1

1

Identification and elimination of the competing pathway towards N-acetyl 2

diaminopentane for improved production of diaminopentane by 3

Corynebacterium glutamicum 4

5

For publication in Applied Environmental Microbiology 6

7

Stefanie Kind1, Weol Kyu Jeong2, Hartwig Schröder2, Oskar Zelder2, and Christoph Wittmann1* 8

9

1 Institute of Biochemical Engineering, Technische Universität Braunschweig, Braunschweig, Germany 10

2 BASF SE, Fine Chemicals and Biotechnology, Ludwigshafen, Germany 11

12

* address of corresponding author: Biochemical Engineering Institute, Technische Universität 13

Braunschweig, Gaussstrasse 17, 38106 Braunschweig, Germany, +49-(0)531-391-7651, +49-(0)531-14

391-7652, e-mail: c.wittmann@tu-braunschweig.de. 15

16

17

18

19

Running title: Diaminopentane production in Corynebacterium glutamicum 20

Keywords: cadaverine, N-acetyltransferase, NCgl1469, systems metabolic engineering, 21

biobased polyamide 22

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.00834-10 AEM Accepts, published online ahead of print on 18 June 2010

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

2

Abstract 1

The present work describes the development of a superior strain of Corynebacterium 2

glutamicum for diaminopentane (cadaverine) production aiming at the identification and 3

deletion of the underlying unknown pathway towards N-acetyl-diaminopentane. This acetylated 4

product variant, recently discovered, is a highly undesired by-product with respect to carbon 5

yield and product purity. Initial studies with C. glutamicum DAP-3c, a previously derived tailor-6

made diaminopentane producer, showed that up to 20 % of the product occurs in the 7

unfavourable acetylated form. The strain revealed enzymatic activity for diaminopentane 8

acetylation requiring acetyl CoA as donor. Comparative transcriptome analysis of DAP-3c and 9

its parent strain did not reveal significant difference in the expression level of 17 potential 10

candidates annotated as N-acetyltransferases. Targeted single deletion of several of the 11

candidate genes unravelled NCgl1469 as responsible enzyme. NCgl1469 was functionally 12

assigned as diaminopentane acetyltransferase. The deletion strain, designated as C. 13

glutamicum DAP-4, exhibited a complete lack of N-acetyl-diaminopentane accumulation in the 14

medium. Hereby, the yield for diaminopentane was increased by 11 %. The mutant strain 15

allowed the production of diaminopentane as sole product. The deletion did not cause any 16

negative growth effects, since specific growth rate and glucose uptake rate remained 17

unchanged. The identification and elimination of the responsible acetyltransferase gene, as 18

presented here, displays a key contribution towards a superior C. glutamicum strain for 19

diaminopentane as future building block for bio-based polyamides. 20

21

22

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

3

Introduction 1

Polyamides are polymers containing monomers joined by peptide bonds, examples being 2

nylons, aramids, or polyaspartate. They are commonly used in textiles, automotives, carpet 3

and sportswear due to their extreme durability and strength. The most prominent products, the 4

polyamides PA 6 and PA 6.6 have an annual market volume of about 6 million tons. Currently, 5

polyamides are derived via chemical routes from fossil raw materials. Due to the shortage of 6

these resources and problems of escalating CO2 production and global warming linked to the 7

underlying processes, bio-based production from renewable resources arise as promising 8

alternative (11, 23, 27). In this context, fermentative production of diaminopentane 9

(cadaverine) as a monomer building block for polyamides has recently come into focus (19). 10

Using diaminopentane derived from microbial biosynthesis, polymerization with appropriate 11

bio-blocks such as succinate (9, 22) provides completely bio-based products. Moreover, 12

polyamides based on diaminopentane, reveal excellent material properties (7). The experience 13

of the past clearly shows that a superior production strain with high yield, productivity and titer 14

requires substantial modification at different key points of the metabolism, which have to be 15

identified by careful investigation of the underlying metabolism (28). The major targets typically 16

comprise the elimination of by-products, the optimization of precursor or cofactor supply, the 17

optimization of product export and the release from undesired regulatory phenomena. From a 18

metabolic viewpoint, diaminopentane is formed directly from lysine by decarboxylation, 19

meaning that Corynebacterium glutamicum, which produces more than 1,000,000 metric tons 20

of L-lysine per year, is a promising production organism. In a first proof of principle, a C. 21

glutamicum wild type was modified by replacing homoserine dehydrogenase with heterologous 22

lysine decarboxylase (cadA) from E. coli (19, 24). The yield of diaminopentane was, however, 23

rather low, underlining that this modification can only be a first step towards a competitive 24

industrial strain. 25

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

4

A milestone towards efficient diaminopentane production was the recent development of a 1

tailor-made production strain of C. glutamicum with genetic optimization of the lysine pathway 2

and the supply of the major precursor oxaloacetate (13). Through systematic analysis of this 3

mutant, N-acetyl diaminopentane was discovered as so far unknown by-product. N-acetyl 4

diaminopentane was secreted by all examined production strains, whereby its concentration 5

was up to 20 % of that of the desired product diaminopentane. The formation of this acetylated 6

by-product is highly undesirable with respect to a high diaminopentane yield with minimized 7

carbon loss into other metabolites and also to product purity, for subsequent polymerization, 8

where high-grade monomers are required. From a metabolic perspective the elimination of the 9

underlying pathway appears crucial. Unfortunately, the enzyme responsible for acetylation of 10

diaminopentane is not known, requiring its identification prior to a rational genetic engineering 11

strategy. This is, however, complicated by the fact that a large number of candidates have to 12

be considered. In the genome of C. glutamicum about 20 different genes are annotated as 13

proteins with acetyltransferase activity. Among these, members of the class of GCN5-related 14

N-acetyltransferases (GNAT) have the common feature that they transfer an acetyl group from 15

acetyl-Coenzyme-A as donor to a primary amino group of small molecules or proteins (8, 20, 16

21, 25, 29). In this regard, the present work describes a detailed study towards a superior 17

diaminopentane producing strain aiming at deletion of the competing pathway to N-acetyl-18

diaminopentane. This included the characterisation of the enzymatic reaction involved, the 19

identification of the corresponding gene by systems-level profiling, followed by targeted 20

deletion of the corresponding gene and investigation of the obtained mutant. 21

22

23

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

5

Materials and Methods 1

Strains and plasmids. Strains used in the present work comprised the wild type 2

Corynebacterium glutamicum ATCC 13032 (ATCC, Manassas, USA), the lysine producer C. 3

glutamicum 11424, exhibiting different modifications of the lysine biosynthetic pathway and 4

anaplerotic carboxylation (2), and the diaminopentane-producer C. glutamicum DAP-3c, 5

rationally derived from C. glutamicum 11424 by codon optimized expression of lysine 6

decarboxylase (13). For genetic engineering work, Escherichia coli strains DH5α and NM522 7

as well as plasmids pTc and pClik int sacB were applied as described previously (13). 8

9

Cultivation and growth conditions. Cultivation was performed as described previously (Kind 10

et al. 2010). First pre-culture was grown in complex medium. For the second pre-culture and 11

main culture, a minimal medium was applied (Becker et al. 2009, Kind et al. 2010). The 12

medium for culture of the strains with the episomal replicating plasmid pClik 5a MCS ldcC 13

additionally contained 25 µg mL-1 kanamycin. 14

15

Chemicals. Tryptone, beef extract, yeast extract and agar were obtained from Difco 16

Laboratories (Detroit, USA). All other chemicals were of analytical grade and obtained from 17

Aldrich (Steinheim, Germany), Merck (Darmstadt, Germany) or Fluka (Buchs, Switzerland). 18

19

Recombinant DNA techniques. Construction, purification and analysis of plasmid DNA, 20

transformation of E. coli and C. glutamicum were performed as described previously (Kind et 21

al. 2010) 22

23

Targeted gene deletion. The targeted deletion of genes was carried out as described 24

previously (Kind et al. 2010), using the corresponding integrative plasmid which cannot 25

replicate in C. glutamicum (1, 3, 4). Genes were deleted by replacement of the coding region 26

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

6

with a shortened gene fragment. The primers used for verification of the genetic changes are 1

listed in Table 1. 2

3

Analysis of substrates and products. Concentration of glucose was quantified in 1:10-4

diluted cultivation supernatant by a glucose analyzer (2300 STAT Plus, Yellow Springs 5

Instrument, Ohio). Determination of cell concentration was performed as described previously 6

(12). Amino acid quantification was carried out by HPLC (14). The same method was adapted 7

by a modified gradient for quantification of biological polyamines including 1,5-iaminopentane, 8

1,4-diaminobutane, 1,3-diaminopropane and N-acetyl-1,5-diaminopentane. 9

10

RNA extraction. For total RNA extraction, exponentially growing cells (1.5 mg cell dry mass) 11

were harvested by centrifugation (13000 x g, 30 s, room temperature). The cell pellet was 12

flash-frozen in liquid nitrogen and kept at -80 °C until further processing. Frozen cells were 13

thawed on ice, re-suspended in 1 mL lysis buffer (4 M guanidinium thiocyanate, 150 mM 14

sodium acetate (pH 5.2) 18.5 mM N-lauroylsarcosinate), mixed with 600 mg soda-lime-glass 15

(0.045 – 0.038 mm, precision glass beads, Worf Glaskugeln, Mainz, Germany) and then 16

mechanically disrupted (4 °C, 2 x 60 s, 6.5 m/s) using FastPrep-24 (MP Biomedicals, Solon, 17

USA). After removal of cell debris by centrifugation (13000 x g, 1 min, 4 °C), the supernatant 18

was mixed vigorously with 1 mL acid phenol solution (aqua-phenol:chloroform:isoamylalcohol 19

50:48:2) for 30 s. After centrifugation (13000 x g, 5 min, RT), the upper phase was transferred 20

into 1 mL chloroform:isoamylalcohol (48:2) followed by mixing and centrifugation (5 min, 13000 21

x g, room temperature). The upper phase (700 µL) was mixed with 70 µL 3 M sodium acetate 22

(pH 5.2) and 1 mL 100 % isopropanol and incubated for 1 h at -80 °C. After centrifugation 23

(13000 x g, 15 min, room temperature), the pellet was resolved in 180 µL RNA storage buffer 24

(20 mM sodium phosphate, 1 mM EDTA). For DNA digestion, 20 µL 10x DNase buffer (200 25

mM sodium acetate, 100 mM MgCl2, 100 mM NaCl) and DNase (30 U; Invitrogen, Karlsruhe, 26

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

7

Germany) were added. Subsequently, RNA was purified (innuPREP-RNA kit, Analytik Jena, 1

Jena, Germany). Quality control and quantification of RNA was performed using the RNA 6000 2

nano-labchip kit and the bioanalyzer 2100 (Agilent, Santa Clara, USA). As quality measure, all 3

samples had to pass a 23S/16S ratio higher than 1.5 and a RNA integrity number (RIN) 4

between 9.4 and 10. 5

6

Gene expression analysis. The comparative analysis of gene expression was carried out 7

using DNA microarrays after extraction of total RNA from growing cultures of C. glutamicum, 8

followed by fluorescence labelling and fragmentation. First, a DNA microarray for gene 9

expression analysis was designed from the C. glutamicum genome NC_006958 as a custom 10

array using the online software Agilent eArray (www.chem.agilent.com). The set of 11

oligonucleotide probes for the genes of interest was designed using the following parameters: 12

(i) 60 bp probe length, (ii) 5 probes per gene, (iii) antisense probe orientation and (iv) 80 °C 13

preferred probe temperature of melting. Fluorescence labelled RNA of C. glutamicum was 14

prepared by direct chemical labelling of 1 µg native mRNA using the ULS fluorescent labelling 15

kit (Kreatech Diagnostics, Amsterdam, Netherlands) following the manufacturer’s protocol. 16

After removal of free ULS label using KREApure columns (Kreatech Diagnostics, Amsterdam, 17

Netherlands), the degree of labelling was measured with a NanoDrop-1000 UV/Vis spectral 18

photometer (peqlab, Erlangen, Germany). Afterwards, 300 ng of RNA labelled with Cy3 and 19

Cy5, respectively, was pooled and fragmented in blocking agent and fragmentation buffer 20

(Agilent, Santa Clara, USA) for 30 minutes at 60 °C (Kreatech Diagnostics, Amsterdam, 21

Netherlands). For competitive hybridization, equivalent amounts of RNA from the two samples 22

to be compared were diluted in 25 µl hybridization buffer (Agilent, Santa Clara, USA). Out of 23

the total volume of 50 µl, 40 µl of each solution were added onto one array, and then 24

hybridized at 65 °C and 10 rpm for 17 h in a dedicated DNA microarray hybridisation oven 25

(Agilent, Santa Clara, USA). The slide was washed in washing buffer 1 (Agilent, Santa Clara, 26

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

8

USA) for 1 minute with washing buffer 2 (Agilent, Santa Clara, USA), dried and scanned using 1

the GenePix 4100A scanner (Axon Instruments, Sunnyvale, USA) at 532 nm and 635 nm. Data 2

processing was carried out by the software GeneSpring 10 from SiliconGenetics (Agilent, 3

Santa Clara, USA). To identify statistically significant gene expression changes, the two-4

sample t-test was used. 5

6

Analysis of acetyltransferase activity. The activity of diaminopentane acetyltransferase was 7

determined in crude cell extract which was prepared from cells grown in minimal medium as 8

described above. Preparation of crude cell extract using 50 mM Tris-HCl-buffer, pH 7.8 and 9

0.75 mM DTT as disruption buffer, and determination of protein concentration (6) were 10

performed as described previously (Becker et al. 2009, Kind et al. 2010). Assays were 11

performed in a total volume of 1 mL containing 50 mM Tris-HCl-buffer (pH 7.8), 0.25 mM 12

acetyl-Coenzyme A (acetyl-coA) and 200 µl cell extract at 30 °C. As substrate, 5 mM 1,5-13

diaminopentane, 1,4-diaminobutane or 1,3-diaminopropane, respectively, were applied. The 14

diamine and acetyl-Coenzyme A were dissolved in 50 mM Tris-HCl-buffer (pH 7.8). The final 15

protein concentration in the assay was in the range of 0.15 to 0.22 mg mL-1. In parallel 16

incubations, the reaction was stopped at a particular time (after 0, 2.5, 5 and 20 min) by 17

heating the reaction mixture at 100 °C for 10 minutes. Subsequently, the formed N-acetyl 18

diaminopentane concentration was measured with HPLC and plotted against the stop time of 19

the reaction. The slope of the linear increase was used for calculation of acetyltransferase 20

activity. Negative controls were carried out without substrate. One unit of acetyltransferase 21

activity was defined as the amount of enzyme that formed 1 µmol of acetylated product per 22

min at 30 °C. 23

24

Results 25

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

9

Metabolic properties of diaminopentane producing C. glutamicum DAP-3c. On minimal 1

medium with glucose as sole carbon source C. glutamicum DAP-3c secreted diaminopentane 2

and N-acetyl diaminopentane during the whole cultivation (Figure 1 A). Thus, 20 % of the total 3

product was present in the undesired acetylated form. The strain grew exponentially exhibiting 4

a specific growth rate of 0.25 h-1 (Figure 1 B). The wild type and the parent lysine-producing 5

strain C. glutamicum 11424 did not accumulate diaminopentane or N-acetyl diaminopentane 6

(data not shown). 7

8

Enzymatic activity catalyzing diaminopentane acetylation. C. glutamicum DAP-3c revealed 9

enzymatic activity for the acetylation of diaminopentane (Table 2). Boiled cell extract did not 10

catalyze this reaction. The conversion required acetyl-CoA as donor of the acetyl group. Based 11

on these results, the next steps focussed on the search for trans-acetylating enzymes utilizing 12

acetyl-CoA as co-substrate. The genome of C. glutamicum was thus screened for genes 13

encoding N-acetyltransferases as potential candidates. Overall, seventeen N-14

acetyltransferases were found, including different members of the GNAT super family. 15

16

Gene expression analysis of acetyltransferases. To identify the responsible gene out of the 17

predicted N-acetyltransferase genes, their expression was compared between the non-18

producing parent strain C. glutamicum 11424 and C. glutamicum DAP-3c, producing 19

diaminopentane and the acetylated variant. This however, did not reveal a statistically 20

significant difference in the expression level of any of the candidates (Figure 2). Based on this 21

finding, it seemed likely that the observed acetylation of diaminopentane was covered by a 22

constitutively expressed enzyme, probably as side activity in addition to its natural function in 23

the cell. 24

25

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

10

Targeted deletion of acetyltransferase candidates in diaminopentane producing C. 1

glutamicum. Due to the fact that gene expression analysis did not provide clear evidence for 2

the gene responsible for acetylation of diaminopentane, a targeted deletion of the candidates 3

encoding for N-acetyltransferases in the genome of C. glutamicum was carried out. It was 4

expected that a strain, lacking the gene encoding the responsible diaminopentane acetylating 5

enzyme, will exhibit at least reduced formation of the acetylated variant. In a first genetic 6

engineering round, six targets were selected. For this purpose, recombinant plasmids, which 7

allow a marker-free replacement of the target gene by a shortened gene fragment, were 8

constructed. These were utilized to delete the genes NCgl0848, NCgl1208, NCgl1469, 9

NCgl1614, NCgl2090 and NCgl2487, each encoding one of the annotated N-10

acetyltransferases in C. glutamicum DAP-3c. 11

12

Physiological properties of acetyltransferase deletion strains. All constructed mutants 13

were found viable, so that obviously no essential gene was among the chosen candidates. The 14

corresponding strains, C. glutamicum ∆act1 to ∆act6, were validated for the deletion by site 15

specific PCR. In all cases the mutant strain revealed a shortened PCR fragment as compared 16

to the parent strain, which verified the corresponding targeted gene deletion (data not shown). 17

Subsequently the mutants were cultivated in minimal medium on glucose, followed by analysis 18

of the products formed (Table 3). Five mutants revealed an unchanged product spectrum. 19

Here, the deletion of the corresponding acetyltransferase did not reduce the undesired 20

conversion. In the culture supernatant C. glutamicum ∆act3, however, the level of N-acetyl-21

diaminopentane was below the detection limit (< 0.1 µM). Diaminopentane secretion was even 22

enhanced in this strain. Obviously, the deleted gene NCgl1469, specifically catalyzed the 23

undesired reaction. Through deletion of this gene, the in vitro activity of diaminopentane 24

acetylation was completely eliminated (Table 2). This underlines that exclusively this enzyme 25

was responsible for the undesired reaction. In contrast to diaminopentane, 1,4-diaminobutane 26

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

11

(putrescine) and 1,3-diaminopropane were not utilized as substrate (Table. 2). The promising 1

deletion strain C. glutamicum ∆act3 was designated as C. glutamicum DAP-4 and studied in 2

detail concerning its production performance. 3

4

Production performance of C. glutamicum DAP-4. Cultivation of C. glutamicum DAP-4 was 5

performed in minimal medium with glucose as sole carbon source (Figure 1 C). The secretion 6

of N-acetyl-diaminopentane and of lysine was negligible. The diaminopentane yield (223 mmol 7

mol glucose)-1 was 11 % higher as compared to that of the parent strain DAP-3c (Table 4), 8

indicating the available carbon from elimination of the by-product was, at least partly, 9

channelled into diaminopentane. The specific growth rate was rather similar in DAP-3c (0.25 h-10

1) and in DAP-4 (0.26 h-1) (Figures 1 B, D). The specific glucose uptake rate was even slightly 11

enhanced as response to the deletion. 12

13

Discussion 14

The production of the monomer building block diaminopentane by C. glutamicum strains with 15

an extended lysine pathway in is one of the most promising biotechnological developments 16

towards bio-based polyamides. Clearly, high-yield and high-selectivity conversion of the raw 17

material into diaminopentane is a crucial prerequisite to establish a competitive process. The 18

diaminopentane yield of first generation mutants in important pioneering studies, 19

overexpressing lysine decarboxylase, was, however, rather low, underlining that this 20

modification can only be a first step (19). In addition to a substantially increased product yield, 21

systems metabolic engineering towards a tailor-made production strain of C. glutamicum 22

recently discovered N-acetyl-diaminopentane, a previously unknown side product of 23

recombinant diaminopentane producers (13). This study further showed that accumulation of 24

N-acetyl-diaminopentane is significant, meaning that every fifth diaminopentane molecule is 25

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

12

acetylated prior to secretion. In this regard, the identification and elimination of the responsible 1

acetyltransferases gene, as presented here, displays a key contribution towards a superior C. 2

glutamicum strain for diaminopentane. The encoding gene NCgl1469 is so far assigned as 3

histone acetyltransferase HPA2 and related acetyltransferase or as . Based on the present 4

findings we propose a functional assignment as diaminopentane acetyltransferase. 5

6

The obtained mutant, C. glutamicum DAP-4 secreted only the target product (Figure 1B). The 7

accumulation of N-acetyl-diaminopentane could be completely avoided by the deletion of 8

diaminopentane acetyltransferase (NCgl1469). First, this resulted in a yield increase by 11 %, 9

allowing a more efficient conversion of the sugar into the desired product (Table 4). Moreover, 10

the created mutant strain appears advantageous with respect to a facilitated down-stream 11

process. The subsequent usage of diaminopentane as polymer building block poses high 12

demand to the product purity, much higher as compared to applications e.g. of lysine in the 13

feed market. N-acetyl-diaminopentane is similar to the product and therefore difficult to be 14

separated, so that its elimination facilitates product purification and provides a further benefit 15

with regard to production costs. It is important to note, that C. glutamicum DAP-4 also did not 16

secrete lysine, so that diaminopentane could be obtained by-product free. Convincingly, the 17

deletion of diaminopentane acetyltransferase did not cause negative effects on strain 18

physiology being reflected e.g. by maintained growth rate or substrate uptake rate (Table 4). 19

20

So far only very little is known about the function of NGcl1469 in C. glutamicum which probably 21

comprises more than the catalytic activity observed here. The enzyme did react with 1,5-22

diaminopentane, but not with other diamines such as 1,4-diaminobutane (putrescine) or 1,3-23

diaminopropane. The encoding gene was found constitutively expressed and non-essential for 24

growth under the conditions chosen. In C. glutamicum, it is activated upon deletion of lexA, the 25

key repressor of the SOS repair pathway against DNA damage (10), but its role here has not 26

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

13

been elucidated. Generally, the hundreds of N-acetyltransferases existing show substantial 1

functional diversity with a broad substrate range from small molecules to proteins including 2

self-acetylation (5, 17, 18). In eukaryotes, they regulate gene expression via acetylation of 3

lysine residues in histones (16). Among bacteria, they are prevalent in aminoglycoside-4

resistant clinical strains, catalyzing detoxification of the drugs via regioselective N-acetylation 5

(25). In addition they play a variety of anabolic and catabolic roles, e. g. in the biosynthesis of 6

UDP-N-acetylglucosamine, an essential compound in prokaryotes and eukaryotes or the 7

acetylation of polyamines targeting them for export out of the cell or degradation (8). 8

9

In summary, the obtained production strain C. glutamicum DAP-4 displays a next important 10

step towards an industrially attractive cell factory. The metabolic properties of the mutants 11

created here, suggest promising strategies for further improvement. One relevant target 12

emerges from the fact that the excess carbon from elimination of N-acetyl-diaminopentane 13

production could only be partially directed towards diaminopentane. Probably this relates to a 14

limited export of diaminopentane, as similarly observed for lysine production in C. glutamicum 15

(26), so that the identification and subsequent overexpression of the unknown diaminopentane 16

export protein displays a further possibility to optimize production. Due to the structural 17

similarity of lysine and diaminopentane, the lysine exporter lysE might be an interesting 18

candidate. 19

20

Acknowledgements 21

We gratefully acknowledge support by the BMBF-Grant “Biobased Polyamides through 22

Fermentation” (No 0315239A) funding our research in a consortium with the companies BASF 23

SE, Daimler AG, Fischerwerke GmbH and Robert Bosch GmbH within the initiative 24

Bioindustry21. Stefanie Kind acknowledges financial support by the Max-Buchner Research 25

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

14

Foundation (MBFSt 2816). We further thank Andrea Michel for support in genetic engineering 1

work. 2

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

15

Literature 1

1. Becker, J., C. Klopprogge, A. Herold, O. Zelder, C. J. Bolten, and C. Wittmann. 2 2007. Metabolic flux engineering of L-lysine production in Corynebacterium glutamicum-3 over expression and modification of G6P dehydrogenase. J Biotechnol 132:99-109. 4

2. Becker, J., C. Klopprogge, H. Schröder, and C. Wittmann. 2009. Tricarboxylic acid 5 cycle engineering for improved lysine production in Corynebacterium glutamicum. Appl 6 Environ Microbiol 75:7866-7869. 7

3. Becker, J., C. Klopprogge, and C. Wittmann. 2008. Metabolic responses to pyruvate 8 kinase deletion in lysine producing Corynebacterium glutamicum. Microb Cell Fact 7:8. 9

4. Becker, J., C. Klopprogge, O. Zelder, E. Heinzle, and C. Wittmann. 2005. Amplified 10 Expression of Fructose 1,6-bisphosphatase in Corynebacterium glutamicum increases 11 in vivo flux through the pentose phosphate pathway and lysine production on different 12 carbon sources. Appl Environ Microbiol 71:8587–8596. 13

5. Blankenship, J., and T. Walle. 1977. Acetylation of spermidine and spermine by rat 14 liver and kidney chromatin. Arch Biochem Biophys 179:235-42. 15

6. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram 16 quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-17 54. 18

7. Carothers, W. H. 1938. Linear polyamides and their production US. 19 8. Dyda, F., D. C. Klein, and A. B. Hickman. 2000. GCN5-related N-acetyltransferases: a 20

structural overview. Annu Rev Biophys Biomol Struct 29:81-103. 21 9. Hong, S. H., J. S. Kim, S. Y. Lee, Y. H. In, S. S. Choi, J. K. Rih, C. H. Kim, H. Jeong, 22

C. G. Hur, and J. J. Kim. 2004. The genome sequence of the capnophilic rumen 23 bacterium Mannheimia succiniciproducens. Nat Biotechnol 22:1275-81. 24

10. Jochmann, N., A. K. Kurze, L. F. Czaja, K. Brinkrolf, I. Brune, A. T. Huser, N. 25 Hansmeier, A. Puhler, I. Borovok, and A. Tauch. 2009. Genetic makeup of the 26 Corynebacterium glutamicum LexA regulon deduced from comparative transcriptomics 27 and in vitro DNA band shift assays. Microbiology 155:1459-77. 28

11. Kaltenbach, H. M., A. Wilke, and S. Bocker. 2007. SAMPI: protein identification with 29 mass spectra alignments. BMC Bioinformatics 8:102. 30

12. Kiefer, P., E. Heinzle, O. Zelder, and C. Wittmann. 2004. Comparative metabolic flux 31 analysis of lysine-producing Corynebacterium glutamicum cultured on glucose or 32 fructose. Appl Environ Microbiol 70:229-39. 33

13. Kind, S., W. K. Jeong, H. Schröder, and C. Wittmann. 2010. Systems-wide metabolic 34 pathway engineering in Corynebacterium glutamicum for bio-based production of 35 diaminopentane. Metab Eng in press. 36

14. Krömer, J. O., M. Fritz, E. Heinzle, and C. Wittmann. 2005. In vivo quantification of 37 intracellular amino acids and intermediates of the methionine pathway in 38 Corynebacterium glutamicum. Anal Biochem 340:171-3. 39

15. Krömer, J. O., E. Heinzle, H. Schröder, and C. Wittmann. 2006. Accumulation of 40 homolanthionine and activation of a novel pathway for isoleucine biosynthesis in 41 Corynebacterium glutamicum McbR deletion strains. J Bacteriol 188:609-18. 42

16. Kuo, M. H., and C. D. Allis. 1998. Roles of histone acetyltransferases and 43 deacetylases in gene regulation. Bioessays 20:615-26. 44

17. Libby, P. R. 1978. Calf liver nuclear N-acetyltransferases. Purification and properties of 45 two enzymes with both spermidine acetyltransferase and histone acetyltransferase 46 activities. J Biol Chem 253:233-7. 47

18. Libby, P. R. 1980. Rat liver nuclear N-acetyltransferases: separation of two enzymes 48 with both histone and spermidine acetyltransferase activity. Arch Biochem Biophys 49 203:384-9. 50

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

16

19. Mimitsuka, T., H. Sawai, M. Hatsu, and K. Yamada. 2007. Metabolic engineering of 1 Corynebacterium glutamicum for cadaverine fermentation. Biosci Biotechnol Biochem 2 71:2130-5. 3

20. Mio, T., T. Yamada-Okabe, M. Arisawa, and H. Yamada-Okabe. 1999. 4 Saccharomyces cerevisiae GNA1, an essential gene encoding a novel acetyltransferase 5 involved in UDP-N-acetylglucosamine synthesis. J Biol Chem 274:424-9. 6

21. Neuwald, A. F., and D. Landsman. 1997. GCN5-related histone N-acetyltransferases 7 belong to a diverse superfamily that includes the yeast SPT10 protein. Trends Biochem 8 Sci 22:154-5. 9

22. Oh, I. J., D. H. Kim, E. K. Oh, S. Y. Lee, and J. Lee. 2009. Optimization and scale-up 10 of succinic acid production by Mannheimia succiniciproducens LPK7. J Microbiol 11 Biotechnol 19:167-71. 12

23. Steinbüchel, A. 2005. Non-biodegradable biopolymers from renewable resources: 13 perspectives and impacts. Curr Opin Biotechnol 16:607-13. 14

24. Tateno, T., Y. Okada, T. Tsuchidate, T. Tanaka, H. Fukuda, and A. Kondo. 2009. 15 Direct production of cadaverine from soluble starch using Corynebacterium glutamicum 16 coexpressing alpha-amylase and lysine decarboxylase. Appl Microbiol Biotechnol 17 82:115-21. 18

25. Vetting, M. W., S. Magnet, E. Nieves, S. L. Roderick, and J. S. Blanchard. 2004. A 19 bacterial acetyltransferase capable of regioselective N-acetylation of antibiotics and 20 histones. Chem Biol 11:565-73. 21

26. Vrljic, M., H. Sahm, and L. Eggeling. 1996. A new type of transporter with a new type 22 of cellular function: L-lysine export from Corynebacterium glutamicum. Mol Microbiol 23 22:815-26. 24

27. Willke, T., and K. D. Vorlop. 2004. Industrial bioconversion of renewable resources as 25 an alternative to conventional chemistry. Appl Microbiol Biotechnol 66:131-42. 26

28. Wittmann, C. 2010. Analysis and Engineering of Metabolic Pathway Fluxes in 27 Corynebacterium glutamicum. Adv Biochem Eng:in press. . 28

29. Wolf, E., A. Vassilev, Y. Makino, A. Sali, Y. Nakatani, and S. K. Burley. 1998. Crystal 29 structure of a GCN5-related N-acetyltransferase: Serratia marcescens aminoglycoside 30 3-N-acetyltransferase. Cell 94:439-49. 31

32 33

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

17

Figure legends 1 2

Figure 1: Physiological characteristics of diaminopentane producing C. glutamicum DAP-3c 3

(A, B) and DAP-4 (C, D) in batch culture on glucose. The linear correlation between growth, 4

production of lysine, diaminopentane (DAP), N-acetyl diaminopentane (N-Ac-DAP) and 5

consumption of glucose indicates metabolic steady-state during the cultivation. The data 6

represent values from three biological replicates for each strain. 7

8

Figure 2: Comparative expression analysis of selected genes, functionally annotated as N-9

acetyltransferase, in the lysine producing strain C. glutamicum 11424 and the diaminopentane 10

producing strain C. glutamicum DAP-3c. The data are given as ratio of expression of 11424 11

versus DAP-3c. The chosen cut-off for a significantly different expression ratio is indicated by 12

the dashed areas. The data originate from at least four biological replicates for each strain. 13

14

15

16

17

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

18

Table 1. Deletion of selected genes, potentially encoding diaminopentane acetylation, in the 1

rationally derived diaminopentane producer C. glutamicum DAP-3c: Constructed mutants, 2

corresponding gene identification and site-specific primer sequences used for the construction 3

(1-4) of each deletion vector and for the verification of each deletion (1,4) by PCR. 4

Strain Designation

Deleted Gene ID

Forward (F) and Reverse (R) Primer Sequences

∆act1 NCgl0848

act1-1: 5’-CCCACTCGAGAACACGTAGAGATCATCG-3’

act1-2: 5’-CCATTCATCGTTGGTGATGGGTCCACTGATGTGACAGTGG-3’

act1-3: 5’-CCACTGTCACATCAGTGGACCCATCACCAACGATGAATGG-3’

act1-4: 5’-GCATACTAGTGCAGATGATGTCACGTCAGC-3’

∆act2 NCgl1208

act2-1: 5’- TGGTGTTCCTGGAAGTCCTC -3’

act2-2: 5’-CAGAGTCAACGCAAACGGTCCATTTTGTGGCATTGCTGGC-3’

act2-3: 5’-GCCAGCAATGCCACAAAATGGACCGTTTGCGTTGACTCTG-3’

act2-4: 5’- CCAGGTTCTCAACGAGCTAG -3’

∆act3 NCgl1469

act3-1: 5’-GCTCCTCGAGGCATTGTATACTGCGACCACT-3’

act3-2: 5’-CGATTCCGTGATTAAGAAGCGCTTCAACCAGAACATCGAC-3’

act3-3: 5’-GTCGATGTTCTGGTTGAAGCGCTTCTTAATCACGGAATCG-3’

act3-4: 5’-CGGTACTAGTGTAGTGAGCCAAGACATGG-3’

∆act4 NCgl1614

act4-1: 5’-TTGTCTCGAGCGTAGGCTTCATGGTCTTGG-3’

act4-2: 5’-GCTCGTACAACGAAACATTGCCCAAGGATAGGAAACAAAGG-3’

act4-3: 5’-CCTTTGTTTCCTATCCTTGGGCAATGTTTCGTTGTACGAGC-3’

act4-4: 5’-TGGCACTAGTGAACATCGAGCTCGCTAGAAG-3’

∆act5 NCgl2090

act5-1: 5’-ACCGACTAGTGACTGAACTATGCCTCTGAG-3’

act5-2: 5’-GTGTTGGTGGATATCTACATCGTCACTGACTTGCTCAGGCAG-3’

act5-3: 5’-CTGCCTGAGCAAGTCAGTGACGATGTAGATATCCACCAACAC-3’

act5-4: 5’-CCAAAACAGTCTGGTTAACTAC-3’

∆act6 NCgl2487

act6-1: 5’-ATCCCTCGAGACTTCCACGCTTTCTAC-3’

act6-2: 5’-GAGTGTTGCCAGCTTCCACCCTCCTTCAAAAGCAATAGTGC-3’

act6-3: 5’-GCACTATTGCTTTTGAAGGAGGGTGGAAGCTGGCAACACTC-3’

act6-4: 3’-AGGATCTAGAATCAGACTCATTGGAGTCG-3’

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

19

Table 2. Specific in vitro activity of diaminopentane acetyltransferase (NGcl1469) in the diaminopentane producing strains C. 1

glutamicum DAP-3c and C. glutamicum DAP-4. The data comprise mean value and standard deviation from three replicates with 2

corresponding deviations. 3

4

Substrate

Addition of

Acetyl coenzyme A Strain

Specific Activity

[mU mg-1]

1,5-diaminopentane + DAP-3c 38.12 ± 0.53

1,5-diaminopentane - DAP-3c < 0.01 ± 0.00

1,5-diaminopentane + DAP-4 < 0.01 ± 0.00

1,5-diaminopentane - DAP-4 < 0.01 ± 0.00

1,4-diaminobutane + DAP-3c < 0.01 ± 0.00

1,4-diaminobutane + DAP-4 < 0.01 ± 0.00

1,3-diaminopropane + DAP-3c < 0.01 ± 0.00

1,3-diaminopropane + DAP-4 < 0.01 ± 0.00

5

6

7

8

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

20

Table 3. Product spectrum of acetyltransferase deletion strains after 24 h on minimal glucose 1

medium. The strains were constructed on basis of the diaminopentane producer C. glutamicum 2

DAP-3c. 3

4

Mutant

Strain Diaminopentane

N-Acetyl

Diaminopentane

Lysine

∆act1 ++ + -

∆act2 ++ + -

∆act3 +++ - -

∆act4 ++ + -

∆act5 ++ + -

∆act6 ++ + -

5

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

21

Table 4. Growth and production characteristics of diaminopentane producing C. glutamicum DAP-3c and DAP-4 in minimal medium 1

with glucose as sole carbon source. 2

3

Strain

µ

h-1

YDap/S

mmol mol-1

YN-Ace-Dap/S

mmol mol-1

YLys/S

mmol mol-1

YX/S

g mol-1

qS

mmol g-1 h-1

DAP-3c 0.25 ± 0.00 200 ± 5 52 ± 3 2 ± 0 64.2 ± 0.8 4.2 ± 0.1

DAP-4 0.26 ± 0.01 223 ± 6 < 0.1 1 ± 0 60.3 ± 0.2 4.4 ± 0.1

4

The data given comprise specific growth rate (µ), specific glucose uptake rate (qS) yield (Y) for diaminopentane (YDap/S), N-acetyl 5

diaminopentane (YN-Ace-Dap/S), lysine (YLys/S) and biomass (YX/S). The yields were determined as slope of the linear fit between biomass 6

or product formation, respectively, and substrate consumption (compare Figure 1). The values given here represent mean values 7

from three parallel cultivation experiments with corresponding deviations. 8

9

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

on June 15, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from