Euphytica (2006) 149: 179–187

DOI: 10.1007/s10681-005-9065-4 C© Springer 2006

Identification and characterization of RAPD and SCAR markers linkedto anthracnose resistance gene in sorghum [Sorghum bicolor (L.) Moench]

Monika Singh1,∗, K. Chaudhary1, H.R. Singal2, C.W. Magill3 & K.S. Boora1

1Department of Biotechnology and Molecular Biology, CCS Haryana Agricultural University, Hisar 125 004,Haryana, India; 2Department of Biochemistry, CCS Haryana Agricultural University, Hisar 125 004, Haryana,India; 3Department of Plant Pathology and Microbiology, Texas A & M University, College Station, USA(∗author for correspondence: e-mail: monika a singh@rediffmail.com)

Received 10 July 2005; accepted 22 November 2005

Key words: anthracnose resistance, gene cloning, gene tagging, RAPD, sorghum, sequencing, SCAR markers

Summary

Anthracnose, one of the destructive foliar diseases of sorghum growing in warm humid regions, is incited bythe fungus Colletotrichum graminicola. The inheritance of anthracnose resistance was studied using the parentalcultivars of Sorghum bicolor (L.) Moench, HC 136 (susceptible to anthracnose) and G 73 (anthracnose resistant).The F1 and F2 plants were inoculated with the local isolates of C. graminicola cultures. The F2 plants showed asegregation ratio of 3 (susceptible): 1(resistant) indicating that the locus for resistance to anthracnose in sorghumaccession G 73 segregates as a recessive trait in a cross to susceptible cultivar HC 136. RAPD (random amplifiedpolymorphic DNA) marker OPJ 011437 was identified as marker closely linked to anthracnose resistance gene insorghum by bulked segregant analysis of HC 136×G 73 derived recombinant inbred lines (RILs) of sorghum. A totalof 84 random decamer primers were used to screen polymorphism among the parental genotypes. Among these, only24 primers were polymorphic. On bulked segregant analysis, primer OPJ 01 amplified a 1437 bp fragment only inresistant parent G 73 and resistant bulk. The marker OPJ 011437 was cloned and sequenced. The sequence of RAPDmarker OPJ 011437 was used to generate specific markers called sequence characterized amplified regions (SCARs).A pair of SCAR markers SCJ 01-1 and SCJ 01-2 was developed using Mac Vector program. SCAR amplification ofresistant and susceptible parents along with their respective bulks and RILs confirmed that SCAR marker SCJ 01 isat the same loci as that of RAPD marker OPJ 011437 and hence, is linked to anthracnose resistance gene. Resistantparent G 73 and resistant bulk amplified single specific band on PCR amplification using SCAR primer pairs.The RAPD marker OPJ 011437 was mapped at a distance of 3.26 cM apart from the locus governing anthracnoseresistance on the sorghum genetic map by the segregation analysis of the RILs. Using BLAST program, it was foundthat the marker showed 100 per cent alignment with the contig 3966 located on the longer arm of chromosome 8of sorghum genome. Therefore, these identified RAPD and SCAR markers can be used in the resistance-breedingprogram of sorghum anthracnose by marker-assisted selection.

Abbreviations: bp- base pair; cM- centimorgan; PCR-polymerase chain reaction; RAPD-random amplified poly-morphic DNA; RIL-recombinant inbred line; SCAR-sequence characterized amplified region

Introduction

Sorghum [Sorghum bicolor (L.) Moench] is the fifthmajor cereal crop in the world after wheat, rice, maizeand barley. It is a self-pollinated annual crop with out-

crossing rates of about 0.10–0.15 (Doggett, 1988), andhybridization with spontaneous species seems to oc-cur frequently. More than half of the world’s sorghumis grown in the semi-arid tropics where it is used asstaple food for millions of people. It is also grown in

180

United States, Australia and other developed nationsfor livestock feed. Worldwide, it is cultivated on anarea of 41 million hectares, producing 63 million tons.The stability of sorghum production relies on its abil-ity to adapt natural stresses especially to its pathogens.Most of the recorded fluctuations of the sorghum yieldare due to foliar diseases caused by fungal pathogens.These pathogens individually or in combination lead toa substantial loss of up to 50–55 per cent in sorghum(Ali & Warren, 1992).

Anthracnose of sorghum, incited by Colletotrichumgraminicola (Ces.) Wils is one of the major foliar dis-eases of sorghum widely prevalent under hot, humidconditions. It infects all the aerial parts of the plant andcauses a total loss up to 70 per cent. Anthracnose dam-age ranges from grain deterioration to peduncle break-age, to stalk rot and foliar damage (Pastor-Corrales &Fredericksen, 1980). This disease is characterized bysmall, circular, elliptical or elongated tan spots withreddish brown margins, studded with black dot-like ac-ervuli appearing on the leaves.

In sorghum, a number of resistant cultivars havebeen identified (Pande et al., 1994) and are used tocreate and improve synthetic population for use insorghum breeding (Duncan et al., 1991). Many diseaseresistant varieties have been evolved through conven-tional plant breeding methods, but the evolution of newraces of pathogens leads to breakdown of host resis-tance. Hence, marker-assisted selection (MAS) wouldimprove the efficiency of breeding for anthracnose re-sistance varieties.

Progress has been made in mapping and taggingmany agriculturally important genes with molecu-lar markers, which forms the foundation of marker-assisted selection (MAS) in crop plants. Presence oftight linkage [<10 cM (centimorgan)] between quan-titative trait(s) and genetic marker(s) has proved use-ful (Kennard et al., 1994; Paran et al., 1991). Molec-ular markers are used to identify and tag desiredgenes. Molecular marker studies using near-isogeniclines (Martin et al., 1991), bulked segregant analy-sis (Michelmore et al., 1991) and recombinant inbredlines (Mohan et al., 1994) have accelerated the map-ping of many genes in different plant species. RFLP(Botstein et al., 1980), SSRs (Litt & Luty, 1989), RAPD(Williams et al., 1990) and AFLP (Vos et al., 1995)have been extensively used to construct genetic mapsand develop DNA fingerprints of many crops.

RAPD is relatively easy, inexpensive and fast tech-nique but its reproducibility is sufficiently problematicdue to short primers being easily affected by annealing

conditions. In order to increase the reproducibility andreliability of PCR assays, specific primers called se-quence characterized amplified regions (SCARs) havebeen developed (Martin et al., 1991) from sequencesof RAPD fragments.

Several tightly linked RAPD markers have beenidentified for anthracnose resistance gene in sorghum[Sorghum bicolor (L.) Moench]. Such markers can fur-ther prove useful in understanding the mechanism ofanthracnose resistance genes. Boora et al. (1998) iden-tified DNA-based markers for a recessive gene confer-ring anthracnose resistance gene in sorghum by screen-ing the bulks by PCR amplification with 300 RAPDprimers. Pandey et al. (2002) found OPI 12 and OPD 12as RAPD markers closely linked to locus for anthrac-nose resistance. These markers will facilitate MAS inbreeding for resistance and map-based cloning of re-sistance gene (s).

The objectives of present study were: (i) to identifythe RAPD marker closely linked to anthracnose resis-tance gene in sorghum by bulked segregant analysis,(ii) to clone and sequence RAPD marker OPJ 011437,(iii) to develop specific SCAR marker linked to locusfor anthracnose resistance, and (iv) finally to map theidentified marker on the sorghum genetic map.

Materials and Methods

Fungal material

Cultures of Colletotrichum graminicola collected fromdiseased plants from the fields were cultured on caseinlactose hydrolysate (CLH) medium at 23◦C under flu-orescent light. Conidia were scrapped off the platesand suspension was made in sterilized distilled waterhaving final concentration of 1 × 106 conidia/ml usinghaemocytometer.

Plant materials, inoculation and scoringfor disease resistance

Two cultivars of sorghum [Sorghum bicolor (L.)Moench], cultivar HC 136 which is agronomically su-perior but susceptible to anthracnose and cultivar G73 which is resistant to anthracnose were selected forthe present investigation. Crosses were made betweenHC 136 × G73 and an F2 population consisting of110 plants were derived. These plants along with theparental lines were raised in the greenhouse followingrecommended agronomic practices and screened for

181

disease resistance by inoculating the same local iso-late of C. graminicola as the primary inoculums. F2

genotypes and 20 plants of each of the parent were in-oculated with 1 ml conidial suspension (1 × 106 perml), into leaf whorl of four-week-old plants. Data wasrecorded three times at 10 days interval after inocu-lation based on symptom expression of the disease.F2 plants were selfed till the F8 progeny, using sin-gle seed descent method, to obtain recombinant inbredlines (RILs). Twenty plants of F2 derived generationwere screened for disease resistance by inoculatingthe same local isolate of the pathogen, used earlierto screen F2 genotypes along with the parental lines.Plants were scored as resistant RILs when all the plantsof F8 progeny showed no disease symptoms (29 re-sistant) and susceptible RILs when all the plants haddisease symptoms (20 susceptible).

Segregation ratios for the disease reaction data fromthe F2 population were tested for goodness of fit to aMendelian 3:1 genotypic ratio using chi-square test.

Cloning vector

pDrive Cloning Vector (supplied with the QIAGENPCR cloning kit) was used for ligation of PCR product.The vector contains several unique restriction endonu-clease recognition sites around the cloning site and aT7 and SP6 promoter on either side, allowing sequenceanalysis using standard primers. It allows ampicillinand kanamycin selection, as well as blue/white colonyscreening.

DNA isolation

Total genomic DNA was isolated from the lyophilizedyoung leaves of 3–4 week old seedlings using CTABextraction method given by Murray and Thompson(1980) modified by Saghai-Maroof et al. (1984) andXu et al. (1994). The DNA concentrations were mea-sured by using UV absorbance spectrophotometer. TheDNA samples were then diluted with 1X TE buffer toa final concentration of 25 ng/μl.

Bulked segregant analysis coupled with RAPD

Bulked segregant analysis developed by Michelmore etal. (1991), was used to identify RAPD marker closelylinked to anthracnose resistance gene in sorghum. Anequal volume, i.e., 4 μg of standardized DNA from 20susceptible and 29 resistant RILs from HC 136 × G73were pooled separately to make the susceptible and

resistant bulks, respectively. A total of 84 randomsequence decamer oligonucleotide primers (OperonTechnologies Inc. USA) were used to detect polymor-phism among the parents HC 136 and G 73. PCR ampli-fication was performed in Biometra T personal and MJResearch PTC-100 programmable thermal cycler. PCRreactions (20 μl) contained 50 ng of genomic DNA, 1unit of Taq DNA polymerase (Genetix), 2 μl of 10XTaq DNA polymerase buffer, 2 mM MgCl2,200 μM ofeach dNTPs (MBI Fermentas) and 0.2 μM of randomprimer. The cycling was performed with initial prede-naturation for 3 min at 94◦C, followed by 45 cyclesof 1 min at 94◦C (denaturation), 1 min at 40◦C (an-nealing), 2 min at 72◦C (extension), and a final 15 minextension at 72◦C. Amplification products were sepa-rated by electrophoresis on 1.0 per cent (w/v) agarosegels stained with ethidium bromide, visualized underUV light and photographed with UV gel documen-tation system (Pharmacia Biotech). Primers showingpolymorphism between the parents were screened withthe susceptible and resistant bulks to find out markersclosely linked to the target, i.e., anthracnose resistancelocus.

Cloning of RAPD marker OPJ 011437

The amplified product OPJ 011437 was excised from theagarose gel and purified using QIAEX II agarose gel ex-traction kit (Qiagen, Germany). The purified fragmentwas cloned into pDrive Cloning Vector of size 3.85kb using QIAGEN PCR Cloning kit ligation protocolaccording to manufacturer’s instructions. The ligation-reaction mixture was transformed into fresh competentcells of Escherichia coli EZ strain. To these cells, SOCbroth was added and the cells were incubated for 60min at 37◦C with shaking (∼150 rpm). SOC broth con-tained 20 g tryptone, 5 g yeast extract, 0.584 g NaCl,2.5 ml KCl (1 M), glucose (20 mM), 10.0 ml MgCl2(1 M), 10 ml MgSO4 (1 M) and distilled water (upto 100 ml). The 100 μl of the transformation mixturewas spread on the Luria-Bertani (LB) plates containing100 μg/ml ampicillin, 20 μl IPTG (100 mM) and 50 μlX-gal (40 mg/ml), and incubated at 37◦C overnight.

Sequencing of RAPD marker closely linked toanthracnose resistance gene and sequencehomology searches

A white colony positive for the desired insert was cho-sen, grown on large scale and plasmid DNA was iso-lated using modified alkaline lysis method given by

182

Brinboim and Dolly, 1979. The insert was released byrestriction digestion of the recombinant plasmid withEco R1 enzyme and the sequencing of this marker wasperformed. Sequence analysis was done in an auto-mated DNA Sequencer, using ABI’s Ampli Taq FSdye terminator cycle sequencing chemistry based ondideoxy chain termination method.

Sequence homology searches were performed us-ing BLAST algorithm at http://www.ncbi.nlm.nih.govof the National Center for Biotechnology Information(NCBI), with the program BLASTN. Sequence iden-tity was compared with respect to the number of acces-sions to which the clone had most similarity, the puta-tive function of the accession and the probability valuefor likelihood that the similarity of association was byrandom chance. Sequence identity was also comparedto that of genes present on the sorghum chromosomesusing BLAST program at http://www.gramene.org.

Generation of SCAR markers and specific PCRamplification

Based on the sequences of the cloned RAPD product, apair of SCAR primers was designed using the programMac Vector for specific amplification of the loci iden-tified by RAPD marker. Care was taken to avoid pos-sible secondary structure or primer dimer generationand false priming, and also to match melting tempera-tures and to achieve appropriate internal stability whilegenerating SCAR primers. Primers were synthesized.Amplification reactions of genomic DNA of parents,resistant and susceptible bulks and RILs were carriedout using SCAR primers. Amplified products were re-solved by electrophoresis in 2.0 per cent agarose gels.

Linkage mapping

Linkage analysis was done as described by Burr et al.,1998 and Haldane and Waddington, 1931. Each allelewas scored with bulks and the marker showing linkagewith the alleles in the bulks was analyzed with indi-vidual RIL. A total of 49 RILs were screened amongwhich, 29 were resistant and 20 were susceptible to an-thracnose. Marker OPJ 01 amplified 1437 bp allele inall the resistant inbred lines except in two, but there wasno amplification of this fragment in susceptible RILsexcept in one. Each locus was scored for parental alle-les to generate a database. A FORTRAN program wasused to calculate the value of ‘r ’, i.e., map distance inMorgans. Map distance in Morgans (r ) was determined

by using following equation:

r = R/(2 − R)

where R represents the proportion of recombinantlines, r represents the proportion of recombinants ina single meiosis.

Results

Genetic analysis of inheritance of gene for resistanceto anthracnose

The F1 of HC 136 × G 73 cross was susceptible toanthracnose disease indicating that anthracnose resis-tance is controlled by a recessive gene. Out of 106 F2

plants screened, 79 plants were found to be susceptibleand 27 were resistant to anthracnose. Hence, there was aMendelian ratio 3:1 of segregation for susceptible andresistant genotypes of F2 generation. This confirmedthat a single recessive gene controlled the anthracnoseresistance. These genotypes were further grown to gen-erate RILs, which were produced by single seed descentmethod, and screening for disease resistance was donein F8 generation. Upon screening of F8 progeny, it wasfound that 20 RILs were susceptible and 29 were resis-tant to anthracnose disease.

Statistical analysis was done using chi-square (χ2)test to confirm the 3:1 segregation. The observed valueof χ2, i.e., 0.012 was found lesser than the expectedvalue. Therefore, the conception that segregation on3(susceptible): 1(resistant) was correct. Besides, theslight deviation of the observed value from the expectedwas due to chance error.

Identification of a RAPD marker closely linked toanthracnose resistance gene

A total of 84 random sequence decamer primers hav-ing 60 per cent or more G + C content were used todetect polymorphism among the parents HC 136 andG 73. Out of 84 primers used, 71 primers showed am-plification in both the parents and generated a totalof 547 discrete bands. Among these, only 24 primersgenerated polymorphism among the susceptible andresistant parents and amplified 46 polymorphic bandswith an average of 1.9 bands per primer. All of these 24primers showing polymorphism with the parental geno-types were also screened with the resistant and suscep-tible bulks in order to identify RAPD marker linked tothe locus for anthracnose resistance. Marker OPJ 01

183

Figure 1. PCR amplification pattern of genomic DNA obtained using

random primers OPA 12 and OPJ 01 in parents and bulks. Lane 1:

Lambda DNA Eco RI/ Hind III double digest marker, lanes 2–5: OPA

12, lanes 6–9: OPJ 01, lanes 2, 6: HC 136, lanes 3, 7: G 73, lanes 4,

8; susceptible bulk and lanes 5, 9: resistant bulk. Arrow indicates the

linked band.

(CCCGGCATAA) amplified a 1437 bp band unique tothe resistant parent and resistant bulk (Figure 1). Hence,it may be deduced that marker OPJ 011437 was closelylinked to anthracnose resistance gene in sorghum.

Cloning of marker OPJ 011437

After transformation, few blue colonies were ap-peared along with white colonies on the selectionmedium. Blue colonies represented transformants hav-ing the self-ligated plasmids without any insert. Whitecolonies were selected as transformants with 1437 bpDNA insert. Plasmid DNA of recombinant clones wasdigested with Eco R1 restriction endonuclease enzyme.On restriction digestion, two bands were appeared; onecorresponding to the size of plasmid DNA (∼3.85 kb)and other to the size of specific DNA insert (1.437 kb).The excised fragment was reamplified using the ran-

dom primer OPJ 01 and same size band was observedin the agarose gel.

Sequencing of RAPD marker OPJ 011437

DNA sequence analysis of OPJ 011437 (GenBank Ac-cession No. DQ235472) revealed that the amplifiedfragment was bordered by the original ten bases of theRAPD primer OPJ 01, i.e., CCCGGCATAA (Figure 2).Sequence homology searches were further carried outusing BLASTN program. The sequence showed align-ment with that of several plant protein encoding genesequences (Table 1). The marker showed 100 per centalignment with contig 3966 (P-value = 0.997) presenton the longer arm of chromosome 8 of the sorghumgenome.

SCAR design and analysis

In order to increase the specificity and reproducibilityof RAPD marker, a set of SCAR markers were designedbased on the sequences of marker OPJ 011437. A pairof specific SCAR markers designated as SCJ 01-1 (for-ward) and SCJ 01-2 (reverse) were designed based onthe sequence of OPJ 011437 (Table 2). Amplificationswere carried out for the parents, bulks and the same setof RILs used for RAPD analysis. Single specific bandof 1437 bp was amplified in case of resistant parent G73 and resistant bulk (Figure 3). SCAR primers pro-duced specific amplification product using primer SCJ01 of the same molecular size and segregation phase asthe original RAPD marker OPJ 011437, indicating thatthe RAPD and SCAR markers share a common locusthat is linked to the anthracnose resistance gene.

Linkage mapping of marker OPJ 011437

Marker OPJ 01 was screened with individual suscepti-ble and resistant RILs in order to check the closenessof the marker to the gene for anthracnose resistance.The marker OPJ 01 produced 1437 bp unique band inall the resistant RILs except in two, but there was noamplification of this fragment in the susceptible RILsexcept in one. This showed a total of three cross overs.The marker OPJ 01 was found to be located at a dis-tance of 0.0326 Morgans or 3.26 cM apart from thelocus governing resistance to anthracnose.

Discussion

Plants with anthracnose were observed in F1 and F2

populations derived from the cross HC 136 × G 73.

184

Figure 2. The DNA sequence of OPJ 011440 and SCAR primer SCJ 01 designed. The bold underlined region is the sequence used for designing

SCAR marker. Highlighted region represents the sequence of primer OPJ 01.

The F1 was found susceptible to anthracnose diseaseindicating that a recessive gene controls anthracnoseresistance. A Mendelian segregation ratio of 3:1 wasobserved for susceptible and resistant genotypes of F2

population suggesting that anthracnose of sorghum iscontrolled by a single recessive gene. These results arein agreements with the previous reports on foliar dis-eases of sorghum (Boora et al., 1998; Pandey et al.,2002). Genetic analysis of inheritance of gene for re-sistance to anthracnose in HC 136× G 73 cross con-firmed that anthracnose resistance is controlled by asingle recessive gene.

RAPD technique is a useful tool for tagging plantgenes. Markers closely linked to simply inherited traitscan be easily identified by bulked segregant analysis ifan appropriate F2 population is available (Michelmoreet al., 1991). In the present study, RAPD marker closelylinked to anthracnose resistance gene in sorghum

[Sorghum bicolor (L.) Moench] was identified by usingbulked segregant analysis. Out of the 84 primers used,only 24 primers differentiated between the parents HC136 and G 73 and amplified 46 polymorphic bands withan average of 1.9 bands per primer. On bulked segregantanalysis, it was found that primer OPJ 01 amplified a1437 bp band unique in resistant parent and resistantbulk only.

The identified RAPD marker closely linked to an-thracnose resistance gene OPJ 011437 was cloned andsequenced. The sequence of this marker was utilizedto generate specific, longer primers. Direct sequenc-ing of PCR products can be used (Hernandez et al.,1999). Sequencing of PCR products using terminalprimers would usually generate incomplete sequencedata at both ends. So the cloning is preferred over di-rect sequencing in order to acquire complete and ana-lyzed sequence data. In the present study, the sequence

185

Table 1. Sequence homology of marker OPJ 011437 using BLASTN program

S. No. DB:ID Source Length (bp) Identity%

1 EM EST:CV065309 WNEL20h4 Wheat EST endosperm library

Triticum aestivum cDNA clone

WNEL20h4 5′ similar toUnknown

Function, mRNA sequence.

594 92

2 EM EST:CK195919 FGAS004365 Triticum aestivum FGAS:

Library 3 Gate 6 Triticum aestivumcDNA, mRNA sequence.

876 100

3 EM EST:CF330508 NACL–06-E02.b1 Rice callus plasmid

cDNA library (NACL) Oryza sativacDNA clone NACL–06-E02, mRNA

sequence.

631 92

4 EM EST:CF330200 NACL–05-N05.g1 Rice callus plasmid

cDNA library (NACL) Oryza sativacDNA clone NACL–05-N05, mRNA

sequence.

442 92

5 EM EST:CF038982 QCH30c10.yg QCH Zea mays cDNA clone

QCH30c10, mRNA sequence.

580 92

6 EM EST:CF038752 QCH28b07.yg QCH Zea mays cDNA clone

QCH28b07, mRNA sequence.

541 100

7 EM EST:CB655974 OSJNEc09N03.f OSJNEc Oryza sativa(japonica cultivar-group) cDNA clone

OSJNEc09N03 5′, mRNA sequence.

564 100

8 EM EST:CA738362 wpi2s.pk006.i18 wpi2s Triticum aestivumcDNA clone wpi2s.pk006.i18 5′ end,

mRNA sequence.

385 92

9 EM EST:BI245282 949027D01.×1 949 - Juvenile leaf and shoot

cDNA from Steve Moose Zea mayscDNA, mRNA sequence.

512 100

10 EM EST:AU225213 Oryza sativa (japonica cultivar-group)

Koshihikari cDNA, clone:KP3-0156.

427 100

Table 2. Characteristics of SCAR primers developed from the

sequence of OPJ 01 1437

SCAR locus Sequence (5′ → 3′)GC

(%)

Tm

(◦C)

SCJ 01-1 TGCGATGAAAATAACCCTTCCC 45.5 56.6

(Forward)

SCJ 01-2 ATGTCAACGGCACAACGACG 55.0 78.4

(Reverse)

analysis of marker linked to the anthracnose resistancegene was performed by using modified dideoxy chaintermination method. The sequence data is given inFigure 2.

In order to increase the specificity of the RAPDmarkers, they are converted into specific markers calledsequence characterized amplified regions (SCARs).SCAR markers are advantageous over RAPD mark-ers because these are codominant, detect only singlegenetically defined loci, identified as distinct bands in

agarose gels, are easier to score, less sensitive to re-action conditions and are more reproducible. SCARslinked to disease resistance genes have been identifiedin many crops like wheat (Gold et al., 1999; Tar et al.,2002), soybean (Zheng et al., 2003), tomato (Ohmoriet al., 1996; Sobir et al., 2000), sorghum (Boora etal., 1998). In view of these, based on the sequences ofRAPD marker OPJ 011437, a pair of SCARs was gen-erated (Table 2). Boora et al. (1998) identified primerOPD 12, amplifying a 232 bp fragment segregatingwith leaf blight resistance in sorghum. This was usedto create SCAR. These SCARs would be of great valuefor marker-assisted selection purpose and introgressionof disease resistance genes (Chague et al., 1996; Booraet al., 1999).

The marker OPJ 011437 was found to be located ata distance of 3.26 cM away from the locus governingresistance to anthracnose as revealed by segregationanalysis of RILs. The identified marker also showed100 per cent identity with contig 3966 located on thelonger arm of chromosome 8 of sorghum genome.

186

Figure 3. PCR amplication of parents and bulks using SCAR marker

SCJ 01 M: Lambda DNA Eco R1/ Hind II double digest marker, lane

1: HC 136, lane 2: G 73, lane 3: Susceptible bulk, lane 4: Resistant

bulk. Arrow indicates the specific amplified band.

The information provided by the identified RAPDand SCAR markers would be very useful in theresistance-breeding program of sorghum anthracnoseby marker-assisted selection and isolation of the an-thracnose resistance gene which can further be utilizedfor genetic improvement for disease resistance. Hence,these markers may prove useful in marker-assisted se-lection, plant genetic diagnostics and gene pyramidingof desirable traits.

Acknowledgements

We are thankful to the Rockefeller Foundation, NewYork, USA for providing financial assistance for the re-search work. The first author MS is grateful to Councilof Scientific and Industrial Research, Government of

India, New Delhi, for providing financial support in theform of Junior and Senior Research Fellowships.

References

Ali, M.E.K. & H.L. Warren, 1992. Anthracnose of sorghum. p. 203–

208. In: W.A.J. de Milliano, R.A. Frederiksen and G.D. Bengston

(eds.). Sorghum and millets diseases: A second world review.

ICRISAT, Patancheru, A.P. 502324, India.

Boora, K.S., R.A. Frederiksen & C.W. Magill, 1998. DNA-based

markers for a recessive gene conferring anthracnose resistance in

sorghum. Crop Sci 38: 1708–1709.

Boora, K.S., R.A. Frederiksen & C.W. Magill, 1999. A molecular

marker that segregates with sorghum leaf blight resistance in one

cross is maternally inherited in mother. Mol Gen Genet 261: 317–

322.

Botstein, B., R.L. White, M. Skolnick & R.W. Dairs, 1980. Construc-

tion of a genetic linkage map using restriction fragment length

polymorphisms. Am J Hum Genet 32: 314–331.

Brinboim, H.C. & J. Dolly, 1979. A rapid alkaline extraction pro-

cedure for screening recombinant plasmid DNA. Nucleic Acids

Res 7: 1513–1523.

Burr, B., F.A. Burr, K. H. Thomson, M. C. Albertson & C. W. Stuber,

1988. Gene mapping with recombinant inbreds in maize. Genetics

118: 519–526.

Chague, Y., J.C. Mercier, M. Guenard, A. de Courcel & F. Vedel,

1996. Identification and mapping on chromosome 9 of RAPD

markers linked to Sw-5 gene in tomato by bulked segregant anal-

ysis. Theor Appl Genet 92: 1045–1051.

Dogget, H. 1988. Sorghum. 2nd ed. John Wiley and Sons, Inc., New

York.

Duncan, R.R., P.J. Bramel-Cox & F.R. Miller, 1991. Contributions

of introduced sorghum germplasm to hybrid development in the

USA. p. 69–102. In: H.L. Shands and L.E. Wiesner (eds.). Use of

plant introductions in cultivar development: Part 1. CSSA spec.

Publ. No. 17, CSSA, Madison, WI.

Gold, J., D. Harder, F.T. Smith, T. Aung & J. Procunier, 1999. De-

velopment of a molecular marker for rust resistance genes Sr39

and Lr35 in wheat breeding lines. Plant Biotechnol. (e-journal)

Haldane, J. B. S. & C. H. Waddington, 1931. Inbreeding and linkage.

Genetics 16: 357–374.

Hernandez, P., A. Martin & G. Dorado, 1999. Development of

SCARs by direct sequencing of RAPD products: A practical tool

for the introgression and marker-assisted selection of wheat. Mol

Breed 5: 245–253.

Kennard, W.C., K. Potter, Dijkhuizen, V. Meglie, J. Staub & M.

Harvey, 1994. Linkages among RFLP, RAPD, isozymes, disease

resistance and morphological markers in narrow and wide crosses

of cucumber. Theor Appl Genet 89: 42–48.

Litt, M. & J.A. Luty, 1989. A hypervariable microsatellite re-

vealed by in vitro amplification of a di-nucleotide repeat within

the cardiac muscle actin gene. Am J Hum Genet 44: 397–

401.

Martin, G.B., J.G.K. Williams & S.D. Tanksley, 1991. Rapid iden-

tification of markers linked to a Pseudomonas resistance gene in

tomato using random primers and near isogenic lines. Proc Natl

Acad Sci USA 88: 2236–2340.

Michelmore, R.W., Paran, I. & R.V. Kesseli, 1991. Identification

of markers linked to disease resistance genes by bulk segregant

187

analysis: A rapid method to detect markers in specific genomic

regions by using segregating populations. Proc Natl Acad Sci

USA 88: 9829–9832.

Mohan, M., S. Nair, A. Bhagwat, T.G. Krishna, & M. Yano, 1997.

Genome mapping, molecular markers and marker assisted selec-

tion in crop plants. Mol Breed 3: 87–103.

Murray, M.G. & W.F. Thompson, 1980. Rapid isolation of high

molecular weight plant DNA. Nucleic Acids Res 8: 4321–4325.

Ohmori, T., M. Murata & F. Motoyoshi, 1996. Molecular character-

ization of RAPD and SCAR markers linked to the Tn-1 locus in

tomato. Theor Appl Genet 92: 151–156.

Pandey, S., A. Sindhu & K.S. Boora, 2002. RAPD based DNA mark-

ers linked to arthracnose disease resistance in Sorghum bicolor.(L.) Moench Indian J Exptl Biol 40: 206–211.

Pande, S., R.P. Thakur, R.I. Karunakar, R. Bandyopadhyay, & Reddy,

B.V.S. 1994. Development of screening methods and identifica-

tion of stable resistance to anthracnose in sorghum. Field Crops

Res 38: 157–166.

Paran,I., R. Kesseli & Michelmore, R. 1991. Identification of restric-

tion fragment length polymorphism and random amplified poly-

morphic DNA markers linked to downy mildew resistance genes

in lettuce, using near isogenic lines. Genome 34: 1021–1027.

Pastor-Corrales, M.A. & R.A. Frederiksen, 1980. Sorghum an-

thracnose. p. 289–294. In: Sorghum diseases, a world review:

Proceedings of the international workshop on sorghum diseases,

11–15 Dec. 1978. ICRISAT, Patancheru, A.P., India.

Saghai-Maroof, M.A., K.M. Soliman, R.A. Jorgensen & R.W. Allard,

1984. Ribosomal DNA spacer length polymorphisms in barley:

Mendelian inheritance, chromosomal location and population dy-

namics. Proc Natt Acad Sci USA 81: 8014–8018.

Sobir, T., M. Ohmori, & F. Motoyoshi, 2000. Molecular characteri-

zation of the SCAR markers tightly linked to the Tm-2 locus of

the genes in Lycopersicon. Theor Appl Genet 101: 64–69.

Tar, M., L. Purnhauser, L. Csosz, A. Mesterhazy & G. Gyulai, 2002.

Identification of molecular markers for an efficient leaf rust resis-

tance gene (Lr 29) in wheat. In: Proceedings of the 7th Hungarian

Congress on Plant Physiology, 2002. Acta Biologica Szegediensis

46(3–4): 133–134.

Vos, P., R. Hogers, M. Beeker, M. Reijans, T. Vandelee, M. Hornes,

A. Frijlers, J. Pot, J. Peleman, M. Kuiper, & M. Zebecau, 1995.

AFLP: A new technique for DNA fingerprinting. Nucleic Acid

Res 23: 4407–4414.

Williams, J.G.K., A.R. Kubelik, K.J. Livak, J.A. Rafalski, & S.V.

Tingey, 1990. DNA polymorphisms amplified primers are useful

as genetic markers. Nucleic Acid Res 18: 6531–6535.

Xu, G.W., C.W. Magill, K.F. Schertz & G.E. Hart, 1994. An RFLP

linkage map of Sorghum bicolor (L). Moench Theor Appol Genet

89: 139–145.

Zheng, C., R. Chang, L. Qiu, P. Chen, X. Wu & S. Chen, 2003. Iden-

tification and characterization of a RAPD/SCAR marker linked to

a resistance gene for soybean mosaic virus in soybean. Euphytica

132: 199–210.