IDENTIFICATION OF UNKNOWN METHIONINE SULFOXIDE …

IDENTIFICATION OF UNKNOWN METHIONINE SULFOXIDE REDUCTASE ACTIVITY IN HALOFERAX VOLCANII

By

ZACHARY ADAMS

A THESIS PRESENTED TO THE GRADUATE SCHOOL

OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2018

© 2018 Zachary Adams

To Mom and Dad

4

ACKNOWLEDGMENTS

First and foremost, I thank my parents for their love and support. I thank my

mentor Dr. Julie Maupin-Furlow, as well as my committee members Dr. Tony Romeo

and Dr. Christopher Reisch for their guidance. I am also grateful to the faculty, staff, and

my colleagues in the Microbiology and Cell Science department.

5

TABLE OF CONTENTS page

ACKNOWLEDGMENTS .................................................................................................. 4

LIST OF TABLES ............................................................................................................ 6

LIST OF FIGURES .......................................................................................................... 7

ABSTRACT ..................................................................................................................... 8

1 INTRODUCTION .................................................................................................... 10

Oxidative Damage .................................................................................................. 10

Methionine Oxidation and Repair ............................................................................ 10 Distribution of Methionine Sulfoxide Reductases .................................................... 11

Molybdopterin Dependent Reduction of Methionine Sulfoxide ................................ 12 Molybdenum Cofactor Biosynthesis ........................................................................ 13

2 PURPOSE .............................................................................................................. 18

3 METHODS .............................................................................................................. 21

Strains and Culture Conditions ............................................................................... 21

General DNA Methodology ..................................................................................... 21

Construction of Deletion Plasmids .......................................................................... 22 Generation of Mutant Strains .................................................................................. 23 Growth Assays ........................................................................................................ 23

4 RESULTS AND DISCUSSION ............................................................................... 29

Deletion of moaE .................................................................................................... 29

ZA106 Fails to Utilize Methionine Sulfoxide ............................................................ 29 Deletion of dmsA .................................................................................................... 30 ZA109 Retains Ability to Grow on Methionine Sulfoxide ......................................... 31 Identification and Deletion of Additional Candidates ............................................... 31

Plate Assay Using Candidate Gene Deletion Strains ............................................. 32

5 CONCLUSIONS ..................................................................................................... 46

LIST OF REFERENCES ............................................................................................... 48

BIOGRAPHICAL SKETCH ............................................................................................ 52

6

LIST OF TABLES

Table page 2-1 List of strains used in this study .......................................................................... 25

2-2 List of plasmids used in this study ...................................................................... 26

2-3 List of primers used in this study ........................................................................ 27

7

LIST OF FIGURES

Figure page 1-1 Repair of methionine sulfoxide by MsrA and MsrB ............................................. 15

1-2 Overview of Moco biosynthesis and its derivatives bis-MGD and MCD in E. coli ...................................................................................................................... 16

1-3 Working model of protein conjugation and sulfur transfer pathways in archaea .............................................................................................................. 17

4-1 PCR screening confirming deletion of moaE in strain ZA106 ............................. 34

4-2 Growth assay comparing strains H26, XF127, XF130, and ZA106 .................... 36

4-3 PCR screening confirming deletion of dmsA in strain ZA109 ............................. 39

4-4 Growth assay comparing strains H26, XF127, XF130, ZA106, and ZA109 ........ 41

4-5 Summary of additional candidate gene information and their respective proteins ............................................................................................................... 43

4-6 PCR screening of candidate gene deletion isolates for strains ZA110-116 ........ 44

4-7 Plate assay for growth of additional candidate mutant strains on MetSO ........... 45

8

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science

IDENTIFICATION OF UNKNOWN METHIONINE SULFOXIDE REDUCTASE ACTIVITY

IN HALOFERAX VOLCANII

By

Zachary Adams

December 2018

Chair: Julie A. Maupin Major: Microbiology and Cell Science

The major methionine sulfoxide reductase enzymes MsrA and MsrB are well

conserved across all domains of life and seem to have evolved convergently out of the

necessity for life in an oxygen-rich world. The apparent lack of these of enzymes in the

majority of thermophilic archaea, among others, is not fully understood.

Recent observations in the archaeon Haloferax volcanii indicate that a

methionine auxotroph with both predicted methionine sulfoxide reductase genes deleted

is still capable of utilizing methionine sulfoxide for growth. This finding reveals that

additional methionine sulfoxide reductase activity is present in H. volcanii and yet to be

identified. We set out to identify which enzyme(s) were responsible for such activity.

While MsrA/B utilize a nucleophilic active site cysteine for reduction of

methionine sulfoxide (MetSO), some oxidoreductases capable of reducing MetSO utilize

molybdopterin based cofactors. To determine if the yet to be identified Msr activity in H.

volcanii was molybdopterin dependent, we further deleted the moaE gene, proposed to

play a key role in biosynthesis of molybdopterin. Accordingly, the resulting disruption of

molybdopterin biosynthesis was found to abolish growth on methionine sulfoxide. We

then identified 8 putative molybdopterin oxidoreductases in H. volcanii and deleted

9

these genes in the initial strain. Work is ongoing to test these deletion strains for

utilization of methionine sulfoxide and is anticipated to serve in the identification of the

unknown methionine sulfoxide reductase(s) in this organism. Such a discovery would

further our knowledge of this increasingly diverse group of enzymes and their unusual

distribution throughout archaea.

10

CHAPTER 1 INTRODUCTION

Oxidative Damage

While the development of Earth’s oxygen rich atmosphere certainly led to an

explosion of life and molded life as we know it today, oxygen also presents unique

challenges to living organisms. Both endogenous factors, such as metabolism, and

exogenous factors, like radiation, can lead to the formation of free radicals and reactive

oxygen species. The formation of these reactive oxidants and the damage they can

cause in living organisms has been extensively reviewed1. Highly reactive oxidants can

react with essentially any biological molecule, including nucleic acids, proteins, lipids,

and carbohydrates. Most early research on the oxidation of biomolecules focused on

lipids and DNA, but scientific advances have addressed difficulties in studying the

oxidation of proteins. Given that proteins constitute the major biological component of

living systems by weight and are estimated to consume the majority of radicals in cells,

the study of protein oxidation represents a critical field2.

Methionine Oxidation and Repair

The sulfur containing amino acids cysteine and methionine (Met) are readily

oxidized by a variety of reactive oxidants. While the unique thiol chemistry of cysteine

has long been understood to play major roles in redox sensing and regulation, protein

folding and function, and others, the importance of methionine oxidation did not gain

much interest until recently3. Oxidation of methionine forms two diastereomers of

methionine sulfoxide (MetSO) in equal measure, Met-(R)-SO and Met-(S)-SO4. Further

oxidation of MetSO is possible, giving methionine sulfone, but this rarely occurs under

11

typical conditions. Methionine oxidation can occur both on free methionine and residues

in protein3,5.

Repair of MetSO back to methionine is possible using methionine sulfoxide

reductase (Msr) enzymes. The two major types of Msrs are MsrA and MsrB. MsrA type

enzymes specifically reduce the Met-(S)-SO stereoisomer both in the free and protein

bound form. MsrB enzymes reduce Met-(R)-SO, also in the free and protein bound

forms, however activity towards free Met-(R)-SO is often much lower6-9. Intriguingly,

MsrA and MsrB share little to no sequence or structural homology yet possess mirror

image active sites and appear to have developed through convergent evolution10,11.

Another class of Msr is represented by enzymes specific for the reduction of free Met-

(R)-SO, the free methionine-(R)-sulfoxide reductase or fRMsr12,13. An overview of the

mechanism of repair by Msrs is shown in Figure 1-1.

Distribution of Methionine Sulfoxide Reductases

As early as the initial discoveries of MsrA and MsrB, it had become evident that

Msr enzymes were represented in all domains of life14,15. Soon thereafter, the dawn of

the post-genomic era confirmed the widespread distribution of Msrs. All eukaryotes and

cyanobacteria examined to date are predicted to encode for MsrA and MsrB, with

multiple isoforms often present16,17. Most bacteria also possess MsrA and MsrB,

however there are some exceptions, including some established bacterial

endosymbionts and endoparasites16,17. Free-living bacteria in which both Msrs are

predicted missing are restricted to a small number of anaerobes and

hyperthermophiles16-18. It is also worth noting that in many bacteria, MsrA and MsrB

domains are fused together within a single protein16,17,19.

12

Among the three domains of life, Msrs appear to be most scarcely distributed in

the archaea. Many archaea are predicted to lack MsrB, and most thermophiles are

predicted to lack both MsrA and MsrB16-18. A notable exception is the hyperthermophilic

archaeon Thermococcus kodakaraensis, which grows at an optimal temperature of 85

°C20. However, the MsrA/B fusion protein of this organism could not be detected in vivo

at temperatures 80-90 °C, and maximum MsrA/B activity was observed at 30 °C18.

Fukushima et. al. proposed that lower oxygen solubility in high temperature

environments may eliminate the need for MetSO reduction and that T. kodakaraensis

may benefit from this enzyme in lower temperature environments18. This hypothesis

may be reasonable given the temperature gradients located at hydrothermal vents but

does not explain if or how other archaea which lack predicted Msrs might cope with

increasing dissolved oxygen at lower temperatures.

Molybdopterin Dependent Reduction of Methionine Sulfoxide

Methionine sulfoxide can also be reduced by oxidoreductases that act on N- and

S-oxide substrates with broad specificity. One example is DMSO reductase, which has

been shown to exhibit broad substrate specificity in bacteria21. In some instances,

molybdopterin dependent enzymes of the DMSO reductase family may display

considerably high activity towards MetSO. E. coli BisC is one such enzyme, in which the

first enzymatic activity for the stereospecific reduction of free MetSO was observed,

allowing E. coli to use free Met-(S)-O for growth22. More recently, MsrP, a novel Msr

enzyme capable of reducing all forms of MetSO with the help of its partner MsrQ, was

identified in the bacterial cell envelope23. Although a member of the molybdopterin

dependent sulfite-oxidase family, homologs of MsrP appear to be strictly contained in

bacteria24. The common feature amongst these enzymes is that they use variants of

13

molybdenum cofactor for reduction of MetSO, as opposed to active site cysteines found

in the classical MsrA, MsrB, and fRMsr9,24. Overall, molybdopterin-dependent

oxidoreductases appear to be playing a larger and larger role in our still growing

understanding of MetSO reduction.

Molybdenum Cofactor Biosynthesis

Biosynthesis of the molybdenum cofactor (Moco) is carried out in three steps.

The first step involves cyclization of GTP to form cyclopyranopterin monophosphate

(cPMP). cPMP is then sulfurylated resulting in the mature form of pyranopterin (MPT).

This step is carried out by MPT synthase, a heterotetrameric complex of MoaD and

MoaE. Following adenylation of MPT, a molybdate ion is inserted to give the most basic

form of Moco (or more informatively, Mo-MPT) catalyzed by the MogA and MoeA

proteins25-27.

Moco can be modified to give derived forms of the cofactor, such as through

addition of GMP or cytosine. Two molecules of the guanine modified Moco (MGD or

MPT guanine dinucleotide cofactor) are joined around one molybdenum center to form

bis-MGD28. bis-MGD is found in enzymes of the DMSO reductase family in bacteria,

whereas a cytosine modified form (MCD) is found in enzymes of the xanthine oxidase

family in E. coli27. While MobA is essential for the attachment of GMP to Moco29, the

function of MobB remains to be determined. Initial reports suggested that MobB might

function as an adapter protein that assists MobA through binding of GTP30. However, a

more recent study showed in vitro that MobA alone is sufficient for formation and

insertion of bis-MGD in the DMSO reductase of Rhodobacter sphaeroides31. See Figure

1-2 for details.

14

In Haloferax volcanii, the MoaE homologue has been observed in complex with

small archaeal modifier protein 1 (SAMP1)32. Given the similarity of H. volcanii MoaE

and SAMP1 to the MPT synthase subunits of other organisms, MoaE is proposed to

function in the sulfurylation of cPMP to form molybdopterin, using thiocarboxylated

SAMP1 as a source of sulfur. This proposal is further supported by the finding that

MoaE is essential for DMSO reductase activity in H. volcanii33. Furthermore, MoaE is

found fused to an N-terminal MobB domain, and this arrangement is often observed in

other halophilic and methanogenic archaea33. A working model for the protein

conjugation and sulfur transfer pathways of archaea is shown in Figure 1-3.

15

Figure 1-1. Repair of methionine sulfoxide by MsrA and MsrB. Reprinted by permission

from Springer Nature: Nature Reviews Microbiology, Oxidative stress, protein damage and repair in bacteria, Gennaris, A., Barras, F. & Collet, J.-F9, Copyright © 2017.

https://www.nature.com/nrmicro/

16

Figure 1-2. Overview of Moco biosynthesis and its derivatives bis-MGD and MCD in E.

coli. Reprinted from Biochimica et Biophysica Acta (BBA) – Bioenergetics, 1827, Iobbi-Nivol, C. & Leimkühler, S., Molybdenum enzymes, their maturation and molybdenum cofactor biosynthesis in Escherichia coli, 1086–110127, Copyright © 2013, with permission from Elsevier.

17

Figure 1-3. Working model of protein conjugation and sulfur transfer pathways in

archaea. Figure courtesy of: Miranda, H. V. et al. E1- and ubiquitin-like proteins provide a direct link between protein conjugation and sulfur transfer in archaea. Proceedings of the National Academy of Sciences 108, 4417–4422 (2011)33.

18

CHAPTER 2 PURPOSE

The absence of a predicted Msr in many archaeal species frames the question of

how these organisms seemingly cope with an inability to reduce MetSO in free or

protein form. Only a handful of Msrs from the archaea have been characterized24. This

group of studied archaeal Msrs includes the previously mentioned MsrAB fusion protein

from T. kodakaraensis18. In addition, the MsrB of Methanothermobacter

thermoautotrophicus10, and an fRMsr from Thermoplasma acidophilum34, are

biochemically and structurally characterized. Lastly, the MsrA and MsrB of Haloferax

volcanii were found to reduce the peptide mimic dabsyl-Met-(S)-O and -Met-(R)-O,

respectively35. Interestingly, treatment of H. volcanii with DMSO stimulates a MsrA-

dependent ubiquitin-like conjugation process, accompanied by an inhibition of the

MetSO reductase activity of MsrA35.

Haloferax volcanii is a halophilic archaeon belonging to the phylum

Euryarchaeota. Originally isolated from the Dead Sea, it grows optimally in NaCl

concentrations from 1.7-2.5 M and at temperatures near 42 °C36. Compared to other

archaea, these relatively moderate growth conditions of H. volcanii make it readily

suitable for laboratory study. Furthermore, the development of a variety of genetic,

biochemical, and now “omics” based tools have led to this organism’s standing as one

of the foremost model organisms in the study of archaea37,38. In light of recent findings

regarding MsrA of H. volcanii, this system represents a promising subject for the study

of Msrs in archaea.

MsrA and MsrB are the only predicted Msrs present in H. volcanii. Our efforts, to

confirm MsrA and MsrB were the only Msrs present in this organism, led to the

19

surprising observation that a methionine auxotroph lacking both MsrA and MsrB can still

utilize MetSO as its only source of methionine for growth. This finding suggests that

additional Msr activity is present in H. volcanii. Given that no dabsyl-MetSO activity was

detected in an MsrAB mutant35, it appears that residual Msr activity in H. volcanii is

likely to be specific for free MetSO.

Although fRMsrs are conserved to a degree in gram-negative bacteria, they

appear to be absent in the vast majority of archaea and are not predicted in any

Halobacteria genomes24. Investigation of this residual Msr activity in H. volcanii may

shed light on whether specific reduction of free MetSO occurs in diverse archaea. In

addition, knowledge of the enzyme(s) involved may provide clues as to other Msrs yet

to identified, perhaps in thermophilic archaea, for instance. Furthermore, this knowledge

would help bolster our understanding of Msrs in a leading model organism for archaea,

where it has already been shown that MsrA plays a complex role in response to

DMSO35.

Our primary objective of this study is to identify the enzyme(s) responsible for the

residual Msr activity identified in H. volcanii. As an initial screen to determine whether

residual activity is molybdopterin dependent, we disrupted the synthesis of Moco

through deletion of moaE from the H26 derived parent strain XF130 (ΔmetE1/2 ΔmsrA

ΔmsrB). Utilization of MetSO was abolished in this strain. This provided evidence that

any residual Msr activity—at a level sufficient to support growth on MetSO—was

molybdopterin dependent. The discovery that E. coli BisC carries out the stereospecific

reduction of free Met-(S)-O was made using a similar approach22. As this approach was

successful, we now use bioinformatic analysis to predict all molybdopterin

20

oxidoreductases in the genome, and candidates were chosen for deletion from the

parent strain. Selection of the enzyme responsible for residual Msr activity would result

in a failure to utilize MetSO for growth. Early follow up experiments will focus on

characterization of the enzyme and its activity towards reduction of MetSO.

21

CHAPTER 3 METHODS

Strains and Culture Conditions

Strains used in this study are listed in Table 2-1. E. coli TOP10 was used for

routine selection, amplification, and maintenance of plasmid DNA. E. coli GM2163 was

used for isolation of plasmid DNA prior to transformation of H. volcanii. E. coli strains

were grown in LB-Miller medium at 37°C. H. volcanii strains were grown at 42-45°C in

ATCC 974, minimal medium (Hv-Min), glycerol minimal medium (GMM), and casamino

acids medium (HvCa) as previously described39,40. Solid medium was supplemented

with 1.5 and 2.0 % (wt/vol) agar for culture of E. coli and H. volcanii, respectively.

Ampicillin was added to LB medium at a concentration of 100 ug/mL where necessary.

Liquid cultures were aerated by rotary shaking at 200 rpm. Cells were stored at -80°C in

20% (vol/vol) glycerol stocks. H. volcanii strains were streaked from the freezer stocks

onto ATCC 974 agar plates.

General DNA Methodology

Plasmids used in this study are listed in Table 2-2. Primers are listed in Table 2-

3. Phusion DNA polymerase was used for high-fidelity amplification of DNA, while

OneTaq and/or Phusion DNA polymerase was used for screening purposes, according

to the manufacturer’s instructions (New England Biolabs). PCR products were analyzed

on 0.8 % (w/v) agarose gels stained with 0.5 μg/mL ethidium bromide in Tris-acetate-

EDTA (TAE) buffer. For PCR products intended for downstream gel extraction and

restriction digest, agarose gels were stained with GelGreen according to the supplier’s

instructions (Biotium). Restriction enzymes, ligase mix, and KLD (kinase, ligase, DpnI)

mix were used according to the manufacturer’s instructions (New England Biolabs).

22

DNA cleanup, gel extraction, and plasmid minipreps were completed using the

respective Monarch purification kits (New England Biolabs). Sanger sequencing was

used to verify the integrity of all constructs (Eton Biosciences).

Construction of Deletion Plasmids

Primers flanking the gene of interest by roughly 500 base pairs on both sides

were designed and checked for specificity using Primer-BLAST (NCBI)41. Restriction

sites and additional bases for optimal cutting were selected for compatibility with

plasmid pTA131 and added onto the primers found specific by Primer-BLAST. These

primes were named “gene/HVO_xxxx pKO UP/DN” (where HVO_xxxx represents the

locus tag number for each respective gene). Inserts for pre-deletion plasmids were

obtained by PCR amplification using the 500 base pair flanking primers, followed by gel

extraction and restriction digest with the appropriate enzyme. The cleaved inserts were

ligated with cut and phosphatase treated pTA131 to form the pre-deletion plasmid. Pre-

deletion plasmids were transformed to E. coli TOP10, screened, and sequenced.

Inverse PCR primers were designed amplifying outwards from the gene of

interest in the pre-deletion plasmid using Primer3Plus42, and named “gene/HVO_xxxx

UP/DN INV.” Where possible, primers were designed for clean deletion of the gene from

the chromosome, or to at least have minimal impact on adjacent genetic material. The

linear product of the inverse PCR reaction amplifying the pre-deletion plasmid was

treated with KLD (kinase, ligase, DpnI) enzyme mix. The resulting deletion plasmid was

transformed to E. coli TOP10. After verification of the construct by DNA sequencing,

deletion plasmids were passaged through E. coli GM2163 before transformation to H.

volcanii strains.

23

Generation of Mutant Strains

H. volcanii mutants containing chromosomal deletions were generated using the

pyrE2-based “pop-in pop-out” method described previously43,44. Deletion plasmid

integrants were selected on HvCa+ agar without uracil. Screening was conducted using

the “pKO UP/DN” primers, and isolates with PCR products indicative of integration were

selected for the “pop-out” step. Isolates were inoculated in 3 mL ATCC 974

supplemented with 5-FOA and cultured for 24 h. Cells (1.8 mL) were harvested by

centrifugation at 6,000 x g for 10 min at room temperature and resuspended in 0.5 mL

18% saline water (SW)39. Serial dilutions (100, 10-1, 10-2 ) were made, and 50 μL of

each dilution was plated on HvCa agar supplemented with 10 μg/mL uracil and 50

μg/mL 5-FOA. Plates were incubated for 5 days at 42 °C, and colonies were patched on

the same medium for screening. Initial screening was conducted using the 500 base

pair flanking primers, and isolates indicating loss of the gene were chosen. Selected

pop-outs were then streaked for further isolation and gene deletion was confirmed by

screening with a different flanking primer pair and/or gene specific primers.

Growth Assays

Strains selected for growth assays in 96-well plates (CellPro, Alkali Scientific

catalog #TPN1096-NT) were inoculated in 2.5 mL GMM supplemented with 0.1 mM L-

methionine and grown to log phase (OD600 of 0.6) in borosilicate glass 13 x 100 mm test

tubes. The log phase cells were subcultured to an initial OD600 of 0.06 in 2.5 mL of the

same medium and grown to OD600 of 0.6. Cells (0.5 mL of this culture) were pelleted by

centrifugation at 6,000 x g for 10 min at room temperature, and 0.48 mL of the

supernatant was carefully removed. A volume of GMM was added so that 5 μL of the

suspension contained 0.003 OD600 units cells. Aliquots (5 μL) of this suspension were

24

used to inoculate each well of a 96-well plate containing 145 μL GMM supplemented

with varying amounts of L-Met or L-MetSO (Sigma-Aldrich, catalog #M1126). Strains

were inoculated in triplicate and positioned to minimize effects of evaporation across

strains and replicates. The outermost wells were filled with 250 μL water to limit

evaporation of the inner wells. Plates were covered with lids and incubated in a Synergy

HTX plate reader (BioTek) with maximum orbital pattern shaking at 42 °C. OD readings

were taken at 600 nm every one or two hours. Roughly every 24 h, the read was

paused, and the plate was removed briefly for replenishing of the water in the outermost

wells. In the second growth assay containing strain ZA109, water was not replaced in

the outermost wells.

For the growth assay on solid medium, strains were picked from the selective

medium used for pop-out described above and inoculated directly on Hv-Min agar

supplemented with 0.25 mM Met or MetSO. When supplemented with Met, the plate

was incubated for 42 h, whereas with MetSO supplementation, incubation lasted a

period of 9 days.

25

Table 2-1. List of strains used in this study.

Strain Description Source or reference

E. coli

TOP10 F- recA1 endA1 hsdR17(rK– mK+) supE44 thi-1 gyrA relA1

Invitrogen

GM2163 F- ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA dcm-6 hisG4 rfbD1 rpsL136 dam13::Tn9 xylA5 mtl-1 thi-1 mcrB1 hsdR2

New England Biolabs

H. volcanii

DS70 wild type isolate DS2 cured of plasmid pHV2 Wendoloski et. al., 2001

H26 DS70 ΔpyrE2 Allers et. al., 2004

XF127 H26 ΔmetE1/2 This study

XF128 H26 ΔmetE1/2 ΔmsrA This study

XF129 H26 ΔmetE1/2 ΔmsrB This study

XF130 H26 ΔmetE1/2 ΔmsrA ΔmsrB This study

ZA106 H26 ΔmetE1/2 ΔmsrA ΔmsrB ΔmoaE This study

ZA109 H26 ΔmetE1/2 ΔmsrA ΔmsrB ΔdmsA This study

ZA110 H26 ΔmetE1/2 ΔmsrA ΔmsrB ΔHVO_0671 This study


ZA112 H26 ΔmetE1/2 ΔmsrA ΔmsrB ΔHVO_B0367 This study





26

Table 2-2. List of plasmids used in this study

Plasmid Description Source or reference

pTA131 Apr; Nvr; pyrE2-based integration vector Allers et. al., 2004

pJAM1114 Apr; Nvr; pTA131-based deletion vector for moaE Miranda et. al., 2011

pJAM3500 Apr; Nvr; pTA131-based pre-deletion vector for dmsA

This study

pJAM3501 Apr; Nvr; pTA131-based deletion vector for dmsA This study

pJAM3502 Apr; Nvr; pTA131-based pre-deletion vector for HVO_0671

This study

pJAM3503 Apr; Nvr; pTA131-based deletion vector for HVO_0671

This study


This study


This study

pJAM3506 Apr; Nvr; pTA131-based pre-deletion vector for HVO_B0367

This study

pJAM3507 Apr; Nvr; pTA131-based deletion vector for HVO_B0367

This study


This study


This study


This study


This study


This study


This study


This study


This study

27

Table 2-3. List of primers used in this study.

Primer Sequence (5'-3')

moaE 447 UP FW CGTGACCGCATCTTAAGGGT

moaE 369 DN RV GTACTGCTTGAGGCGGTCTT

moaE 229 INT FW TACGACTACGCGCTCCTCTC

moaE 750 INT RV AATCGGCACCTCGTCTTTCA

dmsA pKO UP CTAGTGGATCCGACGGCGAGTGTATCG

dmsA pKO DN CGATCAAGCTTGTCACCGAAGATGCGGG

dmsA INT FW GCCACCGAACCGGCGTCGAG

dmsA INT RV AATAAGCTTGTCACCTCCCGCCCCGG

dmsA UP INV TCCGTCGTCACTCATCGAAC

dmsA DN INV GGGAGGTGACTGACCATGAC

HVO_0671 pKO UP CGAATAAGCTTGACGAGATTTACGAGCC

HVO_0671 pKO DN CTAGTGGATCCGTCGAAGTCGGCTATTC

HVO_1471 pKO UP CGATCAAGCTTCGAGAAGTGGTCCTTGA

HVO_1471 pKO DN CTAGTGGATCCGAAGGCGACCTGCAC

HVO_B0367 pKO UP CTGTTAAGCTTGGTGAACTGTCGGCGCTTTTC

HVO_B0367 pKO DN CAACAGGATCCACGACGGTACAGGGCGTGAAG

HVO_B0164 pKO UP CGAATAAGCTTGACTACCACGACGAATC

HVO_B0164 pKO DN CTAGTGGATCCCTCGCGCTTGTAGATG

HVO_0935 pKO UP CGAATAAGCTTGAAGAGGATGAGCAGGA

HVO_0935 pKO DN CTACAGGATCCACGTCCCACTCGGATA

HVO_1908 pKO UP CGATCAAGCTTAGAAGACGCGTCGATAC

HVO_1908 pKO DN CTAGAGGATCCATAGTGTCGGTGCAGG

HVO_B0235 pKO UP GACATGAATTCCCCAGAGGGCACCGATAGAG

HVO_B0235 pKO DN GGTAAGGATCCAGTTGCCAGAGAATAGACACGG

HVO_0671 UP INV AGAAGTGATAGCGTTTCGAGCG

HVO_0671 DN INV TTCCAGTGGGTCGATGTGGTC

HVO_1471 UP INV CCGACGCACCTATCACTAACGA

HVO_1471 DN INV AGCTGAGCTGAGTTTTCGGTCC

HVO_B0367 UP INV TGCATGCGTACTCACTACACCA

HVO_B0367 DN INV ATGACGCGAGAGAGACAGAACC

28

Table 2-3. Continued

Primer Sequence (5'-3')

HVO_B0164 UP INV AAAAGACGGTCGTTAGTGCCAG

HVO_B0164 DN INV GGTGATGCCGAATGAGCACC

HVO_0935 UP INV CGCTGACACACCACACACATAG

HVO_0935 DN INV GATGACTGACTCGTCGGCGTC

HVO_1908 UP INV ATATACCCCGTGCCGTTCGTG

HVO_1908 DN INV GTGAGCGACTGATGGCGTTC

HVO_B0235 UP INV TTTGTCAGAACAGGTGCCGCTC

HVO_B0235 DN INV ACGTTTCGCTGTACTCCTCTCC

29

CHAPTER 4 RESULTS AND DISCUSSION

Deletion of moaE

In order to disrupt molybdopterin synthesis in the methionine auxotroph msrA

msrB mutant (XF130), the moaE gene was deleted from XF130. See methods for

details. Initial pop-out colonies were screened by PCR using primers flanking moaE,

and colonies indicating loss of moaE were streaked for further isolation. This strain

(ΔmetE1/2 ΔmsrA ΔmsrB ΔmoaE) was putatively named ZA106. Further isolated

colonies of ZA106 were then screened using one primer pair flanking moaE and one

pair specific for moaE itself (Figure 3-1). When screened using flanking primers, the

PCR products generated from the deletion mutants were roughly 800 bp less than the

wild-type controls, suggesting that moaE was no longer present. Some minor PCR

products were observed when isolates were screened with moaE specific primers,

however these were expected to be nonspecific products based on size and

comparison to wild type. An isolate (ZA106) that did not display evidence for carrying

the moaE gene based on this PCR analysis (lane 1) was chosen for subsequent strain

preservation and growth assays.

ZA106 Fails to Utilize Methionine Sulfoxide

The isolate ZA106 (ΔmetE1/2 ΔmsrA ΔmsrB ΔmoaE) was assayed for growth

under conditions where MetSO was the only source of methionine present. Growth of

ZA106 was not supported when cultured in GMM supplemented with 0.1 mM MetSO

(Figure 3-2). We note that 0.1 mM Met supplementation was only sufficient to restore

growth of the mutant strains to about half that of the wild type strain H26. This finding

indicated that a higher level of Met supplementation is required under these growth

30

conditions for Met auxotrophs to grow similar to wild type and provided room for

improvement in design of future assays. Still, ZA106 grew similar to the other mutant

strains under Met supplementation, suggested that deletion of moaE did not result in

any significant general impact of growth. Rather, the deletion of moaE was responsible

for loss of residual Msr activity in the cell that previously allowed for growth on MetSO in

strain XF130. Complementation of moaE via plasmid will be completed to confirm this

finding.

Deletion of dmsA

The finding that disruption of molybdopterin synthesis in a methionine auxotroph

with all known Msrs deleted abolished growth on MetSO established clear support that

any major residual Msr activity yet to be identified in H. volcanii was likely molybdopterin

dependent. We next set out to identify what specific molybdoenzyme(s) might be

responsible for this residual Msr activity. Given that moaE deletion in H. volcanii was

previously observed to abolish DMSO reductase activity33, and that DMSO reductases

are known to be capable of reducing MetSO, we chose to delete the gene encoding for

the active site subunit of DMSO reductase—dmsA. Plasmid pJAM114 was introduced in

XF130 (ΔmetE1/2 ΔmsrA ΔmsrB) for deletion of dmsA from the chromosome, as

described in the methods. Candidate deletion mutants were identified by PCR screening

and the strain was putatively named ZA109 (ΔmetE1/2 ΔmsrA ΔmsrB ΔdmsA).

Putative strains were subjected to further isolation and verification of gene loss

by PCR screening. When primers flanking dmsA were used for screening, a PCR

product in the mutants was observed that migrated approximately 1500 bp less than the

product observed in the wild-type control (Figure 3-3). This difference was expected to

be about 2500 bp given the size of dmsA (2532 bp). However, the smaller observed

31

difference can be explained by the migration of the wild-type product some 1000 bp

lower than expected, likely due to incomplete product formation. The mutant product

appeared to be the same size as that of the deletion plasmid itself (lane 14), the fidelity

of which had been verified by DNA sequencing. Furthermore, screening with primers

specific for dmsA over a range of temperatures also suggested that dmsA was no

longer present in ZA109.

ZA109 Retains Ability to Grow on Methionine Sulfoxide

Following generation of strain ZA109, growth was assayed in a similar fashion as

the previous experiment. While ZA106 (ΔmetE1/2 ΔmsrA ΔmsrB ΔmoaE) again failed to

grow on MetSO, ZA109 (ΔmetE1/2 ΔmsrA ΔmsrB ΔdmsA) grew similarly to the wild

type under MetSO supplementation (Figure 3-4). This result suggested that DMSO

reductase was not responsible—or at least not alone—for the residual Msr activity in H.

volcanii. Note that after about 24 h incubation, the OD600 readings for mutant strains

growing without Met appeared to increase slightly but steadily. This increase can also

be observed for strain ZA106 grown on MetSO supplementation. However, this modest

increase can likely be attributed to failure to replenish the water in the outside wells of

the plate, which we have observed results in evaporation of sample cultures and can

impact OD readings. Separate assays conducted in test tubes confirmed that ZA109

was still able to utilize MetSO, whereas ZA106 could not (data not shown).

Identification and Deletion of Additional Candidates

We next sought to test a complete set of candidate ORFs for residual Msr

activity. Seven genes encoding for predicted MPT oxidoreductases were identified and

a summary of their information is shown in Figure 3-5. All seven of these genes were

32

deleted from XF130 (ΔmetE1/2 ΔmsrA ΔmsrB) using the previously described method

and screened for confirmation. Pop-out colonies were screened by the same 500 bp

flanking primers used in construction of the pre-deletion plasmid, and colonies yielding a

PCR product of roughly 1000 bp in the absence of wild-type PCR product were selected

for growth assay as indicated in Figure 3-6. Further isolation and screening of these

isolates remains to be completed. The strains were tentatively named ZA110-116.

Plate Assay Using Candidate Gene Deletion Strains

The isolates of strains ZA110-116 obtained above, in addition to ZA106

(ΔmetE1/2 ΔmsrA ΔmsrB ΔmoaE), were inoculated on Hv-Min plates supplemented

with either 0.25 mM Met or MetSO. After 42 h incubation, all strains were observed to

grow when supplemented with 0.25 mM Met (Figure 3-7). However, on the plate

supplemented with MetSO, minimal to no growth was observed for all strains.

Therefore, incubation of the MetSO supplementation plate was extended to 9 days. By

this point in time, growth was visible for all of the tested strains, but still below the level

observed with Met supplementation. This finding may be explained by the level of

MetSO supplementation not being adequate to achieve the same rate of growth

observed under Met supplementation, or another factor resulting from conducting the

assay on agar plates as opposed to liquid.

More importantly, ZA106 was observed to grow on MetSO supplementation,

which contrasts with the results of both growth assays in liquid media. This level of

growth did at least appear to be the lowest of all strains examined. Interestingly, ZA111

(ΔmetE1/2 ΔmsrA ΔmsrB ΔHVO_1471) appeared to grow at a level similar to ZA106

under MetSO supplementation. This finding suggested that HVO_1471 might be

responsible for at least some of the residual Msr activity present in H. volcanii. Thus, the

33

finding that ZA106 grew on the MetSO supplementation plate presents a double-edged

sword. On one side, the growth of ZA106 is concerning given that growth assays in

liquid indicate the strain is unable to utilize MetSO. On the other, the similar level of

growth observed for ZA111 suggests that HVO_1471 may contain Msr activity.

Use of the plate assay, while intended to provide a quick initial screen of the

candidate Msr deletion strains, did introduce some complications. However,

troubleshooting is to be expected when developing new assays. It may be that ZA106

can utilize MetSO when cultured in a less aerobic environment such as on agar plates.

Alternatively, MetSO may be reduced by other strains on the plate and eventually

diffuse back into the medium, permitting growth of ZA106. Streaking the strains on

separate plate seems to be a good place to start. In any case, further isolation of the

candidate deletion strains and a more thorough PCR screening should be completed.

Troubleshooting of the plate assay should be investigated while also preparing for the

liquid growth assay performed previously. No conclusion should be jumped to

concerning this initial screening of the candidate deletion strains.

34

Figure 4-1. PCR screening confirming deletion of moaE in strain ZA106. Diagram at top

depicts moaE and associated PCR products, to scale. Primers “moaE 447 UP FW” and “moaE 369 DN RV” were used to generate product A (pA), with an expected size in wild-type strains of 1603 bp. Primers “moaE 229 INT FW” and “moaE 750 INT RV” were used to generate product B (pB), with an expected size in wild-type strains of 507 bp. A) Screening of ZA106 isolates vs. wild-type control by primers “moaE 447 UP FW” and “moaE 369 DN RV.” Lane M, marker; 1-12, ZA106 isolates (lysate); 13, wild-type lysate; 14, wild-type genomic DNA extract. B) Screening of ZA106 isolates vs. wild-type control by primers “moaE 229 INT FW” and “moaE 750 INT RV.” Lane M, marker; 1-12, ZA106 isolates (lysate); 13, wild-type lysate; 14, wild-type genomic DNA extract.

35

Figure 4-1. Continued

36

A)

Figure 4-2. Growth assay comparing strains H26, XF127, XF130, and ZA106. Strains

were grown in glycerol minimal media (GMM) supplemented with A) No Met, B) 0.1 mM Met, and C) 0.1 mM MetSO.

37

B)


38

C)


39

Figure 4-3. PCR screening confirming deletion of dmsA in strain ZA109. Diagram at top

depicts dmsA and associated PCR products, to scale. Primers “dmsA pKO UP/DN” were used to generate product A (pA), with an expected size in wild-type strains of 3773 bp. Primers “dmsA INT FW/RV” were used to generate product B (pB), with an expected size in wild-type strains of 2379 bp. A) Screening of ZA109 isolates by primers “dmsA pKO UP/DN.” Lane M, marker; 1-12, ZA109 isolates (lysate); 13, wild-type lysate; 14, dmsA deletion plasmid pJAM3501. Saturated pixels were colored red by image capture software. B) Gradient PCR screening of ZA109 isolates by primers “dmsA INT FW/RV.” Lane M, marker; 1-4, isolate of ZA109; 5-8, additional isolate of ZA109, 9-12, wild-type lysate. Annealing temperatures for each set of samples were 64, 60, 50, and 46 °C, from left to right.

40


41

A)

Figure 4-4. Growth assay comparing strains H26, XF127, XF130, ZA106, and ZA109.

Strains were grown in glycerol minimal media (GMM) supplemented with A) No Met, B) 0.25 mM Met, and C) 0.25 mM MetSO.

42

B)


43

C)


Figure 4-5. Summary of additional candidate gene information and their respective

proteins. Acquired from UniProt database.

44

Figure 4-6. PCR screening of candidate gene deletion isolates for strains ZA110-116.

Primers were the same used in construction of pre-deletion plasmids (pKO UP/DN). Top diagram shows an example gene of 1000 bp, its pKO primer locations, and the respective PCR product (pX) generated. Red boxes denote separate reaction sets for each strain, labels A-G referring to ZA110-116, consecutively. The right most lane in each reaction set is a control using the parent strain DNA as template, yielding a PCR product approximately 1000 bp plus the gene size. Potential deletion isolates display an absence of this PCR product, with a strong product instead at roughly 1000 bp. Candidate deletion isolates marked by red asterisks were selected for growth assay and further isolation.

45

Figure 4-7. Plate assay for growth of additional candidate mutant strains on MetSO.

The plate on the left is supplemented with 0.25 mM Met and was incubated for 42 hours; on right, 0.25 mM MetSO supplementation with 9 days incubation. Wedges A-G are inoculated with the additional candidate mutant strains, wedge Z is inoculated with ZA106.

46

CHAPTER 5 CONCLUSIONS

Observations preceding this study indicated that an H. volcanii methionine

auxotroph with both predicted Msrs (MsrA/B) deleted was still capable of growth on

MetSO as the sole source of methionine. This discovery came as a surprise given that

no additional Msrs are predicted in H. volcanii, nor do they appear to be present in other

Halobacteria genomes. Since many oxidoreductases are molybdopterin dependent, we

deleted a gene thought to be a critical component of the molybdopterin synthesis

machinery in H. volcanii. Successful deletion of moaE revealed that the residual Msr

activity of H. volcanii was indeed molybdopterin dependent, as the strain was no longer

able to utilize MetSO for growth. This finding provided a clear step forward in identifying

the enzyme(s) responsible for residual Msr activity in H. volcanii.

Further investigation found that DMSO reductase is likely not the source of

residual Msr activity. Seven additional candidate genes were deleted from H. volcanii,

but initial experiments have not been conclusive as to whether one or more of these

candidates are culprits. Continuation of the growth assay initiated in this study may

reveal that one of these candidate genes is responsible. Further isolation of strains

ZA110-116 and more thorough confirmation of their deletion should be completed

regardless before these genes are ruled out. Alternatively, other methods may need to

be utilized to identify this unknown source of Msr activity.

Preparation of the individual diastereoisomers Met-(R)-SO and Met-(S)-SO could

provide more information regarding the stereospecificity of the residual Msr activity.

Given that prior work did not observe Msr activity in an H. volcanii ∆msrA ∆msrB mutant

using the peptide mimic dabsyl-MetSO35, it seems that any major residual activity would

47

likely be specific for free MetSO. Should targeted approaches fail, broader genetic or

biochemical approaches such as transposon mutagenesis or cell lysate fractionation

could be utilized to identify the unknown source of Msr activity in H. volcanii. Such an

effort would be helpful in furthering our understanding of Msrs and their peculiar

distribution in archaea.

48

LIST OF REFERENCES

1 Halliwell, B. & Gutteridge, J. M. C. Free radicals in biology and medicine. Fifth Edition. Oxford University Press (2015).

2 Davies, M. J. The oxidative environment and protein damage. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics 1703, 93-109, doi:10.1016/j.bbapap.2004.08.007 (2005).

3 Levine, R. L., Moskovitz, J. & Stadtman, E. R. Oxidation of methionine in proteins: roles in antioxidant defense and cellular regulation. IUBMB Life 50, 301-307, doi:10.1080/713803735 (2000).

4 Lavine, T. F. The formation, resolution, and optical properties of the diasteroisomeric sulfoxides derived from L-methionine. Journal of Biological Chemistry 169, 477-492 (1947).

5 Vogt, W. Oxidation of methionyl residues in proteins: tools, targets, and reversal. Free Radical Biology and Medicine 18, 93-105, doi:10.1016/0891-5849(94)00158-G (1995).

6 Sharov, V. S., Ferrington, D. A., Squier, T. C. & Schöneich, C. Diastereoselective reduction of protein-bound methionine sulfoxide by methionine sulfoxide reductase. FEBS Letters 455, 247-250, doi:10.1016/S0014-5793(99)00888-1 (1999).

7 Kim, H.-Y. & Gladyshev, V. N. Methionine sulfoxide reduction in mammals: characterization of methionine-R-sulfoxide reductases. Molecular Biology of the Cell 15, 1055-1064, doi:10.1091/mbc.e03-08-0629 (2003).

8 Ezraty, B., Aussel, L. & Barras, F. Methionine sulfoxide reductases in prokaryotes. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics 1703, 221-229, doi:10.1016/j.bbapap.2004.08.017 (2005).

9 Ezraty, B., Gennaris, A., Barras, F. & Collet, J.-F. Oxidative stress, protein damage and repair in bacteria. Nature Reviews Microbiology 15, 385-396, doi:10.1038/nrmicro.2017.26 (2017).

10 Carella, M. et al. Structure–function relationship in an archaebacterial methionine sulphoxide reductase B. Molecular Microbiology 79, 342-358, doi:10.1111/j.1365-2958.2010.07447.x (2011).

11 Boschi-Muller, S. & Branlant, G. Methionine sulfoxide reductase: Chemistry, substrate binding, recycling process and oxidase activity. Bioorganic Chemistry 57, 222-230, doi:10.1016/j.bioorg.2014.07.002 (2014).

49

12 Lin, Z. et al. Free methionine-(R)-sulfoxide reductase from Escherichia coli reveals a new GAF domain function. Proceedings of the National Academy of Sciences 104, 9597-9602, doi:10.1073/pnas.0703774104 (2007).

13 Le, D. T. et al. Functional analysis of free methionine-R-sulfoxide reductase from Saccharomyces cerevisiae. Journal of Biological Chemistry 284, 4354-4364, doi:10.1074/jbc.M805891200 (2009).

14 Brot, N., Weissbach, L., Werth, J. & Weissbach, H. Enzymatic reduction of protein-bound methionine sulfoxide. Proceedings of the National Academy of Sciences 78, 2155-2158, doi:10.1073/pnas.78.4.2155 (1981).

15 Grimaud, R. et al. Repair of oxidized proteins: identification of a new methionine sulfoxide reductase. Journal of Biological Chemistry 276, 48915-48920, doi:10.1074/jbc.M105509200 (2001).

16 Zhang, X.-H. & Weissbach, H. Origin and evolution of the protein-repairing enzymes methionine sulphoxide reductases. Biological Reviews 83, 249-257, doi:10.1111/j.1469-185X.2008.00042.x (2008).

17 Delaye, L., Becerra, A., Orgel, L. & Lazcano, A. Molecular evolution of peptide methionine sulfoxide reductases (MsrA and MsrB): on the early development of a mechanism that protects against oxidative damage. Journal of Molecular Evolution 64, 15-32, doi:10.1007/s00239-005-0281-2 (2007).

18 Fukushima, E., Shinka, Y., Fukui, T., Atomi, H. & Imanaka, T. Methionine sulfoxide reductase from the hyperthermophilic archaeon Thermococcus kodakaraensis, an enzyme designed to function at suboptimal growth temperatures. Journal of Bacteriology 189, 7134-7144, doi:10.1128/JB.00751-06 (2007).

19 Kryukov, G. V., Kumar, R. A., Koc, A., Sun, Z. & Gladyshev, V. N. Selenoprotein R is a zinc-containing stereo-specific methionine sulfoxide reductase. Proceedings of the National Academy of Sciences 99, 4245-4250, doi:10.1073/pnas.072603099 (2002).

20 Atomi, H., Fukui, T., Kanai, T., Morikawa, M. & Imanaka, T. Description of Thermococcus kodakaraensis sp. nov., a well studied hyperthermophilic archaeon previously reported as Pyrococcus sp. KOD1. Archaea 1, 263-267, doi:10.1155/2004/204953 (2004).

21 Simala-Grant, J. L. & Weiner, J. H. Kinetic analysis and substrate specificity of Escherichia coli dimethyl sulfoxide reductase. Microbiology 142, 3231-3239, doi:10.1099/13500872-142-11-3231 (1996).

22 Ezraty, B., Bos, J., Barras, F. & Aussel, L. Methionine sulfoxide reduction and assimilation in Escherichia coli: new role for the biotin sulfoxide reductase BisC.

50

Journal of Bacteriology 187, 231-237, doi:10.1128/JB.187.1.231-237.2005 (2005).

23 Gennaris, A. et al. Repairing oxidized proteins in the bacterial envelope using respiratory chain electrons. Nature 528, 409-412, doi:10.1038/nature15764 (2015).

24 Maupin-Furlow, J. A. Methionine sulfoxide reductases of archaea. Antioxidants 7, 124, doi:10.3390/antiox7100124 (2018).

25 Hille, R., Hall, J. & Basu, P. The mononuclear molybdenum enzymes. Chemical Reviews 114, 3963-4038, doi:10.1021/cr400443z (2014).

26 Mendel, R. R. The molybdenum cofactor. The Journal of Biological Chemistry 288, 13165-13172, doi:10.1074/jbc.R113.455311 (2013).

27 Iobbi-Nivol, C. & Leimkühler, S. Molybdenum enzymes, their maturation and molybdenum cofactor biosynthesis in Escherichia coli. Biochimica et Biophysica Acta (BBA) - Bioenergetics 1827, 1086-1101, doi:10.1016/j.bbabio.2012.11.007 (2013).

28 Johnson, J. L., Bastian, N. R. & Rajagopalan, K. V. Molybdopterin guanine dinucleotide: a modified form of molybdopterin identified in the molybdenum cofactor of dimethyl sulfoxide reductase from Rhodobacter sphaeroides forma specialis denitrificans. Proceedings of the National Academy of Sciences 87, 3190-3194, doi:10.1073/pnas.87.8.3190 (1990).

29 Palmer, T., Goodfellow, I. P. G., Sockett, R. E., McEwan, A. G. & Boxer, D. H. Characterisation of the mob locus from Rhodobacter sphaeroides required for molybdenum cofactor biosynthesis. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression 1395, 135-140, doi:10.1016/S0167-4781(97)00145-0 (1998).

30 Eaves, D. J., Palmer, T. & Boxer, D. H. The product of the molybdenum cofactor gene mobB of Escherichia coli is a GTP-binding protein. European journal of biochemistry 246, 690-697, doi:10.1111/j.1432-1033.1997.t01-1-00690.x (1997).

31 Lake, M. W., Temple, C. A., Rajagopalan, K. V. & Schindelin, H. The crystal structure of the Escherichia coli MobA protein provides insight into molybdopterin guanine dinucleotide biosynthesis. Journal of Biological Chemistry 275, 40211-40217, doi:10.1074/jbc.M007406200 (2000).

32 Humbard, M. A. et al. Ubiquitin-like small archaeal modifier proteins (SAMPs) in Haloferax volcanii. Nature 463, 54-60, doi:10.1038/nature08659 (2010).

33 Miranda, H. V. et al. E1- and ubiquitin-like proteins provide a direct link between protein conjugation and sulfur transfer in archaea. Proceedings of the National Academy of Sciences 108, 4417-4422, doi:10.1073/pnas.1018151108 (2011).

51

34 Kim, H. S. et al. Structural and biochemical analysis of a type II free methionine-R-sulfoxide reductase from Thermoplasma acidophilum. Archives of Biochemistry and Biophysics 560, 10-19, doi:10.1016/j.abb.2014.07.009 (2014).

35 Fu, X. et al. Methionine sulfoxide reductase A (MsrA) and its function in ubiquitin-like protein modification in archaea. mBio 8, e01169-01117, doi:10.1128/mBio.01169-17 (2017).

36 Mullakhanbhai, M. F. & Larsen, H. Halobacterium volcanii spec. nov., a Dead Sea halobacterium with a moderate salt requirement. Archives of Microbiology 104, 207–214 (1975).

37 Soppa, J. From genomes to function: haloarchaea as model organisms. Microbiology 152, 585-590, doi:10.1099/mic.0.28504-0 (2006).

38 Hartman, A. L. et al. The complete genome sequence of Haloferax volcanii DS2, a model archaeon. PLOS ONE 5, e9605, doi:10.1371/journal.pone.0009605 (2010).

39 Dyall-Smith, M. The Halohandbook v7.3. (2015).

40 Rawls, K. S., Yacovone, S. K. & Maupin-Furlow, J. A. GlpR represses fructose and glucose metabolic enzymes at the level of transcription in the Haloarchaeon Haloferax volcanii. Journal of Bacteriology 192, 6251-6260, doi:10.1128/JB.00827-10 (2010).

41 Ye, J. et al. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13, 134, doi:10.1186/1471-2105-13-134 (2012).

42 Untergasser, A. et al. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research 35, W71-W74, doi:10.1093/nar/gkm306 (2007).

43 Bitan-Banin, G., Ortenberg, R. & Mevarech, M. Development of a gene knockout system for the halophilic archaeon Haloferax volcanii by use of the pyrE gene. Journal of Bacteriology 185, 772-778, doi:10.1128/JB.185.3.772-778.2003 (2003).

44 Allers, T., Ngo, H.-P., Mevarech, M. & Lloyd, R. G. Development of additional selectable markers for the halophilic archaeon Haloferax volcanii based on the leuB and trpA genes. Applied and Environmental Microbiology. 70, 943-953, doi:10.1128/AEM.70.2.943-953.2004 (2004).

52

BIOGRAPHICAL SKETCH

Zachary Adams obtained his Bachelor of Science in 2016 from the University of

Florida. During his senior year, he worked in the laboratory of Dr. Julie Maupin-Furlow in

the Microbiology and Cell Science Department. He chose to continue his studies there,

and later obtained his Master of Science degree in the Fall of 2018.

Documents

IDENTIFICATION OF UNKNOWN METHIONINE SULFOXIDE …