Identification of the female-determining regionof the W chromosome in Bombyx mori

H. Abe Æ T. Fujii Æ N. Tanaka Æ T. Yokoyama Æ H. Kakehashi ÆM. Ajimura Æ K. Mita Æ Y. Banno Æ Y. Yasukochi Æ T. Oshiki ÆM. Nenoi Æ T. Ishikawa Æ T. Shimada

Received: 11 April 2007 / Accepted: 8 September 2007 / Published online: 28 September 2007

� Springer Science+Business Media B.V. 2007

Abstract The W chromosome of the silkworm Bombyx

mori is devoid of functional genes, except for the putative

female-determining gene (Fem). To localize Fem, we

investigated the presence of W-specific DNA markers on

strains in which an autosomal fragment containing domi-

nant marker genes was attached to the W chromosome. We

produced new W-chromosomal fragments from the exist-

ing Zebra-W strain (T(W;3)Ze chromosome) by X-

irradiation, and then carried out deletion mapping of these

and sex-limited yellow cocoon strains (T(W;2)Y-Chu, -Abe

and -Ban types) from different Japanese stock centers. Of

12 RAPD markers identified in the normal W chromo-

somes of most silkworm strains in Japan, the newly

irradiated W(B-YL-YS)Ze chromosome contained three,

the T(W;2)Y-Chu chromosome contained six, and the

T(W;2)Y-Abe and -Ban chromosomes contained only one

(W-Rikishi). To investigate the ability of the reduced

W-chromosome translocation fragments to form hetero-

chromatin bodies, which are found in nuclei of normal

adult female sucking stomachs, we examined cells of the

normal type p50 strain and the T(W;2)Y-Chu and -Abe

strains. A single sex heterochromatin body was found in

nuclei of p50 females, whereas we detected only small sex

heterochromatin bodies in the T(W;2)Y-Chu strain and no

sex heterochromatin body in the T(W;2)Y-Abe strain. Since

adult females of all strains were normal and fertile, we

conclude that only extremely limited region, containing

the W-Rikishi RAPD sequence of the W chromosome, is

required to determine femaleness. Based on a comparison

of the normal W-chromosome and 7 translocation and

W-deletion strains we present a map of Fem relative to the

12 W-specific RAPD markers.

Keywords Silkworm � Bombyx mori � W chromosome �Translocation � Deletion-mapping � Sex chromosome �RAPD

Introduction

The sex chromosomes of the silkworm Bombyx mori

(2n = 56), are designated ZW (XY) for the female and ZZ

(XX) for the male (Tanaka 1916). Femaleness is deter-

mined by the presence of a single W chromosome,

irrespective of the number of autosomes or Z chromosomes

(Hashimoto 1933). Therefore, the putative Fem (female

determinant) gene is assumed to occupy a certain region of

the W chromosome. To analyze the mechanism of sex

determination in B. mori, genetic mapping and analysis of

H. Abe (&) � T. Fujii � N. Tanaka � T. Yokoyama �H. Kakehashi � T. Oshiki

Department of Biological Production, Faculty of Agriculture,

Tokyo University of Agriculture and Technology, Saiwai-cho,

3-5-8 Fuchu, Tokyo 183-8509, Japan

e-mail: wfem@cc.tuat.ac.jp

M. Ajimura � K. Mita � Y. Yasukochi

National Institute of Agrobiological Science, Owashi 1-2,

Tsukuba, Ibaraki 305-8634, Japan

Y. Banno

Kyushu University Graduate School of Bioresource and

Bioenvironmental Science, Hakozaki 6-10-1, Higashi-ku,

Fukuoka 812-8581, Japan

M. Nenoi � T. Ishikawa

National Institute of Radiological Sciences 9-1, Anagawa 4-9-1,

Inage-ku, Tiba 263-8555, Japan

T. Shimada

Department of Agricultural and Environmental Biology,

Graduate school of Agricultural and Life Sciences, The

University of Tokyo, Yayoi 1-1-1, Bunkyo-ku 113-8657, Japan

123

Genetica (2008) 133:269–282

DOI 10.1007/s10709-007-9210-1

the Fem gene on the W chromosome is required. Although

400 or more visible mutations have been placed on linkage

maps in B. mori (Doira 1992; Goldsmith 1995; Goldsmith

et al. 2005) and many genes have been mapped to the Z

chromosome (Fujii et al. 1998; Koike et al. 2003), no gene

for a morphological character has so far been mapped to

the normal W chromosome. Similarly, no W-specific

markers have been found despite construction of extensive

linkage maps in silkworm, including RAPDs (Promboon

et al. 1995; Yasukochi 1998), AFLPs (Tan et al. 2001),

SSRs (Miao et al. 2005) and SNPs (Yamamoto et al.

2006). Recently, a draft sequence of B. mori (p50 strain)

genome using three-fold whole-genome shotgun sequenc-

ing was obtained by Mita et al. (2004), and a Chinese

group obtained a draft sequence of p50 strain using 5.9-fold

whole-genome shotgun sequencing (Xia et al. 2004), but as

these shotgun sequencing efforts were undertaken using

only the male genome, systematic molecular analysis of the

W chromosome of B. mori has not yet been initiated.

Therefore, for the purpose of analyzing the W chromosome

at the molecular level, we have been identifying DNA

sequences specific to the W chromosome. To date, we have

identified 12 W-specific RAPD markers (Abe et al. 1998a,

2005b). However, the genetic mapping of these W-specific

RAPD markers on the W chromosome is impossible by

conventional recombination experiments because crossing-

over is restricted to males in B. mori. Further, Sahara et al

(2003) succeeded in identifying the W chromosome by

fluorescence in situ hybridization (FISH) using four bac-

terial artificial chromosome (BAC) probes derived from the

W chromosome. However, the probes painted uniformly

the whole W chromosome because it is largely composed

of nested retrotransposons (Abe et al. 2002, 2005a).

Therefore, it is very difficult to use FISH for cytogenetic

mapping of W-specific markers.

In several sex-limited B. mori strains the autosomal

fragment containing the dominant genes for visible/mor-

phological traits have been translocated to the W

chromosome using X-ray or gamma-ray irradiation (Taz-

ima 1941, 1944; Tazima et al. 1951; Kimura et al. 1971).

Recently, we used W-translocation strains with W-specific

RAPD markers to analyze the W chromosome region.

Fortunately, the normal W chromosomes of the strains in

Japan are almost identical in type (Japanese-W-Eve type)

(Abe et al. 2005b). Therefore, a deletion of the W chro-

mosome can be detected by the disappearance of W-

specific RAPD markers. In the sex-limited zebra (Zebra-

W) strain, female larvae have a zebra marking due to the

T(W;3)Ze chromosome, whereas male larvae have no

marking (whitish skin) (Hashimoto 1948), and the W

chromosome region lacks two of 12 known RAPD markers

(W-Mikan and W-Samurai) (Abe et al. 2005b). In the sex-

limited black egg strain, the female eggs are black, while

the male eggs are yellowish white due to the T(W;10)+w–2

chromosome (Tazima et al. 1951) in which the W chro-

mosome region lacks one of the 12 RAPD markers (W-

Mikan) (Abe et al. 2005b). Finally, in the ‘‘male’’ of the

Z101 strain the DfZ-DfW chromosome, in which the W

chromosome fragment is attached to the Z chromosome

fragment, contains three W-specific RAPD markers (W-

Mikan, W-Samurai and W-Bonsai) (Fujii et al. 2006).

Therefore, we thought that these modified W chromosomes

are not the result of simple fusion of autosome fragments to

the end of unaltered W chromosome but rather the products

of reciprocal translocations accompanied by partial dele-

tions of the W chromosome (Abe et al. 2005b; Fujii et al.

2006). Recently, by using X-ray irradiation, we obtained

the ZeWZ2 chromosome, in which a fragment of the

T(W;3)Ze chromosome designated as ZeW is attached to

the Z chromosome fragment (Z2), having three of 12 W-

specific RAPD markers (W-Bonsai, W-Yukemuri-L and

W-Yukemuri-S) (Fujii et al. 2007).

We think that if more W chromosome variants could be

developed through breaking by X-ray irradiation, we could

map these W-specific RAPD markers and Fem on the W

chromosome by deletion mapping. Therefore, in this study,

to obtain more W chromosome variants, we attempted to

fragment the T(W;3)Ze chromosome using X-rays, and then

investigated the presence or absence of the W-specific

RAPD markers of the resulting W chromosome variant. We

also investigated the presence or absence of the W-specific

RAPD markers of the T(W;2)Y chromosome in sex-limited

yellow cocoon strains maintained by several different

institutes and research groups. Additionally, we investi-

gated the presence of a sex chromatin body (SB), deduced

to be the condensed W chromosomes (Ennis 1976; Traut

and Marec 1996), in polyploid tissue of the sex-limited

yellow cocoon strain. Here, we determine the order of the

W-specific RAPD markers and putative Fem gene on the W

chromosome. We report that only an extremely limited

region containing the W-Rikishi RAPD marker sequence of

the W chromosome is required to determine femaleness.

Materials and methods

Silkworm strains and X-ray irradiation

We used the p50, C108, SCH, and C125 strains with nor-

mal W chromosomes and sex-limited Zebra-W and sex-

limited yellow-cocoon strains with modified W chromo-

somes. All silkworms were reared on fresh mulberry

leaves.

The p50 and C108 strains are highly inbred and have

been maintained by sister-brother mating, as described by

Promboon et al (1995). For phenotypic marker of the Z

270 Genetica (2008) 133:269–282

123

chromosome, sch (sex-linked chocolate, 1(Z)-21.5) and od

(distinct translucent, 1(Z)-49.6) were used. The SCH strain

has the marker, sch, on the Z chromosome. Newly hatched

female larvae (WZsch) and male larvae (Zsch/Zsch) are

reddish brown. A cross of female (WZ+sch) with male (Zsch/

Zsch) produces female larvae (WZsch) that are reddish

brown when hatched, while male larvae (Zsch/+) are black.

The OD strain has the marker, od, on the Z chromosome.

Both of female (W/Zod) and male (Zod/Zod) larvae are

translucent. The characteristics of these marker genes are

described in Doira (1978).

The sex-limited Zebra-W strain was used for the X-ray

irradiation experiments. This strain is congenic to strain

C108 with respect to the W chromosome. It carries the

T(W;3)Ze chromosome, and has been maintained by

repeated backcrossing of zebra females to white males of

strain C108 (Abe et al. 2005b). Female pupae in mid or late

pupal stages of this strain were rotated on a turn table and

irradiated by a 4,000 R dose of X-ray irradiation produced

by a SOFTEX M-70WE irradiator (SOFTEX Co. Ltd)

applied at a rate of 2.8 Gy/min (total irradiation time

13007@) as described previously (Fujii et al. 2007). Subse-

quently, the emerged female moths were crossed to SCH or

C108 males. Offspring were reared by two different

methods.

In one method (Experiment 1), we crossed the emerged

female moths with males of the SCH strain. To reduce the

labor required for breeding, black larvae (male) were

removed by tweezers. Alternatively, to breed only male

larvae, reddish larvae (female) were removed. When the

larvae reached the fourth instar, we could discriminate the

zebra or white larvae and bred only zebra male and white

female larvae. Thus, although the probability of detecting

breakage of the T(W;3)Ze chromosome was lower because

we eliminated half of the hatched larvae, we were able to

reduce labor. We investigated a total of 15,074 larvae using

this method.

By a second method (Experiment 2), so as not to reduce

the probability of detecting the breakage of the T(W;3)Ze

chromosome, we crossed emerged female moths to males

of the C108 strain (white larvae), reared the resulting lar-

vae to the 5th (final) instar, and distinguished the sexes by

inspecting Ishiwata’s germal discs and Herald’s gland on

the post-ventral surface. We examined a total of 18,793 5th

instar larvae using this method/in this experiment.

The sex-limited yellow cocoon strains have the T(W;2)Y

chromosome (Kimura et al. 1971). The hemolymph of

female larvae is deep yellow from the presence of the Y

gene (Y, 2–25.6), since carotenoids present in mulberry

leaves pass through their digestive organs, and they spin

yellow cocoons, while male larvae have white hemolymph

and spin white cocoons. We used three sex-limited

yellow cocoon strains maintained by three researchers:

T(W;2)Y-Abe and T(W;2)Y-Chu, maintained at the Faculty

of Agriculture, Tokyo University of Agriculture and

Technology by H. Abe and T. Yokoyama, respectively, and

the T(W;2)Y-Ban type maintained at the Silkworm Genetic

Division, Kyusyu University, by Y. Banno.

To investigate the possibility that the T(W;2)Y-Abe and

T(W;2)Y-Chu chromosomes may behave as a chromosome

2 not a W chromosome, we crossed a female having the

T(W;2)Y-Abe (Z+od/T(W;2)Y-Abe) or T(W;2)Y-Chu (Z+od/

T(W;2)Y-Chu) chromosome with a male (od/od) of the OD

strain.

The original W chromosome of the three T(W;2)Y

chromosomes (-Abe, -Chu, and -Ban types) was the normal

W chromosome of the C125 strain (Kimura et al. 1971).

The C125 strain used in this study was purchased from

Gunma Sericultural Experiment Station.

DNA extraction, W-specific RAPD markers, primers

and PCR

Genomic DNA was extracted from posterior silk glands of

larvae or legs of moths as described previously (Abe et al.

1996; 1998a).

PCR using 10-mer primers was carried out as previ-

ously described (Abe et al. 1998a). Briefly, 45 cycles of

PCR were performed on a Zymoreactor II Thermal Cycler

(ATTO Co.) as follows: 94�C for 1 min, 37�C for 1 min,

and 72�C for 3 min followed by a final extension of

10 min at 72�C. PCR products were analyzed by elec-

trophoresis on 2% agarose gels and stained with ethidium

bromide.

The twelve W-specific RAPD markers used in this study

were described previously (Abe et al. 1998a; 2005b).

BAC libraries, screening, DNA sequencing and

sequence analysis

Two B. mori bacterial artificial chromosome (BAC)

libraries, constructed separately using genomic DNA from

mixed populations of males and females of the p50 and

C108 silkworm strains, were used (Wu et al. 1999).

Another B. mori BAC library was also constructed using

genomic DNA extracted from a mixed population of the

p50 strain (K. Mita, unpublished data). We used a locus-

specific PCR strategy according to the protocol described

in Yasukochi (2002) to obtain a BAC clone containing the

W-Rikishi RAPD marker sequence. To detect the W-Ri-

kishi RAPD marker as a sequence-characterized amplified

region (SCAR) marker (Paran and Michelmore 1993), we

used primers Rikishi-A1 (50-GGCGATGCTGTGTACCC

AGAATGT-30) and Rikishi-B2 (50-GTCCTCTGCGA

Genetica (2008) 133:269–282 271

123

TGGGTGGCACATA-30) (Abe et al. 2005b). We obtained

one positive BAC clone (designated 1C7C) containing the

W-Rikishi RAPD marker sequence, which was sequenced

by a shotgun method. Based on its nucleotide sequence, we

designed longer primer pairs (Table 1) to amplify the

regions containing the boundaries of retrotransposable

elements as new W-specific PCR markers.

For shotgun sequencing, BAC DNA was physically

fragmented using the HydroShear process (GeneMachines

Inc., USA). The fragmented DNA was separated by aga-

rose gel electrophoresis, and 2- and 5-kb fractions were

extracted from gels. Using T4 DNA ligase (TaKaRa Bio

Inc.), fragments of each size were ligated separately into a

pUC118 plasmid vector that had been previously digested

with Hinc II and treated with bacterial alkaline phospha-

tase. The ligated DNA samples were introduced into E. coli

DH10B by electroporation, resulting in 2- and 5-kb shot-

gun libraries.

About 1,000 clones were selected from each library for

sequencing. Plasmid DNA was prepared from overnight

cultures using an automated plasmid isolation machine

(PI-1100; Kurabo Ind. Ltd.). Sequencing was carried out

from both ends of plasmid DNAs using an ABI 3700

capillary sequencer and BigDye Terminator v3.1 Cycle

Sequencing Kit (Applied Biosystems). About 4,000

sequence profiles, which had been qualified by Phred

(CodonCode Co.), were assembled by the CAP4 program

of the Paracel Genome Assembler using a Compac

machine of the Dragon Genomic Center, TaKaRa Bio

Inc.

The BLAST program (Altschul et al. 1990) was used to

search for sequence similarities with known DNA

(BLASTN) or protein (BLASTX) sequences.

Observation of the sex heterochromatin body

We observed the sex heterochromatin body (SB), which is

easily detected in the highly polyploid nuclei of the sucking

stomachs in females (Pan et al. 1987), by the method of

Tanaka et al (2000). Excised sucking stomachs were dis-

sected on slides with forceps. The tissue was then stained

with acetic orcein (3%), covered with coverslips, com-

pressed after 10 min, and observed by light microscopy.

GenBank accession numbers

The nucleotide sequences of the seven stretches of the

1C7C BAC clone reported here were deposited in the

DDBJ, EMBL and GenBank nucleotide databases under

accession numbers AB251908–AB251914.

Results

Breakage of the T(W;3)Ze chromosome by X-ray

irradiation

We attempted to fragment the T(W;3)Ze chromosome

using X-rays. In Experiment 1, to breed only female larvae,

newly hatched black larvae (male) were removed by

tweezers. Alternatively, to breed only male larvae, reddish

larvae (female) were removed. The larvae reached the

fourth instar, we discriminated the zebra or white larvae

and bred only zebra male and white female larvae. Using

this approach of Experiment 1, we detected one zebra male

larva out of 7,002 males (Table 2). Unfortunately, this

Table 1 Primer sequences for

amplification of W-specific

PCR markers of the 1C7C BAC

clone

W-specific PCR marker Primers Sequence 50-30 Product size (bp)

W-R-C2 C2-A GATGCGCACACGGATGACTACTTCG 578

C2-B ACTGAAATGGGTCTAAAGTTAGTGG

W-R-C8 C8-C AAAGTGGTGAATATTGAGTACAGCT 613

C8-D CAGCACGCGACGGGTGCCTGAATCG

W-R-C12 C12-G ACACTACTTTCCGGTTACGTACCAT 578

C12-H GTGACTGCCGATGGAATACAAAGTC

W-R-C18 C18-K GTCCTAGTTTCATGCTAGCTTCAGT 440

C18-L AAGCAGGCTTAGCCTTCGGCACAGA

W-R-C21 C21-G AACTTCGGGTAGTGCAGTGCTAGTA 483

C21-H GGTCCATTCCACATCAGATCATTCA

W-R-C27 C27-Q CGGAGGAATTCCGCGAATACAGCGT 507

C27-R ATTCACCACTTCATTATCCTGGAAT

W-R-C29 C29-E CGACCGTGAGAGTGCCAGCATCAGC 575

C29-F TTACTTAAAACTTGAAGTTAATGCG

272 Genetica (2008) 133:269–282

123

larva died during the 5th instar. Therefore, it was imme-

diately dissected and genomic DNA was extracted from the

posterior silk gland and used as template for PCR. No W-

specific RAPD markers were amplified from this zebra

male. We detected 10 white female larvae out of 8,072

females (Table 2). Two of the 10 white females died dur-

ing 5th instar; DNA was extracted from the posterior silk

gland of each and used as templates for PCR. Ten W-

specific RAPD markers were amplified from these two

larvae. Eight of the 10 white female larvae grew into adult

moths, were crossed with C108 males, and produced eggs.

After oviposition, genomic DNA extracted from legs of

each of these eight moths was used as templates for PCR;

10 W-specific RAPD markers were also amplified from

these eight female moths. Thus, all 10 white female larvae

appearing in this study contained all 10 W-specific RAPD

markers, as did the normal zebra female. These results

indicated that in all white females the breakage occurred in

the attachment site between the W-chromosome segment

carrying the putative Fem gene (B region) and the chro-

mosome 3 fragment carrying Ze (Fig. 1C).

In Experiment 2, we reared the resulting larvae to the

final instar, and distinguished the sexes by inspecting the

post-ventral surface. Using the method of Experiment 2,

we detected three females out of 9,868 white larvae

(Table 3). The three white female larvae grew into adult

moths, were crossed with C108 males, and produced eggs.

After oviposition, genomic DNA extracted from legs of

each of these three moths was used as templates for PCR,

yielding products for all 10 W-specific RAPD markers.

These results indicated that the breakage occurred at an

attachment site between the B region and the Ze-containing

chromosome 3 fragment in these individuals (Fig. 1C). We

also detected one male out of 8,925 zebra larvae (Table 3)

which grew into an adult moth, was crossed with C108

females, and produced eggs. After copulation, genomic

DNA was extracted from the legs and used as a template

for PCR; only three W-specific RAPD markers (W-Bonsai,

W-Yukemuri-L and W-Yukemuri-S) were amplified from

this male moth. Among its progeny, both white and zebra

larvae appeared. The ratio of zebra females:zebra males

was 1:1, and all zebra larvae contained the same three

W-specific RAPD markers, irrespective of sex. These

results indicated that the breakage occurred in the B region

(Fig. 1B) between Fem and the Ze containing segment, and

that the W chromosome fragment generated was accom-

panied by a chromosome 3 fragment containing the

W-Bonsai, W-Yukemuri-L, and W-Yukemuri-S RAPD

markers (designated as the ‘‘W(B-YL-YS)Ze’’ chromo-

some) (Table 4). However, the structure of this W(B-

YL-YS)Ze chromosome is not known. One possibility is

that it was attached to an autosome. A more detailed

genetic study is needed to clarify the features of the

W(B-YL-YS)Ze chromosome.

Presence or absence of W-specific RAPD markers on the

T(W;2)Y chromosomes and the W chromosome of the C125

We determined the presence or absence of the W-

specific RAPD markers in three sex-limited yellow cocoon

strains and the original type C125 strain. The T(W;2)Y-Chu

type strain contained six of the 12 previously identified

W-specific RAPD markers (W-Rikishi, W-Yukemuri-L,

W-Yukemuri-S, W-Bonsai, W-Samurai, and W-Mikan)

(Table 4). Both the T(W;2)Y-Abe and T(W;2)Y-Ban

translocations contained only one of the 12 W-specific

RAPD markers (W-Rikishi). However, the C125 strain

contained all 12 W-specific RAPD markers (Table 4).

These results suggested that the original W chromosome of

the T(W;2)Y-Abe and -Ban strains differed from the stan-

dard normal Japanese-W-Eve type. However, the original

W chromosome of the T(W;2)Y strain was the W chro-

mosome of the C125 strain (Kimura et al. 1971).

Therefore, this explanation does not seem likely. Another

possibility is that almost all of the attached regions, except

for one containing the W-Rikishi RAPD marker with the

putative Fem gene, were deleted from the T(W;2)Y-Abe

and -Ban chromosomes. Therefore, to investigate the

presence or absence of the regions around the W-Rikishi

RAPD marker sequence in the T(W;2)Y-Abe and -Ban

chromosomes, we attempted to obtain a BAC clone con-

taining the W-Rikishi RAPD marker sequence and to

convert the DNA sequences of this BAC clone into new

W-specific PCR markers, as described below.

1C7C BAC clone structure and amplification patterns

of new W-specific PCR markers using newly designed

primers

We used a PCR strategy to obtain the BAC clone, 1C7C,

which contained the W-Rikishi RAPD marker sequence,

and subjected it to shotgun sequencing. The total amount of

sequences obtained from 1C7C BAC clone was 92,501 bp.

We were unable to construct a single contiguous sequence

due to the presence of many repetitive DNA elements.

Table 2 Segregation in the F1 progeny of the cross between the sex-

limited Zebra-W strain irradiated by X-ray and SCH strain (EXP.1)

sch ($) +sch (#)

Ze + Ze +

8062 10 1 7001

Mating: female · male

Zþsch

/T(W;3)Ze · Zsch/Zsch)

Genetica (2008) 133:269–282 273

123

However, based on BLASTN and BLASTX searches, we

identified many regions containing the boundaries of ret-

rotransposable elements, from which we have developed 7

new W-specific PCR markers.

W-1C7C-C2 stretch

The W-1C7C-C2 stretch (4355 bp) contained two partial

amino acid (aa) coding regions which were revealed by

BLASTX and BLASTN searches to contain part of the

reverse transcriptase (RT) domain of a non-LTR retro-

transposon. We designated these non-LTR retrotransposons

as Tama and Akebono. However, we could not find typical

poly(A) tails (Fig. 2A), and therefore, we could not deter-

mine the precise boundary between these two elements. To

amplify the region containing the boundary of Tama and

Akebono as a W-specific PCR marker, we designed a longer

primer pair, C2-A and C2-B. The new primers produced a

female-specific band (designated as the W-R-C2 marker)

along with some non-specific bands, as shown in Fig. 3A.

W-1C7C-C8 stretch

The W-1C7C-C8 stretch (8562 bp) contained a long aa and

a partial aa coding region. BLASTX and BLASTN sear-

ches revealed that the long aa sequence contained cysteine

and histidine (Cys) motifs, protease (Pro), RT, RNase H

(RH), and integrase (Int) domains, and an open reading

frame (ORF) typical of a Pao-like LTR retrotransposon

(designated Ichiro) (Abe et al. 2001; Xiong et al. 1993).

Moreover, a poly(A) tail of a BMC1-like non-LTR retro-

transposon appeared at the 50 end (Ogura et al. 1994; Abe

et al. 1998b). Furthermore, the sequence of BMC1, from

the 50-UTR to ORF1, appeared at the 30end, and we iden-

tified LTR-like sequences at both ends of the ORF of

Ichiro. We suspected that the sequence 50-GGGGGG-30 in

the region between the ORF of Ichiro and the 50-UTR of

BMC1 might represent a polypurine tract (PPT). Although

we could not definitively identify the initiation site of the

30LTR of Ichiro from the sequence data of the 50LTR

because the 50LTR may be incomplete, it should be

included in the region adjacent to the PPT. The sequence

data also strongly indicated that another non-LTR

Fig. 1 Three models of

expected breakage of the

T(W;3)Ze chromosome by X-

ray. (A) A breakage occurs

between one end of the W

chromosome and the Fem gene

(A region); (B) A breakage

occurs between the Fem gene

and the attachment site of the W

and chromosome 3 fragment (B

region); (C) A breakage occurs

in the attachment site between

the W and chromosome 3

fragment

Table 3 Segregation in the F1 progeny of the cross between the sex-

limited Zebra-W strain irradiated by X-ray and C108 strain (EXP.2)

Ze ($) Ze (#) +Ze ($) +Ze(#)

8924 1 3 9865

Mating: female · male

(Z/T(W;3)Ze, p/p · Z/Z, p/p)

p; Plain(p) is without marking

Table 4 Presence or absence of W-specific RAPD markers in the silkworm strains and W chromosome variants

Strain or chromosome Kabuki Kamikaze BMC1-

Kabuki

Sakura Sasuke Musashi Rikishi Yukemuri-L Yukemuri-S Bonsai Samurai Mikan

C125 + + + + + + + + + + + +

T(W;2)Y-Chu – – – – – – + + + + + +

T(W;2)Y-Ban – – – – – – + – – – – –

T(W;2)Y-Abe – – – – – – + – – – – –

W(B-YL-YS)Ze – – – – – – – + + + – –

274 Genetica (2008) 133:269–282

123

retrotransposon was inserted into the 50LTR of Ichiro.

Therefore, we determined that the W-1C7C-C8 stretch was

composed of three retrotransposons (Fig. 2B). To amplify

the region containing the boundary of Ichiro and the 50

non-LTR element as a W-specific PCR marker, we

designed a longer primer pair, C8-C and C8-D. The new

primers produced a female-specific band (designated as the

W-R-C8 marker), accompanied by some non-specific

bands, shown in Fig. 3B.

W-1C7C-C12 stretch

The W-1C7C-C12 stretch (6670 bp) contained three partial

aa coding regions. BLASTX and BLASTN searches

revealed that one of them contained part of the RT domain

of a non-LTR retrotransposon, and a second aa coding

region at the 50 end contained part of ORFs 1 and 2 of

BMC1. Another non-LTR retrotransposon called TREST1

(accession No. D55702) was located at the 30 end. In the

non-LTR retrotransposons adjacent to the BMC1 sequence

(designated Manga), we could not find the 30-UTR or

poly(A) tail. These results indicated that BMC1 was

inserted into Manga. Moreover, a BLASTN search

revealed that the nucleotide sequence (nucleotide positions

3498–3781) between Manga and TREST1 was partially

homologous to an already reported Bombyx repetitive

sequence but that the remaining region was not homolo-

gous to any known sequence. Therefore, we determined

that the W-1C7C-C12 stretch was composed of three

Fig. 2 Schematic diagrams of

the seven stretches of 1C7C

BAC clone and the female-

specific PCR markers. (A) W-

1C7C-C2; (B) W-1C7C-C8; (C)

W-1C7C-C12; (D) W-1C7C-

C18; (E) W-1C7C-C21; (F) W-

1C7C-C27, and (G) W-1C7C-

C29. These maps are based on

DNA sequence information.

Each block indicates a

transposable element and each

box with an arrow indicates one

LTR of each retrotransposon.

The arrows under or over each

box indicate the transcriptional

orientation. The double-ended

arrows in each stretch indicate

the newly designed female-

specific PCR markers. RT,

reverse transcriptase domain;

Cys, cysteine and histidine

motif; Pro, protease domain;

RH, RNase H domain; Int,

Integrase domain; PPT,

polypurine tract

Genetica (2008) 133:269–282 275

123

non-LTR retrotransposons, a Bombyx repetitive sequence,

and an unknown sequence (Fig. 2C). To amplify the region

containing the boundary of Manga and the Bombyx

repetitive sequence as a W-specific PCR marker, we

designed a longer primer, C12-G and C12-H. The new

primers produced a female-specific band (designated as the

W-R-C12 marker), accompanied by some non-specific

bands, as shown in Fig. 3C.

W-1C7C-C18 stretch

The W-1C7C-C18 stretch (1381 bp) contained two partial

aa coding regions. BLASTX and BLASTN searches

revealed that one of them contained part of the Cys motifs

of a Pao-like LTR retrotransposon (designated Yukata)

and the other one contained a portion of the non-LTR

retrotransposon BMC1. Moreover, a poly(A) tail of a

retroelement was attached to the 50 end. Therefore, we

determined that the W-1C7C-C18 stretch was composed of

two retrotransposons and the poly(A) tail of a retroelement

(Fig. 2D). To amplify the region containing the boundary

of Yukata and BMC1 as a W-specific PCR marker, we

designed the longer primer pair C18-K and C18-L. The

new primers produced a female-specific band (designated

as the W-R-C18) as shown in Fig. 3D.

W-1C7C-C21 stretch

The W-1C7C-C21 stretch (8673 bp) contained four partial

aa coding regions. BLASTX and BLASTN searches

revealed that an aa coding region at the 50 end contained

part of ORF2 of BMC1, an aa coding region adjacent to

BMC1contained part of the RT domain of a non-LTR

retrotransposon (designated Otaku), an aa coding region

adjacent to Otaku contained parts of the RT, RH, and Int

domains of a Pao-like LTR retrotransposon (designated

Kimono), and the remaining aa coding region adjacent to

Kimono contained part of ORFs 1 and 2 of a BMC1-like

non-LTR retrotransposon. We could not find the 30-UTR or

poly(A) tail of Otaku. These results indicated that the

BMC1 element at the 50 end was inserted into Otaku.

Moreover, we could not find the 50LTR, Cys motif, or Pro

domains of Kimono, similarly indicating that Otaku was

inserted into Kimono. We suspected that the sequence 50-GGGGGAA-30 in the region between the ORF of Kimono

and the BMC1-like non-LTR retrotransposon might rep-

resent a PPT. Moreover, we found that the ORF of this

BMC1-like retrotransposon did not contain an RT domain

or poly(A) tail. These results indicated that the BMC1-like

retrotransposon was inserted into Kimono. Although we

could not definitively determine the 30LTR of Kimono

because the 50LTR was not contained in this stretch, the

sequence between the PPT and the end of the aa coding

region of the BMC1-like retrotransposon was thought to be

a part of the 30LTR. Therefore, we determined that W-

1C7C-C21 stretch was composed of four retrotransposons

as shown in Fig. 2E. To amplify the region containing the

boundary of Otaku and Kimono as a W-specific PCR

marker, we designed a longer primer pair, C21-G and C21-

H. The new primers produced a female-specific band

(designated as the W-R-C21 marker), as shown in Fig. 3E.

W-1C7C-C27 stretch

The W-1C7C-C27 stretch (2465 bp) contained two partial

aa coding regions. BLASTX and BLASTN searches

revealed that one of them contained part of ORF1 of BMC1

and the other one contained part of the RT domain of a

non-LTR retrotransposon (designated Hide). The 50end of

this copy of BMC1 was slightly truncated; further, we

could not find the typical poly(A) tail of Hide. These

results indicated that the BMC1 element was inserted into

Fig. 3 Amplification patterns of genomic DNA from males and

females of the p50 strain using the seven newly developed primers

sets shown in Table 1. (A) W-R-C2; (B) W-R-C8; (C) W-R-C12; (D)

W-R-C-18; (E) W-R-C21; (F) W-R-C27 and (G) W-R-C29. Arrow-

heads indicate female-specific PCR markers. M, molecular size

marker (100 bp ladder). The number at the left indicate base pairs

276 Genetica (2008) 133:269–282

123

the 30-UTR region of Hide. Therefore, we determined that

the W-1C7C-C27 stretch was composed of two non-LTR

retrotransposons (Fig. 2F). To amplify the region contain-

ing the boundary of BMC1 and Hide as a W-specific PCR

marker, we designed a longer primer pair, C27-Q and C27-

R. The new primers produced a female-specific band

(designated as the W-R-C27 marker), as shown in Fig. 3F.

W-1C7C-C29 stretch

The W-1C7C-C29 stretch (5753 bp) contained two partial

aa coding regions. BLASTX and BLASTN searches

revealed that one of them contained part of a Pao-like

retrotransposon, Kamikaze (Abe et al. 2001) and that the

other one contained part of ORF2 of a non-LTR retro-

transposon (designated Tojo). We identified the 30LTR of

Kamikaze, between the aa coding regions of Kamikaze and

Tojo. Therefore, we determined that the W-1C7C-29

stretch was composed of two retrotransposons as shown in

Fig. 2G. To amplify the region containing the boundary of

kamikaze and Tojo as a W-specific PCR marker, we

designed a longer primer pair, C29-E and C29-F. The new

primers produced a female-specific band (designated as the

W-R-C29 marker), accompanied by some non-specific

bands, as shown in Fig. 3G.

Presence of W-specific sequences around the W-Rikishi

RAPD marker in the sex-limited yellow cocoon strains

As described above, both W chromosomes of the T(W;2)Y-

Abe and -Ban strains contained only the W-Rikishi RAPD

marker. To map this region in more detail, we investigated

the presence or absence of the seven newly developed W-

specific PCR markers (W-R-C2, W-R-C8, W-R-C12, W-R-

C18, W-R-C21, W-R-C27 and W-R-C29) derived from the

1C7C BAC clone. The T(W;2)Y-Abe and -Ban type chro-

mosomes contained all seven W-specific PCR markers

(data not shown).

Sex heterochromatin body in sex-limited yellow cocoon

strains

We prepared sucking stomachs of the p50 strain (normal W

chromosome) and two sex-limited yellow cocoon strains

(T(W;2)Y-Chu and T(W;2)Y-Abe types), and inspected

them in detail for the presence and shape of SBs. In the p50

strain, a single SB was regularly observed in the nuclei of

female moths (Fig. 4B and C), whereas no SB was detected

in nuclei of male moths (Fig. 4A). In the sex-limited

yellow cocoon strain with the T(W;2)Y-Chu type

chromosome, several cases were recognized. In one, we

observed a single smaller SB than in the p50 strain

(Fig. 4D and E). In another, we observed several SBs in

each nucleus (two, Fig. 4F; four, Fig. 4G) in female moths.

However, the other sex-limited yellow cocoon strain with a

T(W;2)Y-Abe type chromosome showed no SB in the

nuclei of female moths (Fig. 4H and I). As expected, we

detected no SB in nuclei of males of either sex-limited

yellow cocoon strain (data not shown).

Genetic behavior of the T(W;2)Y-Abe chromosome in

female meiosis

We suspected that the T(W;2)Y-Abe chromosome and

T(W;2)Y-Chu chromosome may behave as a chromosome

2 not a W chromosome during meiosis because the frag-

ment of chromosome 2 present in this strain might be

longer than the fragment of the W chromosome. However,

all newly hatched female larvae carrying the T(W;2)Y-Abe

and T(W;2)Y-Chu chromosomes were translucent (od),

while all male larvae were normal opacity (+od) (Table 5).

Thus, the T(W;2)Y-Abe and T(W;2)Y-Chu chromosomes

behaved as a W chromosome in meiosis.

Discussion

Breakage of the T(W;3)Ze chromosome

Just prior to deposition, the egg nucleus is in metaphase of

the first maturation division, which is soon terminated by

elimination of the first polar body (Sakaguchi 1978). After

metaphase I, the W chromosome and Z chromosome move

to opposite poles. The movement of an induced W chro-

mosome fragment to a particular pole is thought to be

random. We can detect the fragmentation of the T(W;3)Ze

chromosome only when the fragments containing Ze mar-

ker and the putative Fem gene separate each other and

move to opposite poles. In this study, three breakage pat-

terns in the T(W;3)Ze chromosome could be expected. A

breakage in the A region (Fig. 1A), would produce a zebra

female larva with the deletion of several W-specific RAPD

markers. However, this zebra female larva cannot be dis-

tinguished from a normal zebra female larva. A breakage

occurring in the B region (Fig. 1B), would produce a white

female larva with the deletion of several W-specific RAPD

markers. Alternatively, if a deleted W chromosome

containing the putative Fem gene was expelled and

the simultaneously generated chromosome 3 fragment

accompanied by a W chromosome fragment remained, a

zebra male larva containing several W-specific RAPD

markers would appear. A breakage occurring in the

Genetica (2008) 133:269–282 277

123

attachment site between the W and chromosome 3 frag-

ment would produce a white female larva with all

10 W-specific RAPD markers, as for a normal zebra

female, and a zebra male larva lacking W-specific RAPD

markers (Fig. 1C). As all 13 white female larvae obtained

in Exp. 1 where we reared selected males and females

based on larval markers and Exp. 2 where we imposed no

prior selection contained all 10 W-specific RAPD markers,

the breakage was strongly indicated to have occurred at

the attachment site between the W and autosomal Ze-

containing fragments. Similarly, it is thought that the zebra

male larva obtained in Exp. 1 had a chromosome 3 frag-

ment, but did not contain a W chromosome fragment

(Fig. 1C). However, the zebra male larva obtained in Exp.

2 contained three W-specific RAPD markers. This result

strongly indicated that a breakage had occurred in the B

region (Fig. 1B), and the irradiation had generated a W

chromosome fragment containing the W-Bonsai, W-Yu-

kemuri-L, and W-Yukemuri-S RAPD markers but no copy

of Fem, accompanied by the chromosome 3 fragment

carrying the Ze marker.

Deletions of the W chromosome region from the

T(W;2)Y chromosome

Kimura et al (1971) employed irradiation to a total of 707

female pupae of the C125 strain carrying normal W chro-

mosomes from 1961 to 1969. Out of a total of 4,502

batches of eggs reared during nine years, they obtained

only one batch in which all the females made yellow

cocoons and all the males made white cocoons. Thus, the

original T(W;2)Y chromosome was clearly produced by

only one event (translocation) in a single female. At that

time, the sex-limited yellow cocoon strain did not show

physiological defects due to the translocation of a chro-

mosome 2 fragment to the W chromosome (Kimura et al.

Fig. 4 The effects of the

deletions of the W chromosome

on the shape of SBs. Arrowhead

indicates SBs. (A) Male nucleus

of p50 strain. No SB is

observed. (B) and (C) Female

nuclei of p50 strain. (normal W

chromosome). A single SB is

observed in each nucleus. (D),

(E), (F) and (G) Female nuclei

of sex-limited yellow cocoon

strain (T(W;2)Y-Chu type

chromosome). A smaller SB is

observed (D and E). Dispersed

SBs are observed (F and G).

(H) and (I) Female nuclei of

sex-limited yellow cocoon

strain (T(W;2)Y-Abe type

chromosome). No SB is

observed. Bar = 10 lm

Table 5 Genetic behavior of the T(W;2)Y chromosomes in female

meiosis

Mating scheme No. of crosses od +

Y($) +(#) Y($) +(#)

T(W;2)Y-Abe/+od · od /od 5 1133 0 0 1145

T(W;2)Y-Chu/+od · od /od 5 1071 0 0 1149

278 Genetica (2008) 133:269–282

123

1971). However, several physiological defects were later

recognized in females containing the T(W;2)Y chromo-

some during the breeding process for developing a

commercial silkworm race (Niino et al. 1987). Therefore

Niino et al (1988) subsequently applied gamma-ray treat-

ment to delete the extra part of the translocated

chromosome 2 fragment except for the Y locus. Thus, the

T(W;2)Y chromosomes had again been modified by irra-

diation, and it seems likely that several silkworm strains

containing differently modified T(W;2)Y chromosomes

were distributed to researchers.

Although there are no precise rearing and distribution

records on the three T(W;2)Y chromosomes (-Chu, -Abe

and -Ban types) used in this study, the original W chro-

mosome of all three strains was the normal W chromosome

of the C125 (Kimura et al. 1971). Because the T(W;2)Y-

Abe type chromosome contained only the W-Rikishi

RAPD marker, we suspect that the W chromosome of the

C125 strain at that time was not the Japanese-W-Eve type

containing the 12 W-specific RAPD markers found in most

Japanese stocks/strains. However, both the T(W;2)Y-Abe

and -Ban type chromosomes contained all seven new

W-specific PCR markers developed from the 1C7C BAC

clone. These results strongly indicated that almost all

regions of the W chromosome were deleted from the

T(W;2)Y-Abe and -Ban chromosomes, but the region

containing the sequence of the 1C7C BAC clone as well as

the putative Fem gene remained. Therefore, these T(W;2)Y

chromosome are thought to have been produced by the

following processes. First, the region of the W chromo-

some containing the six W-specific RAPD markers (W-

Kabuki, W-Kamikaze, W-Musashi, W-Sakura, W-Sasuke

and W-BMC1-Kabuki) was deleted by X-ray irradiation.

Subsequently, the region containing the putative Fem gene

was translocated to chromosome 2 (Fig. 5). This chromo-

some is thought to be the T(W;2)Y-Chu type. Then, the

region of the W chromosome of the original T(W;2)Y

chromosome containing the 5 W-specific RAPD markers

(W-Mikan, W-Samurai, W-Bonsai, W-Yukemuri-L, and

W-Yukemuri-S) was deleted by irradiation or spontane-

ously during the breeding process (Fig. 5). This

chromosome, containing only the W-Rikishi RAPD mar-

ker, is thought to be the T(W;2)Y-Abe or -Ban type

chromosome. Based on these observations, we treat the

T(W;2)Y-Abe and T(W;2)Y-Ban chromosomes as being

identical.

A sex chromatin body (SB), observed in the nuclei of

lepidopteran females, has been deduced to be composed of

condensed W chromosomes (Ennis 1976; Traut and Marec

1996). The number of SBs in a cell nucleus of B. mori

corresponds to the number of W chromosomes. Whereas in

a mutant female with more W chromosomes or their

fragments, more sex chromatin bodies is found per

polyploid nucleus, and each SB is composed of copies of

the different W (Ito 1977; Pan et al. 1986, 1987). However,

translocation or fusion of the W chromosome with an

autosome or with the Z chromosome is accompanied by

fragmentation of the SB in polyploid cells of the moth,

Ephestia kuehniella (Marec and Traut 1994; Traut et al.

1986). Traut et al (1986) showed that deletion of approx-

imately half of the W chromosome in Ephestia results in a

drastic size reduction of the SB. Similarly, in B. mori,

several SBs were observed in each nucleus of the sex-

limited pB (TWPB) strain (Tanaka et al. 2000). In the

present study, we observed several smaller SBs in a single

nucleus of a cell having the T(W;2)Y-Chu type chromo-

some (Fig. 4D, E, F and G). Moreover, no SB was detected

in nuclei of female moths having the T(W;2)Y-Abe type

chromosome (Fig. 4H and I). These results strongly indi-

cate that the W chromosome region of the T(W;2)Y-Abe

type chromosome is too short to form an SB detectable by

light microscopy.

Additionally, we suspected that the T(W;2)Y-Abe and

T(W;2)Y-Chu chromosomes may behave as a chromosome

2 not a W chromosome during meiosis. However, the

T(W;2)Y-Abe and T(W;2)Y-Chu chromosomes behaved as

a W chromosome in meiosis (Table 5). This indicated that

even the relatively small fragment of the W remaining was

capable of paring with the Z and driving normal meiotic

segregation.

The chromosome 2 fragment containing the Y gene

translocated to W chromosome lost the opportunity of

chromosomal recombination and behaves as part of the W

chromosome. The properties of lack of recombination and

genetic degeneration are closely connected in the evolution

of heteromorphic sex chromosomes (reviewed in Charles-

worth et al. 2005). Therefore, the several chromosome

fragments translocated to the W chromosome (T(W;2)Y,

T(W;2)pSa and T(W;3)Ze) will be useful for molecular

analyses of the degeneration and evolution of chromosome

fragments.

Order of the W-specific RAPD markers and the position

of putative Fem gene

It is impossible to estimate the relative position of the

putative Fem gene to and the genetic distance between the

W-specific RAPD markers based on the recombination

frequency, since crossing over is restricted to males in B.

mori. However, by combining available data on the pres-

ence or absence of W-specific RAPD markers on the

deleted W chromosomes in this study with the results of

Abe et al (2005b) and Fujii et al (2006, 2007), the relative

positions of the W-specific RAPD markers and the putative

Fem gene could be mapped (Fig. 6). The T(W;10)+w–2

Genetica (2008) 133:269–282 279

123

chromosome does not contain the W-Mikan RAPD marker

(Abe et al. 2005b). The T(W;3)Ze chromosome does not

contain the W-Samurai and W-Mikan RAPD markers (Abe

et al. 2005b). The DfZ-DfW chromosome contains the W-

Bonsai, W-Samurai, and W-Mikan RAPD markers (Fujii

et al. 2006). The ZeW chromosome contains the W-Bonsai,

W-Yukemuri-L, and W-Yukemuri-S (Fujii et al. 2007).

The W(B-YL-YS)Ze chromosome also contains the W-

Bonsai, W-Yukemuri-L, and W-Yukemuri-S. These results

strongly indicate that although the order of W-Yukemuri-L

and W-Yukemuri-S could not be determined, these 5 W-

specific RAPD markers are arranged in the order W-Mikan,

W-Samurai, W-Bonsai, and W-Yukemuri-S or W-Yuke-

muri-L RAPD starting from one end of the W chromosome

(Fig. 6). Moreover, it is concluded that regions containing

these 5 W-specific RAPD markers (from the W-Mikan to

W-Yukemuri-L or W-Yukemuri-S), do not contain the

putative Fem gene.

The T(W;2)Y-Chu and -Abe chromosomes did not con-

tain the W-Kabuki, W-Kamikaze, W-Musashi, W-Sasuke,

W-Sakura, and BMC1-Kabuki RAPD markers. However,

the T(W;2)Y-Abe chromosome contained only the W-

Rikishi RAPD marker. These results strongly indicate that

although the order of 6 W-specific RAPD markers, except

W-Rikishi, could not be determined, the W-Rikishi RAPD

marker is located most distal from one end of the W chro-

mosome. Furthermore, it is concluded that the W-Rikishi

RAPD marker is nearest to the putative Fem gene. The

positional information of the putative Fem gene obtained in

this study could be an essential first step for its cloning.

It is of interest that even large deletions of the W

chromosome do not affect female fertility. Moreover, the

present full-length normal W chromosome is not likely to

be essential because large deletions of these parts of the W

chromosome do not affect viability. Combining the DNA

sequence data of W-specific RAPD markers and W-specific

BAC clones (Abe et al. 1998a, 2005a and 2005b) with the

results of this study, we suggest that except for the region

containing the putative Fem gene, the W chromosome is a

huge useless graveyard.

Fig. 5 Schematic diagrams of

the generation of the T(W;2)Y-

Chu and T(W;2)Y-Abe

chromosomes. The female-

specific RAPD markers are

indicated at the right side of the

W chromosome. Y is the yellow

blood gene on chromosome 2.

Fem is the putative female-

determining gene

Fig. 6 Mapping of the female-

specific RAPD markers and the

putative Fem gene on the W

chromosome using the W

chromosome variants. For the

T(W;3)Ze, T(W;10)+w-2 DfZ-

DfW and ZeWZ2 chromosomes,

see the previous papers (Abe

et al. 2005b; Fujii et al. 2006,

2007). The pink rectangle is the

W chromosome or W

chromosome fragment. The

orders of 6 W-specific RAPD

markers (W-Kabuki, W-

Kamikaze, W-Musashi, W-

Sasuke, W-Sakura and BMC1-

Kabuki) and 2 W-specific

RAPD markers (W-Yukumuri-L

and W-Yukemuri-S) could not

be determined

280 Genetica (2008) 133:269–282

123

Our results lead to the conclusions that (1) putative Fem

genes are not distributed evenly over the entire W chro-

mosome, (2) no gene governing viability or femaleness is

located on the regions deleted from the W chromosome in

the T(W;2)Y-Abe chromosome, (3) only an extremely

limited region, containing the W-Rikishi RAPD marker

sequence of the W chromosome, is required to determine

femaleness.

Since RAPD markers are well interspersed in the gen-

ome and unbiased with regard to linkage group (Promboon

et al. 1995), it is likely that the 12 W-specific RAPD

markers are randomly distributed on the W chromosome.

Under this assumption, only one-twelfth of the W chro-

mosome is retained in the T(W;2)Y-Abe chromosome, and

the putative Fem gene is located in the middle of the W

chromosome. It is very difficult to determine the exact

length of the W chromosome region of T(W;2)Y-Abe

chromosome. The haploid genome of B. mori (2n = 56) is

estimated to be 475 Mb (Mita et al. 2004). On the

assumption that all chromosomes are nearly the same size,

the size of the W chromosome can be estimated to be

17 Mb (475/28 = 16.96). Therefore, the length of one-

twelfth of the W chromosome can be estimated to be

1.4 Mb (17/12 = 1.416). This length can be covered by

contiguous BAC clones. Moreover, when candidates of the

Fem gene are obtained, whether or not they are located on

the W chromosome region of T(W;2)Y-Abe should be

investigated as an important test of its identification. Even

if a candidate gene is located somewhere on the W chro-

mosome, if it is not present in the W-region of the

T(W;2)Y-Abe translocation, it cannot be the Fem gene.

Thus, the T(W;2)Y-Abe chromosome will be indispensable

for positional cloning of the Fem gene.

Acknowledgements This work was supported by grants from

BRAIN (to K. M.), Grants-in-Aid for Scientific Research, MEXT

(Nos. 17052006, 17580044, 16011263 and 17018007) and JSPS (No.

16208006), the Insect Technology Project, MAFF/NIAS (No. 1216),

and the National Bioresource Project, MEXT.

References

Abe H, Ohbayashi F, Harada T, Shimada T, Yokoyama T, Kobayashi

M, Oshiki T (1996) An application of DNA diagnosis method for

preservation of the susceptible strain to densonucleosis virus

type-1 of the silkworm, Bombyx mori. J Seric Sci Jpn 65:196–

299 (in Japanese with English summary)

Abe H, Kanehara M, Terada T, Ohbayashi F, Shimada T, Kawai S,

Suzuki M, Sugasaki T, Oshiki T (1998a) Identification of novel

random amplified polymorphic DNAs (RAPDs) on the W

chromosome of the domesticated silkworm, Bombyx mori, and

the wild silkworm, B. mandarina, and their retrotransposable

element-related nucleotide sequences. Genes Genet Syst 73:

243–254

Abe H, Ohbayashi F, Shimada T, Sugasaki T, Kawai S, Oshiki T

(1998b) A complete full-length non-LTR retrotransposon,

BMC1, on the W chromosome of the silkworm, Bombyx mori.Genes Genet Syst 73:353–358

Abe H, Ohbayashi F, Sugasaki T, Kanehara M, Terada T, Shimada T,

Kawai S, Mita K, Kanamori Y, Yamamoto M-T, Oshiki T (2001)

Two novel Pao-like retrotransposons (Kamikaze and Yamato)

from the silkworm species Bombyx mori and B. mandarina:

common structural features of Pao-like elements. Mol Genet

Genomics 265:375–385

Abe H, Sugasaki T, Terada T, Kanehara M, Ohbayashi F, Shimada T,

Kawai S, Mita K, Oshiki T (2002) Nested retrotransposons on

the W chromosome of the wild silkworm Bombyx mandarina.

Insect Mol Biol 11:307–314

Abe H, Mita K, Yasukochi Y, Oshiki T, Shimada T (2005a)

Retrotransposable elements on the W chromosome of the

silkworm, Bombyx mori. Cytogenet Genome Res 110:144–151

Abe H, Seki M, Ohbayashi F, Tanaka N, Yamashita J, Fujii T,

Yokoyama T, Takahashi M, Banno Y, Sahara K, Yoshido A,

Ihara J, Yasukochi Y, Mita K, Ajimura M, Suzuki MG, Oshiki T,

Shimada T (2005b) Partial deletions of the W chromosome due

to reciprocal translocation in the silkworm Bombyx mori. Insect

Mol Biol 14:339–352

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic

local alignment search tool. J Mol Biol 215:403–410

Charlesworth D, Charlesworth B, Marais G (2005) Steps in evolution

of heteromorphic sex chromosomes. Heredity 95:118–128

Doira H (1978) Genetic stocks of the silkworm. In: Tazima Y (ed)

The silkworm, an important laboratory tool. Kodansha Ltd.,

Japan

Doira H (1992) Genetical stocks and mutations of Bombyx mori. In:

Doira H (ed) Important genetic resources. Silkworm Genetic

Division, Institute of Genetic resources, Faculty of Agriculture,

Kyusyu University, Fukuoka, Japan, pp 1–73

Ennis TJ (1976) Sex chromatin and chromosome numbers in

Lepidoptera. Can J Cytol 18:119–130

Fujii H, Banno Y, Doira H, Kihara H, Kawaguchi Y (1998) Genetical

stocks and mutations of Bombyx mori: Important genetic

resources, 2nd edn. Institute of Genetic Resources, Faculty of

Agriculture, Kyusyu University, Fukuoka

Fujii T, Tanaka N, Yokoyama T, Ninaki O, Oshiki T, Ohnuma A,

Tazima Y, Banno Y, Ajimura M, Mkita K, Seki M, Ohbayashi F,

Shimada T, Abe H (2006) The female-killing chromosome of the

silkworm, Bombyx mori, was generated by translocation between

the Z and W chromosomes. Genetica 127:253–265

Fujii T, Yokoyama T, Ninagi O, Kakehashi H, Obara Y, Nenoi M,

Ishikawa T, Mita K, Shimada T, Abe H (2007) Isolation and

characterization of sex chromosome rearrangements generating

male muscle dystrophy and female abnormal oogenesis in the

silkworm, Bombyx mori. Genetica 130:267–280

Goldsmith MR (1995) Genetics of the silkworm: revisiting an ancient

model system. In: Goldsmith MR, Wilkins AS (eds) Molecular

model systems in Lepidoptera. Cambridge University Press,

New York, pp 21–76

Goldsmith MR, Shimada T, Abe H (2005) The genetics and genomics

of the silkworm, Bombyx mori. Annu Rev Entomol 50:71–100

Hashimoto H (1933) The role of the W-chromosome in the sex

determination of Bombyx mori. Jpn J Genet 8:245–247 (in

Japanese)

Hashimoto H (1948) Sex-limited zebra, an X-ray mutation in the

silkworm. J Seric Sci Jpn 16:62–64

Ito S (1977) Cytogenetical studies on the chromosomes of silk

gland cells of the silkworm with special reference to the structure

and behavior of the sex chromosomes. Jpn J Genet 52:

327–340

Kimura K, Harada C, Aoki H (1971) Studies on the W-translocation

of yellow blood gene in the silkworm (Bombyx mori). Jpn J

Breed 21:199–203 (in Japanese with English summary)

Genetica (2008) 133:269–282 281

123

Koike Y, Mita K, Suzuki MG, Maeda S, Abe H, Osoegawa K, deJong

PJ, Shimada T (2003) Genomic sequence of a 320-kb segment of

the Z chromosome of Bombyx mori containing a kettin ortholog.

Mol Genet Genomics 269:137–149

Marec F, Traut W (1994) Sex chromosome paring and sex chromatin

bodies in W-Z translocation strains of Ephestia kuehniella(Lepidoptera). Genome 37:426–435

Miao XX, Xub SJ, Li MH, Li MW, Huang JH, Dai FY, marino SW,

Mills DR, Zeng P, Mita K, Jia SH, Zhang Y, Liu WB, Xiang H,

Guo QH, Xu AY, Kong XY, Lin HX, Shi YZ, Lu G, Zhang X,

Huang W, Yasukochi Y, Sugasaki T, Shimada T, Nagaraju J,

Xiang ZH, Wang SY, Goldsmith MR, Lu C, Zhao GP, Huang YP

(2005) Simple sequence repeat-based consensus linkage map of

Bombyx mori. Proc Natl Acad Sci USA 102:16303–16308

Mita K, Kasahara M, Sasaki S, Nagayasu Y, Yamada T, Kanamori H,

Namiki N, Kitagawa M, Yamashita H, Yasukochi Y, Kadono-

Okuda K, Yamamoto K, Ajimura M, Ravikumar G, Shimomura

M, Nagamura Y, Shin IT, Abe H, Shimada T, Morishita S,

Sasaki T (2004) The genome sequence of silkworm, Bombyxmori. DNA Res 11:27–35

Niino T, Eguchi R, Shimazaki A, Shibukawa A (1988) Breakage by c-

rays of the +i-lem locus on the translocated 2nd chromosome in

the sex-limited yellow cocoon silkworm. J Seric Sci Jpn 57:75–

76

Niino T, Kanda T, Eguchi R, Shimazaki A, Shibukawa A (1987)

Defects and structure of translocated chromosome in the sex-

limited yellow cocoon strain of the silkworm, Bombyx mori. J

Seric Sci Jpn 56:240–246 (in Japanese with English summary)

Ogura T, Okano K, Tsuchida K, Miyajima N, Tanaka H, Takeda N,

Izumi S, Tomino S, Maekawa H (1994) A defective non-LTR

retrotransposon is dispersed throughout the genome of the

silkworm, Bombyx mori. Chromosoma 103:311–323

Pan QZ, Sugai E, Oshiki T (1986) Sex-chromatin in cell nuclei of

abdominal leg of the silkworm, Bombyx mori. J Seric Sci Jpn

55:483–487 (in Japanese with English summary)

Pan QZ, Sugai E, Oshiki T (1987) Sex-chromatin observation in cell

nuclei of tissues of the silkworm moth, Bombyx mori. J Seric Sci

Jpn 56:436–439 (in Japanese with English summary)

Paran I, Michelmore W (1993) Development of reliable PCR-based

markers linked to downy mildew resistance genes in lettuce.

Theor Appl Genet 85:985–993

Promboon A, Shimada T, Fujiwara H, Kobayashi M (1995) Linkage

map of random amplified polymorphic DNAs (RAPDs) in the

silkworm, Bombyx mori. Genet Res Camb 66:1–7

Sahara K, Yoshido A, Kawamura N, Ohnuma A, Abe H, Mita K,

Oshiki T, Shimada T, Asano SI, Bando H, Yasukochi Y (2003)

W-derived BAC probes as a new tool for identification of the W

chromosome and its aberrations in Bombyx mori. Chromosoma

112:48–55

Sakaguchi B (1978) Gametogenesis, fertilization and embryogenesis

of the silkworm: In: Tazima Y (ed) The silkworm, an important

laboratory tool. Kodansha Ltd., Japan

Tan YD, Wan C, Zhu Y, Lu C, Xiang Z, Deng HW (2001) An

amplified fragment length polymorphism map of the silkworm.

Genetics 157:1277–1284

Tanaka N, Yokoyama Y, Irobe Y, Abe H, Ninagi O, Oshiki T (2000)

Breakage and subsequent return for W chromosome-pB frag-

ment-fifth linkage group fusion chromosome in the sex-limited

pB silkworm strain (TWPB), Bombyx mori. J Seric Sci Jpn

69:327–330

Tanaka Y (1916) Genetic studies in the silkworm. J Coll Agric

Sapporo 6:1–33

Tazima Y (1941) A simple method of sex discrimination by means of

larval markings in Bombyx mori. J Seric Sci Jpn 12:184–188 (in

Japanese)

Tazima Y (1944) Studies on chromosome aberrations in the

silkworm. II. Translocation involving second and W-chromo-

somes. Bull Seric Exp Stn 12:109–181 (in Japanese with English

summary)

Tazima Y, Harada C, Ohta N (1951) On the sex discriminating

method by colouring genes of silkworm eggs. I. Induction of

translocation between the W and tenth chromosomes. Jpn J

Breed 1:47–50 (in Japanese with English summary)

Traut W, Weith A, Traut G (1986) Structural mutants of the W

chromosome in Ephestia (Insecta, Lepidoptera). Genetica 70:69–

79

Traut W, Marec F (1996) Sex chromatin in Lepidoptera. Quart Rev

Biol 71:239–256

Wu C, Asakawa S, Shimizu N, Kawasaki S, Yasukochi Y (1999)

Construction and characterization of bacterial artificial chromo-

some libraries from the silkworm, Bombyx mori. Mol Gen Genet

261:698–706

Xia Q, Zhou Z, Lu C, Cheng D, Dai F, Li B, Zhao P, Zha X, Cheng T,

Chai C, Pan G, Xu J, Liu C, Lin Y, Qian J, Hou Y, Wu Z, Li G,

Pan M, Li C, Shen Y, Lan X, Yuan L, Li T, Xu H, Yang G, Wan

Y, Zhu Y, Yu M, Shen W, Wu D, Xiang Z, Yu J, Wang J, Li R,

Shi J, Li H, Li G, Su J, Wang X, Li G, Zhang Z, Wu Q, Li J,

Zhang Q, Wei N, Xu J, Sun H, Dong L, Liu D, Zhao S, Zhao X,

Meng Q, Lan F, Huang X, Li Y, Fang L, Li C, Li D, Sun Y,

Zhang Z, Yang Z, Huang Y, Xi Y, Qi Q, He D, Huang H, Zhang

X, Wang Z, Li W, Cao Y, Yu Y, Yu H, Li J, Ye J, Chen H, Zhou

Y, Liu B, Wang J, Ye J, Ji H, Li S, Ni P, Zhang J, Zhang Y,

Zheng H, Mao B, Wang W, Ye C, Li S, Wang J, Wong GK,

Yang H, Biology Analysis Group (2004) A draft sequence for the

genome of the domesticated silkworm (Bombyx mori). Science

306:1937–1940

Xiong Y, Burke WD, Eickbush TH (1993) Pao, a highly divergent

retrotransposable element from Bombyx mori containing long

terminal repeats with tandem copies of the putative R region.

Nucleic Acids Res 21:2117–2123

Yamamoto K, Narukawa J, Kadono-Okuda K, Nohata J, Sasanuma

M, Suetsugu Y, Banno Y, Fujii H, Goldsmith MR, Mita K (2006)

Construction of a single nucleotide polymorphism linkage map

for the silkworm, Bombyx mori, based on bacterial artificial

chromosome end sequences. Genetics 173:151–161

Yasukochi Y (1998) A dense genetic map of the silkworm, Bombyxmori, covering all chromosomes based on 1,018 molecular

markers. Genetics 150:1513–1525

Yasukochi Y (2002) PCR-based screening for bacterial artificial

chromosome libraries. Methods Mol Biol 192:401–410

282 Genetica (2008) 133:269–282

123