ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, May 2009, p. 1840–1849 Vol. 53, No. 50066-4804/09/$08.00�0 doi:10.1128/AAC.01614-08Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Identification and Characterization of Mefloquine Efficacy against JCVirus In Vitro�†

Margot Brickelmaier,1 Alexey Lugovskoy,1 Ramya Kartikeyan,2 Marta M. Reviriego-Mendoza,2Norm Allaire,1 Kenneth Simon,1 Richard J. Frisque,2 and Leonid Gorelik1*

Biogen IDEC Inc., 14 Cambridge Center, Cambridge, Massachusetts 02142,1 and Department of Biochemistry andMolecular Biology, The Pennsylvania State University, University Park, Pennsylvania 168022

Received 5 December 2008/Returned for modification 28 January 2009/Accepted 20 February 2009

Progressive multifocal leukoencephalopathy (PML) is a rare but frequently fatal disease caused by theuncontrolled replication of JC virus (JCV), a polyomavirus, in the brains of some immunocompromisedindividuals. Currently, no effective antiviral treatment for this disease has been identified. As a first step in theidentification of such therapy, we screened the Spectrum collection of 2,000 approved drugs and biologicallyactive molecules for their anti-JCV activities in an in vitro infection assay. We identified a number of differentdrugs and compounds that had significant anti-JCV activities at micromolar concentrations and lackedcellular toxicity. Of the compounds with anti-JCV activities, only mefloquine, an antimalarial agent, has beenreported to show sufficiently high penetration into the central nervous system such that it would be predictedto achieve efficacious concentrations in the brain. Additional in vitro experiments demonstrated that meflo-quine inhibits the viral infection rates of three different JCV isolates, JCV(Mad1), JCV(Mad4), and JCV(M1/SVE�), and does so in three different cell types, transformed human glial (SVG-A) cells, primary human fetalglial cells, and primary human astrocytes. Using quantitative PCR to quantify the number of viral copies incultured cells, we have also shown that mefloquine inhibits viral DNA replication. Finally, we demonstratedthat mefloquine does not block viral cell entry; rather, it inhibits viral replication in cells after viral entry.Although no suitable animal model of PML or JCV infection is available for the testing of mefloquine in vivo,our in vitro results, combined with biodistribution data published in the literature, suggest that mefloquinecould be an effective therapy for PML.

Progressive multifocal leukoencephalopathy (PML) is a pro-gressive, usually fatal, demyelinating disease caused by JC virus(JCV) infection and the destruction of oligodendrocytes inmultiple brain foci of susceptible individuals. JCV is a double-stranded DNA polyomavirus that is believed to cause asymp-tomatic infections in 65 to 90% of the human population, asjudged by the presence of virus-specific antibodies (35). Thereis persistent viral shedding in the urine of 20 to 40% of indi-viduals (35), which, together with the observed presence of thevirus in kidney tubular epithelial cells (32, 49), indicates thatJCV establishes a persistent and chronic infection in a largefraction of the human population. Despite this high infectionrate and viral prevalence, PML is a rare disease that almostexclusively afflicts individuals who are immunocompromiseddue to genetic factors, human immunodeficiency virus (HIV)infection, hematological malignancies, or immunosuppressivetherapies (8, 14).

Currently there are no approved or proven therapies forPML. Although a number of preclinical reports and case stud-ies have suggested the potential anti-PML effects of antiviraland antineoplastic drugs such as cytarabine, cidofovir, andtopotecan, larger case-controlled studies failed to establish the

efficacies of these drugs (1, 21, 27, 28, 31, 39). To date, the mosteffective intervention for the treatment of PML is reconstitu-tion of the patient’s immune system. Thus, the introduction ofhighly active antiretroviral therapy was the single most signif-icant development, reducing the rate of mortality from PML inHIV-positive individuals from 90% to 50% (8, 10, 16–18).Similarly, a reduction in the drug regimen of PML patientsundergoing immunosuppressive therapy may halt the worsen-ing of clinical symptoms (20, 54). However, an immune recon-stitution approach is not possible or successful in all patients.Therefore, it is imperative that the search for therapeuticstargeting JCV directly be continued.

To identify drugs with anti-JCV activity, we screened a com-mercially available collection of approved drugs and bioactivecompounds in an in vitro JCV infection assay. As a primaryscreen, we monitored inhibition of the viral infection rate oftransformed human glial (SVG-A) cells (38) exposed toJCV(M1/SVE�), a modified form of JCV (58). The infectionrate was measured as the percentage of cells expressing theviral capsid protein VP1. Of the 2,000 compounds in the Spec-trum collection, 14 were found to reduce the number of in-fected cells by �50% at concentrations of �20 �M (50%effective concentration [EC50], �20 �M). Since PML is a resultof uncontrolled viral replication in the central nervous system(CNS), it is critical that potential therapeutic agents cross theblood-brain barrier (BBB) at a concentration sufficient to beeffective. On the basis of the published literature on the 14drug candidates with in vitro anti-JCV activity that have beenidentified, only mefloquine, an antimalarial agent, appears toexhibit a level of CNS penetration that could be expected to

* Corresponding author. Mailing address: Biogen IDEC Inc., 14Cambridge Center, Cambridge, Massachusetts 02142. Phone: (617)679-3297. Fax: (617) 679-3148. E-mail: Leonid.gorelik@biogenidec.com.

† Supplemental material for this article may be found at http://aac.asm.org/.

� Published ahead of print on 2 March 2009.

1840

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

ac o

n 24

Nov

embe

r 20

21 b

y 21

3.23

1.13

9.18

7.

achieve in vitro-derived efficacious concentrations in humans(33, 47). Our experiments characterizing the anti-JCV activityof mefloquine, together with the available published data, sug-gest that the efficacy of mefloquine treatment should be exam-ined in patients with PML.

MATERIALS AND METHODS

Source and identity of potential therapeutic agents. The Spectrum collection(MicroSource Discovery Inc., Groton, CT) consists of �1,000 bioactive com-pounds and natural products plus �1,000 Food and Drug Administration-ap-proved drugs that are defined according to the name designations set forth in theUSP Dictionary of USAN and International Drug Names (57). An alphabeticallisting of the compounds is available at http://www.msdiscovery.com/spectrum.html. The compounds are supplied as 10 mM solutions in dimethyl sulfoxide(DMSO). In our follow-up experiments, mefloquine and all other drugs werepurchased from Sigma-Aldrich (St. Louis, MO), and 100 mM stock solutionswere prepared in DMSO. Two mefloquine enantiomers were separated from acommercial mefloquine sample by Chiral Technologies (West Chester, PA) bychiral high-pressure liquid chromatography on a Chiralpak IA column to a purityof �98.6% for each enantiomer. Mefloquine analogs were purchased from Bio-Blocks, Inc. (San Diego, CA.). Cidofovir (Vistide) was obtained from Gilead asa 0.238 M aqueous stock solution.

Propagation and identity of cultured cells. SVG-A cells (a gift from WalterAtwood, Brown University), established by transforming human fetal glial cellswith an origin-defective simian virus 40 (SV40) mutant (38), were cultured in 1�Eagle minimal essential medium supplemented with 10% heat-inactivated fetalbovine serum (FBS) and 4 mM L-glutamine (Mediatech, Inc.). Viral infectionwas performed in the same medium supplemented with 2% heat-inactivated FBS.

Human astrocytes were isolated from a fetal cerebral cortex (ScienCell Re-search Laboratories, Carlsbad, CA) and cultured in proprietary astrocyte growthmedium (ScienCell Research Laboratories). Viral infection of the astrocytes wasperformed in this medium.

Cultures of primary human fetal glial (PHFG) cells were prepared from fetalbrain tissue by using a modification of an earlier protocol (44). Briefly, tissue wasreceived in glial cell medium (Dulbecco modified Eagle’s minimal essentialmedium [DMEM] supplemented with 3% FBS, 7% bovine calf serum, 100 U/mlpenicillin, 100 �g/ml streptomycin, 50 �g/ml gentamicin, and 2.5 �g/ml ampho-tericin B [Fungizone]). After removal of the meninges and blood vessels, thetissue was washed twice in 10 to 30 ml glial cell medium without gentamicincontaining 200 �g/ml amikacin (Sigma) and was then pelleted in a clinicalcentrifuge (3 min, 1,120 rpm). The tissue was transferred to a sterile petri dishcontaining 10 to 20 ml medium, and tissue fragments were reduced in size byexpressing them through a 10-ml syringe (without a needle) and a 40-meshscreen in a tissue dissociation device (Sigma). Cells derived by this procedurewere seeded on 100-ml tissue culture plates in glial cell medium by using avolume of 0.5 ml of cells per plate. After 1 week, if the astrocyte layer wasconfluent, the cultures were placed in maintenance medium (DMEM supple-mented with 3% FBS, penicillin, and streptomycin). If the astrocyte layer was notconfluent, the cultures were placed in glial cell medium without amikacin. At 2to 3 weeks after they were seeded, the cells were prepared for freezing. Briefly,cell cultures were incubated overnight in DMEM containing 10% FBS. On thenext day, the heterogeneous population of cells containing astrocytes and smallround cells clustered on top of the astrocyte layer was washed with saline A(trypsin buffer, 0.8% NaCl, 0.4% KCl, 0.1% glucose, 0.035% NaHCO3, 0.2%EDTA, pH 7.0). After aspiration, saline A was added again to each plate, and thecells were incubated for 3 min at 37°C. Trypsin (in saline A) was added, and cellswere incubated for 4 min at 37°C. DMEM containing 10% FBS was added, andthe cells were gently collected in 50-ml conical tubes. The cell suspension wascentrifuged, the pellet was washed once with DMEM containing 10% FBS, andthe cells were then pelleted again. The cells were suspended in freezing medium(DMEM, 10% FBS, 10% DMSO) and were stored in liquid nitrogen until theywere used for infectivity assays with JCV(Mad1).

JCV isolates. The hybrid virus JCV(M1/SVE�) (a gift from Walter Atwood)was constructed by first inserting SV40 regulatory sequences into the JCV-(Mad1) transcriptional control region to create the hybrid genome, JCV(M1/SVE) (58). Transfection of SVG-A cells with this DNA yielded JCV(M1/SVE�),which comprised JCV-SV40 enhancer signals linked to the JCV(Mad1) genome.To produce purified preparations of virus, SVG-A cells were plated at 50%confluence and were infected with a 1:50 dilution of JCV(M1/SVE�) for 1 h at37°C (25, 36). The cells were cultured for 3 weeks and were then scraped fromthe flasks, pooled (along with cells that had detached during prior medium

changes), and pelleted. The cell pellet was resuspended in 20 ml of supernatantand disrupted in a microfluidizer (Microfluidics, Inc.). Deoxycholate was addedto the cell lysates at a final concentration of 0.25%, and the mixture was incu-bated at 37°C for 30 min. The virus-containing supernatant was centrifuged at10,000 rpm for 30 min in an SA600 rotor and aliquoted and stored at �80°C. TheJCV(Mad4) isolate (46) was obtained from the American Type Tissue Collection(Manassas, VA), and the prototype JCV(Mad1) isolate (24, 45) was a gift fromDuard Walker (Madison, WI).

Detection of antibodies. PAb597 (a gift from Walter Atwood [19]), a mousemonoclonal antibody directed against SV40 major capsid protein VP1, cross-reacts with JCV VP1 (4) and was used with an Alexa-Fluor 488-labeled goatanti-mouse secondary antibody (Invitrogen, Carlsbad, CA) to visualize JCV-infected cells by indirect immunofluorescence. Cell nuclei were counterstainedwith 4�,6-diamidino-2-phenylindole (DAPI) (Invitrogen). Neutralizing anti-JCVrabbit antiserum was a gift from Walter Atwood (3).

JCV infectivity assay. SVG-A cells were seeded at 2,000 cells/well/0.075 ml ofculture medium in flat-bottom 96-well plates (Corning). The compounds to betested for antiviral activity were prepared the next day in assay medium (1�Eagle minimal essential medium with 2% heat-inactivated FBS and 4 mM L-glutamine). A master viral plate was prepared by mixing equal volumes of 2�compound and virus diluted two times to yield the final working concentrationsof compound and virus. The plate containing cells was gently inverted andshaken to remove the medium. From the master plate, 0.035 ml of compoundplus virus was added to designated wells. The cells were incubated with thecompound-virus mixture for 60 min in a humidified, 37°C incubator containing5% CO2. Medium containing the final concentration of the drug was added todesignated wells to bring the final volume to 0.1 ml/well. After incubation of theplates for 3 days, the cells were washed once with 1� phosphate-buffered saline(PBS) and fixed in 2% paraformaldehyde–1� PBS for 30 min at room temper-ature. The fixative was removed, and the cells were permeabilized with 0.5%Triton X-100 in PBS for 30 min. Cells infected with JCV(M1/SVE�) werevisualized by staining with 0.05 ml of PAb597 (2 �g/ml in 1� PBS) for 60 min at37°C. Following a wash step with 1� PBS, an Alexa-Fluor 488-labeled goatanti-mouse secondary antibody (1:100 dilution in 1� PBS) and DAPI (1 �g/ml,0.05 ml/well) were added to the cells for 30 min at 37°C. The cells were washedwith 1� PBS, and field images of each well were acquired and analyzed with aCellomics ArrayScan imager (Thermo Scientific Inc.) and Target Activationsoftware.

The infectivity assay was also performed with human astrocytes or PHFG cellsbut with the following modifications. Human astrocytes were seeded at 4,000cells/well/0.075 ml of culture medium in flat-bottom 96-well plates. The culturemedium was used as the virus diluent, and the duration of the infection was 6 to10 days. PHFG cells (�1.2 � 105) were seeded onto 35-mm plates containing 2.0ml DMEM supplemented with 10% FBS, 100 U/ml penicillin, 100 �g/ml strep-tomycin, and 2 mM L-glutamine. The cells were exposed 48 h later to 5 hemag-glutinating units of JCV(Mad1) diluted in DMEM; 0.5% heat-inactivated FBS;and 2.5 �M, 5 �M, 7.5 �M, or 10 �M of mefloquine in 0.01% DMSO. Threeindependent sets of experiments were performed, each of which was performedwith two samples at each time point. Cells not exposed to mefloquine wereinfected with 1 or 5 hemagglutinating units of JCV(Mad1) and served as controlsto determine mefloquine’s inhibitory activity and to confirm that the infected cellnumbers increased proportionally with a fivefold increase in the virus inoculum.Virus was allowed to adsorb to the cells for 3 h at 37°C, and then DMEMsupplemented with 3% heat-inactivated FBS and the appropriate amount ofmefloquine was added. The medium was replaced 5 days postinfection, and DNAwas extracted from the cells at days 7 and 10 postinfection.

DNA extraction and sample preparation. DNA was extracted from cells witha QIAamp 96 blood kit (Qiagen, Inc.) and were treated with RNase A, which isoptional. The DNA was quantitated with a Quant-iT double-stranded DNAhigh-sensitivity assay, according to the manufacturer’s recommendations (Mo-lecular Probes Inc., Eugene, OR). The purified DNA was stored at �20°Cuntil use.

Real-time quantitative PCR (qPCR) assay. TaqMan forward and reverseprimers and MGB probes were designed to recognize conserved JCV earlycoding sequences and were designed with Primer Express (version 3.0) software(Applied Biosystems, Foster City, CA). The sequence of the forward primer wasAGGCAGCAAGCAATGAATCC, that of the reverse primer was ATGGCAATGCTGTTTTAGAGCAA, and that of the 6-carboxyfluorescein-labeled probewas CCACCCCAGCCATAT. To create a copy number standard curve forabsolute quantification, we linearized plasmid pUC19 containing the JCV ge-nome with SmaI. Quadruplicate PCRs were run in a 384-well optical plate(Applied Biosystems). Real-time reactions were performed in a 7900HT thermalcycler (Applied Biosystems) under the following conditions: 50°C for 2 min, 95°C

VOL. 53, 2009 MEFLOQUINE EFFICACY AGAINST JC VIRUS IN VITRO 1841

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

ac o

n 24

Nov

embe

r 20

21 b

y 21

3.23

1.13

9.18

7.

for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 60 s with 900 nM forwardand reverse primers, 200 nM TaqMan probe, and 1� Universal master mix(Applied Biosystems). The JCV copy number was determined for each experi-mental sample by comparison to the JCV plasmid standard curve by usingSequence Detection software (Applied Biosystems) and normalization to thetotal amount of DNA extracted from a sample. Zero copies of JCV DNA weredetected in a noninfected negative control. P values were calculated by a Studentt test.

Determination of rates of viral inhibition. We determined the percentage ofcells infected following exposure to JCV by dividing the number of immunoflu-orescent cells by the total number of nucleated cells and then multiplying thatvalue by 100, that is, percent JCV-positive cells (total number of VP1-positivecells)/(total number of DAPI-positive cells) � 100. The percent viral inhibition bya compound was calculated on the basis of the percentage of JCV-positive cellsrather than the number of VP1-positive cells: percent JCV inhibition [1 �(percent JCV-positive cells with a compound � percent JCV-positive cells in thenegative control)/(percent JCV-positive cells in the positive control � percentJCV-positive cells in the negative control)] � 100, where the positive controlrepresents cells infected with virus in the absence of any compound and thenegative control denotes cells not infected with virus. The number of JCV-positive cells in the negative control samples quantitated with the CellomicsArrayScan imager was always 1% of the number of JCV-positive cells in thepositive control. The percentage of JCV DNA replication inhibition was calcu-lated as [1 � (JCV DNA copy number in cells treated with a compound/JCVDNA copy number in the positive control)] � 100. Zero copies of the JCVgenome were detected in negative control samples. For high-throughput screen-ing of the compounds, we calculated the Z factor, which was equal to 1 � [3 � (�p ��n)/��p � �n�], where � is the mean, � is the standard deviation, p is the positivecontrol, and n is the negative control (61). The intraplate intragroup coefficientof variance was always below 20%, and Z� was always �0.5. EC50s were calcu-lated with Prism software (GraphPad Software Inc., La Jolla, CA). The EC50 wascalculated by fitting of a sigmoid dose-response curve, Y bottom � {(top �bottom)/[1 � 10ˆ(X � log EC50)]}, where X is the logarithm of the inhibitorconcentration, Y is the response (i.e., percent inhibition), top is the highestobserved value, and bottom is the lowest observed value.

Molecular modeling and in silico screening. The ROCS program (version2.3.1; Openeye Scientific Software, Santa Fe, NM) was used to compare thethree-dimensional shapes of diverse compound classes and to perform virtualscreening against clinical compounds extracted from the MDL Drug Data Re-port database (Symyx Technologies, Inc.). The program OMEGA2 (version2.3.0; Openeye Scientific Software) was used to generate multiple low-energyconformations of the compounds. The three-dimensional enumerated conform-ers were compared on the basis of the implicit Mills-Dean atom chemical forcefield scheme in conjunction with the shape-base matching algorithm of theROCS program (version 2.3.1; Openeye Scientific Software). The overlays withthe best scores were visualized in the PyMOL program (version 1.0.0b15;DeLano Scientific LLC, Palo Alto, CA).

RESULTS

Primary screen: JCV infectivity assay. To identify drugs withanti-JCV activity, we screened a commercially available collec-tion of approximately 2,000 approved drugs and bioactive com-pounds, called the Spectrum collection, for their anti-JCV ac-tivities in an in vitro viral infectivity assay (48). As a primaryscreen, we monitored inhibition of the viral infection rate ina human fetal astroglial cell line (SVG-A) infected withJCV(M1/SVE�), a modified form of JCV. SVG-A cells (38)were chosen for use in the primary screening assay, as theyrepresent one of the few available cell lines permissive for JCVreplication, and JCV(M1/SVE�) was chosen because its infec-tion of SVG-A cells results in an accelerated rate of viralreplication that permits the earlier detection of infected cellsrelative to that observed with other cell types and JCV isolates(3 versus 6 to 10 days postinfection). The JCV(M1/SVE�)genome includes the coding sequences of prototype strainJCV(Mad1) isolated from a patient with PML (24, 45) linkedto hybrid JCV-SV40 noncoding regulatory sequences (58).

This rearrangement of transcriptional signals extends the spe-cies and cell type host range of the virus.

To facilitate screening of the Spectrum collection, weadapted the JCV infectivity assay (48) to a 96-well format andemployed a Cellomix ArrayScan high-content imager to mea-sure JCV replication. In this system, infected cells can bedetected by immunofluorescent staining with antibodies thatrecognize the JCV capsid protein, VP1. The total numbers ofcells in the culture were visualized by staining with DAPI,which stains DNA (Fig. 1A). Use of the Cellomics ArrayScanimager allowed us to simultaneously identify and count eachDAPI- and VP1-positive event in the assay well and routinelycounted 300 to 800 VP1-positive and 8,000 to 16,000 DAPI-positive events per well, thus minimizing variability due to anonuniform cell growth pattern and/or intrawell viral spread.By using this format, 4 to 7% of all cells were found to expressJCV VP1 72 h postinfection, and the number of infected cells(i.e., VP1-positive cells) at the end of the culture period wasproportional to the number of infectious viral particles used toinfect the cell culture (Fig. 1B). In each experiment, the high-est viral dilution that yielded maximum infectivity was used.Using neutralizing rabbit anti-JCV serum as a positive controlfor the inhibition of infectivity, we showed that the assay re-sponds to viral inhibition in a predictive fashion (Fig. 1C).

We initially tested the compounds for their antiviral activi-ties at a single dose (10 �M) and noticed that some of thecompounds that inhibited the number of virus-infected cells(i.e., VP1-positive cells) to a great extent also dramaticallyreduced the total number of cells (i.e., DAPI-positive events),suggesting the occurrence of cytotoxic or cytostatic effects. Todetermine whether a particular compound had decreased thenumber of virus-infected cells because of its antiviral effect, wecalculated the percent viral inhibition using the infection rate(i.e., the percentage of JCV-positive cells) rather than the totalnumber of JCV-infected cells (i.e., the number of VP1-positivecells). With this system, we observed that treatment with cido-fovir, a drug that has been tested clinically for its efficacy inpatients with PML (21, 27, 39), inhibited the number of in-fected cells and the total number of cells in culture to the samedegree, indicating that the percent inhibition of the infectionrate (i.e., the percentage of JCV-positive cells) was not signif-icant (Fig. 1D). Similar effects were noted for other drugsreported to have cytotoxic effects, e.g., mitomycin C and cyt-arabine (data not shown). Therefore, we determined the anti-viral activity of each compound by calculating viral inhibitionon the basis of the percentage of JCV-positive cells rather thanthe absolute number of JCV-positive cells per group.

Drug screening and selection. A number of drugs and com-pounds that inhibited the JCV infection rate by �20% withoutcausing significant cell toxicity (20% total cell number inhi-bition) were identified (Fig. 2). We chose 20% as a cutoff forthe first-pass screening because the coefficient of variancevalue of our assay was consistently 20%; 67 compounds ful-filled this criterion (see the table in the supplemental mate-rial). These compounds were subsequently tested in the sameassay by using several different concentrations to further eval-uate their therapeutic potential. On the basis of the dose-response data, 14 drugs proved to be effective and demon-strated �50% inhibition of virus-infected cells (EC50, 20�M) without inducing significant cell toxicity (20% total cell

1842 BRICKELMAIER ET AL. ANTIMICROB. AGENTS CHEMOTHER.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

ac o

n 24

Nov

embe

r 20

21 b

y 21

3.23

1.13

9.18

7.

number inhibition) (Table 1). The compounds that had re-duced the total cell number by �80% were retested at lowerconcentrations, but none that demonstrated a clear anti-JCVeffect without a concomitant cytotoxic or cytostatic effect wereidentified (Fig. 2). We chose to proceed with testing only with

the drugs that did not reduce the total cell numbers to diminishthe chance of confounding an antiviral effect with a cytotoxic orcytostatic effect.

JCV actively replicates and destroys oligodendrocytes in theCNS of PML patients. Therefore, it is crucial to the success ofany potential PML therapy that the candidate drug be capableof achieving an efficacious concentration in the brain. Unfor-tunately, many drugs are incapable of penetrating the BBB. Onthe basis of a review of the literature (Table 1), only 1 of the 14compounds with anti-JCV activity, mefloquine, has beenshown to accumulate in the brains of treated patients at theconcentration at which it is efficacious in vitro (EC50, 3.9 � 2.1�M) (Fig. 3A). A postmortem brain analysis of people takingmefloquine prior to their deaths measured 35 to 50 nmol ofdrug per gram of brain tissue, or approximately 35 to 50 �M(33, 47). Since potentially efficacious doses of mefloquinecould be achieved in the brains of patients receiving approveddoses of the drug, subsequent experiments focused upon char-acterization of the anti-JCV activity of mefloquine.

Characterization of mefloquine activity in primary cell cul-ture. To further characterize the effect of mefloquine on theactivity of JCV, experiments were performed to evaluatewhether the JCV-inhibitory effect of mefloquine was depen-dent on the cell line used in the primary screen. The SVG-Acell line has been propagated in vitro for many generations and

FIG. 1. Detection and measurement of JCV infection. (A) SVG-A cells infected with JCV(M1/SVE�) were fixed and stained 3 dayspostinfection with murine monoclonal antibodies specific for VP1 protein (green staining). All cells present in the culture were visualized withDAPI DNA nuclear staining (blue). The picture was taken with a Cellomics ArrayScan camera. Magnification, �200. (B) The number of infectedcells (i.e., VP1-positive cells) per group is plotted against the dilution factor of the viral stock used to infect the cells (mean � standard deviation[n 2]; blue line). The total numbers of cells (yellow bars) were similar for all groups. Cells were infected in the presence of various dilutions ofJCV-neutralizing antiserum (C) or cidofovir (D). Cells were fixed and stained at 3 days postinfection, and the total numbers of VP1-positive andDAPI-positive events per treatment group were determined with a Cellomics ArrayScan imager. Data are presented as percent inhibition relativeto that for the no-drug control of the number of JCV-positive (JCV�) cells, the total number of cells, or the number of JCV-positive cellsnormalized by total cell number (percent JCV-positive cells). Data from a representative experiment of at least three performed are shown.

FIG. 2. Flowchart describing the steps used to screen the com-pounds in the Spectrum collection. Primary screening employed theSVG-A cell line and the virus JCV(M1/SVE�), and the assay wasperformed as described in the legend to Fig. 1. TC50, drug concentra-tion for inhibition of total cell numbers by 50%.

VOL. 53, 2009 MEFLOQUINE EFFICACY AGAINST JC VIRUS IN VITRO 1843

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

ac o

n 24

Nov

embe

r 20

21 b

y 21

3.23

1.13

9.18

7.

was transformed by an SV40 large T antigen that can enhanceJCV replication. To evaluate whether mefloquine is capable ofinhibiting viral replication in cells more closely resembling theJCV target cell in the human brain, experiments were per-formed with primary glial cells. In vitro infection of homoge-neous cultures of primary oligodendrocytes, a primary JCVtarget in the brains of patients with PML, has not been estab-lished; therefore, we employed human fetal astrocytes to testthe ability of mefloquine to inhibit viral infection in a primarycell culture. In these cells, mefloquine inhibits JCV infectionwith essentially the same efficacy as it inhibits viral infection inSVG-A cells (Fig. 3B). These data suggest that the anti-JCVeffect of mefloquine occurs in a more relevant cellular back-ground.

Characterization of mefloquine effects on natural JCV iso-lates. Experiments were performed to demonstrate that theinhibitory effect of mefloquine is not limited to the JCV(M1/SVE�) construct used in the primary screening assay.JCV(M1/SVE�) was used because of its faster growth kineticsand ease of preparation relative to those of in vivo isolates ofJCV; however, the transcription of its JCV genes is not regu-lated by an authentic JCV enhancer element. To ensure thatmefloquine’s antiviral activity is not limited to this modifiedvirus, we tested mefloquine’s ability to inhibit JCV(Mad4), anin vivo isolate from a PML patient (46). On the basis of theresults of five independent experiments, mefloquine inhibitedJCV(Mad4) infection of SVG-A cells with the same efficacyas it did JCV(M1/SVE�) infection (Fig. 3C), demonstratingthat mefloquine has an effect against a known pathogenic formof JCV.

Characterization of mefloquine’s effect on JCV DNA repli-cation. To better understand mefloquine’s mechanism of ac-tion and to address whether this drug inhibits viral DNA rep-lication as opposed to a later step in the viral life cycle, a qPCRassay was employed to measure viral DNA levels in treated anduntreated cells. The results presented in Fig. 3D indicate that

the percentage of JCV DNA replication inhibited by meflo-quine closely paralleled the percent inhibition of the infectionrate, suggesting that mefloquine inhibits the infection rate atone of the steps involved in viral DNA replication and not VP1protein expression. We sought to extend this observation to aJCV(Mad1) infection of the naïve cells most commonly used topropagate the virus in culture, PHFG cells. At days 7 and 10postinfection, mefloquine inhibited JCV(Mad1) DNA replica-tion in these cells with nearly the same efficacy (EC50, �5 �M)that it inhibited JCV(M1/SVE�) DNA replication in SVG-Acells (Fig. 3E).

Effect of mefloquine on established JCV infection. Our ex-periments indicated that mefloquine inhibited JCV infectionwhen it was added to cells at the same time that the virus wasadded, but it was not clear from the results of those experi-ments whether mefloquine inhibited viral entry of the cells ora later step in the viral life cycle. Once PML is diagnosed, manycells have already been infected, and a preferred drug candi-date for PML treatment should demonstrate an ability to in-hibit an ongoing viral replication cycle. To investigate thispossibility, mefloquine was added to cells at the time of infec-tion or 3 or 24 h postinfection and the antiviral activity wasmeasured. Mefloquine effectively inhibited JCV infection un-der all three conditions (Fig. 3F). Since most of the virus entersthe cells within 1 h and all of the virus entered the cells by 24 hpostinfection in our assay (the addition of JCV-neutralizingantiserum 24 h after virus addition was completely ineffectiveat blocking viral infection), our results suggest that mefloquinewould effectively inhibit viral replication in cells already in-fected with JCV.

Lack of inhibitory effect of CSF on anti-JCV effect of meflo-quine. While 98% of the mefloquine in plasma is reported tobe protein bound, high ratios of the concentration in tissue tothe concentration in plasma have been described (41). It is notclear how mefloquine’s high level of protein binding mightaffect its anti-JCV activity; therefore, we tested the drug’s

TABLE 1. JCV inhibitors identified from screening of Spectrum collectiona

Inhibitor name Therapeutic use Statusb TC50c (�M) EC50 (�M)

Concn (�M)d Reference(s) forpharmacokinetic

dataBrain Plasma

Isotretinon Antineoplastic USP, INN, BAN �40 4.4 �7.3e 24 22, 34Mefloquine Antimalarial USAN, INN, BAN 16.1 4.0 30–50 6.0 33, 47Diclofenac sodium Antiinflammatory USP, JAN 30.5 8.3 2.7e 8.0 26, 51Diltiazem hydrochloride Ca channel blocker USP, INN, BAN, JAN �40 8.5 �1.1e 0.5 9, 12Fusidic acid Antibacterial USAN, INN, BAN �40 8.6 1.9 19–171 40, 56Miconazole nitrate Antifungal USP, JAN 22.9 8.6 NAf 0.024 55Mefenamic acid Anti-inflammatory USP, INN, BAN, JAN �40 10.9 2.4e 40–80 26, 29Flunixin meglumine Anti-inflammatory USP, veterinary �40 16.6Propanil NA �40 7.8Dehydroabietamide NA �40 13.0Diffractic acid NA �40 14.4Harmane NA �40 14.4Xanthone NA �40 16.8Methoxyvone NA �40 17.2

a The compounds selected had anti-JCV activity (EC50) at �20 �M and a therapeutic index (TC50/EC50) of �2.b USP, United States Pharmacopeia; INN, International Nonproprietary Name; BAN, British Approved Name; USAN, U.S. Approved Name; JAN, Japanese

Approved Name.c TC50, inhibition of total cell numbers by 50%.d The highest concentration achieved in the brain or plasma/serum, as reported in the literature.e No data for humans are available; the data are based on the data reported from animal studies.f NA, not applicable.

1844 BRICKELMAIER ET AL. ANTIMICROB. AGENTS CHEMOTHER.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

ac o

n 24

Nov

embe

r 20

21 b

y 21

3.23

1.13

9.18

7.

efficacy in the presence of increasing concentrations of humancerebrospinal fluid (CSF) to mimic the conditions encounteredby the drug in the brain. To this end, we added CSF at a finalconcentration of 2%, 10%, or 20% over a range of mefloquine

concentrations and calculated the EC50 for viral inhibition. Asshown in Fig. 4, the EC50s were consistent for all levels of CSFadded to the culture (up to 20%).

Characterization of antiviral effects of mefloquine enantiomersand analogs. Mefloquine is a racemic mixture of (11R,12S) and(11S,12R) enantiomers of (2,8-bis-trifluoromethyl-quinolin-4-yl)-piperidin-2-yl-methanol hydrochloride (Fig. 5A and B). Whilethere is a minimal difference between the activities of the enan-tiomers against malaria (5, 13), the (R,S) enantiomer has a muchmore potent (�1,000-fold) antagonistic activity against the A2aadenosine receptor (59). The two enantiomers also display dif-ferent pharmacokinetics and brain penetration properties (6, 11).To better understand the anti-JCV effects of the two componentsof the marketed mefloquine racemate, each enantiomer was sep-arated from the racemate by chiral chromatography and tested inthe JCV inhibition assay. The two enantiomers were found tohave similar efficacies in inhibiting JCV. Although the differencein activity was small, it was statistically significant, with (R,S)-mefloquine being less than twofold more active (2.7 versus 4.5�M; P 0.02) than (S,R)-mefloquine or a racemate (2.7 versus4.0 �M; P 0.036) (Fig. 5A and B). On the basis of this resultand on the reported brain concentrations for mefloquine enan-tiomers (6), we conclude that an efficacious concentration ofmefloquine would be achieved in the brains of PML patients

FIG. 3. Characterization of mefloquine anti-JCV effect. (A and B) To further characterize the anti-JCV effect of mefloquine in different celltypes and against different JCV isolates, viral infections were performed over the range of mefloquine concentrations in SVG-A cells withJCV(M1/SVE�) (n 12) (A), in primary human fetal astrocytes with JCV(M1/SVE�) (B), or in SVG-A cells with JCV(Mad4) (n 5) (C). (Dand E) Characterization of the effect of mefloquine on the inhibition of JCV DNA replication. (D) Viral T-antigen DNA was quantified in thepresence of various drug concentrations by qPCR in SVG-A cells infected with JCV(M1/SVE�); the inhibition of JCV DNA copy number andthe inhibition of JCV-positive (JCV�) cells were measured in a replicate plates, the results of one representative experiment of two performed areshown. (E) By using the same qPCR assay, mefloquine’s ability to inhibit JCV(Mad1) DNA replication in PFHG cells was measured over a rangeof drug concentrations at days 7 and 10 postinfection. The graph represents the average percent JCV DNA inhibition for three independentexperiments with duplicate samples per time point. (F) The effect of the delay of mefloquine addition was measured in cultures of primary humanfetal astrocytes infected with JCV(M1/SVE�). Cells were exposed to various concentrations of mefloquine at the same time (T) as virus additionor at 3 h or 24 h after virus addition. Ten days after infection with virus, cells were fixed and stained and the number of virus-infected cells wasdetermined. The results of a representative experiment of five experiments conducted with either primary astrocytes or SVG-A cells is shown. Themethod used for the calculation of percent JCV inhibition is described in Materials and Methods. Inhibition of total cell numbers (i.e.,DAPI-positive events) was less than 20% for all drug concentrations plotted. Unless otherwise noted, only one representative graph is shown, butthe EC50 is calculated as an average of all experiments.

FIG. 4. Human CSF does not interfere with mefloquine’s anti-JCVactivity. SVG-A cells were infected with JCV(M1/SVE�) over a range ofmefloquine concentrations in the presence of 2%, 10%, or 20% humanCSF. Three days later the cells were fixed and stained and the totalnumbers of VP1-positive cells and DAPI-positive events per treatmentgroup were determined with a Cellomics ArrayScan imager. The resultsfrom one representative experiment (of a total of two independent ex-periments) are shown. The method used for the calculation of the percentJCV inhibition is described in Materials and Methods.

VOL. 53, 2009 MEFLOQUINE EFFICACY AGAINST JC VIRUS IN VITRO 1845

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

ac o

n 24

Nov

embe

r 20

21 b

y 21

3.23

1.13

9.18

7.

taking the drug. Furthermore, the very small difference in theanti-JCV activities between the enantiomers suggests that thiseffect is not mediated by the A2a adenosine receptor.

To further explore the structure-activity relationship for me-floquine, we acquired and tested other mefloquine analogs.Specifically, we tested a racemic mixture of (11S,12S) and(11R,12R) enantiomers of mefloquine (Fig. 5C) and of thepyridine analog of mefloquine, (2,8-bis-trifluoromethyl-quino-lin-4-yl)-pyridin-2-yl-methanol (Fig. 5D). The activity of threo-(R*,R*)-mefloquine (Fig. 5C) was almost the same as the ac-tivity of erythro-(R*,S*)-mefloquine (4.6 versus 4.5 �M),indicating that some degree of flexibility exists in the chiralcenters at positions 11 and 12 of the mefloquine moleculerequired for the inhibition of JCV replication. On the otherhand, when the piperidine moiety was replaced with the pyri-dine, as in (2,8-bis-trifluoromethyl-quinolin-4-yl)-pyridin-2-yl-methanol (Fig. 5D), the anti-JCV activity was dramaticallyreduced. These results indicate that the presence of a saturatedheterocycle at this position is crucial for target inhibition.

Modeling studies suggest shape similarities among chemi-cally diverse JCV inhibitors. To gain insights into the potentialmechanism of action or molecular target of mefloquine in theinhibition of JCV replication, we analyzed the chemical classesof drugs with inhibitory activity (see the table in the supple-mental material) and found that arylanthranilic and arylal-kanoic acid nonsteroidal anti-inflammatory drugs (NSAIDs)(Table 1; Fig. 6) represented the most frequent class of inhib-itors. This observation suggests that a common structural motifis shared by at least some JCV inhibitors. To explore the

structural relationships among chemically diverse JCV inhibi-tors, we compared their three-dimensional shapes while as-suming that molecules have similar shapes if their volumesoverlay well. Conversely, any volume mismatch would repre-sent a measure of dissimilarity. Such shape- and chemicalfeature-based comparisons (52) indicate that mefloquine,mefenamic acid, and indomethacin can occupy the same con-formational space (Fig. 7). We then extended this analysis tocompounds in clinical testing reported in the MDL Drug DataReport database and discovered that mefloquine overlaid wellwith several nucleoside analogues, such as 8-chloroadenosine3�,5�-monophosphate (Fig. 7) and 3-deazaadenosine (data notshown). The last two compounds inhibited the rate of infectionof JCV(M1/SVE�) in SVG-A cells with efficacies similar to theefficacy observed with mefloquine (Fig. 7 and data not shown).Taken together, these data suggest that chemically diverse JCVinhibitors may have a common mechanism of viral inhibitionand act, in part, as mimetics of nucleoside analogues.

DISCUSSION

PML is a devastating neurodegenerative viral disease thataffects some immunosuppressed individuals, including 4 to 5%of HIV-positive patients with AIDS and those undergoing im-munosuppressive therapies (for a review, see reference 8).Reconstitution of a patient’s immune system either by highlyactive antiretroviral therapy for HIV-positive individuals or bymoderating the immunosuppressive therapies, whenever pos-sible, for others is the only treatment option available today formanagement of this disease. Although different drugs havebeen tested as potential treatments for PML, all have failed todemonstrate clinical efficacy, thus keeping the search for drugswith anti-JCV activity a high priority. We report here on theidentification of a number of drugs with anti-JCV activity de-termined by in vitro screening of a commercially availablecollection of approved drugs and bioactive compounds.

FIG. 5. Anti-JCV activities of various forms of mefloquine. The(R,S)-mefloquine (A) and (S,R)-mefloquine (B) enantiomers wereseparated from a mefloquine drug racemate by chiral chromatography;the racemate of (S,S)- and (R,R) enantiomers of mefloquine (C) or(2,8-bis-trifluoromethyl-quinolin-4-yl)-pyridin-2-yl-methanol (D) wereadded to SVG-A cells simultaneously with JCV(M1/SVE�). The cellswere fixed and stained at 3 days postinfection, and the total numbersof VP1-positive cells and DAPI-positive events per treatment groupwere determined with a Cellomics ArrayScan imager. The results ofone representative experiment of a total of six (A and B) or two (C andD) performed are shown. EC50s are the means of all experimentsperformed. Ten micromolar was the highest concentration tested; TI,therapeutic index (TC50/EC50).

FIG. 6. Structure-activity relationship of the arylanthranilic andarylalkanoic acid JCV inhibitors. Viral inhibition was measured by aninfectivity assay with SVG-A cells and JCV(M1/SVE�). The EC50 datarepresent averages calculated from two or more experiments, and thetherapeutic index (TC50/EC50) was �3 for all compounds shown.

1846 BRICKELMAIER ET AL. ANTIMICROB. AGENTS CHEMOTHER.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

ac o

n 24

Nov

embe

r 20

21 b

y 21

3.23

1.13

9.18

7.

Cytarabine, cidofovir, and alpha interferon have all beenreported to exert anti-JCV activities in vitro; but for PMLpatients they do not offer protection or an improvement incondition over that observed with placebo (for a review, seereference 7). It is possible that the specific pharmacologicalproperties of these drugs in vitro and in vivo are responsible fordiscrepancies between the results obtained in in vitro infectiv-ity assays and those obtained in in vivo clinical trials. Cytara-bine has a short half-life, and although it may reach a concen-tration of �4 �M in the CSF (37), studies with animals suggestthat it does not cross the BBB to accumulate in the brainparenchyma in an amount required to inhibit JCV replication(30). The well-known toxicities of cytarabine (i.e., bone mar-row suppression and nephrotoxicity) do not allow it to beadministered frequently or for an extended period of time tocompensate for its unfavorable pharmacokinetic properties.Cidofovir was chosen as a treatment for PML on the basis of itsactivity against murine polyomavirus and SV40 polyomavirus(2). However, cidofovir displays little (31) or no (Fig. 1D)anti-JCV activity in vitro at the doses achievable in the plasmaof treated patients (10 �M); brain biodistribution data do notappear to be available for this drug. Data addressing the abilityof alpha interferon to cross the BBB are also lacking, but onthe basis of the size of the interferon molecule and its shorthalf-life in blood, one may predict that it would not accumulatein the brain in significant amounts (53). Because JCV infectsand replicates in cells throughout the entire white matter of the

brain, an effective drug candidate for the treatment of PMLmust be able to cross the BBB and accumulate throughout theentire brain parenchyma at a dose sufficient to suppress JCVproliferation.

Our initial screening identified several drugs with anti-JCVactivities (Table 1), but only mefloquine was shown to accu-mulate to therapeutically relevant levels in the brain tissue ofpeople receiving clinically approved doses. This drug crossesthe BBB and accumulates in the brain at concentrations that,when the drug is tested in cultured cells, lead to the inhibitionof JCV infection (33, 47). The drug is likely to accumulate inthe brain parenchyma at a concentration much higher thanthat in the plasma because of its long plasma half-life, lipophi-licity (log P 2.47), and inhibition of MDR-1, a multidrugresistance protein responsible for the efflux of drugs out of thebrain (47, 50).

It was recently suggested that 5HT2A receptor blockersmight be potential drug candidates for the treatment of PMLon the basis of their ability to obstruct the binding of the JCVcapsid to its purported cellular receptor (23, 43). This obser-vation remains controversial, as a second group failed to detectthe anti-JCV activity of 5HT2A blockers (15) and we failed touncover such activity for more than 20 drugs in the Spectrumcollection belonging to this class of inhibitors (data not shown).Even in those studies reporting that 5HT2A blockers had an-tiviral activity, the inhibitory mechanism involves a block toJCV cell entry and not a block to viral proliferation in cells

FIG. 7. Shape similarity among chemically diverse JCV inhibitors. The shapes and chemical features of mefloquine (magenta), mefenamic acid(yellow), indomethacin (gray), and 8-chloroadenosine 3�,5�-monophosphate (green) are compared. The overlays were achieved with the ROCSprogram and were visualized by the use of PyMOL software.

VOL. 53, 2009 MEFLOQUINE EFFICACY AGAINST JC VIRUS IN VITRO 1847

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

ac o

n 24

Nov

embe

r 20

21 b

y 21

3.23

1.13

9.18

7.

already infected with JCV (43). Since a great many glial cellsare already infected once a diagnosis of PML is made, the beststrategy for the prevention of further brain damage and fortreatment would be to inhibit viral replication that has alreadybeen established. We report here that mefloquine reduces JCVreplication by acting at a step subsequent to viral entry into thecell.

We have employed qPCR to quantify the number of viralgenome copies in infected PHFG and SVG-A cell cultures,and we have used this approach to demonstrate that meflo-quine inhibits JCV DNA replication. Although mefloquine wasdiscovered more than 30 years ago, its molecular target(s) inpatients with malaria has not been identified. Overall, very fewmolecular targets of mefloquine have been identified, so it isnot surprising that the precise molecular mechanism by whichmefloquine interferes with JCV DNA replication remains un-known. (11S,12R)-Mefloquine is a specific and high-affinityinhibitor of the adenosine A2a receptor (59). Still, the adeno-sine A2a receptor does not appear to be a relevant target forJCV inhibition because while (11R,12S)-mefloquine is �1,000-fold more active than the (11S,12R) enantiomer against aden-osine A2aR, it is only 2-fold more active than the other enan-tiomer as a JCV inhibitor. Furthermore, we tested a number ofspecific adenosine receptor inhibitors, and none of them werefound to effectively inhibit JCV infection (data not shown). Inour search for a common motif among compounds in theSpectrum collection with anti-JCV activities, we noted thatN-arylanthranilic and arylalkanoic acid NSAIDs are dispropor-tionately represented as a class. Although many of these mol-ecules inhibit COX-1 and COX-2 activities as well as prosta-glandin synthesis, such mechanisms do not seem relevant totheir anti-JCV activity, as other NSAIDS in the library from adifferent molecular class, e.g., arylpropionic acid ibuprofen orflurbiprofen, do not display anti-JCV activity, despite theirCOX-inhibitory activity.

It is intriguing that the three-dimensional confirmation ofmefloquine fits into the shapes of arylanthranilic and arylal-kanoic acid NSAIDs (Fig. 7), suggesting that while these com-pounds belong to different chemical classes, all may share acommon molecular target. A search for other molecules withthree-dimensional structures similar to those of mefloquineand mefenamic acid revealed several adenosine analogs (e.g.,3-deazaadenosine and 8-chloroadenosine 3�,5�-monophos-phate) with anti-JCV activities. One might speculate that theseinhibitors bind to an ATP- or nucleotide-binding pocket of amolecule crucial for viral replication and disrupt its function.Since these drugs do not show cytotoxic effects at doses thatexhibit anti-JCV effects, it is possible that they directly inhibitT antigen, the JCV-encoded replication protein, rather thanthe cellular DNA replication machinery required for viral rep-lication. The conserved T antigen of polyomaviruses is a hex-americ helicase that hydrolyzes ATP and forms an ATP-de-pendent replication complex at the AT-rich viral origin ofreplication (42, 60). Direct biochemical experiments will berequired to investigate whether mefloquine targets this multi-functional viral protein.

In summary, mefloquine inhibits the replication of threedifferent JCV isolates in three different cell types. Further-more, mefloquine inhibits viral replication in cells previouslyinfected with JCV. Finally, mefloquine accumulates in brain

tissue at levels more than sixfold its EC50. Although no appro-priate animal model is available to test the ability of meflo-quine to inhibit JCV in vivo, our in vitro data coupled withpublished biodistribution data for this drug suggest that me-floquine could represent an effective therapeutic agent for thetreatment of PML. Currently, a controlled randomized clinicaltrial is under way to determine if mefloquine provides clinicalefficacy for viral inhibition and protection from neurologicaldamage in PML patients.

ACKNOWLEDGMENTS

We are grateful to Walter Atwood and Duard Walker for theirgenerosity in providing valuable reagents and to Walter Atwood andBrigitte Bollag (Penn State University) for assistance in establishingthe JCV infectivity assay and the protocol for propagating PHFG cells,respectively. We thank Ted Lin and Kevin Guckian (both from BiogenIDEC Inc.) for their help with compound verification. We appreciateeditorial help and discussions from Susan Goelz, Petra Duda, andDebra Kinch.

REFERENCES

1. Aksamit, A. J. 2001. Treatment of non-AIDS progressive multifocal leukoen-cephalopathy with cytosine arabinoside. J. Neurovirol. 7:386–390.

2. Andrei, G., R. Snoeck, M. Vandeputte, and E. De Clercq. 1997. Activities ofvarious compounds against murine and primate polyomaviruses. Antimicrob.Agents Chemother. 41:587–593.

3. Atwood, W. J. 2001. A combination of low-dose chlorpromazine and neu-tralizing antibodies inhibits the spread of JC virus (JCV) in a tissue culturemodel: implications for prophylactic and therapeutic treatment of progres-sive multifocal leukencephalopathy. J. Neurovirol. 7:307–310.

4. Atwood, W. J., L. Wang, L. C. Durham, K. Amemiya, R. G. Traub, and E. O.Major. 1995. Evaluation of the role of cytokine activation in the multiplica-tion of JC virus (JCV) in human fetal glial cells. J. Neurovirol. 1:40–49.

5. Basco, L. K., C. Gillotin, F. Gimenez, R. Farinotti, and J. Le Bras. 1992. Invitro activity of the enantiomers of mefloquine, halofantrine and enpirolineagainst Plasmodium falciparum. Br. J. Clin. Pharmacol. 33:517–520.

6. Baudry, S., Y. T. Pham, B. Baune, S. Vidrequin, C. Crevoisier, F. Gimenez,and R. Farinotti. 1997. Stereoselective passage of mefloquine through theblood-brain barrier in the rat. J. Pharm. Pharmacol. 49:1086–1090.

7. Berger, J. R. 2000. Progressive multifocal leukoencephalopathy. Curr. Treat.Options Neurol. 2:361–368.

8. Berger, J. R., and E. O. Major. 1999. Progressive multifocal leukoencepha-lopathy. Semin. Neurol. 19:193–200.

9. Bianchetti, G., S. Billy, V. Ascalone, S. Saivin, G. Houin, and P. Rosenzweig.1996. Multicenter studies on the pharmacokinetic profile of sustained-re-lease oral diltiazem (300 mg) after once a day repeated administration:influence of age. Int. J. Clin. Pharmacol. Ther. 34:195–201.

10. Bossolasco, S., G. Calori, F. Moretti, A. Boschini, D. Bertelli, M. Mena, S.Gerevini, A. Bestetti, R. Pedale, S. Sala, S. Sala, A. Lazzarin, and P. Cinque.2005. Prognostic significance of JC virus DNA levels in cerebrospinal fluid ofpatients with HIV-associated progressive multifocal leukoencephalopathy.Clin. Infect. Dis. 40:738–744.

11. Bourahla, A., C. Martin, F. Gimenez, V. Singhasivanon, P. Attanath, A.Sabchearon, T. Chongsuphajaisiddhi, and R. Farinotti. 1996. Stereoselec-tive pharmacokinetics of mefloquine in young children. Eur. J. Clin. Phar-macol. 50:241–244.

12. Bregante, M. A., J. J. Aramayona, L. J. Fraile, M. A. Garcia, and C. Solans.2000. Diltiazem blood pharmacokinetics in the pregnant and non-pregnantrabbit: maternal and foetal tissue levels. Xenobiotica 30:831–841.

13. Brocks, D. R., and R. Mehvar. 2003. Stereoselectivity in the pharmacody-namics and pharmacokinetics of the chiral antimalarial drugs. Clin. Pharma-cokinet. 42:1359–1382.

14. Brooks, B. R., and D. L. Walker. 1984. Progressive multifocal leukoenceph-alopathy. Neurol. Clin. 2:299–313.

15. Chapagain, M. L., S. Verma, F. Mercier, R. Yanagihara, and V. R. Nerurkar.2007. Polyomavirus JC infects human brain microvascular endothelial cellsindependent of serotonin receptor 2A. Virology 364:55–63.

16. Cinque, P., S. Bossolasco, A. M. Brambilla, A. Boschini, C. Mussini, C.Pierotti, A. Campi, S. Casari, D. Bertelli, M. Mena, and A. Lazzarin. 2003.The effect of highly active antiretroviral therapy-induced immune reconsti-tution on development and outcome of progressive multifocal leukoenceph-alopathy: study of 43 cases with review of the literature. J. Neurovirol.9(Suppl. 1):73–80.

17. Cinque, P., I. J. Koralnik, and D. B. Clifford. 2003. The evolving face ofhuman immunodeficiency virus-related progressive multifocal leukoenceph-alopathy: defining a consensus terminology. J. Neurovirol. 9(Suppl. 1):88–92.

1848 BRICKELMAIER ET AL. ANTIMICROB. AGENTS CHEMOTHER.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

ac o

n 24

Nov

embe

r 20

21 b

y 21

3.23

1.13

9.18

7.

18. Clifford, D. B., C. Yiannoutsos, M. Glicksman, D. M. Simpson, E. J. Singer,P. J. Piliero, C. M. Marra, G. S. Francis, J. C. McArthur, K. L. Tyler, A. C.Tselis, and N. E. Hyslop. 1999. HAART improves prognosis in HIV-associ-ated progressive multifocal leukoencephalopathy. Neurology 52:623–625.

19. Crawford, L., and E. Harlow. 1982. Uniform nomenclature for monoclonalantibodies directed against virus-coded proteins of simian virus 40 and poly-oma virus. J. Virol. 41:709.

20. Crowder, C. D., K. A. Gyure, C. B. Drachenberg, J. Werner, R. E. Morales,H. H. Hirsch, and E. Ramos. 2005. Successful outcome of progressive mul-tifocal leukoencephalopathy in a renal transplant patient. Am. J. Transplant.5:1151–1158.

21. De Luca, A., A. Ammassari, P. Pezzotti, P. Cinque, J. Gasnault, J. Beren-guer, S. Di Giambenedetto, A. Cingolani, Y. Taoufik, P. Miralles, C. M.Marra, and A. Antinori. 2008. Cidofovir in addition to antiretroviral treat-ment is not effective for AIDS-associated progressive multifocal leukoen-cephalopathy: a multicohort analysis. AIDS 22:1759–1767.

22. Eckhoff, C., and C. C. Willhite. 1997. Embryonic delivered dose of isotreti-noin (13-cis-retinoic acid) and its metabolites in hamsters. Toxicol. Appl.Pharmacol. 146:79–87.

23. Elphick, G. F., W. Querbes, J. A. Jordan, G. V. Gee, S. Eash, K. Manley, A.Dugan, M. Stanifer, A. Bhatnagar, W. K. Kroeze, B. L. Roth, and W. J.Atwood. 2004. The human polyomavirus, JCV, uses serotonin receptors toinfect cells. Science 306:1380–1383.

24. Frisque, R. J., G. L. Bream, and M. T. Cannella. 1984. Human polyomavirusJC virus genome. J. Virol. 51:458–469.

25. Frye, S., C. Trebst, U. Dittmer, H. Petry, M. Bodemer, G. Hunsmann, T.Weber, and W. Luke. 1997. Efficient production of JC virus in SVG cells andthe use of purified viral antigens for analysis of specific humoral and cellularimmune response. J. Virol. Methods 63:81–92.

26. Fukuda, M., K. Kitaichi, F. Abe, Y. Fujimoto, K. Takagi, K. Takagi, T.Morishima, and T. Hasegawa. 2005. Altered brain penetration of diclofenacand mefenamic acid, but not acetaminophen, in Shiga-like toxin II-treatedmice. J. Pharmacol. Sci. 97:525–532.

27. Gasnault, J., P. Kousignian, M. Kahraman, J. Rahoiljaon, S. Matheron,J. F. Delfraissy, and Y. Taoufik. 2001. Cidofovir in AIDS-associated pro-gressive multifocal leukoencephalopathy: a monocenter observational studywith clinical and JC virus load monitoring. J. Neurovirol. 7:375–381.

28. Gasnault, J., Y. Taoufik, C. Goujard, P. Kousignian, K. Abbed, F. Boue, E.Dussaix, and J. F. Delfraissy. 1999. Prolonged survival without neurologicalimprovement in patients with AIDS-related progressive multifocal leukoen-cephalopathy on potent combined antiretroviral therapy. J. Neurovirol.5:421–429.

29. Glazko, A. J. 1966. Experimental observations on flufenamic, mefenamicand meclofenamic acids. 3. Metabolic disposition. Ann. Phys. Med.(Suppl.):23–36.

30. Groothuis, D. R., H. Benalcazar, C. V. Allen, R. M. Wise, C. Dills, C.Dobrescu, V. Rothholtz, and R. M. Levy. 2000. Comparison of cytosinearabinoside delivery to rat brain by intravenous, intrathecal, intraventricularand intraparenchymal routes of administration. Brain Res. 856:281–290.

31. Hall, C. D., U. Dafni, D. Simpson, D. Clifford, P. E. Wetherill, B. Cohen, J.McArthur, H. Hollander, C. Yainnoutsos, E. Major, L. Millar, J. Timpone,et al.. 1998. Failure of cytarabine in progressive multifocal leukoencepha-lopathy associated with human immunodeficiency virus infection. N. Engl.J. Med. 338:1345–1351.

32. Hirsch, H. H., C. B. Drachenberg, J. Steiger, and E. Ramos. 2006. Polyoma-virus-associated nephropathy in renal transplantation: critical issues ofscreening and management. Adv. Exp. Med. Biol. 577:160–173.

33. Jones, R., G. Kunsman, B. Levine, M. Smith, and C. Stahl. 1994. Mefloquinedistribution in postmortem cases. Forensic Sci. Int. 68:29–32.

34. Khan, A. A., J. G. Villablanca, C. P. Reynolds, and V. I. Avramis. 1996.Pharmacokinetic studies of 13-cis-retinoic acid in pediatric patients withneuroblastoma following bone marrow transplantation. Cancer Chemother.Pharmacol. 39:34–41.

35. Knowles, W. A. 2006. Discovery and epidemiology of the human polyoma-viruses BK virus (BKV) and JC virus (JCV). Adv. Exp. Med. Biol. 577:19–45.

36. Liu, C. K., A. P. Hope, and W. J. Atwood. 1998. The human polyomavirus,JCV, does not share receptor specificity with SV40 on human glial cells.J. Neurovirol. 4:49–58.

37. Lopez, J. A., E. Nassif, P. Vannicola, J. G. Krikorian, and R. P. Agarwal.1985. Central nervous system pharmacokinetics of high-dose cytosine arabi-noside. J. Neurooncol. 3:119–124.

38. Major, E. O., A. E. Miller, P. Mourrain, R. G. Traub, E. de Widt, and J.

Sever. 1985. Establishment of a line of human fetal glial cells that supportsJC virus multiplication. Proc. Natl. Acad. Sci. USA 82:1257–1261.

39. Marra, C. M., N. Rajicic, D. E. Barker, B. A. Cohen, D. Clifford, M. J.Donovan Post, A. Ruiz, B. C. Bowen, M. L. Huang, J. Queen-Baker, J.Andersen, S. Kelly, and S. Shriver. 2002. A pilot study of cidofovir forprogressive multifocal leukoencephalopathy in AIDS. AIDS 16:1791–1797.

40. Mindermann, T., W. Zimmerli, Z. Rajacic, and O. Gratzl. 1993. Penetrationof fusidic acid into human brain tissue and cerebrospinal fluid. Acta Neu-rochir. (Wien) 121:12–14.

41. Mu, J. Y., Z. H. Israili, and P. G. Dayton. 1975. Studies of the disposition andmetabolism of mefloquine HCl (WR 142,490), a quinolinemethanol antima-larial, in the rat. Limited studies with an analog, WR 30,090. Drug Metab.Dispos. 3:198–210.

42. Murakami, Y., and J. Hurwitz. 1993. DNA polymerase alpha stimulates theATP-dependent binding of simian virus tumor T antigen to the SV40 originof replication. J. Biol. Chem. 268:11018–11027.

43. O’Hara, B. A., and W. J. Atwood. 2008. Interferon beta1-a and selectiveanti-5HT(2a) receptor antagonists inhibit infection of human glial cells by JCvirus. Virus Res. 132:97–103.

44. Padgett, B. L., C. M. Rogers, and D. L. Walker. 1977. JC virus, a humanpolyomavirus associated with progressive multifocal leukoencephalopathy:additional biological characteristics and antigenic relationships. Infect. Im-mun. 15:656–662.

45. Padgett, B. L., D. L. Walker, G. M. ZuRhein, R. J. Eckroade, and B. H.Dessel. 1971. Cultivation of papova-like virus from human brain with pro-gressive multifocal leucoencephalopathy. Lancet i:1257–1260.

46. Padgett, B. L., D. L. Walker, G. M. ZuRhein, A. E. Hodach, and S. M. Chou.1976. JC papovavirus in progressive multifocal leukoencephalopathy. J. In-fect. Dis. 133:686–690.

47. Pham, Y. T., F. Nosten, R. Farinotti, N. J. White, and F. Gimenez. 1999.Cerebral uptake of mefloquine enantiomers in fatal cerebral malaria. Int.J. Clin. Pharmacol. Ther. 37:58–61.

48. Pho, M. T., A. Ashok, and W. J. Atwood. 2000. JC virus enters human glialcells by clathrin-dependent receptor-mediated endocytosis. J. Virol. 74:2288–2292.

49. Randhawa, P., F. Baksh, N. Aoki, D. Tschirhart, and S. Finkelstein. 2001. JCvirus infection in allograft kidneys: analysis by polymerase chain reaction andimmunohistochemistry. Transplantation 71:1300–1303.

50. Riffkin, C. D., R. Chung, D. M. Wall, J. R. Zalcberg, A. F. Cowman, M. Foley,and L. Tilley. 1996. Modulation of the function of human MDR1 P-glycop-rotein by the antimalarial drug mefloquine. Biochem. Pharmacol. 52:1545–1552.

51. Romsing, J., D. Ostergaard, T. Senderovitz, D. Drozdziewicz, J. Sonne, andG. Ravn. 2001. Pharmacokinetics of oral diclofenac and acetaminophen inchildren after surgery. Paediatr. Anaesth. 11:205–213.

52. Rush, T. S., III, J. A. Grant, L. Mosyak, and A. Nicholls. 2005. A shape-based 3-D scaffold hopping method and its application to a bacterial protein-protein interaction. J. Med. Chem. 48:1489–1495.

53. Seelig, A. 2007. The role of size and charge for blood-brain barrier perme-ation of drugs and fatty acids. J. Mol. Neurosci. 33:32–41.

54. Shitrit, D., L. Nirit, S. I. Shiran, G. Izbicki, D. Sofer, M. Eldad, and M. R.Kramer. 2003. Progressive multifocal leukoencephalopathy in a lung trans-plant recipient. J. Heart Lung Transplant. 22:946–950.

55. Stevens, R. E., J. Konsil, S. S. Verrill, P. Roy, P. B. Desai, D. H. Upmalis, andF. L. Cone. 2002. Bioavailability study of a 1200 mg miconazole nitratevaginal ovule in healthy female adults. J. Clin. Pharmacol. 42:52–60.

56. Turnidge, J. 1999. Fusidic acid pharmacology, pharmacokinetics and phar-macodynamics. Int. J. Antimicrob. Agents 12(Suppl. 2):S23–S34.

57. U.S. Pharmacopeia. 2005. USP dictionary of USAN and international drugnames. U.S. Pharmacopeia, Rockville, MD.

58. Vacante, D. A., R. Traub, and E. O. Major. 1989. Extension of JC virus hostrange to monkey cells by insertion of a simian virus 40 enhancer into the JCvirus regulatory region. Virology 170:353–361.

59. Weiss, S. M., K. Benwell, I. A. Cliffe, R. J. Gillespie, A. R. Knight, J.Lerpiniere, A. Misra, R. M. Pratt, D. Revell, R. Upton, and C. T. Dourish.2003. Discovery of nonxanthine adenosine A2A receptor antagonists for thetreatment of Parkinson’s disease. Neurology 61:S101–S106.

60. Wessel, R., J. Schweizer, and H. Stahl. 1992. Simian virus 40 T-antigen DNAhelicase is a hexamer which forms a binary complex during bidirectionalunwinding from the viral origin of DNA replication. J. Virol. 66:804–815.

61. Zhang, J. H., T. D. Chung, and K. R. Oldenburg. 1999. A simple statisticalparameter for use in evaluation and validation of high throughput screeningassays. J. Biomol. Screen. 4:67–73.

VOL. 53, 2009 MEFLOQUINE EFFICACY AGAINST JC VIRUS IN VITRO 1849

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

ac o

n 24

Nov

embe

r 20

21 b

y 21

3.23

1.13

9.18

7.