eds, Molecular approaches to improving food quality and safety. Van Nostrand Reinhold, New York, pp 1-36

Larkin PJ, Scowcroft WR (1981) Somaclonal Variation - a Novel Source of Variability from Cell-Cultures for Plant Improvement. Theoretical and Applied Genetics 60: 197-214

Li X, Yu X, Wang N, Feng Q, Dong Z, Liu L, Shen J, Liu B Genetic and epigenetic instabilities induced by tissue culture in wild barley (Hordeum brevisubulatum (Trin.) Link). Plant Cell, Tissue and Organ Culture

Maeshima M, Sasaki T, Asahi T (1985) Characterization of Major Proteins in Sweet-Potato Tuberous Roots. Phytochemistry 24: 1899-1902

56

Mainieri D, Rossi M, Archinti M, Bellucci M, De Marchis F, Vavassori S, Pompa A, Arcioni S, Vitale A (2004) Zeolin. A new recombinant storage protein constructed using maize gamma-zein and bean phaseolin. Plant Physiology 136: 3447-3456

Matsuoka K, Nakamura K (1991) Propeptide of a precursor to a plant vacuolar protein required for vacuolar targeting. Proceedings of the National Academy of Sciences of the United States of America 88: 834-838

Meza TJ, Stangeland B, Mercy IS, Skarn M, Nymoen DA, Berg A, Butenko MA, Hakelien AM, Haslekas C, Meza-Zepeda LA, Aalen RB (2002) Analyses of single-copy Arabidopsis T-DNA-transformed lines show that the presence of vector backbone sequences, short inverted repeats and DNA methylation is not sufficient or necessary for the induction of transgene silencing. Nucleic Acids Research 30: 4556-4566

Munthali MT, Newbury HJ, FordLloyd BV (1996) The detection of somaclonal variants of beet using RAPD. Plant Cell Reports 15: 474-478

Muskens MW, Vissers AP, Mol JN, Kooter JM (2000) Role of inverted DNA repeats in transcriptional and post-transcriptional gene silencing. Plant Molecular Biology 43: 243-260

Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10: 1-6

Polacco JC, Holland MA (1993) Roles of Urease in Plant-Cells. International Review of Cytology - a Survey of Cell Biology, Vol 145 145: 65-103

Polanco C, Ruiz ML (2002) AFLP analysis of somaclonal variation in Arabidopsis thaliana regenerated plants. Plant Science 162: 817-824

Raemakers K, Schreuder M, Anggraini V, Putten H, Pereira I, Visser R (2007) Cassava. In Transgenic Crops IV, p 317

Raemakers K, Schreuder M, Pereira I, Munyikwa T, Jacobsen E, Visser R (2001) Progress made in FEC transformation of cassava. Euphytica 120: 15

Sambrook J, Fritsch E, Maniatis T (1989) Molecular Cloning: a laboratory manual. CSH Laboratory Press, Cold Spring Harbor, NY

Schagger H, von Jagow G (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Analytical Biochemistry 166: 368-379

Schreuder MM, Pereira IJ, Raemakers CJJM, Jacobsen E, Visser RGF (2001) Effects of Somaclonal Variation in Cassava Plants Regenerated from Friable Embryogenic Callus of Increasing Age. In 5th International Scientific Meeting of the Cassava Biotechnology Network, Vol S7-26, Donald Danforth Plant Science Center, St. Louis, Missouri USA

Scrimshaw NS (2007) Fifty-five-year personal experience with human nutrition worldwide. Annual Review of Nutrition 27: 1-18

Soni R, Murray JA (1994) Isolation of intact DNA and RNA from plant tissues. Analytical Biochemistry 218: 474-476

Stupak M, Vanderschuren H, Gruissem W, Zhang P (2006) Biotechnological approaches to cassava protein improvement. Trends in Food Science & Technology 17: 634-641

Vanetten CH, Kwolek WF, Peters JE, Barclay AS (1967) Plant Seeds as Protein Sources for Food or Feed. Evaluation Based on Amino Acid Composition of 379 Species. Journal of Agricultural and Food Chemistry 15: 1077-&

57

Vaucheret H, Beclin C, Elmayan T, Feuerbach F, Godon C, Morel JB, Mourrain P, Palauqui JC, Vernhettes S (1998) Transgene-induced gene silencing in plants. Plant Journal 16: 651-659

Yang J, Barr LA, Fahnestock SR, Liu ZB (2005) High yield recombinant silk-like protein production in transgenic plants through protein targeting. Transgenic Research 14: 313-324

Zhang P, Bohl-Zenger S, Puonti-Kaerlas J, Potrykus I, Gruissem W (2003) Two cassava promoters related to vascular expression and storage root formation. Planta 218: 192-203

Zhang P, Gruissem W (2004) Production of transgenic cassava (Manihot esculenta Crantz). In Transgenic Crops of the World - Essential Protocols. Curtis, Ian S., pp 301-319

Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250

Zimmermann P, Hennig L, Gruissem W (2005) Gene-expression analysis and network discovery using Genevestigator. Trends in Plant Science 10: 407-409

Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W (2004) GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiology 136: 2621-2632

58

Figures and tables

Figu

re 1

: S

ubce

llula

r lo

caliz

atio

n of

sto

rage

pro

tein

s in

cas

sava

pro

topl

asts

usi

ng a

pro

lam

ine

deriv

ed s

igna

l seq

uenc

e (s

cale

ba

r is

10µm

). (1

) Pro

lSS

:GFP

:AS

P1:

KD

EL

(RV

3) is

targ

eted

to E

R. (

2) P

rolS

S:G

FP:A

SP

1 (R

V3- ) i

s re

tain

ed in

the

ER

onl

y af

ter

Bre

feld

inA

tre

atm

ent.

(3)

Pro

lSS

:GFP

:Spo

ram

in:K

DE

L (R

V6)

is s

ucce

ssfu

lly r

etai

ned

in t

he E

R.

(4)

Pro

lSS

:GFP

:Zeo

lin:K

DE

L (R

V14

) lo

caliz

es t

o E

R a

nd t

he v

acuo

le.

(A)

brig

htfie

ld im

age,

(B)

GFP

:pro

tein

sig

nal,

(C)

BiP

:RFP

con

trol s

igna

l for

ER

, (D

) ov

erla

y of

(B) a

nd (C

), (E

) mag

nifie

d se

ctio

ns o

f sig

nal f

rom

(B)

Figure 1

59

Figure 2

R

V3/1

a

RV3

/1b

RV3

/6

R

V3/R

1

R

V3/R

4

RV3

/R5

R

V3/R

6

1-1

1

W

T

Figu

re 2

: Sou

ther

n bl

ot o

f sev

en c

assa

va li

nes

trans

form

ed w

ith c

onst

ruct

RV

3

60

Figure 3

Figu

re 3

: Rea

l-tim

e PC

R o

f sev

en tr

ange

nic

cass

ava

lines

exp

ress

ing

the

AS

P1

gene

. Tra

nscr

ipt a

bund

ance

w

as d

eter

min

ed in

leav

es a

nd ro

ots

of in

vitr

o pl

ants

.

61

Figure 4

Figu

re 4

: W

este

rn B

lot

of t

otal

roo

t pr

otei

n ex

tract

ions

of

seve

n tra

nsge

nic

cass

ava

lines

. Tw

o lin

es d

o no

t in

dica

te p

rote

in a

ccum

ulat

ion.

RV3

/1a

RV3

/1b

R

V3/6

R

V3/R

1 R

V3/R

4 R

V3/R

5 R

V3/R

6

W

T 1

-11

62

Figure 5

Figu

re 5

: P

heno

typi

c ch

arac

teriz

atio

n of

sev

en t

rans

geni

c ca

ssav

a lin

es.

AS

P1 e

xpre

ssio

n es

timat

ed f

rom

W

este

rn b

lot u

sing

Imag

eJ. E

ach

sym

bol i

n pl

ant h

eigh

t cor

resp

onds

to c

a.25

cm. S

tora

ge ro

ot fo

rmat

ion

refe

rs

to th

ose

plan

ts p

er li

ne th

at w

ere

able

to fo

rm c

lear

ly d

istin

guis

habl

e st

orag

e ro

ots.

63

Figure 6

Figu

re 6

: To

tal p

rote

in c

onte

nt in

cas

sava

sto

rage

roo

ts. P

lant

s w

ere

anal

yzed

afte

r 5

mon

ths

in s

oil a

nd a

fter

8 m

onth

s. W

here

mor

e th

an o

ne s

ampl

e w

as m

easu

red,

sta

ndar

d de

viat

ion

betw

een

biol

ogic

al r

eplic

ates

is g

iven

. Fo

r lin

es R

V3-

1A a

nd R

V3-

6 no

sto

rage

root

s w

ere

avai

labl

e af

ter 5

mon

th, a

s w

as fo

r lin

e R

V3-R

6 af

ter 8

mon

ths.

64

Figure 7

Figu

re 7

: Com

plet

e am

ino

acid

ana

lysi

s of

two

trans

geni

c ca

ssav

a st

orag

e ro

ots

both

exp

ress

ing

the

AS

P1

gene

. Err

or b

ars

depi

ct b

iolo

gica

l sta

ndar

d de

viat

ion

afte

r Gau

ssia

n er

ror p

ropa

gatio

n. T

rp w

as n

ot d

eter

min

ed.

Cha

nges

in C

ys-C

ys c

once

ntra

tion

wer

e no

t sig

nific

ant a

nd o

mitt

ed h

ere.

65

VIII. Import of a storage protein into plastidal stroma is inhibited in cassava

Target Journal: Mol Biol Rep (as short comm.) Authors: Stupak M, Faso C, Gruissem W, Zhang P

Abstract Low protein levels in cassava storage roots have been a primary target of nutritional

improvement in cassava breeding programs. One of the approaches to solve this

problem is to express heterologous storage proteins targeted to suitable subcellular

locations to achieve high levels of protein accumulation. In this report we investigated

the ability of cassava plastids to accumulate ASP1, a recombinant storage protein

designed specifically for nutritional enhancement purposes. To do this, we performed

both transient and stable expression assays in cassava. Surprisingly, ASP1 could

never be successfully imported into plastids and the transit peptide remained

uncleaved. We therefore conclude that plastids are not a suitable place to

accumulate ASP1 in cassava.

Introduction Cassava is one of the five most important food and feed crops in the world and is

mainly grown in tropical developing countries because of its starchy storage roots

(FAO, 2005). However, the presence of cyanogenic glucosides coupled with the

absence of sufficient levels of high quality protein frequently leads to the occurrence

of Protein-Energy-Malnutrition (PEM) in areas where consumers rely mostly or

exclusively on this food source (Cock, 1982; FAO, 2004). We have addressed this

problem in our laboratory by transgenesis, meaning the transfer and expression of

heterologous storage proteins in cassava storage roots (reviewed in Stupak et al.,

2006). Proof of concept for this kind of approach was provided previously with the

stable expression of an untargeted storage protein in cassava (Zhang et al., 2003),

yet significant improvements on a nutritional level could not be observed (Chapter

six).

One of the ways in which recombinant protein production in plants can be increased

is to exploit the existing subcellular targeting mechanisms to promote organelle-

66

specific protein deposition. Plastids have been successfully used for the

accumulation of heterologous proteins in plants. For our purposes, we considered

plastidial targeting as a promising strategy for ASP1 accumulation due to the high

abundance of amyloplasts in cassava storage roots. The well-characterized transit

peptide psrbcS from the P. sativum RuBisCo small subunit (Van den Broeck et al.,

1985) was used to direct our nuclear-encoded protein to plastids. Plastidial targeting

of ASP1 was first evaluated using several subcellular prediction softwares.

Experimental proof was then obtained with both transient (protoplasts) and stable

(plants) expression assays. The establishment of transgenic plants stably expressing

our transgene allowed us to conclude that the plastid-targeted ASP1 protein cannot

be correctly imported into cassava plastids and that this is not dependent on the

origin of the analysed tissue.

Material and Methods Vector construction Transformation vectors were designed using pCAMBIA1301 (Cambia, Australia) as a backbone (for vector maps see chapter XI). A synthetic oligo (“KDEL oligo”) containing a KDEL sequence followed by a Stop-codon, was digested with PstI and BstEII and cloned into our pCAMBIA backbone. ASP1 gene was amplified from pCASP1 (Zhang et al., 2003) using primers “ASP1 Fwd” and “ASP1 Rev” and cloned into our KDEL-backbone using SmaI/SalI. The endogenous cassava promoter p54 was amplified with PCR from pCP54GUS (Zhang et al., 2003) using primers “p54 Fwd” and “p54 Rev” and cloned into the cassette using EcoRI/NcoI. The well characterized transit peptide psrbcS from P. sativum RuBisCo small subunit (Acc.Nr.: X04333) was amplified using PCR with pCL60-srbcS (Bauer et al., 2000) as template vector (primers “psTP Fwd” and “psTP Rev”). The PCR product was cloned into the vector above using NcoI/SmaI. The resulting transformation vector was called RV9. Primers Name sequence (5’-3’) KDEL oligo GCCTGCAGGAAGGACGAGCTCTAGAGGTCACCGCG ASP1 Fwd CAGCGCCTCTCCATGGCCCGGGATGCTTGAAG ASP1 Rev CTATGTCGACATTCCCGATCGTTCAAAC p54 Fwd TAGAATTCGGATCCACGGGTGTGGGCCAACTC p54 Rev CTATTTCATTTTCTCTTGCTTTCGCCACCATGGAG psTP Fwd TCCTCTAGAGTCGACCATGG psTP Rev CAGGTGTGGCCCGGGAAA Transient protoplast assay Cell content of one jar cassava callus tissue (1-2g) was treated with 50ml of enzyme solution A under sterile conditions and incubated at 26°C in the dark for 16h (shaking at ~80rpm). Digested solution was filtered (50µm) and filter was washed with 10ml wash solution B. Protoplasts in flow-through were pelleted (15ml Falcon tubes, 70g, 10min) and washed twice with solution B. Protoplasts were counted (Jessen chamber) and resuspended in salt solution C depending on yield (1 to 3x106 protoplasts /ml). To 1ml of protoplast solution 20µg of plasmid DNA were added and gently mixed. Then 1ml of PEG solution D was added slowly and samples were incubated while gently shaking (RT,

67

5min).Then 6ml of nutrient solution E were added and samples were incubated for recovery (RT, dark, ~80rpm, 40-48h). Protoplasts were concentrated, warmed to 30°C and mixed with an equal part of low-melting-point agarose (2%, 45°C). Final solution was spread on microscopic slides (warmed to 33°C) and cooled to RT. Samples were observed using Confocal Laser Scanning Microscopy (Leica SP1-2) and images were processed using Imaris software (Bitplane AG, Zurich, Switzerland). Each vector was used in at least three independent tranformations and within each batch of transformation several protoplasts were checked for homogenicity and reproducibility of GFP pattern. Solution A (pH=5.7, filter-sterilized) Cellulase RS Onozuka (10g/l), Macerozyme (200mg/l), Pectolyase Y-23 (10mg/l), NAA (1mg/l), 2,4-D (1mg/l), Zeatin (1mg/l), D-Mannitol (91g/l), MES (0.5g/l), Na2 -EDTA (19.3mg/l), FeSO4x7H2O (14mg/l), MgSO4x7H2O (492mg/l), KNO3 (740mg/l), KH2PO4 (34mg/l), CaCl2x2H2O (487.4mg/l). Solution B (pH=5.6-5.8, autoclaved) CaCl2x2H2O (487.4mg/l), KH2PO4 (34mg/l), KNO3 (740mg/l), MgSO4x7H2O (492mg/l), Mannitol (45.5g/l), NaCl (7.3g/l). Solution C (pH=5.8, autoclaved) MgCl2x2H2O (3.05g/l), MES (1g/l), Mannitol (91.1g/l). Solution D (pH=8.0-9.0, autoclaved) PEG 4000 (400g/l), D-Mannitol (72.9g/l), Ca(NO3)2x4H2O (23.6g/l). Solution E (autoclaved) Picloram (10mg/l), MS salts +Vit. (4.4g/l), Glucose (102.6g/l), Mannitol (4.56g/l), Xylitol (30.8g/l), Sorbitol (4.56g/l), Myo-inositol (976mg/l). Plant Material Transformation of cassava (cultivar TMS60444) was conducted using Agrobacterium-mediated gene transfer into friable embryogenic callus (FEC) tissue essentially as described by (Zhang and Gruissem, 2004). Hygromycin-resistant transformants were regenerated in vitro. Three-week old plantlets were transplanted to pots and transferred to the greenhouse. Leaves, roots and storage roots were harvested after 5 months. Previously established transgenic plants expressing cytosolic ASP1 (Zhang et al., 2003) together with wild-type plants (TMS60444) were grown under controlled conditions in a green-house for 3-34 months and harvested at several time points. Molecular analysis Total cassava protein was extracted from leaves and roots of in vitro plantlets using the TRIZOL extraction protocol (Invitrogen). Protein extracts were quantified according to (Bradford, 1976) and 10µg total protein per lane were loaded on a Tricine SDS gel (Schagger and von Jagow, 1987). Western blotting was performed (Sambrook et al., 1989) and ASP1 bands were detected using a polyclonal antibody and ECL detection kits (Amersham Biosciences, Piscataway, USA).

Results

In silico targeting analysis The vector of interest (RV9) was designed using the N-terminal signal sequence of

RuBisCo small subunit in order to localize ASP1 into the plastids. A C-terminal KDEL

sequence was present in the vector which was not predicted to influence plastidal

targeting. Several targeting prediction tools were used in order to confirm in theory

68

the functionality of our construct. All tools used predicted functional targeting to

chloroplasts or plastids (Nielsen et al., 1997; Emanuelsson et al., 2000; Nair and

Rost, 2005; Xie et al., 2005; Hoglund et al., 2006; Pierleoni et al., 2006). LOCtree

was the only software that also predicted the functionality of the KDEL tetrapeptide

as a RER retention signal (Figure 1, A).

TargetP predicted a peptidase cleavage site 56AA downstream of translation

initiation corresponding to the well-characterized cleavage site for the RuBisCo small

subunit. Consequently, a 7AA long linker- peptide (introduced during the cloning

procedure) was predicted to remain attached to the N-terminus of the resulting

protein (Figure 1, B).

Transient expression analysis In order to observe the targeting pattern of plastid-directed ASP1, the gene coding for

eGFP was cloned between the psrbcS transit peptide and our gene of interest. By

using a cassava protoplast transient transformation procedure previously established

in our laboratory (unpublished), a green fluorescence signal could be detected in the

cytosol and in the periphery of the plastid and may be localized primarily in the outer

membrane of the organelle or the intermembrane space. Fluorescence surrounding

plastids was not equally distributed but rather showed distinct spots of high intensity

(Figure 2, A and D).

To understand whether the KDEL signal was involved in this unexpected deposition

pattern, two control vectors were designed and tested. In one of them we removed

the KDEL tetrapeptide and replaced it with an SKL tripeptide (RV9m) which was

reported to have no direct effect on plastidal import while redirecting a fraction of

synthetised pre-proteins to peroxisomes, leading to dual targeting condition

(Hyunjong et al., 2006). Following transient expression of this construct, we observed

a fluorescence pattern similar to the one using the plastid-directed ASP1-KDEL

construct, with fluorescence surrounding spherical organelles and additional

fluorescence from small, unidentified cellular components that we hypothesize could

be peroxisomes (Figure 2, B). Therefore, we conclude that the KDEL peptide is

probably not involved in the observed inhibition of plastid-targeted ASP1 import.

The second control vector had the complete ASP1 coding sequence replaced with

the sporamin coding sequence (RV8), another storage protein which exists in nature

(sweet potato). The plastid targeting signal and the KDEL tetrapeptide remained

69

unchanged. Following transient expression of this new construct, we observed a

homogenous spot-like fluorescence in spherical organelles, suggesting successful

import of modified sporamin in plastids (Figure 2, C).

To investigate whether the observed plastid import inhibition of ASP1 was dependent

on the tissue we were using, we transiently transformed A. thaliana protoplasts with a

modified RV9 construct, in which the p54 endogenous cassava promoter was

substituted with the constitutive CaMV35S promoter. In parallel, we also transformed

A. thaliana protoplasts with a vector encoding plastid-targeted psrbcS-eGFP under

the control of the same promoter (pCL60) (Figure 3). We observed that the control

vector expressed eGFP was clearly imported within chloroplasts. In contrast to this,

the plastid-targeted eGFP-ASP1 fusion did not accumulate and remained confined to

the cytosol.

Taken together, these results suggest that inhibition of complete plastid import for

psrbcS-ASP1 is neither dependent on plant species nor on plastid functionality.

Stable expression analysis To investigate the deposition pattern of plastid-targeted ASP1 in plants, the eGFP

coding sequence was excised from the RV9 vector. The resulting construct was used

for stable transformation and subsequent regeneration of transgenic cassava plants.

Five independent transgenic cassava lines carrying the psrbcS-ASP1-KDEL

expression cassette were regenerated. We could verify stable integration of the

cassette and constitutive gene transcription in both leaves and roots using standard

molecular tools (data not shown).

Protein levels of transgenic cassava roots were visualized and compared on a

Western blot (Figure 4). ASP1 bands were clearly detectable in all four transgenic

lines. Surprisingly, the migration profile of ASP1 protein bands correlated to a protein

size of 14kDa. This figure is 1-2 kDa higher than the weight of the fully processed

ASP1 molecule. The same result could be reproduced using leaf protein extracts

(data not shown).

These protein analysis results indicate that the plastid transit peptide has not been

cleaved off from the ASP1 protein. This, together with our transient expression

observations supports our hypothesis that ASP1 cannot be properly imported into

cassava plastids.

70

Discussion Improving protein content in cassava storage roots and the choice of the most

suitable storage protein to adopt remain major challenges in the cassava research

community. ASP1 has been considered a promising candidate in terms of nutritional

value and is compatible with subcellular targeted expression. Based on previous

observations in A. thaliana the psrbcS signal sequence was chosen in order to

achieve plastid targeting and to maintain an active cleavage site for the stromal

processing peptidase (Van den Broeck et al., 1985; Bedard and Jarvis, 2005). The

signal itself was functional when substituting ASP1 with sporamin and directs the

respective target proteins into the plastidal stroma. The C-terminal KDEL tetrapeptide

did not seem to interfere with that process either. Consequently, here we could show

for the first time that a protein coupled to psrbcS could not be imported into plastidal

stroma but rather accumulates at the outer envelope membrane or the inter-

membrane space in non-photosynthetic cells. It has been shown that the TP of RbcS

in actively photosynthetising cells specifically interacts with Toc34 or Toc159

depending on phosphorylation of the TP (Sveshnikova et al., 2000; Becker et al.,

2004) and that both interactions are involved in the import of both photosynthetic and

non-photosynthetic preproteins (reviewed in Bedard and Jarvis, 2005). Therefore,

one explanation for our observations in cassava callus tissue could be that plastid

import is inhibited in this specific tissue. Nevertheless, our in planta results obtained

from protein analysis in both leaves and roots which show the incorrect processing of

targeted ASP1 indicates that complete plastid import is also affected in green tissue.

It has been shown that nuclear-encoded plastidial precursor proteins compete for

the same import machinery (Row and Gray, 2001) but this fact alone cannot explain

the complete absence of imported ASP1 since we would expect at least partial

stromal import. Thus we speculate that inhibited plastid import could be correlated to

our protein’s structural properties. ASP1 was designed to form a very stable tertiary

structure in the absence of disulfide bridges comprised of four helical repeating units,

each 20 amino acids long (Bhatnagar, 1992). The stability of these interactions may

lead to a partial folding of the protein after cytosolic translation, negatively affecting

the required unfolding procedure which occurs prior to plastidial import. The size of

ASP1 does not allow for import of a partially folded protein (Clark and Theg, 1997).

71

Currently we cannot rule out completely that linker and/or transit peptide contribute to

this effect.

Further experiments such as the expression of truncated ASP1 versions or the

testing of other plastid targeting signals would be helpful to understand if indeed

import inhibition is due to ASP1’s peculiar structure or whether it is the signal we

have chosen to test that is not suitable for plastid targeting of ASP1. Nevertheless, it

currently seems that the ASP1 protein cannot be imported into plastids by using the

psrbcS signal peptide.

References Bauer J, Chen K, Hiltbunner A, Wehrli E, Eugster M, Schnell D, Kessler F (2000)

The major protein import receptor of plastids is essential for chloroplast biogenesis. Nature 403: 203-207

Becker T, Jelic M, Vojta A, Radunz A, Soll J, Schleiff E (2004) Preprotein recognition by the Toc complex. EMBO Journal 23: 520-530

Bedard J, Jarvis P (2005) Recognition and envelope translocation of chloroplast preproteins. Journal of Experimental Botany 56: 2287-2320

Bhatnagar D (1992) Molecular approaches to improving food quality and safety. Van Nostrand Reinhold, New York

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72: 248-254

Clark SA, Theg SM (1997) A folded protein can be transported across the chloroplast envelope and thylakoid membranes. Molecular Biology of the Cell 8: 923-934

Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762

Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. Journal of Molecular Biology 300: 1005-1016

FAO (2004) Agricultural biotechnology Meeting the needs of the poor? Food and Agriculture Organization of the United Nations FAO, Rome

FAO (2005) FAOSTAT data. In, Vol 2006 Hoglund A, Donnes P, Blum T, Adolph HW, Kohlbacher O (2006) MultiLoc:

prediction of protein subcellular localization using N-terminal targeting sequences, sequence motifs and amino acid composition. Bioinformatics 22: 1158-1165

Hyunjong B, Lee DS, Hwang I (2006) Dual targeting of xylanase to chloroplasts and peroxisomes as a means to increase protein accumulation in plant cells. Journal of Experimental Botany 57: 161-169

Nair R, Rost B (2005) Mimicking cellular sorting improves prediction of subcellular localization. Journal of Molecular Biology 348: 85-100

72

Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10: 1-6

Pierleoni A, Martelli PL, Fariselli P, Casadio R (2006) BaCelLo: a balanced subcellular localization predictor. Bioinformatics 22: e408-416

Row PE, Gray JC (2001) Chloroplast precursor proteins compete to form early import intermediates in isolated pea chloroplasts. Journal of Experimental Botany 52: 47-56

Sambrook J, Fritsch E, Maniatis T (1989) Molecular Cloning: a laboratory manual. CSH Laboratory Press, Cold Spring Harbor, NY

Schagger H, von Jagow G (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Analytical Biochemistry 166: 368-379

Stupak M, Vanderschuren H, Gruissem W, Zhang P (2006) Biotechnological approaches to cassava protein improvement. Trends in Food Science & Technology 17: 634-641

Sveshnikova N, Grimm R, Soll J, Schleiff E (2000) Topology studies of the chloroplast protein import channel Toc75. Biological Chemistry 381: 687-693

Van den Broeck G, Timko MP, Kausch AP, Cashmore AR, Van Montagu M, Herrera-Estrella L (1985) Targeting of a foreign protein to chloroplasts by fusion to the transit peptide from the small subunit of ribulose 1,5-bisphosphate carboxylase. Nature 313: 358-363

Xie D, Li A, Wang M, Fan Z, Feng H (2005) LOCSVMPSI: a web server for subcellular localization of eukaryotic proteins using SVM and profile of PSI-BLAST. Nucleic Acids Research 33: W105-110

Zhang P, Bohl-Zenger S, Puonti-Kaerlas J, Potrykus I, Gruissem W (2003) Two cassava promoters related to vascular expression and storage root formation. Planta 218: 192-203

Zhang P, Gruissem W (2004) Production of transgenic cassava (Manihot esculenta Crantz). In Transgenic Crops of the World - Essential Protocols. Curtis, Ian S., pp 301-319

Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250

73

Figures and tables Figure 1

Figu

re 1

: (A

) P

redi

cted

sub

cellu

lar

loca

lizat

ion

patte

rn o

f ps

Rbc

S:A

SP

1:K

DE

L us

ing

seve

ral

pred

ictio

n to

ols.

Pre

dict

ed p

eptid

ase

clea

vage

site

dow

nstre

am o

f tra

nsla

tion

initi

atio

n is

sho

wn.

Opt

ion

in s

ome

tool

s no

t ava

ilabl

e (N

.A.);

Tra

nsit

pept

ide

sequ

ence

and

pro

tein

lin

ker u

sed

for e

xper

imen

ts (B

).

74

Figure 2

Figu

re 2

: Tr

ansf

orm

ed c

allu

s pr

otop

last

s of

M. e

scul

enta

. (A

) Lo

caliz

atio

n pa

ttern

of p

sRbc

S:G

FP:A

SP

1:K

DE

L (R

V9)

sur

roun

ding

pla

stid

s in

cas

sava

pr

otop

last

s. F

luor

esce

nce

hots

pots

can

be

seen

with

in c

ircul

ar s

igna

ls (

red

arro

w).

(B)

Loca

lizat

ion

patte

rn o

f ps

Rbc

S:G

FP:A

SP

1:S

KL

(RV9

m)

as

circ

ular

sig

nals

(red

arr

ow) a

nd p

oint

s of

fluo

resc

ence

, bei

ng p

roba

bly

pero

xiso

mes

. (C

) Loc

alis

atio

n pa

ttern

of p

sRbc

S:G

FP:S

pora

min

:KD

EL

(RV

10) a

s ev

enly

dis

tribu

ted

sign

al w

ithin

sph

eric

al p

last

ids.

(D

) 3D

rec

onst

ruct

ion

of a

pro

topl

ast e

xpre

ssin

g ps

Rbc

S:G

FP:A

SP

1:K

DE

L (R

V9)

, as

seen

bef

ore

in

(A).

Fluo

resc

ence

hot

spot

s ca

n be

see

n w

ithin

nea

rly e

very

circ

ular

sig

nal (

red

arro

ws)

.

75

Figure 3

Figu

re 3

: Tr

ansf

orm

ed l

eaf

prot

opla

sts

of A

. th

alia

na.

(AS

P1)

Loca

lizat

ion

patte

rn o

f ps

Rbc

S:G

FP:A

SP

1:K

DE

L (R

V9)

with

in c

ytos

ol.

No

impo

rt or

ac

cum

ulat

ion

at t

he p

erip

hery

of

plas

tids

coul

d be

see

n. (

C1-

C6)

Loc

aliz

atio

n pa

ttern

of

cont

rol c

onst

ruct

psR

bcS

:GFP

(pC

L60)

with

in c

ytos

ol a

nd in

pl

astid

s. I

n pa

rticu

lar

som

e flu

ores

cenc

e sp

ots

wer

e m

ore

inte

nsiv

e an

d di

d no

t co

loca

lize

com

plet

ely

with

chl

orop

hyll

auto

fluor

esce

nce

indi

catin

g st

rom

al G

FP d

epos

ition

. (A)

Brig

htfie

ld, (

B) G

FP::p

rote

in s

igna

l, (C

) chl

orop

hyll

auto

fluor

esce

nce,

(D) o

verla

y of

(B) a

nd (C

).

76

Figure 4

Fi

gure

4: W

este

rn b

lot a

gain

st A

SP

1 pr

otei

n in

tota

l cas

sava

root

pro

tein

ext

ract

s. (9

-1, 9

-2, 9

-5,

9-7

) Fou

r tra

nsge

nic

lines

exp

ress

ing

Rbc

S:A

SP

1:K

DE

L.(C

) Con

trol l

ine

expr

essi

ng

AS

P1:

KD

EL

with

out t

rans

it pe

ptid

e. (W

T) w

ildty

pe c

ontro

l lin

e

77

IX. Evaluation of vacuoles as a suitable protein storage place in cassava

Target Journal: Journal of Plant Research (as short communication) Authors: Stupak M, Faso C, Gruissem W, Zhang P

Introduction Cassava plays an important role in global food supply especially in developing

countries (Cock, 1982). Besides its leaves consumers mainly appreciate the starchy

storage roots which are rich in carbohydrates but relatively low in protein

(Balagopalan et al., 1988). This leads to a serious concern for an adequate protein

supply for those communities of consumers who heavily rely on cassava for nutrition.

Consequently, those consumers are at risk of developing Protein-Energy-Malnutrition

(PEM). Recently, strategies on how to tackle this problem have been discussed and

reviewed (Stupak et al., 2006). In our laboratory, we focus on expression of

heterologous storage proteins in cassava storage roots for the prevention of PEM.

Several protein candidates have been tested for their potential to increase selective

content of essential amino acids, in addition to gaining an overall increase in protein

content, by specific subcellular targeting to the rough endoplasmic reticulum (Chapter

seven). In this report, ASP1 and sporamin have both been targeted to the vacuole in

cassava cells. To our knowledge, this is the first report concerning the exploitation of

the cassava vacuole as a site for recombinant protein accumulation. In fact there is

yet no data available on protein stability in this organelle in cassava storage roots.

In recent years at least two distinct types of vacuoles were found to exist (Paris et al.,

1996; Jauh et al., 1999) and their relative abundance seems to be dependent on

many different factors including species, type and age of the tissue (Park et al., 2004;

Martinoia et al., 2007). One type is more specialized in protein storage (PSVs) while

the other type is scarcely involved in protein accumulation and is defined as a lytic

vacuole. However, even combinations of both types of organelle have been reported

(Jiang et al., 2001) making functional predictions in non-model plants like cassava

problematic. Consequently, the rationale behind our vacuolar targeting strategy was

to imitate conditions in crops which are known to develop storage organs similar to

cassava storage roots. Sweet potato (Ipomoea batatus, Convolvulaceae) is one of

78

these crop candidates and naturally accumulates sporamin, a protein reported to

account for over 80 % of the total protein content in sweet potato (Maeshima et al.,

1985). Sporamin naturally accumulates in lytic vacuoles and its signal sequence can

be reliably used to target other heterologous proteins towards this organelle

(Matsuoka and Nakamura, 1991; Koide et al., 1997). In this paper we initiate a first

evaluation of vacuoles as suitable protein storage compartments in cassava using

the sporamin-derived targeting signal.

Material and Methods Vector construction Transformation vectors were designed using pCAMBIA1301 (Cambia, Australia) as a backbone (for vector maps see chapter XI). A synthetic oligo (“KDEL oligo”) containing a KDEL sequence followed by a Stop-codon, was digested with PstI and BstEII and cloned into our pCAMBIA backbone. ASP1 gene was amplified from pCASP1 (Zhang et al., 2003) using primers “ASP1 Fwd” and “ASP1 Rev” and cloned into our KDEL-backbone using SmaI/SalI. The 5’ signal sequence of the sporamin gene (Acc.Nr.: DQ195772) was amplified using PCR (primers “SporSS Fwd” and “SporSS Rev”) on the plasmid PspoAF-1 (Matsuoka and Nakamura, 1991). The PCR product was digested with BspHI/SmaI and cloned into the previous vector digested with NcoI/SmaI (RV4). The sporamin gene itself was amplified on the same donor plasmid (primers “Spor Fwd” and “Spor Rev”) and inserted into the vector backbone using SmaI/PstI thus replacing ASP1 (RV8). The endogenous cassava promoter p54 was amplified with PCR from pCP54GUS (Zhang et al., 2003) using primers “p54 Fwd” and “p54 Rev” and cloned into the cassette using EcoRI/NcoI of both RV4 and RV8. Primers Name sequence (5’-3’) KDEL oligo GCCTGCAGGAAGGACGAGCTCTAGAGGTCACCGCG ASP1 Fwd CAGCGCCTCTCCATGGCCCGGGATGCTTGAAG ASP1 Rev CTATGTCGACATTCCCGATCGTTCAAAC p54 Fwd TAGAATTCGGATCCACGGGTGTGGGCCAACTC p54 Rev CTATTTCATTTTCTCTTGCTTTCGCCACCATGGAG Spor Fwd AACCCGGGTCCTCTGAAACTCCAGTAC Spor Rev GTCATCAAACCTACCGATGTCTGCAGTG SporSS Fwd CATCATGAAAGCCCTCACACTGG SporSS Rev CCCCACCACACACGAACCCGGGTC PP2A-RT Fwd TGTGGAAATATGGCATCAATTTTGG PP2A-RT Rev GCAACAGAAAGCCGTGTCAC ASP1-RT Fwd CCCGGGATGCTTGAAGAGC ASP1-RT Rev CTAGAGCTCGTCCTTCCTGC Plant Material Transformation of cassava (cultivar TMS60444) was conducted using Agrobacterium-mediated gene transfer into friable embryogenic callus (FEC) tissue essentially as described by (Zhang and Gruissem, 2004). Hygromycin-resistant transformants were regenerated in vitro. Three-week old plantlets were transplanted to pots and transferred to the greenhouse. Storage roots of line RV4+/8 (n=2) and WT (n=4) were harvested after 5 months.

79

Transient protoplast assay Cell content of one jar cassava callus tissue (1-2g) was treated with 50ml of enzyme solution A under sterile conditions and incubated at 26°C in the dark for 16h (shaking at ~80rpm). Digested solution was filtered (50µm) and filter was washed with 10ml wash solution B. Protoplasts in flow-through were pelleted (15ml Falcon tubes, 70g, 10min) and washed twice with solution B. Protoplasts were counted (Jessen chamber) and resuspended in salt solution C depending on yield (1 to 3x106 protoplasts /ml). To 1ml of protoplast solution 20µg of plasmid DNA were added and gently mixed. Then 1ml of PEG solution D was added slowly and samples were incubated while gently shaking (RT, 5min).Then 6ml of nutrient solution E were added and samples were incubated for recovery (RT, dark, ~80rpm, 40-48h). Protoplasts were concentrated, warmed to 30°C and mixed with an equal part of low-melting-point agarose (2%, 45°C). Final solution was spread on microscopic slides (warmed to 33°C) and cooled to RT. Samples were observed using Confocal Laser Scanning Microscopy (Leica SP1-2) and images were processed using Imaris software (Bitplane AG, Zurich, Switzerland). Each vector was used in at least three independent tranformations and within each batch of transformation several protoplasts were checked for homogenicity and reproducibility of GFP pattern. Solution A (pH=5.7, filter-sterilized) Cellulase RS Onozuka (10g/l), Macerozyme (200mg/l), Pectolyase Y-23 (10mg/l), NAA (1mg/l), 2,4-D (1mg/l), Zeatin (1mg/l), D-Mannitol (91g/l), MES (0.5g/l), Na2 -EDTA (19.3mg/l), FeSO4x7H2O (14mg/l), MgSO4x7H2O (492mg/l), KNO3 (740mg/l), KH2PO4 (34mg/l), CaCl2x2H2O (487.4mg/l). Solution B (pH=5.6-5.8, autoclaved) CaCl2x2H2O (487.4mg/l), KH2PO4 (34mg/l), KNO3 (740mg/l), MgSO4x7H2O (492mg/l), Mannitol (45.5g/l), NaCl (7.3g/l). Solution C (pH=5.8, autoclaved) MgCl2x2H2O (3.05g/l), MES (1g/l), Mannitol (91.1g/l). Solution D (pH=8.0-9.0, autoclaved) PEG 4000 (400g/l), D-Mannitol (72.9g/l), Ca(NO3)2x4H2O (23.6g/l). Solution E (autoclaved) Picloram (10mg/l), MS salts +Vit. (4.4g/l), Glucose (102.6g/l), Mannitol (4.56g/l), Xylitol (30.8g/l), Sorbitol (4.56g/l), Myo-inositol (976mg/l). Molecular analysis Total cassava RNA and protein were extracted from leaves and roots of in vitro plantlets using the TRIZOL extraction protocol (Invitrogen). 2µg total RNA per sample was further treated with Super Script II Reverse Transcriptase (Invitrogen) according to manufacturer’s instructions. Real-time PCR on Cassava cDNA samples was carried out on a LightCycler 2.0 machine (F. Hoffmann-La Roche Ltd, Basel, Switzerland) using Serine/Threonine protein phosphatase PP2A catalytic subunit 2A (Acc.Nr. BM259718) as reference gene (primers “PP2A-RT Fwd” and “PP2A-RT Rev”) with ASP1 as gene of interest (primers “ASP1-RT Fwd” and “ASP1-RT Rev”). Results were processed for normalization using Microsoft Excel. Protein extracts were quantified according to (Bradford, 1976) and 10µg total protein were loaded per lane on a Tricine SDS gel (Schagger and von Jagow, 1987). Western blot was performed (Sambrook et al., 1989) and ASP1 bands were detected using a polyclonal antibody and ECL detection kits (Amersham Biosciences, Piscataway, USA). Amino-Acid Analysis Storage roots were peeled at the root cortex, sliced and freeze-dried for 24h while leaves were lyophilized directly. All plant material was ground afterwards to a homogenous powder and stored at -80◦C until use. Samples containing 1mg total protein were weighed and hydrolyzed with 2ml of 6M HCl for 24h at 110◦C in an oil bath using Argon as inert gas. After hydrolysis samples were evaporated (Rotavapor, BÜCHI Labortechnik AG, Switzerland) at ≤ 50°C, resuspended in 5ml sample buffer (0.16M Li-acetate-buffer, pH 2.20; No. 5.403.047, Laborservice Onken GmbH, Gründau-Breitenborn, Germany) and filtered through a 0.45-µm PVDF membrane

80

(Millipore AG, Switzerland). 50µl of the solution were injected into an automated Biochrom30 Analyser (Laborservice Onken) and separated afterwards by ion exchange chromatography (Lithium High Resolution Column, 4.0x125mm, No. 5.503.611, Laborservice Onken) based on a 5 buffer system. Following separation, amino acids were derivatized with ninhydrin and detected at 570nm and 440nm. Quantification was based on external standards (Cat-No. 20088ZZ, Pierce, Perbio Science Switzerland SA, Lausanne, Switzerland) consisting of a mixture of 5.0nmol of each amino acid in 50µl loading buffer. Each analysis was performed with two technical replicates and several biological replicates (as described in section “plant material“).

Results

Vacuoles can accumulate storage proteins In our experiments, ASP1 was coupled to two subcellular localization signals.

We added an N-terminal sporamin signal sequence and an RER retention signal was

engineered at the C-terminus of ASP1. We wanted to investigate if protein

accumulation in cassava cells could be distributed between two organelles of the

secretory pathway. Our results from transient expression assays in cassava

protoplasts clearly show that eGFP derived signals accumulate both in vacuoles and

in the RER simultaneously (Figure1, A). Organelle identification was achieved by co-

expression of an ER-resident chaperone (BIP) coupled to RFP (Figure1, column 3).

In order to elucidate whether an ER retention signal is mandatory for dual targeting

we cloned a TAG stop codon immediately upstream of the KDEL tetrapeptide. The

resulting vector (RV4-) triggered GFP protein accumulation in vacuoles only (Figure1,

B). Co-localisation with BIP resulted in no overlapping signals thus indicating a

complete endoplasmic flow-through of our protein.

In order to check whether dual targeting to vacuoles and ER was a protein-

dependent observation, we decided to test these conditions by using another storage

protein. Therefore ASP1 was exchanged in our transformation vector with the sweet-

potato derived storage protein sporamin. The resulting construct (RV8) successfully

triggered green fluorescence both in vacuoles and endoplasmic reticulum, in a

manner comparable to ASP1 (Figure1, C). Co-localisation with BIP identified the part

of the signal derived from the RER.

Our transient expression data suggest that dual targeting in cassava to vacuoles and

ER leads to successful protein accumulation in both organelles and is most likely not

protein-specific.

81

Stable transformation Mature vacuoles derived from a proliferated plant tissue can have altered physico-

chemical properties when comparing them to those derived from undifferentiated

callus cells. This required us to investigate whether expression in cassava storage

roots would not interfere with the accumulation of these proteins within cassava

vacuoles. We therefore used our constructs for stable cassava transformation and

regeneration. The construct carrying the ASP1-KDEL gene (RV4+) was successfully

transferred into cassava and three lines could be regenerated. Molecular

characterisation of these lines (Figure2) showed that one line (RV4+/8) had the ASP1

gene expressed constitutively both in leaves and roots, one line in leaves only

(RV4+/9) and one line neither in leaves nor in roots (RV4+/1). Protein accumulation in

roots of line RV4+/8 could be confirmed. The migration speed of the ASP1 protein

band (12-13kD) corresponds to the molecular weight of a processed ASP1-KDEL

protein without the N-terminal signal sequence, indicating the entrance of the protein

into the secretory pathway following the correct cleavage of the sporamin-derived

signal sequence.

Storage root analysis Although there was only one line (RV4+/8) available expressing the gene of interest

we decided to compare the protein production performance of its storage roots with

untransformed ones. Roots of line RV4+/8 appeared to have significantly higher total

protein levels than wildtype roots. We found 2.70(±0.44)g protein per 100g sample in

RV4+/8 and only 1.33(±0.16)g/100g in WT corresponding to a protein increase of

more than twofold.

Discussion Within this paper we could show that the sporamin signal sequence is functional in

cassava and triggers vacuolar protein deposition most likely in the central, lytic

vacuole. The combination of this signal sequence with an ER retention signal has

been already shown to lead to an increased protein accumulation in Arabidopsis

seeds (Yang et al., 2005) and tobacco leaves (Ramirez et al., 2003). Our results from

transient expression in protoplasts support the feasibility of this dual targeting

approach for both of our tested storage proteins. However, comparative conclusions

between ASP1 and sporamin are not feasible with this approach due to a high

variation in protoplast transformation efficiency and would require e.g. the integration

82

of an internal reference (fluorescence) marker like BiP:RFP in the same expression

cassette for expression levels to be compared effectively.

Furthermore, long-term protein stability and turn-over cannot be predicted based

exclusively on transient expression data and thus stable transformation was required

for reliable conclusions. Although routine transformation procedures have been

established (Raemakers et al., 1997; Zhang and Gruissem, 2004) cassava

transformation and regeneration remains a challenging task. Nevertheless, the data

currently available from line RV4+/8 supports our transient expression findings that

Spor:ASP1:KDEL is stably expressed and accumulates in cassava roots. The

migration speed of the expressed protein on a Western blot corresponds to the one

of a fully processed storage protein. Had cleavage not occurred, we would have

expected a band of 16.2kD whilst cleavage of the signal sequence would result in a

13.9kD band. Upon vacuolar protein import further pro-peptide cleavage would result

in a 12kD band which seems to correlate best with our band-size (Woolford et al.,

1986; Matsuoka and Nakamura, 1991). As a consequence the band corresponding to

RER-retained ASP1 could not be clearly identified using Western-blot analysis. In

order to clarify the subcellular storage place of ASP1 in transgenic cassava roots

stable integration of a reporter gene or the use of post-transformation visualization

techniques such as electron microscopy would be helpful. However, storage root

analysis of the transgenic line RV4+/8 confirms the potential of vacuolar targeting in

cassava to obtain a strong increase in total protein. The upcoming regeneration of

more lines expressing the ASP1 gene and the targeting of proteins to both the RER

and vacuoles will help us to understand whether the specific targeting strategy that

we have decided to implement is directly responsible for the sharp increase in protein

quantity that we have observed.

Acknowledgements We would like to thank Prof. Yeh for kindly providing us the plasmid PspoAF-1, Prof.

Brandizzi and Prof. Hwang for the BiP::RFP control vector. Furthermore we would

like to thank Hanna Schneider for technical assistance with Amino Acid Analysis.

83

References Balagopalan C, Padmaja G, Nanda S, Morthy S (1988) Cassava nutrition and

toxicity. In Cassava in Food, Feed and Industry. CRC Press, Boca Raton, Florida

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72: 248-254

Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762

Jauh GY, Phillips TE, Rogers JC (1999) Tonoplast intrinsic protein isoforms as markers for vacuolar functions. Plant Cell 11: 1867-1882

Jiang L, Phillips TE, Hamm CA, Drozdowicz YM, Rea PA, Maeshima M, Rogers SW, Rogers JC (2001) The protein storage vacuole: a unique compound organelle. Journal of Cell Biology 155: 991-1002

Koide Y, Hirano H, Matsuoka K, Nakamura K (1997) The N-terminal propeptide of the precursor to sporamin acts as a vacuole-targeting signal even at the C terminus of the mature part in tobacco cells. Plant Physiology 114: 863-870

Maeshima M, Sasaki T, Asahi T (1985) Characterization of Major Proteins in Sweet-Potato Tuberous Roots. Phytochemistry 24: 1899-1902

Martinoia E, Maeshima M, Neuhaus HE (2007) Vacuolar transporters and their essential role in plant metabolism. Journal of Experimental Botany 58: 83-102

Matsuoka K, Nakamura K (1991) Propeptide of a precursor to a plant vacuolar protein required for vacuolar targeting. Proceedings of the National Academy of Sciences of the United States of America 88: 834-838

Paris N, Stanley CM, Jones RL, Rogers JC (1996) Plant cells contain two functionally distinct vacuolar compartments. Cell 85: 563-572

Park M, Kim SJ, Vitale A, Hwang I (2004) Identification of the protein storage vacuole and protein targeting to the vacuole in leaf cells of three plant species. Plant Physiology 134: 625-639

Raemakers CJJM, Sofiari E, Jacobsen E, Visser RGF (1997) Regeneration and transformation of cassava. Euphytica 96: 153-161

Ramirez N, Rodriguez M, Ayala M, Cremata J, Perez M, Martinez A, Linares M, Hevia Y, Paez R, Valdes R, Gavilondo JV, Selman-Housein G (2003) Expression and characterization of an anti-(hepatitis B surface antigen) glycosylated mouse antibody in transgenic tobacco (Nicotiana tabacum) plants and its use in the immunopurification of its target antigen. Biotechnology and Applied Biochemistry 38: 223-230

Sambrook J, Fritsch E, Maniatis T (1989) Molecular Cloning: a laboratory manual. CSH Laboratory Press, Cold Spring Harbor, NY

Schagger H, von Jagow G (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Analytical Biochemistry 166: 368-379

Stupak M, Vanderschuren H, Gruissem W, Zhang P (2006) Biotechnological approaches to cassava protein improvement. Trends in Food Science & Technology 17: 634-641

Woolford CA, Daniels LB, Park FJ, Jones EW, Van Arsdell JN, Innis MA (1986) The PEP4 gene encodes an aspartyl protease implicated in the posttranslational regulation of Saccharomyces cerevisiae vacuolar hydrolases. Molecular and Cellular Biology 6: 2500-2510

84

Yang J, Barr LA, Fahnestock SR, Liu ZB (2005) High yield recombinant silk-like protein production in transgenic plants through protein targeting. Transgenic Research 14: 313-324

Zhang P, Bohl-Zenger S, Puonti-Kaerlas J, Potrykus I, Gruissem W (2003) Two cassava promoters related to vascular expression and storage root formation. Planta 218: 192-203

Zhang P, Gruissem W (2004) Production of transgenic cassava (Manihot esculenta Crantz). In Transgenic Crops of the World - Essential Protocols. Curtis, Ian S., pp 301-319

Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250

85

Figures and tables Figure 1

Figu

re 1

: Vac

uola

r tar

getin

g of

sto

rage

pro

tein

s sp

oram

in a

nd A

SP1

coup

led

to e

GFP

in c

assa

va p

roto

plas

ts. I

n or

der t

o tri

gger

ta

rget

ing

the

spor

amin

sig

nal s

eque

nce

was

use

d. S

cale

bar

is 1

0µm

. (A

) Loc

aliz

atio

n pa

ttern

of S

S:G

FP:A

SP

1:K

DE

L (R

V4)

in

vacu

oles

and

ER

. (B

) Lo

caliz

atio

n pa

ttern

of S

S:G

FP:A

SP

1 (R

V4- ).

With

out E

R r

eten

tion

sign

al c

an b

e fo

und

in v

acuo

les

only

. (C

) Lo

caliz

atio

n pa

ttern

of

SS

:GFP

:spo

ram

in:K

DEL

(R

V8)

in

vacu

oles

and

ER

. (1

) B

right

field

, (2

) G

FP:p

rote

in s

igna

l, (3

) B

iP:R

FP s

igna

l for

ER

, (4)

ove

rlay

of (2

) + (3

).

86

Figure 2

Figu

re 2

: Mol

ecul

ar c

hara

cter

izat

ion

of c

assa

va li

nes

trans

form

ed w

ith S

pora

min

SS

-AS

P1-

KD

EL.

Top

par

t: re

lativ

e A

SP

1 tra

nscr

ipt a

bund

ance

of 3

di

ffere

nt li

nes

usin

g R

eal-t

ime

PC

R in

leav

es a

nd ro

ots.

Bot

tom

par

t: P

rote

in a

bund

ance

in y

oung

root

s.

87

X. Discussion and Perspectives Genetic engineering has been the method of choice to express foreign genes coding

for storage proteins in crop plants (reviewed in Beauregard and Hefford, 2006).

Unfortunately this has had only limited success; Chakraborty et al. (2000) report a

48% increase in total protein in transgenic potato tubers, whereas De Jaeger et al.

(2002) report increases of 36.5% in A. thaliana seeds and only a 4% increase was

achieved in canola seeds (Altenbach et al., 1992). The aim of this study was to

increase total protein content in cassava storage roots by up to four fold, as directed

by the BioCassavaPlus initiative. In order to achieve this goal, reliable measurements

of the protein status quo were needed. Here we present for the first time extensive

protein and amino acid data for cassava cultivar TMS60444. This complements

findings from studies that used other cultivars, mainly from South-America (Ceballos

et al., 2006).

Interestingly, we have shown that root protein levels can vary up to 23% between

biological replicates and depend on the time of harvest. This must be taken into

consideration in future experiments when analysing the protein content of cassava

storage roots. To date, studies have not applied uniformed standards for this issue,

often opting to determine crude protein content using the Kjeldahl Nitrogen method

(Yeoh and Chew, 1977; Gomez and Noma, 1986). This provides only an estimate

since nitrogen to protein conversion factors have been shown to vary significantly in

cassava (Yeoh and Truong, 1996). More recently, results have been obtained directly

from analysing anhydrous amino acids. Unfortunately, even these studies follow

different standards of sample preparation, leading most probably to incomparable

results. For example, Ngudi et al. (2002) and our own lab lyophilized cassava flour

that had been subjected to acid hydrolysis, whereas Nassar and Sousa (2007) first

extracted root proteins that were then hydrolyzed. It is apparent that a standardized

protocol describing protein analysis which is based on established protocols (AOAC,

1997) is critical to normalize results obtained from different laboratories.

Based on results obtained from amino acid analysis of spiked cassava samples, we

show that SAA from cassava storage roots cannot be reliably quantified using

88

standard amino acid analysis without performic acid pre-oxidation. The available

literature does not address this issue exhaustively, resulting usually in very low

values for SAA (Yeoh and Chew, 1977; Ngudi et al., 2002; Zhang et al., 2003;

Nassar and Sousa, 2007). Whether pre-oxidation with performic acid would have

resulted in a more reliable quantification has not been examined here but at least one

available reference value would suggest that for cassava. Consequently, we propose

that future experiments are conducted using methods reliable for SAA quantification,

such as XRFS or sample pre-oxidation with performic acid, as highlighted in this

study.

One aim of the project was to improve the protein content by expressing ASP1,

sporamin and zeolin targeted to vacuoles, ER and plastids. We show that all three

storage proteins can accumulate in the ER, while zeolin can also be found in lytic

vacuoles. This finding contradicts data from Mainieri et al. (2004), who reported that

zeolin accumulates within insoluble and stable ER-derived protein bodies. Currently it

is not clear whether root cells of cassava are able to form protein bodies at all and

requires further investigation. Notably, in transgenic plants the superiority of ER

retention in comparison to cytosolic deposition could be shown, at least for ASP1,

resulting in a much higher protein accumulation both in leaves and roots. However, a

phenotypic distortion was observed in all plants expressing ASP1 but this

phenomenon is currently not understood and could be linked to either tissue-culture

induced somaclonal variation and/or a side effect of the construct. Current thinking

suggests the latter explanation is more probable for this deleterious effect. Firstly, the

literature regarding somaclonal variation in cassava does not support the high

frequency of phenotypic disorder we observed in this cultivar (Raemakers et al.,

2001; Schreuder et al., 2001; Raemakers et al., 2007). Secondly, two lines that

contained the silenced transgene were comparable in appearance to untransformed

plants. Finally, propagation via stem-cuttings in the glasshouse did not induce a

partial recovery of affected plants, as would be expected if the phenotype was due to

somaclonal variation. It is clear that a detailed analysis of the affected plants is

required to determine the reason why the construct should have a negative effect.

This would also offer insights into the mechanism behind protein transport and

accumulation in cassava roots.

89

Notably, storage roots of several transgenic lines contained significantly elevated

levels of most amino acids. Line RV3-1B had on average a 15% increase and line

RV3-1A was greater still at approximately 27%. Total protein increased only

moderately by 7% and 14% due to a significant decrease in levels of

glutamate/glutamine. We could report here that arginine plays a crucial role as

component of the total protein fraction since high protein values were coupled to high

levels of arginine. We reported here up to 14-fold increased levels of Arg compared

to WT in high protein cassava flour and Nassar and Sousa (2007) measured a 6-8

fold increase in two of their high protein cassava hybrids supporting the idea that

higher arginine levels correlate with higher total protein content. The ongoing

generation of more transgenic lines will be helpful to understand the cause of this

increase and whether the effect can be uncoupled from any phenotypic abnormality.

Besides the ER, plastids were considered as a potential cellular storage place for

exogenous proteins and subsequently tested here for their accumulation potential.

Interestingly, our results strongly suggest that ASP1 cannot be properly imported into

plastidal stroma but rather accumulates at the plastid membrane or inter-membrane

space. This has never been reported so far for any storage protein. Instead it has

been shown that import efficiency can be reduced after partial elimination of C-

terminal sequences of the transit peptide (Lee et al., 2002). Consequently, a minimal

length of 73AA of the A. thaliana homologue is required for effective import, while the

transit peptide from P. sativum was reported to be effective with at least 57AA (Van

den Broeck et al., 1985). Independently of the genetic source proteins with a non-

functional transit peptide were always found in the cytosol but not in the inter-

membrane space of plastids. This suggests that fusion proteins studied within this

thesis are in fact coupled to a functional transit peptide successfully directing their

target towards plastids. But at the plastids further stromal import would be inhibited

due to other factors not related to the transit peptide such as the structure of the

ASP1 protein.

The third sub-cellular protein location in cassava we examined here were vacuoles.

Despite the ongoing discussion regarding development of different types of vacuoles

(Martinoia et al., 2007) we could show with our approach that storage proteins can be

targeted to and accumulated within them. Whether the addition of an ER retention

90

signal has an influence on final protein yield needs to be examined further but

currently our data suggests a complete vacuolar deposition in planta. Eventually,

increased abundance of the introduced storage protein might be achieved in the next

generation of transformants.

Further research is required to determine the most suitable cellular location for

storage protein accumulation in cassava cells and it is likely that this will be protein

dependent. However, research conducted during this thesis provided the answer to

many important questions on the way and contributed significantly towards

understanding of current limitations. The ongoing sequencing project of the cassava

genome will provide essential data to gain further insights into the molecular

mechanisms behind protein accumulation and thus lead to the establishment of long

term strategies to improve the nutritional value of cassava storage roots (Raven et

al., 2006).

Altenbach SB, Kuo CC, Staraci LC, Pearson KW, Wainwright C, Georgescu A, Townsend J (1992) Accumulation of a Brazil nut albumin in seeds of transgenic canola results in enhanced levels of seed protein methionine. Plant Molecular Biology 18: 235-245

AOAC (1997) Official methods of analysis of AOAC international, Ed 16 Vol 3. Elsevier, Amsterdam

Beauregard M, Hefford MA (2006) Enhancement of essential amino acid contents in crops by genetic engineering and protein design. Plant Biotechnology Journal 4: 561-574

Ceballos H, Sanchez T, Chavez AL, Iglesias C, Debouck D, Mafla G, Tohme J (2006) Variation in crude protein content in cassava (Manihot esculenta Crantz) roots. Journal of Food Composition and Analysis 19: 589-593

Chakraborty S, Chakraborty N, Datta A (2000) Increased nutritive value of transgenic potato by expressing a nonallergenic seed albumin gene from Amaranthus hypochondriacus. Proceedings of the National Academy of Sciences of the United States of America 97: 3724-3729

De Jaeger G, Scheffer S, Jacobs A, Zambre M, Zobell O, Goossens A, Depicker A, Angenon G (2002) Boosting heterologous protein production in transgenic dicotyledonous seeds using Phaseolus vulgaris regulatory sequences. Nature Biotechnology 20: 1265-1268

Gomez G, Noma AT (1986) The Amino-Acid-Composition of Cassava Leaves, Foliage, Root Tissues and Whole-Root Chips. Nutrition Reports International 33: 595-601

Lee KH, Kim DH, Lee SW, Kim ZH, Hwang I (2002) In vivo import experiments in protoplasts reveal the importance of the overall context but not specific amino

91

acid residues of the transit peptide during import into chloroplasts. Molecules and Cells 14: 388-397

Mainieri D, Rossi M, Archinti M, Bellucci M, De Marchis F, Vavassori S, Pompa A, Arcioni S, Vitale A (2004) Zeolin. A new recombinant storage protein constructed using maize gamma-zein and bean phaseolin. Plant Physiology 136: 3447-3456

Martinoia E, Maeshima M, Neuhaus HE (2007) Vacuolar transporters and their essential role in plant metabolism. Journal of Experimental Botany 58: 83-102

Nassar NM, Sousa MV (2007) Amino acid profile in cassava and its interspecific hybrid. Genetics and Molecular Research 6: 192-197

Ngudi DD, Kuo YH, Lambein F (2002) Food safety and amino acid balance in processed cassava "Cossettes". Journal of Agricultural and Food Chemistry 50: 3042-3049

Raemakers K, Schreuder M, Anggraini V, Putten H, Pereira I, Visser R (2007) Cassava. In Transgenic Crops IV, p 317

Raemakers K, Schreuder M, Pereira I, Munyikwa T, Jacobsen E, Visser R (2001) Progress made in FEC transformation of cassava. Euphytica 120: 15

Raven P, Fauquet C, Swaminathan MS, Borlaug N, Samper C (2006) Where next for genome sequencing? Science 311: 468

Schreuder MM, Pereira IJ, Raemakers CJJM, Jacobsen E, Visser RGF (2001) Effects of Somaclonal Variation in Cassava Plants Regenerated from Friable Embryogenic Callus of Increasing Age. In 5th International Scientific Meeting of the Cassava Biotechnology Network, Vol S7-26, Donald Danforth Plant Science Center, St. Louis, Missouri USA

Van den Broeck G, Timko MP, Kausch AP, Cashmore AR, Van Montagu M, Herrera-Estrella L (1985) Targeting of a foreign protein to chloroplasts by fusion to the transit peptide from the small subunit of ribulose 1,5-bisphosphate carboxylase. Nature 313: 358-363

Yeoh HH, Chew MY (1977) Protein content and acid composition of cassava seed and tuber. Malaysian Agricultural Journal 51: 1-6

Yeoh HH, Truong VD (1996) Protein contents, amino acid compositions and nitrogen-to-protein conversion factors for cassava roots. Journal of the Science of Food and Agriculture 70: 51-54

Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250

92

XI. Vector overview

Figure 1: Vector overview. For CLSM green fluorescent protein (GFP) was cloned in vectors

at position indicated. KDEL= tetrapeptide triggering ER retention. (A) Four vectors used in chapter VII using three different storage proteins. ProlSS= rice prolamin signal sequence inducing entry into the secretory pathway. (B) Four vectors used in chapter VIII. SKL= tripeptide functional as peroxisomal targeting signal. psRbcS TP= transit peptide of P. sativum RuBisCo small subunit triggering protein deposition in plastidal stroma. (C) Three vectors used in chapter IX. SporSS= sporamin signal sequence containing a signal for entrance into the secretory pathway as well as a vacuolar sorting determinant (NPIRL).

93

XII. Acknowledgments I would like to thank all people who helped and supported me during the last years. In particular, acknowledgement should be given to all my colleagues and friends here who created a really stimulating environment both for work and leisure. Thanks to Alessandro, Daniel, Eveline, Gilles, Judith, Lorenzo, Ruben, Sonja, Sylvain, and Yec’han for enduring my persistent optimism, my singing, and my lunch calls. It was a pleasure for me to have such competent and creative cassava mates as colleagues like Adrian, Boris, Carmen, Dario, Hervé, Judith, Kim, and Simon. Out of these I would like to thank in particular Hervé for sailing by my side during deep and shallow waters. For useful comments and English proofreading I would like to thank in particular Simon and Carmen. Eveline, Hervé, and Johannes are acknowledged for further valuable comments. For scientific advice and supervision of my abandoned rice project I would like to thank Christoph Sautter. For cassava supervision Peng has to be acknowledged. And Wilhelm Gruissem is acknowledged for providing me the independence of pursuing my PhD in his lab. But all the brain is useless without a heart providing it with the essence of life. And indeed, Alexandra was, is and will be essential for me and my brain. This list could be much longer and I ask for apologies from all people who assisted me in any way not mentioned here. Thanks for contributing to such a great period in my life! May those who love us, love us. And those who don't love us - may God turn their hearts. And if He cannot turn their hearts, may He turn their ankles, so that we may know them by their limping. (taken from the movie “Keeping the Faith”)

94

XIII. Curriculum Vitae Personal Details Details of Birth: 02/01/1978 in Bad Friedrichshall (D) Postgraduate Experience 05/2004 – present: Ph.D. thesis at ETH Zurich, group of Prof. Gruissem in the field

of Cassava Plant Biotechnology University Education 09/1998 – 09/2003: Diplom-Lebensmittelchemiker (Food Chemistry) at the University

of Karlsruhe 03/2003 – 09/2003: Diplomarbeit (thesis) at The University of Western Australia in

the lab of Dr. Susan J. Barker School Education 06/1997: Abitur (School-leaving exam) 1988 – 1997: Secondary school; priorities were Chemistry and English 1985 – 1988: Primary school education Private Interests

Soccer, SCUBA- diving, rock-climbing, singing in a choir

95