608 Chiang Mai J. Sci. 2011; 38(4)

Chiang Mai J. Sci. 2011; 38(4) : 608-618http://it.science.cmu.ac.th/ejournal/Contributed Paper

Identification of Drug-Type and Fiber-Type of Hemp(Cannabis sativa L.) by Multiplex PCRSomkhid Thichak*[a], Surapol Natakankitkul [b], Sunee Chansakaow [b] andSalakchit Chutipongvivate [c][a] Regional Medical Sciences Center 10, Chiang Mai 50180, Thailand.[b] Department of Pharmaceutical Sciences, Faculty of Pharmacy, Chiang Mai University, Chiang Mai 50200,

Thailand.[c] Regional Medical Sciences Center 3, Chon Buri 20000, Thailand.*Author for correspondence; e-mail: somkid.t@dmsc.mail.go.th

Received: 9 February 2011Accepted: 19 June 2011

ABSTRACTThe multiplex PCR method for identification of drug type and fiber-type of 100

hemp samples was developed and evaluated. Two loci multiplex PCR molecular markerswere simultaneously amplified and detected. The first locus, 700 bp-Cannabis marker, wasdesigned to be Cannabis genus specific, while the second locus, 1.2 kb-drug-type marker, wasspecific to THCA synthase gene of drug-type plants. The results showed that Cannabis markerwas detected in all samples, but drug-type marker was found in only 63 samples. Therefore,by this method, 37 plants could be identified to be fiber-type, whereas the other plants wereconsidered as drug-type. The relative accuracy between the developed multiplex PCR methodand reference method (based on CBD/THC ratio) was 93%.

Keywords: hemp, Cannabis sativa L., multiplex PCR, molecular marker.

1. INTRODUCTIONHemp (Cannabis sativa Linn.) is one of

the interesting plants. It is an annual floweringand dioeciously plant. Many parts of Cannabissativa L. have been used for a variety ofpurposes such as fiber from stalk, oil andhealthy food from seeds [1,2]. The mainpsychoactive substance which producesby Cannabis sativa L. is known as -9-tetrahydrocannnabinol (THC) [1,3,4]. In manycountries, legal cultivation is allowed only forfiber varieties with THC content belowpsychoactive level. Thus, cultivation ofindustrial hemp requires a tight control of high

THC containing plants (drug-type) [5].Furthermore, in hemp selection wherefiber-type plants (suitable for fiber or seedsproduction) are desired, eradication ofdrug-type from fiber-type is necessary [4].Unfortunately, drug-type plants are notmorphologically distinguishable from fiber-type [5]. For these reasons, the accurate methodto identify the hemp types at molecular levelis important.

Besides THC, another substance whichis produced in high concentrations by someplants is cannabidiol (CBD) [1,3,4]. It is not

Chiang Mai J. Sci. 2011; 38(4) 609

psychoactive, but it has recently been reportedto inhibit the effect of THC [6-8]. Both THCand CBD are derived artificially by non-enzymatic decarboxylation from their acidicprecursors, -9-tetrahydrocannnabinolic acid(THCA) and cannabidiolic acid (CBDA),respectively [7]. Since both substances areaccumulate mainly in inflorescences; thus,quantification of THC and CBD is generallygiven by their amount (% dry wt.) in theextracts from dried inflorescences (30 cm ofthe upper flowering part). Chemically, basedon CBD/THC ratio, hemp exists in threedifferent principal types. The first one isdefined as drug-type due to its low CBD/THC ratio. The second is intermediate, whichhas both THC and CBD in a ratio close to1.0 (typically ranging from 0.5 to 3.0), andthirdly, it is called fiber-type which has highCBD/THC ratio due to the low level ofTHC (lower than 0.3%) [4].

The highly accurate techniques such asGC, GC-MS and HPLC have been frequentlyused for THC and CBD quantitative analysis[1,4,8-11]. Nevertheless, the techniques requireexpensive equipments and high maintenancecosts. Furthermore, in young hemp plants, thequantification of THC and CBD by thesetechniques is not accurate due to the absenceor low abundance of the substances [1,11].Recently, the genes encode THCA and CBDAsynthase have been characterized and thecoding sequences, approximately 1.6 kb, wereobtained [7,12]. The study of DNApolymorphisms in THCA synthase geneshowed that nucleotide sequences ofintermediate and drug-type were similar. Incontrast, nucleotide sequences of fiber-typewere approximately 4% different from thoseof intermediate and drug-type. In the past,simplex polymerase chain reaction (simplexPCR) has been used successfully to amplify aspecific fragment of THCA synthase gene ofeither intermediate or drug-type. This

fragment, however, named “drug-typemarker”; and was used to distinguishintermediate and drug-type from fiber-type.In addition, another marker specific to thegene for large subunit of rbcL in chloroplastwas also amplified and used to confirm thepresent of Cannabis sativa L. [11,14]. Suchsimplex PCR markers are useful foridentification of hemp types especially inyoung plants. However, the disadvantage ofsimplex PCR is it can amplify only one markergene per reaction which is not appropriatefor amplifying multiple markers. Hence, forsimultaneous amplification of multiplemarkers, its variant known as “multiplex PCR”is more suitable [13].

In this work, the multiplex PCR methodwas developed and used to simultaneouslyamplify two specific molecular markers fromhemp samples for identification of hemptypes. The method was evaluated for itsaccuracy and discussed in relation to its utility.

2. MATERIALS AND METHODS2.1 Plant Samples

All plants were grown by HighlandResearch and Development Institute (PublicOrganization) at the Royal Agricultural StationPang Da, Chiang Mai in the seasons of 2009and 2010. One hundred samples werecollected from flowering part of the plants(30 cm from the top including inflorescencesand leaves) belonging to three varieties(32, 34 and 34 plants of V50, Mae Sa Maiand Houy Hoy, respectively). Among these,52 samples were dried, while 48 samples werefrozen fresh. The numbers of male and femalewere equal. Each sample was previouslyanalyzed for THC and CBD contents basedon the guidelines of UNODC [15] by usingthe Chrompack® 9002 GC-FID (Varian,Netherlands). The THC contents of allsamples were presented in ranges from 0 to1.829% whereas CBD contents were

610 Chiang Mai J. Sci. 2011; 38(4)

presented in ranges from 0 to1.326%. Formultiplex PCR, a small amount of eachsample was used as a source of isolatinggenomic DNA.

2.2 Genomic DNA IsolationTotal genomic DNA was isolated from

either 10 mg of dry sample or 40 mg offrozen fresh sample using the NucleoSpin®

Plant II isolation kit (Macherey-Nagel,Germany). The isolation procedure wascarried out according to the manufacturer’sguidelines. Concentration of isolated genomicDNA was determined by gel electrophoresisalong with TrackitTM 100 bp DNA Ladder(Invitrogen, USA) as known DNA standardin 2% agarose gel, and stained with ethidiumbromide. Photographs of gels were recordedunder UV light (254 nm) using the GeneFlashgel documentation system (SYNGENE, UK).Finally, DNA concentrations were estimatedusing Photo-CaptMw software (VilberLourmat, France). Small amount of isolatedgenomic DNA was used as DNA templatein the multiplex PCR.

2.3 Multiplex PCR Markers Amplificationand Detection

Two molecular markers were simulta-

neously amplified using multiplex PCRmethod with two sets of primers. The firstprimers set (“c-f ” and “c-r”) was designedfor this study which based on nucleotidesequences of the gene for large subunit ofrbcL of Cannabis genus (AJ390068, AJ402933and AF500344) deposited in GenBankdatabase at the website of National Centerfor Biotechnology Information (NCBI). Theamplification was expected to produce 700bp fragment product named “Cannabismarker”. The second primers set, “g” and“h”, as described elsewhere, was specific to alocus of THCA synthase gene of intermediateand drug-type plants, and its amplified productexpected to be 1.2 kb fragment called “drug-type marker” [11]. The nucleotide sequencesof the primers which were used in multiplexPCR is shown in Table 1, and a diagram ofspecific loci is illustrated in Figure 1.

For developing multiplex PCR method,a fiber-type (F) and a drug-type control (D)were used as reference materials. In themultiplex PCR reaction, the primers concen-trations and amounts of DNA template wereoptimized. Because of different efficiencybetween primers sets, primers g and h werefixed at 0.3 μM whereas primers c-f and c-rwere varied from 0.3 to 0.05 μM. After

Figure 1. The diagram of specific loci of primers.

Chiang Mai J. Sci. 2011; 38(4) 611

optimized concentrations of primers werefound, these concentrations were further usedin the reactions for optimization of DNAtemplate amounts which were varied from100 to 0.25 ng.

The developing multiplex PCR reactionswere performed in total volume of 25 μl,with each reaction containing 1X PCR buffer,2.5 mM MgCl2, 0.2 mM dNTPs, 0.75 Uniti-TaqTM DNA polymerase (iNtRON Biotech-nology, Korea), 0.3 μM primers g and h, 0.3-0.05 μM primers c-f and c-r (produced byBio Basic Inc., Canada), and 100-0.25 ng DNAtemplate. The reactions were carried out inthe GeneAmp® PCR system 2,400 (AppliedBiosystems, USA). The conditions were:preheating at 94oC for 10 min, followed by35 cycles at 94oC for 1 min, 57oC for 1 min,and 72oC for 2 min, with a final extensionstep at 72oC for 5 min, as previouslydescribed [11].

The amplified products of two molecularmarkers were detected along with GeneRulerTM

100 bp DNA Ladder (Fermentas, USA) bygel electrophoresis on 2% agarose gels preparedwith Tris-Borate-EDTA (TBE) buffer. Afterstaining with ethidium bromide, the amplifiedproducts were visualized and recorded underUV light (254 nm) using the GeneFlash geldocumentation system (SYNGENE, UK).

After optimized, the developed multiplexPCR method was used to amplify the Cannabismarker and drug-type marker among 100unknown samples. It was performed in a totalvolume of 25 μl, with each reaction containing1X PCR buffer, 2.5 mM MgCl2, 0.2 mMdNTPs, 0.75 Unit i-TaqTM DNA polymerase

(iNtRON Biotechnology, Korea), 0.3 μMprimer g and h, 0.05 μM primer c-f and c-r,(produced by Bio Basic Inc., Canada), and0.25 ng DNA template. The reactions werecarried out in the GeneAmp® PCR system2,400 (Applied Biosystems, USA). Thereactions conditions and amplified productsdetection were performed using the sameprocedure of the developing steps.

2.4 Identification of Hemp TypesIdentification of drug-type and fiber-

type of 100 hemp samples using the developedmultiplex PCR method was based on thepresence of specific markers: Cannabis markerand drug-type marker. A sample whichshowed only one amplified DNA fragment(Cannabis marker) was identified to be fiber-type, whereas a sample with the simultaneouspresence of both Cannabis marker and drug-type marker was considered as drug-type.

To gain inside the validity of developedmultiplex PCR method for identification ofhemp types, the relative accuracy was determined.The identification using CBD/THC ratio wasused as a reference method. Each samplewas previously analyzed for THC and CBDcontents based on the guidelines of UNODC[15] by using the Chrompack® 9002 GC-FID(Varian, Netherlands). By using the referencemethod, hemp could be identified into threetypes. The first one was defined as drug-typedue to its low CBD/THC ratio. The secondwas intermediate, which had both THC andCBD in a ratio close to 1.0 (typically rangingfrom 0.5 to 3.0), and thirdly, it was called fiber-type which had high CBD/THC ratio due to

Primer Specific gene Nucleotide sequence (5′- 3′) Product size

c-f rbcL CGCTCTACGTCTGGAAGATTTGAG 700 bpc-r (Cannabis) CTTGAGTGAAATAAATACCACGGCTTC (Cannabis marker)g THCA synthase AATAACTCCCATATCCAAGCA 1.2 kbh (drug-type) AGGACTCGCATGATTAGTTT (drug-type marker)

Table 1. Nucleotide sequences of primers which were used in multiplex PCR.

612 Chiang Mai J. Sci. 2011; 38(4)

the low level of THC (lower than 0.3%) [4].The relative accuracy between developedmultiplex PCR methods and referencemethod was calculated using the followingformula (2.4.1).

Relative accuracy (%) = (A+B+C) × 100 2.4.1N

where A = number of samples which wereidentified to be fiber-type by both methods,B = number of samples which were identifiedto be intermediate by reference method andidentified to be drug-type by developedmultiplex PCR method, C = number ofsamples which were identified to be drug-type by both methods, and N = total numberof samples.

2.5 Assessment of Primer SpecificityTo assess primer specificity, the amplified

products were analyzed for DNA sequencing.The 700 bp and 1.2 kb amplified productswere obtained from fiber-type and drug-typecontrol sample, respectively. DNA sequencingwas performed (via service of Bio BasicInc., Canada) using the ABIPrismTM 3730 XL(Applied Biosystems, USA). After receivedDNA sequencing results, the identity weredetermined by comparing the nucleotidesequences of amplified products withsubmitted nucleotide sequences available inGenBank using the BLAST program [16].

3. RESULTS AND DISCUSSIONTotal genomic DNA was isolated from

either 10 mg of dry sample or 40 mg offrozen fresh sample using the commercialisolation kit. The estimated concentrations ofisolated genomic DNA (data not shown) werein the range of 44-116 ng/μl (71±18 ng/μl).It seemed that the DNA concentrations werereasonably consistent, although different typesof samples were used. Therefore, based ondata from this study, users might not need to

find out an exact concentration of isolatedDNA using gel electrophoresis. In order tosave costs and time, we suggest that userscould predict the concentration of isolatedDNA which could be around 70 ng/μl.

Recently, simplex PCR, a technique whichcan be used to amplify only one target locusper reaction, has been successfully used bysome researchers to amplify two or three lociof molecular markers for identification ofhemp types [8,11,17]. However, in thatsituation, simplex PCR is rather costs and timeconsuming when compared with multiplexPCR. Therefore, in this study, we chosemultiplex PCR for DNA amplification.Furthermore, for application, multiplex PCRis more convenient. However, undesirableprimer-primer interactions and unspecificamplification were occurred using thistechnique especially caused by primersconcentrations or amount of DNA template.To handle this problem, we tried to find theoptimal concentrations of primers and theoptimal amount of DNA template in thedeveloping steps. Finally, we found that 0.3μM of primer set g and h, and 0.05 μM ofprimer set c-f and c-r were the optimalconcentrations (Figure 2). Furthermore, 0.25ng of DNA template was found to be theoptimal amount for this developed multiplexPCR (Figure 3).

The amplified products obtained fromdeveloped multiplex PCR method in 100hemp samples were detected using gelelectrophoresis, and the representative resultis shown in Figure 4. In fiber-type control, asexpected, only one amplified product (700 bp)was detected. In contrast, both 700 bp and1.2 kb amplified products were presentedsimultaneously in drug-type control. Identifi-cation of types among the unknown sampleswas performed in the same way. It wasrevealed that H62, H63, H64 and H66 wereconsidered as drug-type, except H65 which

Chiang Mai J. Sci. 2011; 38(4) 613

Figure 2. Multiplex PCR products on 2% agarose gels obtained from the optimization ofprimers concentrations. Lane M: 100 bp DNA ladder;; F: Fiber-type control; D: Drug-typecontrol; DW: Distilled water.

Figure 3. Multiplex PCR products on 2% agarose gels obtained from the optimization ofDNA template amounts. Lane M: 100 bp DNA ladder;; F: Fiber-type control; D: Drug-typecontrol; DW: Distilled water.

Figure 4. Multiplex PCR products on 2% agarose gels for rbcL and THCA synthase geneanalysis. Lane M: 100 bp DNA ladder; DW: Distilled water; F: Fiber-type control;D: Drug-type control; Lane 1 to 5: Samples H62 to H66, respectively.

614 Chiang Mai J. Sci. 2011; 38(4)

Sample CBD THC Multiplexcode (%dry wt.) (% dry wt.) CBD/THC ratio Type PCRH1 0.455 0.301 1.51 I FH2 0.378 0.156 2.42 I DH3 0.271 0.109 2.49 I DH4 0.326 0.000 N/C F FH5 0.477 0.373 1.28 I DH6 0.167 0.055 3.05 F DH7 1.063 0.572 1.86 I DH8 1.012 0.602 1.68 I FH9 0.575 0.024 24.35 F FH10 0.498 0.022 22.11 F FH11 0.273 0.000 N/C F FH12 0.406 0.279 1.46 I FH13 0.543 0.027 20.50 F FH14 0.592 0.401 1.47 I DH15 0.356 0.175 2.04 I DH16 0.711 0.762 0.93 I DH17 0.890 0.441 2.02 I DH18 1.078 0.047 22.64 F FH19 0.615 0.087 6.99 F FH20 0.837 0.471 1.78 I DH21 0.946 0.505 1.87 I DH22 0.586 0.365 1.60 I FH23 0.467 0.157 2.97 I DH24 0.567 0.000 N/C F FH25 0.502 0.033 14.95 F FH26 0.210 0.623 0.34 D DH27 0.373 0.166 2.24 I DH28 0.797 0.315 2.53 I DH29 1.132 0.487 2.32 I DH30 0.610 0.033 18.21 F FH31 1.326 0.605 2.19 I DH32 0.554 0.041 13.39 F FH33 0.134 0.069 1.94 I DH34 0.722 0.633 1.14 I DH35 0.504 0.284 1.77 I DH36 0.166 0.122 1.36 I DH37 0.849 0.557 1.52 I DH38 0.257 0.000 N/C F FH39 0.409 0.000 N/C F FH40 0.234 0.381 0.610 I DH41 0.131 0.000 N/C F FH42 0.252 0.112 2.25 I DH43 0.140 0.050 2.83 I DH44 0.053 0.245 0.22 D DH45 0.291 0.000 N/C F FH46 0.159 1.148 0.14 D DH47 0.217 0.175 1.24 I DH48 0.088 0.857 0.10 D D

Table 2. The comparison of identification of hemp types between the developed multiplexPCR method and reference method.

Reference method

Note: F, Fiber-type; D, Drug-type; I, Intermediate; N/C, Not calculable.

Chiang Mai J. Sci. 2011; 38(4) 615

H49 0.203 0.000 N/C F FH50 0.529 0.221 2.40 I DH51 0.421 0.039 10.95 F FH52 0.257 1.829 0.14 D DH53 0.856 0.321 2.67 I DH54 1.130 0.380 2.97 I DH55 0.245 0.029 8.58 F FH56 0.366 0.000 N/C F FH57 0.243 0.000 N/C F FH58 0.387 0.413 0.94 I DH59 0.180 0.088 2.06 I DH60 0.120 0.034 3.49 F DH61 0.667 0.312 2.13 I DH62 0.229 0.089 2.57 I DH63 1.056 0.599 1.76 I DH64 0.149 0.132 1.12 I DH65 0.447 0.033 13.55 F FH66 0.297 0.710 0.42 D DH67 0.125 0.081 1.55 I DH68 0.393 0.000 N/C F FH69 0.036 0.452 0.07 D DH70 0.095 0.165 0.58 I DH71 0.317 0.000 N/C F FH72 0.042 0.400 0.10 D DH73 0.717 0.397 1.81 I DH74 0.548 0.443 1.24 I FH75 0.288 0.181 1.59 I DH76 0.217 0.160 1.36 I DH77 0.155 0.119 1.29 I DH78 0.191 1.455 0.13 D DH79 0.134 0.079 1.70 I DH80 0.593 0.544 1.09 I DH81 0.448 0.219 2.04 I DH82 0.088 0.000 N/C F FH83 0.332 0.122 2.72 I DH84 0.151 0.505 0.30 D DH85 0.284 0.149 1.91 I DH86 0.656 0.060 10.88 F FH87 0.118 0.659 0.18 D DH88 0.374 0.000 N/C F FH89 0.705 0.050 14.24 F FH90 0.533 0.296 1.81 I DH91 0.474 0.025 19.26 F FH92 0.164 0.000 N/C F FH93 0.339 0.281 1.20 I DH94 0.000 0.423 0.00 D DH95 0.131 0.041 3.18 F FH96 0.344 0.130 2.64 I DH97 0.160 0.000 N/C F FH98 0.703 0.325 2.16 I DH99 0.175 0.000 N/C F FH100 1.126 0.515 2.18 I D

Note: F, Fiber-type; D, Drug-type; I, Intermediate; N/C, Not calculable.

Sample CBD THC Multiplexcode (%dry wt.) (% dry wt.) CBD/THC ratio Type PCR

Table 2. The comparison of identification of hemp types between the developed multiplexPCR method and reference method. (continued)

Reference method

616 Chiang Mai J. Sci. 2011; 38(4)

was identified to be fiber-type. The overallresults of identification of 100 hemp samplesusing multiplex PCR markers are presentedin Table 2. By this method, 37 samples wereidentified to be fiber-type, whereas 63 sampleswere identified to be drug-type. The datasuggests that the developed multiplex PCRcan be used to distinguish fiber-type fromdrug-types, although the intermediate will beincluded in drug-type.

The results of the developed multiplexPCR method were compared with those ofreference method (identification based onCBD/THC ratio). The comparison is sum-marized in Table 3. The relative accuracybetween the developed multiplex PCR andreference method for identification of hemp

types was 93%. This was similar to the resultsusing simplex PCR in previous reports [8,11].However, simplex PCR is rather costs andtime consuming. In contrast, for application,multiplex PCR with combination of primersis more convenient. Thus, a high capacity ofidentification of drug-type and fiber-type bymultiplex PCR markers was confirmed.Therefore, such markers are suitable in rulingout the presence of intermediate and drug-type from a breeding line in a mass screeningduring improvement of types under hempselection. Furthermore, it may be useful insurveillance of drug-type among industrialhemp cultivation in order to control theexpansion of narcotic plants.

Among 100 samples, there were 7 samples

Multiplex PCR F I D Total

F 32 5 0 37D 2 49 12 63

Total 34 54 12 100Relative accuracy = (32+49+12) × 100 = 93%

100

Table 3. The summarized comparison of identification of hemp types between the developedmultiplex PCR method and reference method.

Note: F, Fiber-type; D, Drug-type; I, Intermediate.

Reference method (based on CBD/THC ratio)

which showed discordant results obtainedfrom developed multiplex PCR method andthe reference method. The characteristics ofthese samples are presented in Table 4. Itwas not clear that what factor affected thediscordant results. However, when CBD/THC ratios was considered, 5 (H1, H8, H12,H22 and H74) out of 7 samples wereidentified to be intermediate. However, thesesamples were identified as fiber-type bymultiplex PCR. One reason may be bindingfailure of primers g and/or h on specificlocus. If any mutation occurs on the specific

locus in the THCA synthase gene, the primerspair may not match the binding site and maygive the negative results for drug-type marker[8]. To confirm the presence of such mutationin these hemp plants, the nucleotide sequenceof THCA synthase gene should be furtherinvestigated.

Recently, the identification of hemp typeshas been studied in 312 plants using CBD/THC ratio [4]. The results showed that all offiber-type plants had CBD/THC ratio > 10whereas intermediate had CBD/THC ratioin the range of 1.03-2.10. In this study, the

Chiang Mai J. Sci. 2011; 38(4) 617

rest two samples (H6 and H60) were identifiedto be fiber-type based on CBD/THC ratios.However, CBD/THC ratios of these sampleswere relatively low (3.05 and 3.49) and closeto 3.0 (the upper limit of CBD/THC ratiosfor intermediate). In contrast, most of otherfiber-type plants (28 out of 30) showed highCBD/THC ratios (>10 or not calculable).Therefore, H6 and H60 might be intermediateinstead of fiber-type. This reason could besupported by the results of multiplex PCRwhich showed drug-type identification inthese samples.

The specificity of the primer was alsodetermined. It was found that the nucleotidesequence of 700 bp amplified product was98% identity, compared with rbcL gene inCannabis genus submitted to GenBank.Furthermore, compared with THCA synthasegene in drug-type, 1.2 kb amplified productalso showed very high identity up to 99%.This result suggests that such primers are highspecific to Cannabis or hemp plants.

4. CONCLUSIONSAccording to the results, it appeared that

the multiplex PCR can be used to distinguishfiber-type from intermediate and drug-type.

This work illustrated that the developedmultiplex PCR is one of the accurate methodsfor identification of hemp type at molecularlevel, and can be used to rule out the presenceof intermediate and drug-type under hempselection. Furthermore, it may be useful insurveillance of drug-type cultivation amongindustrial hemp for the control of expansionof narcotic plants.

ACKNOWLEDGEMENTSThis work was supported by the Faculty

of Pharmacy, Chiang Mai University andRegional Medical Sciences Center 10. Theauthors would like to thank to the HighlandResearch and Development Institute (PublicOrganization) for donation of the samplesand Mrs. Prapatsorn Tipparat for THC andCBD contents analysis.

REFERENCES

[1] Hillig K.W. and Mahlberg P.G., AChemotaxonomic analysis of canna-binoid variation in Cannabis (Cannabaceae),Am. J. Bot., 2004; 91: 966-975.

[2] Hakki E.E., Kayis S.A., Pinarkara E. andSag A., Inter simple sequence repeatsseparate efficiently hemp from Marijuana

Code Variety Sex Sample type SeasonMultiplex

CBD/THC ratio Type PCR

H1 V50 Male Dry 2009 1.51 I F

H6 V50 Male Frozen fresh 2009 3.05 F D

H8 V50 Male Dry 2009 1.68 I F

H12 V50 Male Dry 2009 1.46 I F

H22 V50 Female Frozen fresh 2010 1.60 I F

H60 Mae Sa Mai Female Frozen fresh 2010 3.49 F D

H74 Houy Hoy Male Dry 2009 1.24 I F

Note: F, Fiber-type; D, Drug-type; I, Intermediate.

Table 4. The characteristics of the samples showed discordant results between the developedmultiplex PCR method and reference method.

Reference method

618 Chiang Mai J. Sci. 2011; 38(4)

(Cannabis sativa L.), J. Biotechnol., 2007; 10:570-581.

[3] Meijer de E.P.M., Bagatta M., Carboni A.,Crucitti P., Moliterni V.M.C., Ranalli P.and Mandolino G., The inheritance ofchemical phenotype in Cannabis sativa L.,Genetics, 2003; 163: 335-346.

[4] Pacifico D., Miselli F., Mecheler M.,Carboni A., Ranalli P. and Mandolino G.,Genetics and marker-assisted selection ofthe chemotype in Cannabis sativa L., Mol.Breeding, 2006; 17: 257-268.

[5] Forapani S., Carboni A., Paoletti C.,Moliteri C. and Ranalli P., Comparisonof hemp varieties using RandomAmplified Polymorphic DNA markers,Crop Sci., 2001; 41: 1682-1689.

[6] Zuardi A.W., Crippa J.A.S., Hallak J.E.C.,Moreira F.A. and Guimaraes F.S.,Cannabidiol, a Cannabis sativa constituent,as an antipsychotic drug, Braz. J. Med. Biol.Res., 2006; 39: 421-429.

[7] Taura F., Sirikantaramas S., Shoyama Y.,Yoshikai K., Shoyama Y. and MorimotoS., Cannabidiolic-acid synthase, thechemotype-determining enzyme in thefiber-type Cannabis sativa, FEBS. Letters,2007; 581: 2929-2934.

[8] Kallawicha K., Survey of Cannabis sativaL. Fiber Type Cultivated in Thailand, M.Sc.Thesis, Mahidol University, Thailand,2007.

[9] Gillan R., Cole M.D., Linacre A., ThorpeJ.W. and Watson N.D., Comparison ofCannabis sativa by Random Amplificationof Polymorphic DNA (RAPD) andHPLC of cannabinoids: a preliminarystudy, Sci. Justice, 1995; 35: 169-177.

[10] Chinaka S., Tanaka S., Takayama N. andUeda K., Analysis of cannabinoids byHPLC using a post-column reaction withfast blue B salt, Jpn. J. Sci. Tech. Iden., 2000;5: 17-22.

[11] Kojoma M., Seki H., Yoshida S. andMuranaka T., DNA polymorphisms inthe tetrahydrocannabinolic acid (THCA)synthase gene in “drug-type” and “fiber-type” Cannabis sativa L., Forensic Sci. Int.,2006; 159: 132-140.

[12] Sirikantaramas S., Morimoto S., ShoyamaY., Ishikawa Y., Wada Y., Shoyama Y. andTaura F., The gene controlling marijuanapsychoactivity, J. Biol. Chem., 2004; 279:39767-39774.

[13] Henegariu O., Heerema N.A., DlouhyS.R., Vance G.H. and Vogt P.H., MultiplexPCR: critical parameters and step-by-stepprotocol, Bio Techniques, 1997; 23: 504-511.

[14] Hasebe M., Omori T., Nakazawa M.,Sano T., Kato M. and Iwatsuki K., rbcLgene sequences provide evidence for theevolutionary lineages of Leptos-prangiate ferns, Proc. Natl. Acad. Sci.USA, 1994; 91: 5730-5734.

[15] United Nations, Recommended Methods forTesting Cannabis, New York, 1987.

[16] Chantratita W. and Lulitanond V.,Bioinformatics, 1st Edn., National Scienceand Technology Development Agency,Bangkok, 2001.

[17] Watanasiri S., Forensic Detection andDiscrimination of Cannabis Types, M.Sc.Thesis, Mahidol University, Thailand,2006.