THE ,JOURNAL OF BIOLOGICAL CHEMISTRY VoI. 2S8, No. 22, Issue of November 25, pp. 14026-14033.1983 I’rmtrd in [ I S.A.

Identification of Multiple Transcriptional Initiation Sites on the Yeast Mitochondrial Genome by in Vitro Capping with Guanylyltransferase”

(Received for publication, May 18, 1983)

Thomas Christianson and Murray RabinowitzS From the Departments of Medicine, Biochemistry, and Biology of the University of Chicago, Chicago, Illinois 60637

We have studied transcriptional initiation in the mi- tochondria of the yeast Saccharomyces cerevisiae by analyzing mitochondrial transcripts from grande and petite yeast after labeling in vitro with vaccinia virus guanylyltransferase and [cY-~’P]GTP. This procedure labels triphosphate-terminated RNA which arises from transcriptional initiation. Exploiting the extremely low GC content (18%) of yeast mitochondrial DNA, we digested the in vitro capped transcripts with the G- specific ribonuclease TI; this resulted in 27 oligonu- cleotides varying in size from 2 to 5 1 nucleotides. RNA from 14 overlapping petites was analyzed and 20 tran- scripts were localized by deletion mapping. Nineteen oligonucleotides were sequences and 13 were identi- fied and precisely localized by comparison with known DNA sequences. In all cases, transcription is initiated at a consensus nonanucleotide sequence which can be considered part of the yeast mitochondrial promoter. We identified initiation sites for the 21 S and 14 S rRNAs; the phenylalanine, f-methionine, and glutamic tRNAs; two sites for the OLI-1 gene; and three for the ori (rep) regions. Most promoters appear to give rise to very long multigene primary transcripts. Examples are multigene transcripts for the glutamic tRNA and COB genes and for the OLI-1, serine tRNA, and Var genes. Since the consensus nonanucleotide sequences at the ori regions are similar to those at other tran- scriptional initiation sites, it is likely that the same RNA polymerase primes DNA replication and gene transcription.

The assembly of mitochondria depends upon information derived from both the nuclear and mitochondrial genomes. Relatively few mitochondrial components are specified by mtDNA. In yeast, these include the large (21 S ) and small (14 S) ribosomal RNAs, about 25 tRNAs, a ribosomal protein (Var l ) , at least two subunits of the oligomyocin-sensitive ATPase (OLI-1 or 0, and OLI-2 or 011), three subunits of cytochrome oxidase (OXI-l,OXI-2, and 0x1-3), and a peptide of the cytochrome bel complex (COB).

In animal mitochondria, transcription originates in the D- loop region on each mtDNA strand, leading to full genome- length transcripts (1, 2). In yeast mitochondria, however, we

* This study was supported in part by National Institutes of Health Grants HL-04442 and HL-09172, by Grant NP-281 from the Ameri- can Cancer Society, and by a grant from the Louis Block Fund of the University of Chicago. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. + To whom correspondence should be addressed.

have demonstrated that multiple initiation sites are distrib- uted throughout the genome. Two approaches were used for the definition of transcriptional initiation sites: first, labeling of transcripts at their initiation sites with guanylyltransferase, and second, analysis of initiation in a homologous in vitro transcription system. In vitro capping of mitochondrial tran- scripts with guanylyltransferase and [cI-~*P]GTP specifically labels RNA molecules that retain the 5’ initiating nucleotide. This method relies on the specificity of the capping reaction in labeling 5’ polyphosphate-terminated molecules which originate from transcriptional initiation. Transcripts labeled in this way may be directly sequenced or used as hybridization probes. By hybridization to restriction digests of mtDNA, we previously demonstrated four or five initiation sites in the grande genome and two in the petite F11 (3). Sequencing of capped transcripts identified the exact initiation sites of the 21 S and 14 S rRNAs (3-6). Highly purified yeast mitochon- drial RNA polymerase also recognized promoters for these two genes and faithfully initiated transcription in vitro at the same sites (7).

A region of homology has been found at the sites for transcriptional initiation of the ribosomal genes of yeast mitochondria (5 , 8). Osinga et al. (6) have shown that, in two distantly related yeast species, Saccharomyces cerevisiae and Kluyueromyces lactis, the initiating nucleotide and the eight nucleotides immediately upstream were identical for the 21 S and 14 S genes. This nonanucleotide sequence is also associ- ated with the initiation sites for the OLI-1 gene’ and is present in all four ori sequences found in supersuppressive petites (6, 9).

In this study we have examined and characterized the multiple mitochondrial transcriptional initiation sites in de- tail by using the in vitro capping procedure. We analyzed RNA from 2 grande strains as well as from 14 deletion petites whose overlapping mtDNA sequences include the entire mi- tochondrial genome. Petite mutants are known to transcribe the mtDNA and, in some cases, to process the transcripts normally (10-12). Analysis of petite RNA has allowed us to detect initiation sites that were not apparent when grande RNA was used, and to localize these sites by deletion mapping. After sequencing 19 transcripts, we identified 13 initiation sites by comparison with published DNA sequences. In every case, the consensus nonanucleotide sequence was present at the initiation site.

MATERIALS AND METHODS

Strains-The genetic and physical characteristics of the grande strains MH41-7B and D273-10B used in this study were described previously (13). Petite strains DS400/A12, DS400/A3, and DS200/

J. C. Edwards, K. A. Osinga, T. Christianson, L. A. M. Hensgens, P. M. Janssens, M. Rabinowitz, and H. F. Tabak, submitted for publication.

14025

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14026 Transcriptional Initiation Sites in Yeast Mitochondria

A1 (14-17) were generously provided by Dr. A. Tzagoloff (Columbia University, New York, NY). Petite PX is a spontaneous deletion mutant arising from petite CEP-2; it was mapped physically by restriction enzyme analysis? All other petites employed were de- scribed by Lewin et al. (18).

Preparation of RNA-Yeast cells were grown by the procedure of Locker et al. (19) and the mitochondria were isolated, lysed, and phenol-extracted as described earlier (20), except that treatment with zymolyase (21) (Miles Laboratories) was substituted for treatment with glusulase. The aqueous phase was extracted with an equal volume of chloroform, adjusted to 0.3 M sodium acetate, and precipitated with 3 volumes of ethanol. The RNA was dissolved in H20 and stored a t

Guanylyltransferase Reactions-Guanylyltransferase was isolated from vaccinia cores according to the procedure of Levens et al. (3). In oitro capping reactions were performed and stopped as described (3,5). Any residual enzymatic activity which might generate triphos- phate termini during the capping reaction would be inhibited by the absence of ATP in the reaction mix. The reaction mixture was extracted twice with phenol and once with chloroform prior to rapid column chromatography (7, 22). The excluded material was precipi- tated with three volumes of ethanol.

Limit TI Digestion and RNA Sequencing Reactions-MtRNA, la- beled at the 5' end by in oitro capping, was digested to completion with ribonuclease TI (Calbiochem-Behring Corp.), which cleaves spe- cifically after G . T o ensure limit digestions, the ribonuclease TI concentration was 100- to 500-fold greater than that used in the partial digestions for RNA sequencing. The T I concentration (0.02 mg/ml) and reaction time (30 min) were considerably below the level a t which TI digestion a t other bases besides G has been detected (23). The TI-generated oligonucleotides were sequenced with the following base-specific ribonucleases: U2 (Calbiochem-Behring Corp.), which cleaves after A; the extracellular ribonuclease from Bacillus cereus, prepared from a culture provided by Dr. U. L. RajBhandry (Massa- chusetts Institute of Technology), which cleaves after pyrimidines; and the ribonuclease Physarum I, which cleaves after all but C. Conditions for all enzymatic digestions were essentially as described by Silberklang et al. (24). except that the U:, digestion was done a t pH 3.5. Partial alkaline hydrolysis for sequencing ladders was per- formed according to Donis-Keller et al. (25), except that the incuba- tion was carried out at 100 "C.

Extraction of Oligonucleotides from Gels-RNA fragments from limit digestions with ribonuclease TI were excised from 20% sequenc- ing gels. T o each slice, 0.35 ml of 2 mM Tris, 1 mM EDTA, 0.01% sodium dodecyl sulfate, and 50 mg/ml of tRNA buffer was added. The slices were then boiled for 10 min and incubated a t 37 "C for 90 min. The buffer was removed, 0.1 ml of fresh buffer was added, and the incubation steps were repeated. The extracts were pooled, phenol- and chloroform-extracted, made to 0.3 M sodium acetate, and precip- itated with 3 volumes of ethanol. Seventy to ninety per cent of the counts were recovered; the oligonucleotides used in the sequencing reactions contained from 50 to 5000 cpm.

Polacrylarnide Gel Electrophoresis-Electrophoresis conditions were as described by Donis-Keller et 01. (25). Since the first few bases were of the greatest interest, 20% polyacrylamide gels were used for sequencing. To ensure retention of the first base on the gel as well as maximum separation of oligonucleotides, we terminated electropho- resis when the bromphenol blue had run two-thirds of the gel length.

RESULTS

-80 "C.

To characterize the transcriptional initiation sites on yeast mtDNA, we used the following strategy. First, mtRNA from grande and petite yeast was capped in uitro using guanylyl- transferase and [a-"'PIGTP. The capped RNA was then sub- jected to limit digestion with ribonuclease TI. The oligonu- cleotide products were expected to vary in size due to the extremely low GC content (18%) of yeast mtDNA (26), re- sulting in a series of oligonucleotides with lengths depending on the distance from the initiation site to the first G. The oligonucleotides were separated by electrophoresis and, in most cases, isolated and sequenced. Petite deletion mapping localized the oligonucleotides to specific regions of the ge- nome. Finally, we matched the sequences of the oligonucleo-

~~ ~~

T. Christianson and M. Rabinowitz, unpublished data.

tides to published DNA sequences, enabling us to definitively localize many initiation sites.

Electrophoretic Separation of TI Digests of in Vitro Capped Mitochondrial Transcripts

Total mtRNA from 14 overlapping petites and 2 grande strains was capped in uitro. The capped RNAs were digested with ribonuclease TI and resolved by electrophoresis on se- quencing gels prior to autoradiography (Fig. 1). The figure is a composite from many gels run under identical conditions. The designation of the oligonucleotide product refers to the nucleotide length. This numerical designation is also used to denote the primary transcript from which the oligonucleotide was derived. In most cases, the bands were excised from gels and eluted and the oligonucleotides were sequenced. Many faint oligonucleotide bands yielded only 50-300 cpm, which required long radiographic exposures and limited analysis to only one or two carefully chosen digestions for sequencing.

Some of the oligonucleotides that were sequenced proved to be products of partial TI digestion. These are marked with P in Fig. 1. For example, the partial digest bands in CEP-2 arise from the 21 S rRNA transcript, since the Gs at positions 9, 12, 20, 25, and 42 conform with the DNA sequence of this gene (3, 8). Partially digested oligonucleotides were useful in extending the sequence information for some of the tran- scripts beyond the first G.

Band splitting frequently occurs in capped oligonucleotides

5 4

2

FIG. 1. Limit -TI digests of capped petite and grande mtRNA. The 14 inner lanes consist of autoradiograms of oligonu- cleotides arising from complete or nearly complete TI digests of capped petite mtRNA electrophoresed on 20% polyacrylamide se- quencing gels. Bands marked P are products of partial rather than complete digestion and bands marked A are artifacts (see text). The last two lanes are digests of grande mtRNA. The nucleotide size of complete digestion products seen in grand or petites is marked on the right. Since the many gels of this composite figure were aligned according to the oligonucleotides in the center of the gels, the smallest (2) and the largest (24, 25, and 51) bands do not align perfectly. The first lane consists of an alkaline ladder marked with nucleotide length. In the second lane, GTP was run as a marker to identify free label not completely removed by chromatograpy after the capping reac- tions. Because the bulk of the marker GTP has run off the gel, only the GMP and GDP contaminants are visible.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Transcriptional Initiation Sites in Yeast Mitochondria 14027

2 to 5 bases in length; it is especially evident for the capped dinucleotide. This splitting is probably due to cyclic inter- mediates which result from ribonuclease TI digestion. The sequences of the upper and lower band of each pair of oligon- ucleotides were identical.

Artifactual bands at positions equivalent to 4, 7, and occa- sionally 5 nucleotides were found in digests of some capped preparations. These were usually less discrete than the oli- gonucleotide bands and could not be sequenced when isolated. Petites F11 and DS400/A12 show these artifacts, which are marked A , most clearly (Fig. 1). The artifact band at nucleo- tide 5 in petite F11 obscures an oligonucleotide, which was nevertheless successfully sequenced when the composite band was isolated.

Comparison of the Products of TI Digestion from Grande and Petite Yeast

A t least five oligonucleotides can be seen in a limit TI digest of capped RNA from the grande strain MH41-7B (Fig. 1). These are 2,5,11,12, and 24 nucleotides in length; sometimes a sixth oligonucleotide of 51 bases can also be seen. The grande strain D273-10B shows the same pattern (data not shown). In contrast, a much larger number of oligonucleotides, 27, is observed in the petite strains. This may be due to several factors, including the high copy number of retained mtDNA sequences in petites and the slower processing of precursors (4, 10, 27). Furthermore, low abundance capped transcripts may be visible in those petites which lack the 21 S rRNA gene, since the very abundant 21 S rRNA may compete for the guanylyltransferase.

To eliminate the possibility that the fidelity of transcrip- tional initiation is aberrant in petites, we analyzed the RNA from the grande 12.14A, derived from MH41. Strain 12.14A contains a nuclear mutation that results in accumulation of RNA precursor^.^ Fig. 1 shows the oligonucleotides arising from digestion of capped 12.14A RNA with ribonuclease TI. It is apparent that many of the oligonucleotides observed in petites, but not visualized in wild type grande, can be seen. This result indicates that the oligonucleotides observed in petites are also present in the wild type grande, but in low abundance.

Three of the petites, all of them small (DS400/A1, 011-2, and DS400/A3), do not exhibit capped oligonucleotides in the TI digests (Fig. 1). They probably lack specific sites of tran- scriptional initiation.

In the grande strains and petites alike, the most abundant oligonucleotides are 2,5, 11, and 12 bases in length. As shown earlier, oligonucleotides 2 and 12 arise from the 21 S and 14 S rRNAs (3-6); the other two correspond to origins of repli- cation as described below. The 21 S rRNA capped transcripts are by far the most abundant. Although they are probably transcribed at nearly equal rates, the 21 S capped transcript is more abundant than the 14 S rRNA primary transcript, because the mature 21 S rRNA retains the primary 5' end whereas during maturation the 14 S rRNA precursor has about 80 nucleotides cleaved from its 5' end (3, 5).

Construction of the Deletion Map The mitochondrial sequences retained in the petite mutants

used in this study have been well characterized. Therefore, genetic localization of the in vitro capped transcripts found in these petites is possible by deletion mapping. The physical and genetic maps of grande MH41 mtDNA are illustrated in Fig. 2A and the mtDNA sequences retained by each of the

D. Mueller, personal communication.

6 9 IO II 12 13 14

25 24-

51

FIG. 2. Petite deletion mapping of capped mitochondrial transcripts. A, the physical and genetic map of the grande strain MH41-7B. The overall map (13, 28, 29) was refined by use of pub- lished sequences and fine restriction maps (8, 14-17, 30-57). The tRNA genes are marked by vertical lines among the rest of the genes. Between 21 S and 0x1-1 there are 16 tRNAs (36); between 0x1-1 and 0x1-2 are the phenylalanine, a threonine, and the valine tRNAs; between ori-5 and ori-1 are the f-methionine and the proline tRNAs; after ori-1 is a tryptophan tRNA; after 14 S is the other tryptophan tRNA; before COB is the glutamic tRNA; and between OLI-1 and Var is a serine tRNA. All genes on this map are transribed from left to right, with the exception of the threonine tRNA between 0x1-1 and 0x1-2. B, the interrupted line shows the extent of published DNA sequences, which were searched for nonanucleotide initiation sequences and for RNA sequence matches. Below this line we show the sequences retained by 14 overlapping petite strains used in this study. The three DS petites have been sequenced (14-17); the other petites were characterized by restriction mapping (18) and F11 was further defined by fine restriction mapping (35). Imprecisely deter- mined ends of the petites are marked by dotted lines. C , in the deletion map for TI-digested capped transcripts in the petites, the transcripts are designated by the number of nucleotides in the T1-digested oligonucleotide; where there are multiple oligonucleotides of the same length, they are further labeled as a, b, or c. The dotted lines specify uncertainty in the deletion map due to imprecisely mapped petites. Vertical lines labeled with genetic names mark the exact initiation sites which have been established by comparison with the DNA sequences.

petites are displayed in Fig. 2B. Fig. 2C illustrates the deletion mapping of the capped transcripts present in each of the petites shown in Fig. 1. A tabulation of the oligonucleotides present in each of the petites appears in Table I. It is apparent that oligonucleotides 2, 5, 9, 10, and 11 bases in length each contain two or three different species. These species are designated by the letter a, b, or c. Different oligonucleotides in each size class were distinguished by being present in petites containing noncontiguous mtDNA sequences and, in many cases, by differences in RNA sequences. Twenty tran- scripts were mapped in this manner. An additional seven distinct, but less intensely labeled oligonucleotides were pres- ent in the large petite OIP2, but these were not mapped since they were not present in any other petite. Therefore, there

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14028 Transcriptional Initiation Sites in Yeast Mitochondria

TABLE I Oligonucleotides present after limit TI digests of capped RNA

This table summarizes the data obtained from Fig. 1. Spaces marked with an X indicate the presence of oligonucleotides; blank spaces, their absence; and question marks, their possible presence. The subclasses of oligonucleotides designated by letters are based on the presence of the oligonucleotides in petites with nonoverlap- Dine genomes (Fie. 21 and on seauence data aresented in subseauent fieures.

~

2a 2b 3 5a 5b 5c 6 9a 9b 9c 10a lob l l a llb 12 13 14 24 25 51

Petites OIOll ? ? X ? X X ? x x X ? ? X F11 X X X DS200/A1 CEOr-5 CE-7

X X

X X X X X X X

PX X X X CEP-2 X X ? X P2 X 011-2

Q3122 x x X X X X DS400/A12 X X OIP2 x x x " x " x x x x x X DS400/A3 0110 X x x x x

Grandes 2 3 5 6 9 10 11 12

12.14A X X x x X X X MH41-7B X X X X

X 7

X X

x x x X

X X

13 14 24 25 51 X

x x x

X

Since the sequences are the same, we cannot distinguish whether one or both are present.

appear to be a minimum of 27 transcriptional initiation sites on the yeast mtDNA. In our deletion mapping, only the presence of an oligonucleotide in a petite was considered. The absence of a transcript could be accounted for by internal deletion, low abundance, or other factors that might obscure its detection.

Detailed Analysis of Oligonucleotides Generated by TI Digestion of Capped Transripts

We further analyzed the RNA sequences of 19 of the Tl- generated capped oligonucleotides. In this way, each tran- script could be distinguished on the basis of sequence as well as size. Comparison of the sequences with reported DNA sequences established the exact site of transcriptional initia- tion on mtDNA.

Two T,-generated Dinucleotides; 21 S rRNA-Capped di- nucleotides were present after limit TI digestion of capped RNA from petites F11, cE01-5, CE-7, CEP-2, Q3122, 01P2, 0110, and perhaps 01011 (Fig. 1 and Table I). In a number of these petites, the mitochondrial genomes do not overlap; therefore, at least two transcripts, designated 2a and 2b, must have G at the second position. The smallest noncontiguous petites containing 2a and 2b are F11 and 0110, respectively (Fig. 2). The localization of 2a is slightly refined by petite CE-7, whereas petite Q3122 considerably reduces the region from which 2b could originate. The sequence of both of these capped dinucleotides is A-G (Fig. 3A). Dinucleotide 2a is very abundant in both grande and petite strains and, since it maps to a region that includes the 21 S rRNA gene, the dinucleotide 2a represents the 21 S rRNA transcript. Earlier sequencing of capped 21 S rRNA (4, 6) has mapped this initiation site precisely; the first two bases of the 21 S rRNA were A-G.

The Trinucleotide-Capped RNA from petites Q3122 and OIP2 includes a labeled trinucleotide after limit T, digestion (Fig. 1 and Table I). The sequence of the trinucleotide in both petites was identical (Fig. 3B). The trinucleotide is mapped to the region of the Q3122 genome (Fig. 2).

Three Tl-generated Pentanucleotides; Ori-3 and Ori-5- Pentanucleotides are found among the oligonucleotides aris- ing from limit T1 digestion of capped RNA from petites 01011,

F11, CEOI-5, PX, CEP-2, Q3122, and OIP2 (Fig. 1 and Table I). The sequence of these pentanucleotides in all cases was A- A-U-A-G. The pentanucleotide sequence from petite OIP2 is shown in Fig. 3C. In grande and some petites, the pentanu- cleotide is quite abundant. The pentanucleotide 5a, present in petite F11, can be distinguished from the others because F11 does not overlap with other petites which contain a pentanucleotide transcript. We have matched the pentanu- cleotide sequence to DNA sequences representing the two origins of replication, ori-3 (rep-1) and ori-5 (rep-2). The pentanucleotide sequence is identical with the last nucleotide and the four nucleotides downstream from the nonanucleotide consensus sequences present in these ori regions (6,9). Dele- tion mapping indicates that 5a corresponds to ori-3 and 5b to ori-5. A pentanucleotide in the petite Q3122 which does not retain either of these ori sites is therefore likely to be different and is designated as 5c (Fig. 2).

The Hexanucleotide-Capped RNA from the petite 01011

and OIP2 have a labeled hexanucleotide after limit T1 diges- tion (Fig. 1 and Table I). We could not obtain a complete sequence of this hexanucleotide. Transcript 6 is mapped to the region of overlap between the two petites (Fig. 2).

Three T,-generated Nonanucleotides; Phenylalanine tRNA-The capped RNA from petites 01011, CEO]-5, CE-7, Q3122, DS400/A12, OIP2, and OrlO have labeled nonanucleo- tides after limit T1 digestion (Fig. 1 and Table I); CEP-2 might also have one, but is is obscured by a nonanucleotide arising from a partial digest of the 21 S rRNA. It is of note that petites CE-7, Q3122, and DS400/A12 have noncontig- uous genomes, demonstrating the existence of three separate nonanucleotides, 9a, 9b, and 9c (Fig. 2). Furthermore, the sequences of the three nonanucleotides differ from each other (Figs. 3 0 and 4, A and D). Transcript 9a maps to the narrow region of overlap between petites CE-7 and 01P2 (Fig. 2). Petites Q3122 and 0101, contain 9b, which is mapped to the region shared by these petites. Transcript 9c is localized by the small petite DS400/A12.

The sequence of 9a matches a published DNA sequence directly following a nonanucleotide initiation sequence up- stream from the phenylalanine tRNA (42). The initiation site

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Transcriptional Initiation Sites in Yeast Mitochondria 14029

A. 2 b B. 3 C. 5 b (ori-5) D. 9a (tRNAPhe) E. loa I W ~ C I G I @ I A I r C h A l G I A f i r C I l G l A l ~ I o l PlqLIGl -cPl~ I

-a $51

FIG. 3. Sequencing of oligonucleotides 2b, 3, 5b, 9a, and 10a derived from complete TI digest of in vitro capped transcripts. RNA sequencing was performed with base-specific ribonucleases and the digests were run on 20% sequencing gels as described under "Materials and Methods." The lanes used for sequencing are described by the following code: A is RNA digested with the A-specific ribonuclease U2; P.v. with the pyrimidine- specific ribonuclease from B. cereus; and -C, with the all but C-specific ribonuclease PhyI. C is a limit digestion with the G-specific ribonuclease TI, 0 is undigested, and L is an alkaline ladder prepared from a long transcript. The quality of some gels was impaired by the low counts available for sequencing. A PhyI digestion was omitted in E because of the small number of counts available. The pyrimidines identified in the B. cereus digestions of E are labeled U because of the scarcity of C in the DNA. Frequently, a number of lanes from identically run gels of the same oligonucleotide are combined. The B. cereuq and TI enzymes were the most specific and reliable. When ambiguity arose in the interpretation of the B. cereus and U2 lanes (last two lanes of B, fourth and fifth lanes of C ) , we relied on the B. cereus digestion. False bands in the UI lanes were frequently faint compared to the B. cereus band at the same position ( B ) and they often completely disappeared in similar digestions ( C , second anc' third lanes uersus fourth and fifth lanes). In D, most positions in the U2 lane are so faint that the As are identitied by the absence of pyrimidine bands in the reliable B. cereus lanes. These inferred bases are marked with lowercase letters.

d

FIG. 4. Sequencing of oligonucleotides 9b, 9c, lla. and a mixture of 1 la and 1 lb derived from limit TI digestion of in vitro capped transcripts. Lanes are labeled as in Fig. 3. In E , the product of complete TI digestion, l l a , is sequenced on the left and the 19-base oligonucleotide derived from partial TI digestion is shown on the right. In C, the sequencing of capped oligonucleotides l l a and l l b , obtained as a mixture from petite 0110, is shown; three bases are ambiguous in this mixture. Because only a small amount of labeled oligonucleotide was available, the PhyI digestion was omitted in A and D , therefore, the pyrimidines labeled U have a low probability of being C.

is 26 bases upstream from the 5' end of the mature tRNA. Neither 9b nor 9c can be matched to a sequence directly after a nonanucleotide initiation sequence. However, the sequence of 9b is identical with the last 9 nucleotides in lla, an oligonucleotide identified with the ori-2 region. Similarly, the sequence of 9c is identical with the sequence of the last 9 nucleotides in l lb , an oligonucleotide identified with the gene OLI-1.

Two T,-generated Decanucleotides-Decanucleotides are found among the oligonucleotides arising from limit TI diges- tion of capped RNA from the petites CEO& CE-7, PX, and 01P2 (Fig. 1 and Table I). Petites CE-7 and PX are noncon- tiguous; thus, there are two separate decanucleotides, 10a and 10b (Fig. 2). Sequencing of the decanucleotides from these petites confirms that there are two different transcripts (Figs. 3E and 5A). Since CEOI-5 and 01P2 both have loa, it maps

FIG. 5. Sequencing of oligonucleotides lob, 12, 13, and 14 derived from complete TI digestion of in vitro capped tran- scripts. Lanes are labeled as in Fig. 3. Because only a small amount of labeled oligonucleotide was available, the PhyI digestion was omit- ted in A and D, the pyrimidines labeled U therefore have a low probability of being C. In D, the first base is not visible. This base is identified as an A by inference, since no band was present in the reliable R. cereus lane. I t is therefore marked with a lowercase letter. The third base in D is ambiguous and is labeled N. It is probably a U, because a band is visible in the B. cereus digestion shown in the second lane. This band may be weak because B. cereus ribonuclease cleaves relatively inefficiently between two pyrimidines. This prop- erty is also evident at the sixth base.

to the small region of overlap. The sequence of oligonucleotide 10b is identical with the sequence of the last 10 nucleotides in oligonucleotide 12, the product of limit TI digestion of the 14 S rRNA primary transcript (see below).

Two TI-generated I I-mers; Ori-2 and OLI-1-Capped RNA from petites OlOl,, Q3122, DS400/A12, OIP2, and 0110 gives rise to 11-mers after limit TI digestion (Fig. 1 and Table I). Since petites Q3122 and DS400/A12 are noncontiguous (Fig. 2), there must be a t least two different 11-mers, I l a and Ilb. Clearly different sequences were found for the 11-mers from 63122 ( l la ) and DS400/A12 (Ilb). The sequencing of l l a is shown in Fig. 4B (first 4 lanes). As will be presented in detail elsewhere,' the sequence of I lb , A-A-U-A-U-A-U-A-U-A-G, represents the initiation site of the OLI-1 gene. This was

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14030 Transcriptional Initiation Sites in Yeast Mitochondria

confirmed by in vitro transcription with mitochondrial RNA polymerase from the same site with cloned DNA templates. The sequencing gels of the 11-mer isolated from 01011, OrP2, and 0110 were difficult to interpret (Fig. 4C) because of the overlap of the two 11-mer bands in TI digests from these petites. Since l l a was therefore in 01011 as well as in Q3122, it could be mapped to the region of overlap between these two petites.

The sequencing of transripts l l a and I l b was further extended by analysis of partial TI digests of capped RNA. The 19-, 20-, and 21-base oligonucleotides from petites 01011 and Q3122 all contained the sequence of l l a (Fig. 4B, last 3 lanes). Similarly incomplete digests of petite 0110 gave rise to a 17-base partial digestion product containing the sequence of Ilb. The sequences of I l b and the 17-base partial digest can be matched exactly with the sequence following a non- anucleotide initiation sequence, about 625 bases upstream from the start codon for the OLI-1 gene (32). Transcript l l a and the 19, 20, and 21 base partials can also be exactly localized to the ori-2 (rep-3) region by comparison with pub- lished sequences (30,31).

We have thus assigned transcripts 5a, 5b, and l l a to ori regions 3, 5, and 2, respectively. From the sequence reported for ori-1 (30), we would expect to observe a third 11-mer. The first 19 bases downstream from the nonanucleotide initiation sequence in ori-1 are identical with the sequence in ori-2, except that a C replaces a U at position 7. Despite the published evidence of transcriptional activity in this ori region (9), our results do not clearly confirm transcription at ori-1. Petite CEP-2 and petite PX derived from CEP-2 contain the ori-1 region, but we do not detect the predicted 11-mer after TI digestion. An 11-mer is detected in RNA from petite 01P2, but it also contains the transcript l l a of ori-2. Although 01P2 possibly transcribes from both ori-1 and ori-2, it may be that our petites do not give rise to an ori-1 transcript. The disparity between our work and that of Bernardi can perhaps be ac- counted for by strain differences. Indeed, Blanc and Dujon (31) did not find supersuppressive petites arising from this region.

As discussed above, oligonucleotides 9b and 9c are identical with the last 9 bases in the 11-mers, l l a and l lb , respectively. Furthermore, 9b maps to the same location as l l a and 9c maps with l l b (Fig. 2 ) . These results suggest secondary ini- tiation, two bases downstream from the major start at the nonanucleotide initiation sequence, gives rise to 9b and 9c. The label incorporated into the shorter oligonucleotide of each pair is only 5-15% of that in the larger oligonucleotides.

The Dodecamer; 14 S rRNA-A dodecamer is present in limit T, digests of capped RNA from the petites PX, CEP-2, P2, Q3122, and 01P2 (Fig. 1 and Table I). The small petite P2 and the overlap between PX and Q3122 (Fig. 2) narrow the mapping of transcript 12 to a small region. The sequence of the dodecamer is shown in Fig. 5. We have previously matched the sequence to a site about 80 bases upstream from the 14 S rRNA (5) by comparison with published sequences of the 14 S rRNA gene'(48). Identical initiation at this site has been demonstrated by in vitro transcription with yeast mitochondrial RNA polymerase and cloned DNA templates (7). As discussed above, oligonucleotide 10b is identical with the last 10 bases of the 14 S dodecamer and it maps to the same region. It thus probably represents a secondary initiation site.

The 13-mer; f-Methionine tRNA-The capped RNA from the petites PX and OIP2 gives rise to a 13-mer after limit T1 digestion (Fig. 1 and Table I). The petite PX is totally contained within the larger petite and thus the oligonucleotide is mapped to the region retained by PX (Fig. 2). Oligonucleo-

tide 13 was isolated and sequenced (Fig. 5). A search of published DNA sequences in the region to which the 13-mer mapped did not uncover a match. However, a match was found when sequences around the f-methionine tRNA were made available to us in advance of publication (58). Initiation is a t a nonanucleotide initiation sequence 28 bases upstream from the 5' end of the mature tRNA. The f-methionine tRNA gene is localized between the ori-5 and ori-1 regions.

The 14-mer-Capped RNA from petites 01011, Q3122, OIP2, and 0110 have labeled 14-mers after limit T1 digestion (Fig. 1 and Table I). The overlap between 01011 and Q3122 localizes the initiation site for transcript 14 to the region between the 0x1-3 and COB genes (Fig. 2 ) . The oligonucleotide was sequenced (Fig. 5), but no match to available DNA sequences was found.

The 24-mer-A 24-mer is found among the oligonucleotide arising from limit T1 digestion of capped RNA from petites F11, CEOI-5, CE-7, and 01P2 (Fig. 1 and Table I). The sequence of the oligonucleotides isolated from all of these petites is the same, starting with A-A-U-A-A-U-A-U-A-A . . . (gels not shown; for complete sequence, see Fig. 6). A faint band suggests the presence of the 24-mer in 01011. Petites CEO]-5 and CE-7 both overlap F11; thus, the 24-mer maps within F11 (Fig. 2 ) . However, OIP2, which shares no sequences with F11, does contain oligonucleotide 24. This is the only instance of inconsistent data in our study. Although it is possible that two identical 24-mer oligonucleotides are tran- scribed in the genome, the 24-mer is not found in any petite that does not overlap F11, except for OrP2. Possibly the restriction mapping of OrP2 mtDNA is in error and the petite contains additional sequences.

Levens et al. (3) previously demonstrated in F11 the pres- ence of a 700-nucleotide capped transcript together with the 21 S rRNA. When this 700-nucleotide capped transcript was isolated from agarose-urea gels and subjected to limit T1 digestion (data not shown), the product was identical with that of oligonucleotide 24. No match for oligonucleotide 24 can be found in the almost completely sequenced DNA down- stream from the 21 S rRNA gene (Fig. 2; Refs. 36 and 37), indicating that oligonucleotide 24 maps to the 5' side of the 21 S gene.

The 25-mer; Second OLI-1-The capped RNA from petite DS400/A12 has a very faint oligonucleotide of 25 bases after limit TI digestion (Fig. 1 and Table I); it may also be present in petite OIOn. Since incorporation of label into the transcript was so low, complete sequencing of oligonucleotide 25 proved impossible. After digestion with the pyrimidine specific ribo- nuclease from B. cereus, only four bases could be identified (gel not shown). Assuming that these are U (because of the scarcity of C in the yeast mitochondrial genome) and inferring that the purines are A in this complete T1 digestion product, the sequence starts A-U-A-U-A-U-A-U-A-N-N . . ., with G at position 25. This sequence matches the DNA sequence (32) following a nonanucleotide initiation sequence 78 bases after the major OLI-1 initiation site (see above) and about 545 bases before the first codon of this gene.

The 51-mer; Glutamic tRNA and COB-Capped RNA from petites 01011, Q3122, OIP2, and 0110 gives rise to labeled oligonucleotides of about 50 bases after limit T I digestion (Fig. 1 and Table I). The overlap of petites 01011 and Q3122 maps this oligonucleotide to a region between the 0x1-3 and COB genes (Fig. 2 ) . The sequence of the oligonucleotide (58) could be read clearly from the gel for 36 bases and was the same for all four petites; it starts with A-A-U-A-U-A-U-A-A- A . . . (see Fig. 6 for more of the sequence). These 36 bases perfectly match a published DNA sequence (57). The match is immediately downstream from a nonanucleotide initiation

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Transcriptional Initiation Sites in Yeast Mitochondria 14031

sequence. The first G is 51 bases downstream from this initiation site. The start for oligonucleotide 51 is 391 bases upstream from the 5' end of the mature glutamic tRNA (15, 57) and about 1550 bases upstream from the COB gene. Intitiation on a cloned DNA template from this region has been demonstrated by in vitro transcription with yeast mito- chondrial RNA polymerase and cloned DNA templates (59).

DISCUSSION

Analysis and Identification of Multiple Initiation Sites-We have analyzed the initiation sites of 20 mitochondrial tran- scripts and have precisely identified 13 of them by comparing their sequences with available DNA sequences. All of these transcripts initiate at the consensus nonanucleotide sequence, but there are three examples of secondary initiation two bases downstream. Initiation sites have been identified for the fol- lowing genes: 21 S rRNA, 14 S rRNA (with a secondary initiation 2 bases downstream), phenylalanine tRNA, f-me- thionine tRNA, glutamic acid, OLI-1 (with strong and weak primary initiation sites, and a secondary initiation for the strong one), and for three ori regions, ori-3, ori-5, and ori-2 (the last having secondary initiation). The RNA sequences, and the DNA sequences from which they are transcribed, are shown in Fig. 6. The remaining transcripts, which have been localized only by deletion mapping, probably initiate within the third of the mitochondrial genome that has not yet been sequenced. Tentative genetic assignments can be made for several of these based on the data in Fig. 2. Either oligonu- cleotide 5c or the less abundant oligonucleotide 3 is likely to be the initiating sequence for the 0x1-3 gene; this gene must initiate at a nucleotide 5' to the published 126 bases upstream from the start codon (52). Transcript 10a must arise from unsequenced DNA on either side of the phenylalanine tRNA gene (42). If downstream from the tRNA, 10a would be the valine tRNA and 0x1-2 transcript. If upstream, it would represent a second initiation site for the phenylalanine tRNA gene, with transcription continuing through the valine tRNA and 0x1-2 genes.

Multigenic Transcripts-Evidence has accumulated that many yeast mitochondrial promoters give rise to very long multigene primary transcripts. Our mapping experiments sup- port these observations and help define the nature of the transcripts. It is likely that the 21 S primary transcript extends well beyond the few tRNAs previously established to be at the 3' end of a 21 S rRNA precursor (11,35). We could map no transcripts nor match any sequences in the nearly completely sequenced tRNA-rich region downstream from the 21 S rRNA gene. Multigene tRNA transripts in this region have previously been demonstrated (60). The transcription unit may well extend through the many tRNAs in the region into the 0x1-1 gene and its downstream URF, since we could assign no transcript upstream from the 0x1-1 gene.

Thalenfeld et al. (61) have shown that the 0x1-2 and valine tRNA genes share a primary transcript. The phenylalanine tRNA may also be included in this transcriptional unit. It also appears that there is a single primary transcript for the 0x1-3 and OLI-2 genes. Cobon et al. (62) showed that some OLI-2 transcripts extend upstream to the 0x1-3 gene. No initiation sites were found by in vitro transcription with yeast mitochondrial RNA polymerase when a template, cloned EcoRI fragment 7, was used which extends from within the 0x1-3 gene to within the OLI-2 gene (7). Furthermore, after hybridization with probes specific for OLI-2 or 0x1-3, the longest transcripts visible on mtRNA blots appear to be identical (data not shown).

The transcriptional initiation site upstream from the glu- tamic tRNA is shared by the COB gene (59). Although map-

A) 2a 21 S rRNA

12 14 S rRNA

10 b

1 3 f-met tRNA

9 a phe tw

51 qlu tw

11 b OLI-1

9 C

25 2nd OLI-1

0 + TATATATAAGT AGTAAAAAGTAGAATAATAG . . . -+a f.... f.0 . + P

d~UAAAdaCUACAAUAAUAC

77-81 + ATTATATAAGT AATAAATAATAGmATAT ... AAUAAAUdAUAgUUUUAUAU

UAAAUAAUAC

28 f A T A T A A G T AATATAATATAAGTATTAAT . . . AAUAUMUAUAAg

26 + ATATATAAGT AATAATAAGTATTATATTAT . . . AAuAAuAdg

391 ATTATATASGT AATATATAAAAATAATAT AA... AAUAUAUAAMAUAAUAUAA.. .Cs,

625 + TTAATATAAGT AATATATATAGlTTATGATA.. . AAUAUAUAUA~UUVAOC:

545 + TTTATATAAGT A~ATATATATTATTAATA ... U A U A U A U A ~

AUAUAUAUANN.. . . . .G -25

5 a D I l - 3 - GATATATAAGT AATAGGGGGAGGCGGTGGGT . . .

5b orl-5 + AATATATAAGT AATAGGGGGAGGGGCT GGG%..

AAUAg

AAUAC

11 LL o n - 2 + AATATATAAGT AATAAATTAAGTTTTATAGG ... 9 b

AAUAA4UUAA~UUWAUAcU;C% UAAAUUAAg

O n - 1 - AAT&IQI&&ET @TAiuCTAACTllTATA CG...

B) 2 b ? 3 ?

? ? ? ?

5 c ? ? ?

AC AUC

l o a ? ? ? 14 ? ? ? 24 "700 n t " ? ?

u 14 S rRNA Y thr tRNA Y cys t R N A Y f-met t R N A " ql" tw " or,-3 u ori-2 d 0x1-2 d 0x1-2 In var d COB

2500 f TITATATMGT AATAAAATTAATATATATAT . . . 208 + TAASTATMGT A~GGCCGGGGGGTCCAAC ... 15 + TAALTATAAGT A~AAAGTAGTAAAGGAGA ... 14 + ATAATATAAGT ATAATTATATAAATGCAAT. . . 1 3 8 1 + TATATATATGT AXATATATATATATTAM . . . - AAAATATAST AAgTAT7TrAATTCCTGGA ...

+ TTTATATAAGT M ~ G T A A A T A T A T A A G ... 2150 + TATTATAAGT AXITATATTCATATATTA . . . 3100 - TATATATAgGT A&AATATAATAGTCCCCACT ... 423 + TTAEATMGT AMCTTATTAATCAACATAG . . . 770 - TATATSTAACT A C 780 - AGTAAGT A I _ 790 - ALATAAGT A T BOO - ATATAAGT A T _

820 - ATGTAAGT AT 810 - ACTAAGT A L

.*ft.tt.

830 - AC~TAAGT AT 840 - AT~TAAGT AT 850 - AGTAAGT 860 - ATGTAAGT E C M C C C C A G A T T AAA...

.ttt..tt *

FIG. 6. Summary of the sequences of capped oligonucleo- tides and DNA initiation regions. A compares the sequences of capped transcripts (italicized) with those DNA sequnces that could be matched. B contains the sequences of capped oligonucleotides which have not yet been identified with a DNA sequence. C shows DNA sequences which are homologous to the nonanucleotide initia- tion sequence, but which do not match capped transcripts. Note the 10 successive adjacent sequences downstream from the COB gene. The oligonucleotides or transcripts are numbered (No.) as described in the text. Genes (or ori regions) in A are those that have been identified with capped transcripts; in C, the genes are reference points localized near the sequences. Column D in A gives the distance, in nucleotides, from the initiation site to the gene (note that there is considerable variation) and, in C, it gives the distance from the homologous sequence to the reference gene (upstream (u), down- stream (d ) , or in the gene is designated by the notation before the gene name). If the distance is italicized, it is imprecise or an estimate. Column S denotes the DNA strand that contains the sequence; the positive strand contains most of the genes. Underlined bases in the DNA sequences indicate a variance from the consensus sequence -10 to +4 bases from the initiation site. For the 10 successive sequences downstream from the COB gene listed in C, underlining to the right of the sequences also indicates variation from the consensus. In this case, the two nucleotides considered are, in fact, the initial two nucleotides of the succeeding sequence that appears in the line below. Asterisks mark the nonanucleotide initiation sequence. Underlined Gs in the RNA sequences indicate the first G in a capped transcript. The secondary capped transcripts of the 14 S and OLI-1 genes and the ori-2 region are listed beneath the respective major tanscripts. The references for the DNA sequences in A are given in the text. The references for Care: 14 S (8), Thr-tRNA (36), Cys-tRNA (36), f-Met- tRNA (58), Glu-tRNA (57), ori-3 and ori-2 (9, 30), 0x1-2 (45, 57), Var (33), and COB (14).

ping with SI nuclease has demonstrated a COB transcript that extends more than 900 bases upstream of the COB gene (15, 63), this 5' end is not the initiation site, because it is not positioned at a nonanucleotide initiation sequence, nor does

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14032 Transcriptional Initiation Sites in Yeast Mitochondria

it match a sequence of any of the capped oligonucleotides. The serine tRNA and Var genes probably share the OLI-1 pair of initiation sites,’ since there are not other nonanucleo- tide initiation sequences or matches to capped transcripts within this completely sequenced region.

Origins of Replication-The yeast mitochondrial genome is thought to contain three (31) or four (30) origins of replica- tion, although, in nonsupressive petites, other sequences can serve this function. A nonanucleotide initiation sequence is found a t each of the putative origins. The DNA sequences downstream from the nonanucleotide initiation regions match three capped transcripts which map to the corresponding ori regions. This observation supports the suggestions that the nonanucleotide sequences are necessary for transcriptional initiation in supersuppressive petites (9) and are involved in priming DNA replication (6). If, as appears likely, transcrip- tion initiated at the ori sites primes DNA synthesis, then the same RNA polymerase is probably used both to prime DNA replication and to transcribe the structural genes, since the DNA sequences at the initiation sites are homologous.

It is not likely that the origins of replication also serve as transcriptional initiation sites for downstream genes. The glutamic tRNA downstream from ori-2 and the f-methionine tRNA downstream from ori-5 each have their own initiation sites and initiation from ori-3 would transcribe the wrong strand of the Var gene. On the other hand, transcriptional initiation sites for specific genes might be capable of serving as surrogate origins of replication. For example, Goursot et al. (57) describe a 30% suppressive petite without an ori region; this petite contains the initiation site for the glutamic tRNA (and COB) genes.

The Sequence at Transcriptional Initiation-The results of our study confirm the role of a nonanucleotide sequence as the signal for initiation of RNA transcription first proposed by Osinga et al. (6). A number of nonanucleotide initiation sequences were uncovered by computer searches of published DNA sequences (6, 9); we have found others by inspecting short published sequences that have evidently not been in- cluded in the DNA data banks and by examining unpublished sequences. A list of these sequences appears in Fig. 6, together with sequences of those transcripts that we have analyzed. All the capped transcripts that we have matched to DNA sequences start at a copy of the nonanucleotide sequence, with only a few base permutations permitted. Three secondary transcripts start two bases downstream from the major initi- ation site.

The nonanucleotide initiation sequence is comprised of nucleotides -8 to +1, which is the initiation site. From the compilation in Fig. 6, a larger consensus sequence at the initiation site can be constructed from this information: A/ T-A/T-[a-T-A-T-A-a-G-T-A*]-purine-t-a. The nonanucleo- tide initiation sequence itself is bracketed and the asterisk marks the first transcribed base. The lowercase letters indi- cate positions where variations appear; the consensus does not vary for the more abundant transcripts. The less abundant transcripts for which variations within the nonanucleotide sequence occur are the phenylalanine, f-methionine, and glu- tamic tRNAs. It should be noted that our evaluation of promoter strength is based on the assumption that the 5‘ triphosphate ends of all the transcripts are equally stable. Aside from the three unusual secondary transcripts which start two bases downstream from a major initiation, only the weak transcripts 3, 14, and 25 vary in the consensus of the first four bases after initiation. The whole homologous se- quence therefore probably is a t least part of the yeast mito- chondrial promoter.

If the initiation sequence were the only important factor,

then the sequence alone could be used to predict transcrip- tional initiation. In Fig. 6C, a number of sequences are listed which do not give rise to capped transcripts. In all but one case, either there is a substitution forbidden by the consensus, or there are one or more substitutions which are unique to the initiation sequences of the less abundant transcripts. The one perfect inactive sequence is about 2.5 kilobases upstream from the 14 S rRNA. This site and some of the imperfect initiation sequences might give rise to occasional rapidly degraded transcripts or be subject to other regulatory elements that might be dependent on the physiological state of the cell.

Although the sequence at the mitochondrial initiation site is rather precisely defined, it is noteworthy that mitochondrial RNA can be isolated from small petites lacking initiation sites and that this RNA incorporates as much label in in vitro capping reactions as does RNA from other petites. Autoradi- ographic exposure of complete TI digests of RNA from petites without initiation sequences results in a ladder (data not shown). A ladder is also frequently seen as background after long exposure of complete T1 digests of RNA from some petites with initiation sequences. This indicates that there may be a weak background of initiation from many sites on mtDNA, and that, in the absence of true promoters, this “random” initiation becomes quite significant. The activity of purified yeast mitochondrial polymerase is very high when poly[d(AT)] is used as template (64) and most of the mito- chondrial genome consists of AT-rich regions. The “random” initiation may also serve to prime DNA synthesis in small petites lacking ori regions or promoters.

Three heavily transcribed initiation sites (14 S, OLI-1, and ori-2) also give rise to less abundant secondary transcripts, which initiate two bases downstream from the regular initia- tion site. The initiating nucleotide for these anomalous tran- scripts appears to be a U. Initiation with a pyrimidine is unusual, but has been observed in eukaryotic systems (65). Although weak secondary initiation might be missed for the less abundant transcripts, its absence at the very strong 21 S rRNA initiation site shows that this phenomenon does not occur a t all initiation sites.

Acknowledgments-We thank Alexander Tzagoloff for the gift of several petite strains and Nancy Martin and Dennis Miller for the communication of unpublished DNA sequences. We thank Godfrey S. Getz for advice and we also benefited from helpful discussions with Klaas Osinga and Henk Tabak.

1.

2.

3.

4.

5.

6.

7.

8.

9. 10.

REFERENCES Montoya, J., Ojala, D., and Attardi, G. (1981) Nature 290, 465-

470 Montoya, J., Christianson, T., Levens, D. Rabinowitz, M., and

Attardi, G. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 7195- 7199

Levens, D., Ticho, B., Ackerman, E., and Rabinowitz, M. (1981) J. Biol. Chem. 256,5226-5232

Levens, D., Christianson, T., Edwards, J., Lustig, A., Ticho, B., Locker, J., and Rabinowitz, M. (1982) in Mitochondrial Genes (Attardi, G., Borst, P., and Slonimski, P., eds) pp. 295-309,

York Cold Spring Harbor Laboratory, Cold Spring Harbor, New

Christianson, T., Edwards, J., Levens, D., Locker, J., and Rabi- nowitz, M. (1982) J. Biol. Chem. 257,6494-6500

Osinga, K. A., de Haan, M., Christianson, T., and Tabak, H. F. (1982) Nucleic Acids Res. 10,7993-8006

Edwards, J. C., Levens, D., and Rabinowitz, M. (1982) Cell 31,

Osinga, K. A., and Tabak, H. F (1982) Nucleic Acids Res. 10,

Baldacci, G., and Bernardi, G. (1982) EMBO J. 1,987-994 Morimoto, R., Locker, J.,Synenki, R. M., and Rabinowitz, M.

337-346

3617-3626

(1979) J. Biol. Chem. 254, 12461-12470

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Transcriptional Initiation Sites in Yeast Mitochondria 14033

11. Locker, J., Synenki, R. M., Merten, S.,andRabinowitz, M. (1981) 41. Fox, T. D. (1979) Proc. Natl. Acad. Sci. U. S. A. 76,6534-6538

12. Martin, N. C., and Underbrink-Lyon, K. (1981) Proc. Natl. Acad. (1979) J. Biol. Chem. 2 5 4 , 11735-11740

13. Morimoto, R., and Rabinowitz, M. (1979) Mol. & Gen. Genet. (1980) Nucleic Acids Res. 8, 1435-1442

14. Nobrega, F. G., and Tzagoloff, A. (1980) J. Biol. Chem. 255, 45. Thalenfeld, B. E., and Tzagoloff, A. (1980) J. Biol. Chern. 255 ,

15. Bonitz, S. G., Homison, G., Thalenfeld, B. E., Tzagoloff, A., and 46. Newman, D., Pham, H. D., Underbrink-Lyon, K., and Martin, Nobrega, F. G. (1982) J. Biol. Chem. 257,6268-6274 N. C. (1980) Nucleic Acids Res. 8,5007-5016

16. Macino, G., and Tzagoloff, A. (1979) J. Biol. Chem. 254 , 4617- 47. Tabak, H. F., Hecht, N. B., Menke, H. H., and Hollenberg, C. P. 4623 (1979) Curr. Gen. 1, 33-43

17. Coruzzi, G., Bonitz, S. G., Thalenfeld, B. E., and Tzagoloff, A. 48. Sor, F., and Fukuhara, H. (1980) C. R. Acad. Sci. Paris 291,933- (1981) J. Biol. Chem. 2 5 6 , 12780-12787 936

18. Lewin, A., Morimoto, R., Rabinowitz, M., and Fukuhara, H. 49. Sor, F., and Fukuhara, H. (1982) in Mitochondrial Genes (Attardi. (1978) Mol. & Gen. Genet. 163,257-275 G., Borst, P. and Slonimski, P., eds) pp. 255-262, Cold Spring

19. Locker, J., Rabinowitz, M., and Getz, G. S. (1974) J. Mol. Biol. Harbor Laboratory, Cold Spring Harbor, New York

20. Locker, J. (1979) Anal. Biochern. 98,358-367 (1982) J . Bwl. Chem. 257,5921-5928 21. Cryer, D. R., Eccleshall, R., and Marmur, J. (1975) in Methods 51. Martin, R. P., Sibler, A.-P., BordonnS, R., Canaday, J., and

in Cell Biology (Prescott, D. M., ed) Vol. 12, pp. 39-44, Academic Dirheimer, G. (1980) in The Organization and Expression of the Press, New York Mitochondrial Genome (Kroon, A. M., and Saccone, C., eds) pp.

22. Penefsky, H. S. (1977) J. Bid. Chern. 252,2891-2899 311-314, Elsevier/North-Holland Biomedical Press, New York 23. Woese, C., Sogin, M., Stahl, D., Lewis, B. J., andBonen, L. (1976) 52. Bonitz, S. G., Coruzzi, G., Thalenfeld, B. E., Tzagoloff, A., and

24. Silberklang, M., Gillum, A. M. and RajBhandary, U. L. (1979) 53. Hensgens, L. A. M., Bonen, L., de Haan, M., van der Horst, G., Methods Enzymol. 59,58-109 and Grivell, L. A. (1983) Cell 32, 379-389

25. Donis-Keller, H., Maxam, A. M., and Gilbert, W. (1977) Nucleic 54. Macino, G., and Tzagoloff, A. (1980) Cell 20,507-517 Acids Res. 4 , 2527-2538 55. Lazowska, J., Jacq, C., and Slonimski, P. P. (1980) Cell 22,333-

26. Bernardi, G. (1976) J. Mol. Euol. 9 , 25-35 348 27. Merten, S., Synenki, R. M., Locker, J., Christianson, T., and 56. Gaillard, C., Strauss, F., and Bernardi, G. (1980) Nature 283 ,

Rabinowitz, M. (1980) Mol. & Gen. Genet. 7 7 , 1417-1421 218-220 28. Morimoto, R., Merten, S., Lewin, A., Martin, N. C., and Rabi- 57. Goursot, R., Mangin, M., and Bernardi, G. (1982) EMBO J. 1,

nowitz, M. (1978) Mol. & Gen. Genet. 163, 241-255 705-711 29. Morimoto, R., and Rabinowitz, M. (1979) Mol. & Gen. Genet. 58. Miller, D. L., Underbrink-Lyon, K., Najarian, D. R., K ~ p p , J.,

170, 11-23 and Martin, N. C. (1983) in Nuclear-Cytoplasmic Interactions 30. de Zamaroczy, M., Marotta, R., Faugeron-Fonty, G., Goursot, R., (Wolf, K., Schweyen, R., and Kaudewitz, F., eds) Walter de

Mangin, M., Baldacci, G., and Bernardi, G. (1981) Nature 2 9 2 , Gruyter, Berlin, in press 75-78 59. Christianson, T., Edwards, J. C., Mueller, D. M., and Rabinowitz,

Ann. N.Y. Acad. Sci. 3 6 1 , 105-118 42. Miller, D. L., Martin, N. C., Pham, H. D., and Donelson, J. E.

Sci. U. S. A. 78,4743-4747 43. Miller, D. L., Sigurdson, C., Martin, N. C., and Donelson, J. E.

170,25-48 44. Li, M., and Tzagoloff, A. (1979) Cell 18,47-53

9828-9837 6173-6180

88,489-502 50. Li, M., Tzagoloff, A., Underbrink-Lyon, K., and Martin, N. C.

J. Mol. Euol. 7, 197-213 Macino, G. (1980) J. Biol. Chem. 255, 11927-11941

31. Blanc, H., and Dujon, B. (1980) Proc. Natl. Acad. Sci. U. S. A. M. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 5564-5568

32. Tzagoloff, A,, Nobrega, M., Akai, A., and Macino, G. (1980) Curr. Res. 10 , 7283-7293 Gen. 2 , 149-157 61. Thalenfeld, B. E., Hill, J., and Tzagoloff, A. (1983) J. Biol. Chem.

33. Hudspeth, M. E. S., Ainley, W. M., Shumard, D. S., Butow, R. 258,610-615 A,, and Grossman, L. I. (1982) Cell 30,617-626

34. Dujon, B. (1980) Cell 20 , 185-197 62. Cobon, G. S., Beilharz, M. W., Linnane, A. W., and Nagley, P.

35. Locker, J., and Rabinowitz, M. (1981) Plasmid 6, 302-314 63. Grivell, L. A., Hensgens, L. A. M., Osinga, K. A., Tabak, H. F., 36. Berlani, R. E., Pentella, C., Macino, G., and Tzagoloff, A. (1980) Boer, P. H., Crusius, J . B. A., Van der Laan, J. C., DeHaan,

J. Bacteriol. 141, 1086-1097 M., Van der Horst, G., Evers, R. F., and Arnberg, A. C. (1982) 37. Berlani, R. E., Bonitz, S. G., Coruzzi, G., Nobrega, M., and in Mitochondrial Genes (Attardi, G., Borst, P., and Slonimski,

Tzagoloff, A. (1980) Nucleic Acids Res. 8, 5017-5030 P., eds) pp. 225-239, Cold Spring Harbor Laboratory, Cold 38. Bonitz, S. G., and Tzagoloff, A. (1980) J. Biol. Chem. 255,9075-

9081 Spring Harbor, NY

64. Levens, D., Lustig, A., and Rabinowitz, M. (1981) J. Biol. Chem. 39. Miller, D. L., and Martin, N. C. (1981) Curr. Gen. 4, 135-143 256,1474-1481 40. Coruzzi, G., and Tzagoloff, A. (1979) J. Biol. Chm. 2 5 4 , 9324- 65. Bunick, D., Zandomeni, R., Ackerman, S., and Weinmann, R.

77,3942-3946 60. Frontali, L., Palleschi, C., and Francisci, S. (1982) Nucleic Acids

(1982) Curr. Gen. 5, 97-107

9330 (1982) Cell 29,877-886

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

T Christianson and M Rabinowitzmitochondrial genome by in vitro capping with guanylyltransferase.Identification of multiple transcriptional initiation sites on the yeast

1983, 258:14025-14033.J. Biol. Chem. 

  http://www.jbc.org/content/258/22/14025Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/258/22/14025.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from