Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Copyright © 2019 Pei et al.This is an open-access article distributed under the terms of the Creative Commons Attribution4.0 International license, which permits unrestricted use, distribution and reproduction in anymedium provided that the original work is properly attributed.
Research Articles: Neurobiology of Disease
ICAM5 as a novel target for treating cognitiveimpairment in Fragile X Syndrome
https://doi.org/10.1523/JNEUROSCI.2626-18.2019
Cite as: J. Neurosci 2019; 10.1523/JNEUROSCI.2626-18.2019
Received: 15 October 2018Revised: 12 December 2019Accepted: 15 December 2019
This Early Release article has been peer-reviewed and accepted, but has not been throughthe composition and copyediting processes. The final version may differ slightly in style orformatting and will contain links to any extended data.
Alerts: Sign up at www.jneurosci.org/alerts to receive customized email alerts when the fullyformatted version of this article is published.
1 1
ICAM5 as a novel target for treating cognitive impairment in Fragile X 1
Syndrome 2
3
Abbreviated title: ICAM5 in Fragile X Syndrome 4
5
Author names and affiliations: Ya-ping Pei1,2,3*, Yue-yi Wang1,2,3*,Dan Liu1,2,3*, 6
Hui-yang Lei5, Zhi-hao Yang1,2,3, Zi-wei Zhang1,2,3, Man Han1,2,3, Ke Cheng1,2,3, 7
Yu-shan Chen1,2,3, Jin-quan Li1,2,3, Gui-rong Cheng1,2,3, Lang Xu1,2,3, Qing-ming Wu1,2, 8
Shawn M. McClintock1,2,4, Ying Yang5, Yong Zhang6, Yan Zeng1,2,3 9 * Co-first authors 10 1 Brain and Cognition Research Institute, Wuhan University of Science and 11
Technology, Wuhan, China 12 2 Hubei Province Key Laboratory of Occupational Hazard Identification and Control, 13
Wuhan University of Science and Technology, Wuhan, China 14 3 Big Data Science and Engineering Research Institute, Wuhan University of Science 15
and Technology, Wuhan, China 16 4 Department of Psychiatry, UT Southwestern Medical Center, Dallas, Texas, USA 17 5 Department of Pathophysiology, School of Basic Medicine and The Collaborative 18
Innovation Center for Brain Science, Key Laboratory of Hubei Province and Ministry 19
of Education of China for Neurological Disorders, Tongji Medical College, 20
Huazhong University of Science and Technology, Wuhan, China 21 6 Department of Neurobiology, School of Basic Medical Sciences and Neuroscience 22
Research Institute, Peking University; Key Lab for Neuroscience, Ministry of 23
Education of China and National Committee of Health and Family Planning of China, 24
Peking University, Beijing, China. 25
26
Corresponding author: Yan Zeng, Brain and Cognition Research Institute, Wuhan 27
University of Science and Technology, Wuhan, China. E-mail: 28
30
Number of pages: 29 31
Number of Figures: 6 32
2 2
Number of Tables: 0 33
Number of words for Abstract: 217 34
Number of words for Introduction: 574 35
Number of words for Discussion: 1223 36
37
Conflict of interest statement: The authors declare no competing financial interests 38
39
Acknowledgments: This work was supported by the National Natural Science 40
Foundation of China (grant 81571095 and 81870901 to Dr. Yan Zeng), Hubei Natural 41
Science Foundation (grant 2016CFB501 to Dr. Yan Zeng), and Hubei health and 42
family planning commission (grant WJ2015MB050 to Dr. Yan Zeng). Dr. 43
McClintock reports honoraria as teaching faculty from TMS Health Solutions. 44
45
46 47
3 3
Abstract 48
Fragile X syndrome (FXS) is the most common inherited form of intellectual 49
disability, resulted from the silencing of the Fmr1 gene and the subsequent loss of 50
FMRP. Spine dysgenesis and cognitive impairment have been extensively 51
characterized in FXS, however, the underlying mechanism remains poorly understood. 52
As an important regulator of spine maturation, intercellular adhesion molecule 5 53
(ICAM5) mRNA may be one of the targets of FMRP and involved in cognitive 54
impairment in FXS. Here we show that in Fmr1 KO male mice, ICAM5 was 55
excessively expressed during the late developmental stage, and its expression was 56
negatively correlated with the expression of FMRP and positively related with the 57
morphological abnormalities of dendritic spines. While in vitro reduction of ICAM5 58
normalized dendritic spine abnormalities in Fmr1 KO neurons, and in vivo 59
knock-down of ICAM5 in the dentate gyrus rescued the impaired spatial and fear 60
memory and anxiety-like behaviors in Fmr1 KO mice, through both granule cell and 61
mossy cell with a relative rate of 1.32 ± 0.15. Furthermore, biochemical analyses 62
showed direct binding of FMRP with ICAM5 mRNA, to the coding sequence of 63
ICAM5 mRNA. Taken together, our study suggests that ICAM5 is one of the targets 64
of FMRP and implicates in the molecular pathogenesis of FXS. ICAM5 could be a 65
therapeutic target for treating cognitive impairment in FXS. 66
67
4 4
Significance Statement 68
Fragile X syndrome (FXS) is characterized by dendritic spine dysgenesis and 69
cognitive dysfunctions, while one of the FMRP latent targets, ICAM5, is well 70
established for contributing both spine maturation and learning performance. In this 71
study, we examined the potential link between ICAM5 mRNA and FMRP in FXS, and 72
further investigated the molecular details and pathological consequences of ICAM5 73
overexpression. Our results indicate a critical role of ICAM5 in spine maturation and 74
cognitive impairment in FXS and suggest ICAM5 is a potential molecular target for 75
the development of medication against FXS.76
5 5
Introduction 77
Fragile X syndrome (FXS) is the most common inherited cause of mental retardation, 78
resulted from the transcriptional silencing of the fragile X mental retardation 1 (Fmr1) 79
gene and the subsequent loss of fragile X mental retardation protein (FMRP) (Davis 80
& Broadie, 2017). FXS is characterized by cognitive impairment associated with a 81
broad spectrum of psychiatric comorbidities, including hyperactive behavior, autism 82
spectrum disorder, poor attention, and seizure (Specchia, D'Attis, Puricella, & 83
Bozzetti, 2017; Wang, Bray, & Warren, 2012). Currently, there is no effective therapy 84
for treating cognitive impairment in FXS, making the quest for novel targets of 85
considerable importance. A common neuropathologic phenotype seen in FXS is 86
dendritic spine malformation, which is associated with an increased number of long, 87
thin, and tortuous spines, and a pruning failure during spine transition from 88
development to mature ones(Irwin et al., 2001; Portera & Yuste, 2001; Wijetunge et 89
al., 2014). Dysgenesis of dendritic spines is also observed in many other 90
neurodevelopmental disorders (NDDs)(Bourgeron, 2009; Calabrese, Wilson, & 91
Halpain, 2006; De, Fernández, Buzzi, Di, & Bagni, 2012; Irwin et al., 2001; Penzes, 92
Cahill, Jones, Vanleeuwen, & Woolfrey, 2011; Portera & Yuste, 2001; Wijetunge et 93
al., 2014). Thus, determining the molecular mechanisms involved in impaired 94
dendritic spine formation and maturation and cognitive impairment may shed light on 95
FXS and other NDDs for the development of new therapeutic strategies. 96
Under normal condition, FMRP exists at high level in dendritic spines (Antar, 97
Dictenberg, Plociniak, Afroz, & Bassell, 2005; Davis & Broadie, 2017). Through 98
binding to mRNAs, FMRP regulates the expression of many genes at the 99
post-transcriptional level (Jennifer C Darnell & Klann, 2013; Specchia et al., 2017), 100
including mRNA dendritic localization, axonal/dendritic transport, and export from 101
6 6
the nucleus to the cytoplasm(Bassell & Warren, 2008; Melko & Bardoni, 2010; 102
Pasciuto, Emanuela, Bagni, & Claudia, 2014). In FXS pathological condition, FMRP 103
loss-of-function results in excessive protein synthesis, and further defects in synaptic 104
plasticity, as well as cognitive impairment (Bassell & Warren, 2008; Jennifer C 105
Darnell & Klann, 2013). Over the last 20 years, a large number of potential mRNA 106
targets of FMRP have been found(Brown & Huynh, 2001; J. C. Darnell et al., 2011; Jr 107
et al., 2012). A well-known study proposed an underestimated list of 842 mRNA 108
targets of FMRP, and also listed a total of 19493 related complexes including 109
intercellular adhesion molecule 5 (ICAM5) (J. C. Darnell et al., 2011). However, the 110
pathological consequences of these mRNA targets remain unclear. 111
ICAM5 is a cell adhesion molecule that belongs to the immunoglobulin (Ig) 112
superfamily (Yoshihiro Yoshihara & Mori, 1994). It is widely expressed in 113
telencephalic neurons and plays an important role in higher order cognitive and motor 114
functions(Mitsui, Saito, Mori, & Yoshihara, 2007; Mori, Fujita, Watanabe, Obata, & 115
Hayaishi, 1987; Oka, Mori, & Watanabe, 1990). In the early postnatal life of 116
mammals, the ontogenic appearance of ICAM5 is consistent with the timing of 117
dendritic outgrowth, spine formation, and synaptogenesis, and its expression persists 118
into adulthood(Li et al., 2000; Mori et al., 1987; Y. Yoshihara et al., 1994). Besides, 119
cleavage of ICAM5 leads to a reduced density of filopodia via β1 integrin interaction 120
and the consequent phosphorylation of cofilin (Conant et al., 2011), decreases 121
glutamatergic transmission and neuronal excitability (Niedringhaus, Chen, Dzakpasu, 122
& Conant, 2012), and alters spine maturation and learning performance (Nakamura et 123
al., 2001). These findings suggest that ICAM5 is involved in dendritic spine 124
morphogenesis and synapse development. However, the involvement of ICAM5 in 125
the neuropathology and spine maturation in FXS remains unclear. 126
7 7
In this study, we aim to examine a possible link between ICAM5 and FMRP in 127
FXS, and to further investigate the molecular detail and the pathological 128
consequences. We confirmed that ICAM5 mRNA is a target of FMRP. In FXS mouse 129
model, ICAM5 expression is aberrantly increased, correlated with the developmental 130
delay of spine maturation and the concomitant cognitive impairment, and the 131
reduction of ICAM5 expression rescues the behavioral disorders in Fmr1 KO mice. 132
133
134
8 8
Materials and methods 135
Animals 136
Fmr1 knock-out (KO) (FVB.129P2-Pde6b+Tyrc-ch Fmr1tm1Cgr/J) and wild type (WT) 137
(FVB.129P2-Pde6b+ Tyrc-ch/AntJ) mice were purchased from Jackson Laboratories 138
(Bar Harbor, ME, USA). All procedures that involved animals were performed in 139
accordance with a protocol approved by the Wuhan University of Science and 140
Technology Animal Research Committee. Male mice were used in all experiments. 141
142
Western blotting analysis 143
The protein level from each selected telencephalic region was measured by western 144
blot analysis as previously described (Zeng, Liu, Wu, Liu, & Hu, 2012). Primary 145
antibodies used in this study were goat polyclonal anti-ICAM5 (Santa Cruz 146
Biotechnology, 2507S, 1:1000), rabbit polyclonal anti-ICAM5 (Abcam, ab232785, 147
1:1000) and rabbit polyclonal anti-FMRP (Cell Signaling Technology, 4317S, 148
1:1000). 149
150
Primary neuron culture, transfection, and morphometrical analysis 151
Primary mouse neuronal cultures were obtained from the cerebral cortex of embryos 152
(E17 - E18) (Hozumi et al., 2003). For neuron transfection, lentiviral vectors were 153
used with 1 × 108 TU/ml (MOI = 10). To suppress and overexpress FMR1, we used 154
GV118 (Shanghai Genechem Co., Ltd. China) with a target sequence 155
5’-ACGAAACTTAGTAGGCAAA-3’ and the GV303 vector (Shanghai Genechem 156
Co., Ltd. China) with full length FMR1 respectively. After 24h transfection, the 157
neurons were cultured 2 days for protein measurement and 8 days for morphological 158
observation of the dendritic spines. Dil staining was performed as described before 159
9 9
(Cheng, Trzcinski, & Doering, 2014), and dendritic spines were examined using a 160
FV1000 confocal microscope (FluoView1000, Olympus, Tokyo, Japan). Spine head 161
width and length of dendritic protrusions were measured by Image J. Only spines 162
within 100 μm of cell bodies were evaluated. 163
164
Quantitative real-time (RT) PCR 165
We evaluated the mRNA level of FMR1 and ICAM5 in Fmr1 KO versus WT mice by 166
quantitative RT-PCR. Total RNA was extracted by TRIzol Reagent (Invitrogen, USA) 167
and subsequently synthesized into single-strand cDNA using Superscript II reverse 168
transcriptase (Invitrogen, USA). The cDNA amplification was performed using SYBR 169
Premix Ex Tap (Tli RNaseH Plus, Takara) on the BIO-RAD CFX96 system (Chen et 170
al., 2018). Genes and forward/reverse primers used for qRT-PCR are: β-actin, forward: 171
CTCTTTTCCAGCCTTCCTTCTTG, reverse: AGAGGTCTT TACGGATGTCAACG; 172
FMR1, forward: ATCGCTAATGCCACTGTTCTTT, reverse: CGACCCATTCCTTG 173
ACCATC; ICAM5, forward: AGAACAGGAAGGCACCAAACAG, reverse: CTGG 174
CTCACTCAAAGTCAGAAGAG; U1 snRNA, forward: GGGAGATACCATGATC 175
ACGAAGGT, reverse: CCACAAATTATGCA GTCGAGTTTCCC. 176
177
Linear sucrose gradient fractionation 178
Three weeks mouse hippocampus lysates and neurons were submitted to FengRui 179
Biotechnology Co., Ltd/YuSen Biotechnology Co., Ltd (Hunan/Shanghai, China) for 180
ribosome bound mRNA test. 181
182
Golgi impregnation procedure and spine analysis 183
The Golgi staining method was performed with the FD Rapid GolgiStain Kit (FD 184
10 10
Neurotechnologies, Columbia, MD, USA) as previously described in Tian (Tian et al., 185
2015) and Gao (Gao et al., 2015). Categories of spine morphology were identified as 186
follows: mushroom-shaped spine (spine with a large bulbous head, the diameter of 187
spine head minus the diameter of the spine neck ≥1.5μm); thin spine (filopodia-like 188
protrusion, diameters of spine and neck are nearly equal, and spine length is greater 189
than spine width); stubby spine (short spine without a well-defined spine neck). 190
191
RNA-binding protein immunoprecipitation (RIP) and RNA immunoprecipitation 192
sequencing (RIP-Seq) cDNA library construction 193
RIP experiments were conducted using the Magna RIP™ RNA-Binding Protein 194
Immunoprecipitation Kit (Millipore, MA, USA) according to the manufacturer’s 195
instructions (Moradi et al., 2016). For RIP-Seq analysis, two types of biological 196
replicates of total RNA samples were obtained, one from the input group (lysate) and 197
one from the FMRP group (lysate incubated with anti-FMRP antibody and magnet). 198
Biological replicates were then submitted to Novogene (Beijing, China) for 199
sequencing. The cDNA library synthesis from total RNA combined with FMRP was 200
carried out according to the manufacturer’s protocols (Illumina, San Diego, CA, 201
USA). To identify FMRP binding sites on ICAM5 mRNA, we used 202
Crosslinking-Immunprecipitation and High-Throughput sequencing (HITS-CLIP) 203
with MEME and Dreme software (Bailey et al., 2009) to analyze and then Tomtom 204
software (Gupta, Stamatoyannopoulos, Bailey, & Noble, 2007) to compare the 205
existing motifs in the database. 206
207
11 11
Stereotactic surgery and virus injection 208
Mice were anesthetized with isoflurane and placed in a stereotaxic apparatus (Item: 209
68030, RWD, Shenzhen, China). To suppress ICAM5 expression in dentate gyrus 210
(DG), AAV-ICAM5 shRNA-EGFP (BrainVTA Co., Ltd., Wuhan, China) was injected 211
into the either DG (the anterior-posterior coordinate was -1.70 mm, and the lateral 212
position was ± 1.20 mm) of one-month-old Fmr1 KO mice. Four weeks after virus 213
injection, mice were submitted to the following tests. 214
215
Slice physiology 216
Slices (400 μm) were obtained from virus or vector infected Fmr1 KO male mice. 217
Mice were anesthetized with isoflurane and rapidly decapitated, and brains were 218
quickly removed and transferred into ice-cold artificial cerebrospinal fluid (ACSF) 219
containing the following (in mM): 124 NaCl, 26 NaHCO3, 3 KCl, 2 CaCl2, 1 MgCl2, 220
1.25 KH2PO4, and 10 glucose, pH 7.4 (oxygenated with 95% O2 and 5% CO2). Slices 221
were cut in ice-cold dissection solution with a vibrating blade microtome, and 222
incubated in an interface chamber for 0.5 h at 34–36°C and 1h at room temperature. 223
The 64-channel multi-electrode (MED64) system (Alpha MED Sciences, Tokyo, 224
Japan) was used to record field excitatory postsynaptic potentials (fEPSPs) as 225
previously described(Chang et al., 2015; Chin-Wei, Yi-Jung, Jing-Jane, & 226
Chao-Ching, 2010). Slices were placed on the top of the 8×8 microelectrode arrays 227
(MED-P515A probe), incubated with continuously infused ACSF at 34°C at the flow 228
rate of 2 mL/min. Stimuli was delivered to the slice via one selected site and the 229
intensity were calculated by 50% of the maximal synaptic response determined by 230
12 12
input-output curves, while the response microelectrodes were used to record the 231
fEPSPs. A LTD was induced with low-frequency stimulation (1 Hz, 900 pulses). 232
Spontaneous excitatory postsynaptic currents (sEPSC) were collected from granular 233
cells in the hippocampal DG using conventional whole cell recording techniques with 234
a Multiclamp 700B amplifier connected to a 1550B A/D board and Clampex 10 235
program suite (Molecular Devices, Sunnyvale, CA). Intracellular solution contained 236
(in mM): 150 KCl, 10 HEPES, 4Mg2ATP, 0.5 NaGTP, 10 phosphocreatine, and 0.2% 237
biocytin or 135 K-gluconate, 15 KCl, 5 NaCl, 0.5 EGTA, 10 HEPES, 2Mg2ATP, and 238
0.2% biocytin, pH 7.3 and 270-290 mOsm, 3–7 MΩ resistance. sEPSC were collected 239
in voltage clamp mode at a holding potential value of -70 mV at a temperature of 240
30-32 °C. Using the template-based analysis feature of Clampfit 10.0, sEPSC events 241
were collected and analyzed. Access resistance was monitored throughout the 242
experiment and data from experiments were excluded if the access resistance or the 243
input resistance changed more than 20% during the experiment. 244
245
Behavioral tests 246
Morris water maze (MWM) test and fear conditioning paradigm test were used to 247
assess spatial learning, fear learning, and memory as previously described (Zeng et 248
al., 2012). Open field (OF) test and elevated plus maze (EPM) tests were used to 249
characterize the mice’s locomotor and anxiety-like behaviors (Gao et al., 2015). 250
Social interaction test was performed with a three-chamber device as previously 251
reported (Tabuchi et al., 2007). After 5 min habituation, the testing mouse was placed 252
in the middle chamber first, a strange mouse S1 that had no prior contact with the 253
13 13
testing mouse was placed in right side chamber while left side chamber was empty in 254
the session 1. Then testing mouse was tested in session 2 with another strange mouse 255
(S2), but in left chamber, while the right chamber was empty. In the session 3, the 256
testing mouse had options between the first already-investigated S1 and a new strange 257
mouse (S3). Both doors to the side chambers were then unblocked and the subject 258
mouse was allowed to explore the entire social test box for 10 minutes in each 259
session. 260
261
Experimental design and statistical analysis 262
Fmr1 KO and age matched WT male mice were used in all experiments. In all cases, 263
4 or more animals of the same age and genotype were used for each parameter. Each 264
neuron was considered as an individual data point for dendritic morphological and 265
electrophysiological experiments. For western blot and behavioral test, n values 266
(number of animals) were reported. Statistical analyses were done using Microsoft 267
Excel and SPSS 16.0 software. For the comparison between two groups, data were 268
analyzed with unpaired two-tailed Student’s t test. One-way ANOVA and two-way 269
ANOVA followed by Bonferroni’s post hoc tests were performed for multiple 270
comparisons. The statistical test and sample size (n) for each experiment were 271
specified in the figure legends. Data were presented as mean ± SEM, with p < 0.05 272
being considered statistically significant. 273
274
14 14
Results 275
Lack of FMRP in Fmr1 KO mice results in changed ICAM5 expression and 276
immature thin spines 277
We first examined the expression of ICAM5 expression in the developing prefrontal 278
cortex, hippocampus and amygdala (Fig. 1A) in WT and Fmr1 KO mice. In Fmr1 KO 279
mice, ICAM5 expression was increased during late brain development from P21 till 280
P90 when the mice developed a mature hippocampus (Fig. 1A and B), while in 281
prefrontal cortex and amygdala, the expression of ICAM5 was also found increased 282
since P21 (Fig. 1A). At P21, ICAM5 expression in Fmr1 KO mice was increased up 283
to 20% ± 1.9% (p =0.0034) relative to that in WT hippocampus, up to 27% ± 1.5% in 284
the prefrontal cortex, and 25% ± 1.9% in the amygdala. However, the ICAM5 mRNA 285
level at P21 was unchanged in the prefrontal cortex, the hippocampus, or the 286
amygdala (Fig. 1C), suggesting a translational disorder of ICAM5 mRNA in Fmr1 287
KO mice. In accordance with this, polyribosome fractionation analysis showed that 288
ribosome-bounded ICAM5 mRNA was significantly increased (39% ± 1.8%, p = 289
0.0051) in 3 weeks Fmr1 KO hippocampus (Fig. 1D) compared to WT, further 290
suggesting a potential role of FMRP on ICAM5 translation. 291
As ICAM5 negatively regulates dendritic spine maturation and facilitates 292
immature spine formation (Conant et al., 2011), we examined the dendritic spines of 293
Golgi-impregnated Fmr1 KO and WT neurons. As shown in Fig. 1 (F and G), spine 294
number and length measurements were significant higher in KO compared to those in 295
WT hippocampus neurons at P21 (40% ± 2.8%, p = 0.039; 43% ± 1.7%, p = 0.0032). 296
The same tendency was also found in the prefrontal cortex and the amygdala (data not 297
shown), indicating a spine overproduction in FXS. Concomitantly, during P21 and the 298
later brain development, WT spines exhibited a steady state, whereas Fmr1 KO spines 299
15 15
remained at pre-pruning levels. As shown in Fig. 1H, at P21, the percentages of 300
immature thin and stubby spines in the Fmr1 KO hippocampus were significantly 301
higher than that in WT (26% ± 3.1%, p = 0.0071), while mature mushroom-shaped 302
spines were significantly decreased (34% ± 2.7%, p = 0.0051). These results showed a 303
developmental delay in the down regulation of spine turnover and in the transition 304
from immature to mature spine subtypes, which matches the time course and reported 305
role of ICAM5 overexpression in the literature (Raemaekers et al., 2012). 306
307
Reduction of ICAM5 normalizes dendritic spine abnormalities in Fmr1 KO 308
neurons 309
To verify the involvement of ICAM5 in dendritic spines, we suppressed ICAM5 310
expression in Fmr1 KO neurons and compared with neurons transfected empty 311
lentiviral vectors (Mock). As shown in Fig. 2 A and B, ICAM5 protein level in Fmr1 312
KO neurons was significantly decreased by ICAM5 shRNA (45% ± 1.6%, p = 0.0114), 313
validating ICAM5 protein suppression. The total spine number was not modified by 314
ICAM5 suppression (Fig. 2C and D). However, the thin spines in ICAM5 shRNA 315
Fmr1 KO neurons were fewer than those in controls (39% ± 2.4%, p = 0.0143, Fig. 316
2C and F), and no significant changes in stubby spines, while the mushroom spines 317
increased (23% ± 2.6%, p = 0.0289), which suggests that ICAM5 suppression 318
attenuated the aberrant maturation of dendritic spines in Fmr1 KO neurons. In 319
addition, the mean length of all spine types was significantly decreased (18% ± 1.8%, 320
p = 0.0153, Fig. 2E). Together, these data demonstrate that the overexpression of 321
ICAM5 in FXS is positively related to the abnormal dendritic spine length and 322
maturation in Fmr1 KO neurons. 323
324
16 16
FMRP affects ICAM5 protein expression and dendritic morphology in cultured 325
neurons 326
To identify whether the increased ICAM5 protein level in Fmr1 KO mice resulted 327
from the loss of FMRP, we modified the FMRP protein levels in WT and KO neurons 328
and examined the alterations in ICAM5 expression and dendritic morphology. Two 329
days after transfection with lentiviral vector, FMRP and ICAM5 expression was tested 330
by western blotting. As shown in Fig. 3, the ICAM5 protein level was negatively 331
correlated with the FMRP level. In WT neurons, ICAM5 was significantly increased 332
(30% ± 1.5%, p = 0.0342, Fig. 3A and B) by FMR1 interference, and ICAM5 mRNA 333
kept unchanged (Fig. 3C, p = 0.0924). Whereas FMR1 overexpression significantly 334
decreased ICAM5 in KO neurons (35% ± 1.2%, p = 0.0272, Fig. 3I and J), without 335
affecting ICAM5 mRNA (Fig. 3K, p =0.0853). However, polyribosome fractionation 336
analysis showed that ribosome-bounded ICAM5 mRNA was significantly increased 337
(23% ± 1.3%, p = 0.0283) after FMR1 interference in WT neurons (Fig. 3D), and the 338
consistently FMR1 overexpression resulted in reduced ribosome-bounded ICAM5 339
mRNA in KO neurons (32% ± 2.0%, p = 0.0121, Fig. 3L), indicating the role of 340
FMRP on ICAM5 translation. 341
To further examine the translational effect of FMR1 on dendritic morphology, we 342
observed spine morphology 7 days after FMR1 shRNA or Ovp-FMR1 lentiviral 343
transfection. Spine length was significantly elongated in FMR1 knock-down WT 344
neuron (28% ± 2.9%, p = 0.0204, Fig. 3E and G) and shortened in FMR1 345
overexpression KO neuron (18% ± 3.1%, p = 0.0294, Fig. 3M and O). Furthermore, 346
the percentage of thin spines in FMR1 knock-down WT neurons increased 47% ± 347
2.7% (p = 0.0113) than that in controls (Fig. 3H), while the percentage of mushroom 348
spines significantly reduced (44% ± 3.3%, p = 0.0192). By contrast, the percentage of 349
17 17
thin spines decreased in FMR1 overexpressed KO neurons (33% ± 2.8%, p = 0.0221, 350
Fig.3M and P) and the mushroom spines increased (29% ± 3.3%, p = 0.0382). These 351
results indicate that FMRP-related ICAM5 protein expression corresponds with 352
dendritic spine morphology, although the total number of dendritic spines was not 353
changed (Fig. 3 F and N). Given the role of ICAM5 in dendritic spine formation and 354
maturation as reported in the literature (Tim et al., 2012) and confirmed in this study 355
(Fig. 2), we hypothesize that FMRP directly affects ICAM5 expression, which 356
consequently influences spine morphology. 357
358
FMRP directly binds to ICAM5 mRNA in vitro 359
To determine whether ICAM5 mRNA is a FMRP target, we tested FMRP/ICAM5 360
mRNA interaction in vitro with RIP followed by qRT-PCR and DNA gel 361
electrophoresis. As shown in Fig. 4A and B, ICAM5 mRNA appeared in the FMRP 362
antibody extracted group and the total input group, but not in the IgG extracted or 363
Blank (no template PCR control) groups, indicating a direct binding of FMRP to 364
ICAM5. 365
HITS-CLIP results show that ten FMRP-connected mRNA motifs were 366
frequently detected, and six of them were highly matched with the ICAM5 mRNA 367
sequence (Fig. 4C and D). Namely, they were AGACMMM, RAAAAWC, 368
ARAAAAW, CACAGCA, SCVAVCH, and TSKGGKC (M=A/C, R=A/G, W=A/T, 369
K=G/U, S=G/C, V=G/A/C and H=A/T/C). Within the ICAM5 mRNA, 93% of the six 370
motifs appeared within the coding sequence (CDS) (Fig. 4D). Most of them located 371
very close to one another, and some are overlapped (data not shown). Gene Ontology 372
(GO, http://www.geneontology.org/) was used to gain insight into the biological 373
functions encoded by the FMRP target transcripts. As seen in Fig. 4E, the FMRP 374
18 18
target transcripts were mainly located around the nucleus and membrane-bounded 375
organelles, suggesting the direct biological modulating role of FMRP on ICAM5. 376
377
Genetic reduction of ICAM5 in DG corrects behavioral deficits in FXS 378
To evaluate the functional relevance of elevated ICAM5 expression in FXS, we 379
examined spatial and fear memory and exploratory and anxiety-like behaviors in 380
Fmr1 KO and ICAM5 knock-down (AAV-ICAM5 shRNA-EGFP) Fmr1 KO mice, 381
and compared their performance with WT, ICAM5 knock-down WT, and adenovirus 382
empty vector (AAV-EGFP) transfected Fmr1 KO and WT mice. 383
We first evaluated spatial memory with the hidden platform Morris water maze 384
(MWM). During the training sessions, KO mice showed significantly longer escape 385
latencies than WT, but the latency was shortened in ICAM5 shRNA KO mice (Fig. 386
5A). After 5 days of training, spatial memory retention was evaluated by removing the 387
hidden platform. KO mice (39% ± 2.3%, p = 0.0255, to WT) showed no preference 388
for the correct quadrant, whereas both the WT and ICAM5 shRNA KO groups spent 389
more time in the correct quadrant (Fig. 5B) and crossed the previous hidden platform 390
location more frequently (Fig. 5C), which suggested impairment of spatial memory 391
performance of Fmr1 KO mice and corrected by reduction of ICAM5 expression. WT 392
mock and ICAM5 shRNA WT mice exhibited no difference from WT. Besides, at the 393
visible-platform test, all group of mice showed comparable escape latency and 394
swimming speed (data not shown), suggesting a comparable motor and visual 395
function among the different mice, and no change in vision or swimming speed was 396
found that could influence the behavioral tests. 397
The social interaction test was performed as shown in the schematic drawing 398
(Fig. 5D). After habituation, all mice presented a preference for strange mouse, S1 in 399
19 19
session 1 and for S2 in session 2, over Blank (data not shown). However, in session 3 400
WT and ICAM5 shRNA KO mice showed a preference for new strange mouse S3, 401
instead of re-put strange mouse S1 (Fig. 5E, 54% ± 2.9%, p = 0.0130; 50% ± 2.0%, p 402
= 0.0183). However KO and KO Mock groups did not showed the preference (p = 403
0.6364 and p = 0.4272), indicating reduced social interaction and memory in Fmr1 404
KO mice and reversed effect of ICAM5 reduction. WT mock and ICAM5 shRNA WT 405
mice showed no difference from WT. 406
For the fear conditioning learning test, during the second and third tone-shock 407
pairs (Fig. 5F), freezing time was decreased about 50% ± 3.5% (p = 0.0065) in KO 408
mice relative to WT. During the intermission, KO mice also showed less freezing time, 409
suggesting impaired fear memory (Fig. 5G, p = 0.0124). A day after the contextual test, 410
KO mice continued to exhibit less freezing time (Fig. 5H, p = 0.0219) when delivered 411
into the contextual fear conditioning environment. There was also decreased memory 412
consolidation for cued fear conditioning (Fig. 5I, p = 0.0153) two hours after the 413
contextual fear conditioning test. All above impaired memory related behaviors were 414
improved in ICAM5 shRNA KO mice compared to KO mice, during the contextual 415
test (Fig. 5G, p = 0.0166), in the conditioning environment (Fig. 5H, p = 0.0138) and 416
cued fear condition (Fig. 5I, p = 0.0247), whereas WT mock and ICAM5 shRNA WT 417
mice had no difference from WT. 418
In addition, the mice were then tested for exploratory behavior in open field (OF) 419
test (Fig. 6A-D). Fmr1 KO mice exhibited longer total travel distance (Fig. 6A, 46% 420
± 2.3%, p = 0.0053), however, less percentage of total distance inside the center than 421
WT (Fig. 6B, 39% ± 2.8%, p = 0.0211), and more percentage of total distance out of 422
center (Fig. 6C, 21%, p = 0.0283), and more number of times across the edges (Fig. 423
6D, 58% ± 1.9%, p = 0.0315). The results suggested a significantly elevated 424
20 20
exploration activity and unconditioned anxiety-related behavior in Fmr1 KO mice, 425
which was reversed by DG ICAM5 knockdown for total travel distance (Fig. 6A, 38% 426
± 3.6%, p = 0.0032), center distance (Fig. 6B, 24% ± 2.1%, p = 0.0455), out-of-center 427
distance (Fig. 6C, 21%, p = 0.0365) and times across the edges (Fig. 6D, 57% ± 4.4%, 428
p = 0.0024). In elevated plus-maze (EPM) test, Fmr1 KO mice also showed impaired 429
anxiety-like behavior. Fmr1 KO mice displayed less time spent in and fewer times 430
entered the closed arms (Fig. 6E and F, 35% ± 3.7%, p = 0.0145 and 18% ± 2.4%, p = 431
0.0426), which was also recovered in ICAM5 shRNA group (28% ± 1.6%, p = 0.0211 432
and 16% ± 1.5%, p =0.0421). Instead, WT mock and ICAM5 shRNA WT mice 433
showed no difference from WT in OF and EPM test. 434
After the behavioral tests, mice were sacrificed, and their brains were collected 435
for detecting transfection efficiency and ICAM5 expression. The ICAM5 protein level 436
in the Fmr1 KO hippocampus was significantly decreased by ICAM5 shRNA 437
intervention (43% ± 1.1%, Fig. 6G and H). Moreover, the large amount of EGFP 438
expression showed that AAV-ICAM5 shRNA-EGFP was successfully transfected into 439
the dentate gyrus (Fig. 6I), validating ICAM5 protein suppression. Surprisingly, both 440
granule cells (GCs) and mossy cells (MCs) were transfected with a relative rate of 441
1.32 ± 0.15, accounting for 56.94% ± 2.96 % and 43.06% ± 2.32 % of total 442
transfected cells. 443
In order to investigate the electrophysiological modification after ICAM5 444
suppression, sEPSC was recorded on the EGFP expressed neurons after Mock or 445
ICAM5 shRNA injection. Compared with the Mock group, ICAM5 shRNA 446
intervention significantly increased the amplitude of sEPSC (Fig. 6J and K, p = 447
0.0160) without changing the frequency (Fig. 6J and K) in GCs, which was consistent 448
with the results of morphological maturation of the dendritic spines (Fig. 2F). Besides, 449
21 21
ICAM5 shRNA intervention significantly rescued the impaired synaptic plasticity, 450
where the classic abnormal LTD is improved (Fig. 6L, p = 0.0032). Although, we did 451
not observe significant difference in LTP between Fmr1 KO and WT mice (data not 452
shown), which is also found by many groups based on different experimental 453
conditions (John, Jessen, Daniel, Fine, & Johann, 2005; Perez Velazquez, 2002). 454
455
Discussion 456
The present study verified for the first time the novel FMRP target ICAM5 mRNA 457
and explored its contribution to spine abnormalities and behavioral defects in FXS. 458
We found that the loss of FMRP relieves its direct binding with ICAM5 mRNA and 459
induces ICAM5 overexpression, which is translationally related to dendritic spine 460
morphological abnormalities in Fmr1 KO neurons. Viral intervention of ICAM5 461
expression in DG reverses the cognitive deficits in the FXS mouse model Fmr1 KO 462
mice, demonstrating the therapeutic value of ICAM5 for treating cognitive 463
dysfunctions in FXS. To our knowledge, this is the first study that detected the role of 464
ICAM5 in cognitive function in vivo. 465
A salient neuropathological defect in FXS is dendritic spine dysgenesis, but its 466
underlying mechanism is still unclear. Previous reports indicate that FMRP regulates 467
the expression of synaptic proteins including PSD-95, CaMKIIα, and MAP1B(R. B. 468
Darnell, 2010; Hou et al., 2006; Kao, Aldridge, Weiler, & Greenough, 2010; Lu & 469
Kunkel, 2004; Mcmahon & Rosbash, 2016; Zalfa et al., 2007). ICAM5 is also 470
reported to promote spine outgrowth via homophilic binding(Li et al., 2000; Recacha 471
et al., 2014), via ICAM5-ERM (ezrin/radixin/moesin) interaction and ectodomain 472
interaction with β1 integrins (Yang, 2012). The homophilic adhesion of ICAM5 473
mediates induction of dendritic outgrowth (Li et al., 2000), since the ICAM5 474
22 22
cytoplasmic region binds ERM family proteins that link membrane proteins to actin 475
cytoskeleton(Yutaka et al., 2007), while the ICAM5 and β1 interaction via the two 476
first Ig-domains stimulates cofilin phosphorylation and facilitates MMP-dependent 477
spine maturation(Conant et al., 2011; Lin et al., 2013). However, ICAM5, the direct 478
negative regulator of dendritic spine maturation has never been examined in FXS. 479
ICAM5 is expressed at low levels in embryos but rapidly increased after birth when 480
large numbers of synapses are formed (H. Matsuno et al., 2006). During spine 481
maturation, ICAM5 expression gradually decreases (H. Matsuno et al., 2006), which 482
is also observed in our results with age. However, in Fmr1 KO mice, since postnatal 483
day 21, ICAM5 was more abundantly expressed than in WT, which is consistent with 484
the timing of increased thin spines and decreased mushroom spines. Besides, reduced 485
ICAM5 expression resulted in spine maturation (Fig. 2F) and synaptic response (Fig. 486
6J-L) in Fmr1 KO neurons, indicating the involvement of ICAM5 in KO neuron spine 487
formation. Regarding the reported effect of ICAM5 in spine pruning and formation 488
(H. Matsuno et al., 2006), these results indicated a critical role of ICAM5 in FXS 489
spine maturation and brain development. Considering that ICAM5 increases since 490
P21, the alterations in spine length and number at P14 indicating the existence of 491
multiple mechanisms in FXS spine abnormality. 492
FMRP is a RNA-binding protein controlling mRNA translation by promoting 493
their dynamic transport and stalling their translation (Jennifer C Darnell & Klann, 494
2013; J. C. Darnell et al., 2011). Most of the previous studies supported that FMRP 495
binds to a large number of mRNAs (J. C. Darnell et al., 2011). Our results showed 496
that ICAM5 expression is excessively expressed in Fmr1 KO mice, and the 497
expression of FMRP was negatively correlated with the expression of ICAM5. 498
Further experiment indicated that FMRP interacts directly with ICAM5 mRNA, 499
23 23
which is consistent with the findings of Darnel et al (J. C. Darnell et al., 2011). 500
Besides, FMRP bound ICAM5 mRNA predominantly in the coding regions, and 501
mainly located around the nucleus and membrane-bounded organelles. FMRP is well 502
known for binding proteins and RNA, in turn regulating RNA processing and 503
metabolism (Zhang et al., 2015), which corresponds with the biological modulation of 504
FMRP on ICAM5 mRNA in our study. These results indicate the overexpressed 505
ICAM5 attributed to the loss of FMRP in FXS. 506
Since both ICAM5 (Mizuno, Yoshihara, Inazawa, Kagamiyama, & Mori, 1997) 507
and FMRP (Hinds et al., 1993) are highly expressed in the cortex and amygdala in 508
WT mice, besides hippocampus we also detected ICAM5 expression in the cortex and 509
amygdala in FXS. The results are consistent in all three regions that ICAM5 was 510
excessively expressed in Fmr1 KO mice, indicating that loss of FMRP induced 511
ICAM5 overexpression could lead to a potential broad pathological consequence in 512
the mammalian brain and FXS. Indeed, we found remarkable numbers of immature 513
spines in neurons from these three regions. The overexpressed ICAM5 corresponded 514
the timing of increased thin spines and decreased mushroom spines. All these results 515
indicate a potential broad role of ICAM5 in the mammalian brain and FXS. 516
The role of ICAM5 is well studied for the last decade, however, the therapeutic 517
role of ICAM5 is still unclear, e.g. if abnormal ICAM5 expression could influence 518
any behavioral disorders in vivo is never studied. Our results indicated that ICAM5 519
knock-down reversed behavioral disorders in Fmr1 KO mice. Intellectual disability is 520
a characteristic phenotypic feature of FXS, which is not fully understood and cannot 521
be improved by current medication. As reported by many research groups, Fmr1 KO 522
mice exhibited impaired memory and exploratory and anxiety-like behaviors(Baker et 523
al., 2010; Spencer, Alekseyenko, Serysheva, Yuva-Paylor, & Paylor, 2010), which 524
24 24
were ameliorated in some degree by lowering ICAM5 expression in DG, a pivotal 525
area connecting amygdala and prefrontal cortex (Zancadamenendez, Alvarezsuarez, 526
Sampedropiquero, Cuesta, & Begega, 2017). Interestingly, ICAM5 suppression did 527
not change the behavior in WT mice. It has been reported that ICAM5-deficient mice 528
showed a decreased density of filopodia and an acceleration of spine maturation in 529
vitro and in vivo(Matsuno & H., 2006). However, it is unclear that if 530
ICAM5-deficient mice exhibit behavior change, and it could be interesting for future 531
study to evaluate the effect of ICAM5 suppression in normal WT mice. Thus, 532
overexpression of ICAM5 in postnatal development in Fmr1 KO mice may be a 533
neurobiological mechanism for FXS pathological phenotypes and a therapeutic target 534
for treatment of FXS cognitive impairment. 535
GCs and MCs are two excitatory cell types of the DG. The GC bodies form the 536
granule cell layer, while the MCs are located only in hilus and are the most common 537
cells in polymorphic layer(Amaral, Scharfman, & Lavenex, 2007). MCs excite or 538
inhibit GCs through direct inputs(Soriano & Frotscher, 1994) or interneurons 539
activation(H. E. Scharfman, 1995), and precede GCs in detecting changes and help 540
expand the range of GC pattern separation(Jung et al., 2019). The understanding of 541
MCs in DG function is limited, but their contributions to behavior have been proposed 542
including memory, novelty and anxiety(Scharfman & E., 2016). It is still unclear that 543
if MCs are involved in the spine dysgenesis and pathophysiology in FXS. Our results 544
indicated that both GCs and MCs were transfected, with a relative rate of 1.32 ± 0.15. 545
After ICAM5 intervention the sEPSC amplitude was increased in Fmr1 KO GCs, 546
probably induced by direct dendritic spine maturation or by the enhanced excited 547
inputs from MCs. Furthermore, ICAM5 intervention in MCs could also contribute to 548
the reversed behavior disorder in KO mice. However, the proportional contribution 549
25 25
for GCs and MCs is still unknown. Future experiments using cell-type specific 550
inactivation might directly test MC contribution to FXS. 551
In summary, our results suggest that ICAM5 is an mRNA target of FMRP and 552
plays a critical role in the spine dysgenesis and pathophysiology of FXS. FMRP could 553
regulate translational events involved in the synthesis of ICAM5 probably via direct 554
binding and concomitantly influences dendritic spine development and disease 555
severity. Genetic ICAM5 intervention attenuated behavioral deficits in Fmr1 KO mice, 556
which may provide therapeutic benefits in the treatment of FXS cognitive impairment 557
and other NDDs. 558
559
26 26
Reference 560
Amaral, D. G., Scharfman, H. E., & Lavenex, P. (2007). The dentate gyrus: fundamental 561 neuroanatomical organization (dentate gyrus for dummies), 163(4), 3 562
Antar, L. N., Dictenberg, J. B., Plociniak, M., Afroz, R., & Bassell, G. J. (2005). Localization of 563 FMRP-associated mRNA granules and requirement of microtubules for activity-dependent 564 trafficking in hippocampal neurons. Genes Brain & Behavior, 4(6), 350-359 565
Bailey, T. L., Boden, M., Buske, F. A., Frith, M., Grant, C. E., Clementi, L., . . . Noble, W. S. (2009). 566 MEME Suite: tools for motif discovery and searching. Nucleic Acids Research, 37(Web 567 Server issue), 202-208 568
Baker, K. B., Wray, S. P., Ritter, R., ., Mason, S., ., Lanthorn, T. H., & Savelieva, K. V. (2010). Male 569 and female Fmr1 knockout mice on C57 albino background exhibit spatial learning and 570 memory impairments. Genes Brain & Behavior, 9(6), 562-574 571
Bassell, G. J., & Warren, S. T. (2008). Fragile X Syndrome: Loss of Local mRNA Regulation Alters 572 Synaptic Development and Function. Neuron, 60(2), 201 573
Bourgeron, T. (2009). A synaptic trek to autism. Current Opinion in Neurobiology, 19(2), 231 574 Brown, V., & Huynh, M. (2001). Interactive CD-ROM: making learning easier. Collegian, 8(1), ii-iv 575 Calabrese, B., Wilson, M. S., & Halpain, S. (2006). Development and regulation of dendritic spine 576
synapses. Physiology, 21(2), 38-47 577 Chang, H. K., Kim, K. H., Kang, K. W., Kang, Y. J., Kim, T. W., Park, H. K., . . . Kim, C. J. (2015). 578
Antidepressants modulate glycine action in rat hippocampus. Journal of Exercise 579 Rehabilitation, 11(6), 311-319 580
Chen, Q. Y., Li, J., Sun, H., Wu, F., Zhu, Y., Kluz, T., . . . Murphy, A. (2018). Role of miR-31 and 581 SATB2 in arsenic-induced malignant BEAS-2B cell transformation. Molecular 582 Carcinogenesis 583
Cheng, C., Trzcinski, O., & Doering, L. C. (2014). Fluorescent labeling of dendritic spines in cell 584 cultures with the carbocyanine dye “DiI”. Frontiers in Neuroanatomy, 8(8), 30 585
Chin-Wei, H., Yi-Jung, H., Jing-Jane, T., & Chao-Ching, H. (2010). Effects of lamotrigine on field 586 potentials, propagation, and long-term potentiation in rat prefrontal cortex in multi-electrode 587 recording. Journal of Neuroscience Research, 83(6), 1141-1150 588
Conant, K., Lonskaya, I., Szklarczyk, A., Krall, C., Steiner, J., Maguire Zeiss, K., & Lim, S. T. 589 (2011). Methamphetamine associated cleavage of the synaptic adhesion molecule 590 intercellular adhesion molecule 5. Journal of Neurochemistry, 118(4), 521-532 591
Darnell, J. C., & Klann, E. (2013). The translation of translational control by FMRP: therapeutic targets 592 for FXS. Nature Neuroscience, 16(11), 1530 593
Darnell, J. C., Van Driesche, S. J., Zhang, C., Hung, K. Y., Mele, A., Fraser, C. E., . . . Chi, S. W. 594 (2011). FMRP stalls ribosomal translocation on mRNAs linked to synaptic function and 595 autism. Cell, 146(2), 247-261 596
Darnell, R. B. (2010). HITS-CLIP: panoramic views of protein-RNA regulation in living cells. Wiley 597 Interdisciplinary Reviews Rna, 1(2), 266-286 598
Davis, J. K., & Broadie, K. (2017). Multifarious Functions of the Fragile X Mental Retardation Protein. 599 Trends in Genetics 600
27 27
De, R. S., Fernández, E., Buzzi, A., Di, M. D., & Bagni, C. (2012). Molecular and cellular aspects of 601 mental retardation in the Fragile X syndrome: from gene mutation/s to spine 602 dysmorphogenesis. Advances in Experimental Medicine & Biology, 970, 517 603
Gao, L., Tian, M., Zhao, H. Y., Xu, Q. Q., Huang, Y. M., Si, Q. C., . . . Sun, L. B. (2015). TrkB 604 activation by 7, 8 dihydroxyflavone increases synapse AMPA subunits and ameliorates 605 spatial memory deficits in a mouse model of Alzheimer's disease. Journal of Neurochemistry, 606 136(3), 620 607
Gupta, S., Stamatoyannopoulos, J. A., Bailey, T. L., & Noble, W. S. (2007). 2007 Gupta et Volume al. 608 8, Issue 2, Article R24 Open Access Method Quantifying similarity between motifs. Genome 609 Biology, 8(2), 90-105 610
Hinds, H. L., Ashley, C. T., Sutcliffe, J. S., Nelson, D. L., Warren, S. T., Housman, D. E., & Schalling, 611 M. (1993). Tissue specific expression of FMR-1 provides evidence for a functional role in 612 fragile X syndrome 613
Hou, L., Antion, M. D., Hu, D., Spencer, C. M., Paylor, R., & Klann, E. (2006). Dynamic translational 614 and proteasomal regulation of fragile X mental retardation protein controls mGluR-dependent 615 long-term depression. Neuron, 51(4), 441-454 616
Hozumi, Y., Ito, T., Nakano, T., Nakagawa, T., Aoyagi, M., Kondo, H., & Goto, K. (2003). Nuclear 617 localization of diacylglycerol kinase zeta in neurons. European Journal of Neuroscience, 618 18(6), 1448–1457 619
Irwin, S. A., Patel, B., Idupulapati, M., Harris, J. B., Crisostomo, R. A., Larsen, B. P., . . . Kozlowski, P. 620 B. (2001). Abnormal dendritic spine characteristics in the temporal and visual cortices of 621 patients with fragile-X syndrome: a quantitative examination. American Journal of Medical 622 Genetics, 98(2), 161–167 623
John, L., Jessen, R. E., Daniel, K., Fine, A. K. S., & Johann, D. H. (2005). Age-dependent and selective 624 impairment of long-term potentiation in the anterior piriform cortex of mice lacking the fragile 625 X mental retardation protein. Journal of Neuroscience, 25(41), 9460-9469 626
Jr, A. M., Mukherjee, N., Bandaru, P., Miller, J. B., Nusbaum, J. D., Corcoran, D. L., . . . Hafner, M. 627 (2012). FMRP targets distinct mRNA sequence elements to regulate protein expression. 628 Nature, 492(7429), 382 629
Jung, D., Kim, S., Sariev, A., Sharif, F., Kim, D., & Royer, S. (2019). Dentate granule and mossy cells 630 exhibit distinct spatiotemporal responses to local change in a one-dimensional landscape of 631 visual-tactile cues. Sci Rep, 9(1), 9545. doi: 10.1038/s41598-019-45983-6 632
Kao, D. I., Aldridge, G. M., Weiler, I. J., & Greenough, W. T. (2010). Altered mRNA transport, 633 docking, and protein translation in neurons lacking fragile X mental retardation protein. 634 Proceedings of the National Academy of Sciences of the United States of America, 107(35), 635 15601 636
Li, T., Henrietta, N., Patrick, K., Yoshihiro, Y., Kensaku, M., Andersson, L. C., . . . Gahmberg, C. G. 637 (2000). Intercellular Adhesion Molecule-5 Induces Dendritic Outgrowth by Homophilic 638 Adhesion. Journal of Cell Biology, 150(1), 243 639
Lin, N., Li, T., Sergei, S., Helena, V., Olaya, L., Kyle, V., . . . Gahmberg, C. G. (2013). Interactions 640 between ICAM-5 and β1 integrins regulate neuronal synapse formation. Journal of Cell 641 Science, 126(1), 77-89 642
28 28
Lu, R., & Kunkel, L. M. (2004). The fragile X protein controls microtubule-associated protein 1B 643 translation and microtubule stability in brain neuron development. Proceedings of the 644 National Academy of Sciences of the United States of America, 101(42), 15201 645
Matsuno, & H. (2006). Telencephalin Slows Spine Maturation. Journal of Neuroscience the Official 646 Journal of the Society for Neuroscience, 26(6), 1776-1786 647
Matsuno, H., Okabe, S., Mishina, M., Yanagida, T., Mori, K., & Yoshihara, Y. (2006). Telencephalin 648 slows spine maturation. Journal of Neuroscience the Official Journal of the Society for 649 Neuroscience, 26(6), 1776 650
Mcmahon, A. C., & Rosbash, M. (2016). Promiscuous or discriminating: Has the favored mRNA target 651 of Fragile X Mental Retardation Protein been overlooked? Proceedings of the National 652 Academy of Sciences of the United States of America, 113(26), 201607665 653
Melko, M., & Bardoni, B. (2010). The role of G-quadruplex in RNA metabolism: involvement of 654 FMRP and FMR2P. Biochimie, 92(8), 919-926 655
Mitsui, S., Saito, M., Mori, K., & Yoshihara, Y. (2007). A Transcriptional Enhancer That Directs 656 Telencephalon-Specific Transgene Expression in Mouse Brain. Cerebral Cortex, 17(3), 657 522-530 658
Mizuno, T., Yoshihara, Y., Inazawa, J., Kagamiyama, H., & Mori, K. (1997). cDNA Cloning and 659 Chromosomal Localization of the Human Telencephalin and Its Distinctive Interaction with 660 Lymphocyte Function-associated Antigen-1 *. Journal of Biological Chemistry, 272(2), 661 1156-1163 662
Moradi, F., Berglund, P., Linnskog, R., Leandersson, K., Andersson, T., & Prasad, C. P. (2016). Dual 663 mechanisms of action of the RNA-binding protein human antigen R explains its regulatory 664 effect on melanoma cell migration. Translational Research the Journal of Laboratory & 665 Clinical Medicine, 172, 45-60 666
Mori, K., Fujita, S. C., Watanabe, Y., Obata, K., & Hayaishi, O. (1987). Telencephalon-specific antigen 667 identified by monoclonal antibody. Proceedings of the National Academy of Sciences of the 668 United States of America, 84(11), 3921-3925 669
Nakamura, K., Manabe, T., Watanabe, M., Mamiya, T., Ichikawa, R., Kiyama, Y., . . . Nabeshima, T. 670 (2001). Enhancement of hippocampal LTP, reference memory and sensorimotor gating in 671 mutant mice lacking a telencephalon-specific cell adhesion molecule. European Journal of 672 Neuroscience, 13(1), 179-189 673
Niedringhaus, M., Chen, X., Dzakpasu, R., & Conant, K. (2012). MMPs and soluble ICAM-5 increase 674 neuronal excitability within in vitro networks of hippocampal neurons. Plos One, 7(8), e42631 675
Oka, S., Mori, K., & Watanabe, Y. (1990). Mammalian telencephalic neurons express a 676 segment-specific membrane glycoprotein, telencephalin. Neuroscience, 35(1), 93 677
Pasciuto, Emanuela, Bagni, & Claudia. (2014). SnapShot: FMRP mRNA Targets and Diseases. Cell, 678 158(6), 1446-1446 679
Penzes, P., Cahill, M. E., Jones, K. A., Vanleeuwen, J. E., & Woolfrey, K. M. (2011). Dendritic spine 680 pathology in neuropsychiatric disorders. Nature Neuroscience, 14(3), 285 681
Perez Velazquez, J. L. (2002). Reduced cortical synaptic plasticity and GluR1 expression associated 682 with fragile X mental retardation protein deficiency. Molecular & Cellular Neuroscience, 683 19(2), 138-151 684
Portera, C. C., & Yuste, R. (2001). [On the function of dendritic filopodia]. Revista De Neurologia, 685 33(12), 1158 686
29 29
Raemaekers, T., Peric, A., Baatsen, P., Sannerud, R., Declerck, I., Baert, V., . . . Annaert, W. (2012). 687 ARF6-mediated endosomal transport of Telencephalin affects dendritic filopodia-to-spine 688 maturation. Embo Journal, 31(15), 3252–3269 689
Recacha, R., Jiménez, D., Tian, L., Barredo, R., Gahmberg, C. G., & Casasnovas, J. M. (2014). Crystal 690 structures of an ICAM-5 ectodomain fragment show electrostatic-based homophilic 691 adhesions. Acta Crystallographica, 70(7), 1934-1943 692
Scharfman, & E., H. (2016). The enigmatic mossy cell of the dentate gyrus. Nature Reviews 693 Neuroscience, 17(9), 562-575 694
Scharfman, H. E. (1995). Electrophysiological evidence that dentate hilar mossy cells are excitatory 695 and innervate both granule cells and interneurons. Journal of Neurophysiology, 74(1), 179-194 696
Soriano, E., & Frotscher, M. (1994). Mossy cells of the rat fascia dentata are 697 glutamate-immunoreactive, 4(1), 65-69 698
Specchia, V., D'Attis, S., Puricella, A., & Bozzetti, M. P. (2017). dFmr1 Plays Roles in Small RNA 699 Pathways ofDrosophila melanogaster. International Journal of Molecular Sciences, 18(5) 700
Spencer, C. M., Alekseyenko, O., ., Serysheva, E., ., Yuva-Paylor, L. A., & Paylor, R., . (2010). Altered 701 anxiety-related and social behaviors in the Fmr1 knockout mouse model of fragile X 702 syndrome. Genes Brain & Behavior, 4(7), 420-430 703
Tabuchi, K., Blundell, J., Etherton, M. R., Hammer, R. E., Liu, X., Powell, C. M., & Südhof, T. C. 704 (2007). A Neuroligin-3 Mutation Implicated in Autism Increases Inhibitory Synaptic 705 Transmission in Mice. Science, 318(5847), 71-76 706
Tian, M., Zeng, Y., Hu, Y., Yuan, X., Liu, S., Li, J., . . . Fu, D. (2015). 7, 8-Dihydroxyflavone induces 707 synapse expression of AMPA GluA1 and ameliorates cognitive and spine abnormalities in a 708 mouse model of fragile X syndrome. Neuropharmacology, 89, 43-53 709
Tim, R., Aleksandar, P., Pieter, B., Ragna, S., Ilse, D., Veerle, B., . . . Wim, A. (2012). ARF6-mediated 710 endosomal transport of Telencephalin affects dendritic filopodia-to-spine maturation. Embo 711 Journal, 31(15), 3252-3269 712
Wang, T., Bray, S. M., & Warren, S. T. (2012). New perspectives on the biology of fragile X syndrome. 713 Current Opinion in Genetics & Development, 22(3), 256 714
Wijetunge, D. S., Karunathilake, K. H., Chaudhari, A., Katani, R., Dudley, E. G., Kapur, V., . . . 715 Kariyawasam, S. (2014). Complete nucleotide sequence of pRS218, a large virulence plasmid 716 that augments pathogenic potential of meningitis-associated Escherichia coli strain RS218. 717 BMC Microbiology, 14(1), 1-16 718
Yang, H. (2012). Structure, Expression, and Function of ICAM-5. Comparative & Functional 719 Genomics, 2012(3), 368938 720
Yoshihara, Y., & Mori, K. (1994). Telencephalin: a neuronal area code molecule? Neuroscience 721 Research, 21(2), 119-124 722
Yoshihara, Y., Oka, S., Nemoto, Y., Watanabe, Y., Nagata, S., Kagamiyama, H., & Mori, K. (1994). An 723 ICAM-related neuronal glycoprotein, telencephalin, with brain segment-specific expression. 724 Neuron, 12(3), 541 725
Yutaka, F., Hitomi, M., Miwa, K., Takehiko, S., Kensaku, M., & Yoshihiro, Y. (2007). Interaction 726 between telencephalin and ERM family proteins mediates dendritic filopodia formation. 727 Journal of Neuroscience the Official Journal of the Society for Neuroscience, 27(33), 728 8866-8876 729
30 30
Zalfa, F., Eleuteri, B., Dickson, K. S., Mercaldo, V., De, R. S., Di, P. A., . . . Grant, S. G. (2007). A new 730 function for the fragile X mental retardation protein in regulation of PSD-95 mRNA stability. 731 Nature Neuroscience, 10(5), 578 732
Zancadamenendez, C., Alvarezsuarez, P., Sampedropiquero, P., Cuesta, M., & Begega, A. (2017). 733 Requiring collaboration: Hippocampal-prefrontal networks needed in spatial working memory 734 and ageing. A multivariate analysis approach. Neurobiology of Learning & Memory, 140, 735 33-42 736
Zeng, Y., Liu, Y., Wu, M., Liu, J., & Hu, Q. (2012). Activation of TrkB by 7,8-dihydroxyflavone 737 prevents fear memory defects and facilitates amygdalar synaptic plasticity in aging. Journal of 738 Alzheimers Disease Jad, 31(4), 765 739
Zhang, P., Kotb, A., Liu, Y., Kumiko, T. Y., Je-Hyun, Y., Grammatikakis, I., . . . Yang, I. H. (2015). 740 Novel RNA- and FMRP-binding protein TRF2-S regulates axonal mRNA transport and 741 presynaptic plasticity. Nature Communications, 6, 8888 742
743
31 31
Fig. 1 Increased ICAM5 expression and immature spines in Fmr1 KO mice. A. 744
Representative western blotting images and quantification of ICAM5 expression from 745
three brain regions (the PFC, HIPP and AMY) during postnatal developmental stage. 746
B. Representative western blotting images and quantification of ICAM5 expression at 747
P90 in the hippocampus. C. Quantification of ICAM5 mRNA with qRT-PCR in 748
prefrontal cortex, hippocampus and amygdala in Fmr1 KO and WT at P21. D. 749
Relatively more ribosome-bounded ICAM5 mRNA was found in 21-day old Fmr1 750
KO mice. E. Representative photograph of Golgi stained apical dendrites of Fmr1 KO 751
and WT neurons. F and G. Increased spine number and prolonged spine length in 752
Fmr1 KO neurons after Golgi staining (per 10 μm dendrite). H. Dendritic spine 753
classification by morphology in Fmr1 KO and WT hippocampus. N = 480 terminals 754
for WT and n = 493 terminals for Fmr1 KO (6 mice per group). Data are presented as 755
mean ± SEM. *** p < 0.001, ** p < 0.01, *p < 0.05 by unpaired two-tailed Student’s t 756
test; 757
758
Fig. 2 ICAM5 shRNA affected dendritic morphology in cultured Fmr1 KO neurons. 759
A and B. Representative western blotting images of ICAM5 and quantification of 760
ICAM5 expression after transfection. C. Representative dendritic segments from 761
Fmr1 KO neurons after transfection (Dil staining). D and E. Statistical analyses of the 762
number and length of spines per 10 μm dendrite. F. Morphology analyses for thin, 763
mushroom, and stubby shaped spines. N = 506 terminals for KO + Mock and n = 500 764
terminals for KO + ICAM5 shRNA (8 mice each group). Data are presented as mean 765
± SEM; *p < 0.05 by unpaired two-tailed Student’s t test. 766
767
32 32
Fig. 3 FMR1 affected ICAM5 protein expression and dendritic morphology in 768
cultured WT and KO neurons. A-H. FMR1 shRNA transfected cultured WT neurons. 769
A and B. Raised ICAM5 and reduced FMRP expression after FMR1 shRNA 770
transfection. C and D. qRT-PCR analyses of total and ribosome-bounded ICAM5 771
mRNA, respectively. E, F and G. Representative dendritic segments from cultured 772
neurons (E, Dil staining) and statistical analyses of spine number/length (F and G) per 773
10 μm dendrites. H. Dendritic spine classification by morphology after FMR1 774
interference. N = 496 terminals for WT+ Mock, n = 470 terminals for WT+ FMR1 775
shRNA (8 mice per group). I-P. FMR1 overexpression transfected cultured KO 776
neurons. I and J. Representative western blotting images and quantification of 777
ICAM5 and FMRP. K and L. qRT-PCR analyses of total and ribosome-binding 778
ICAM5 mRNA, respectively. M-O. Representative dendritic segments from cultured 779
neurons (Dil staining) and statistical analyses of spine number/length per 10 μm 780
dendrite. P. Dendritic spine classification by morphology after FMR1 overexpression. 781
N = 490 terminals for KO + Mock, and n = 524 terminals for KO+ OVP-FMR1 (8 782
mice per group). Data are presented as mean ± SEM. *** p < 0.001, **p < 0.01, *p < 783
0.05 by unpaired two-tailed Student’s t test. 784
785
Fig. 4 FMRP binding sites on ICAM5 mRNA determined by sequence analysis. A. 786
ICAM5 mRNA was found in FMRP extracted group by qPCR. Negative control: 787
Blank and IgG groups. Positive control: ICAM5 mRNA in lysate input group and U1 788
snRNA in SNRNP70 group. B. DNA gel electrophoresis of the qPCR products of A. 789
33 33
C. Six major ICAM5 RNA recommended segments were inferred as the FMRP 790
binding sites. D. Left: Distribution of the six FMRP binding motifs (a, b, c, d, e, and f) 791
across the representative ICAM5 mRNA. Open boxes and bold lines indicate CDS 792
and untranslated regions (UTRs), respectively. Right: Occurrence frequency of the six 793
motifs in CDS and UTRs. E. The top 3 Gene Ontology (GO) terms enriched in FMRP 794
target transcripts and their GO categories; n = 3, ***p < 0.001 by one-way ANOVA 795
with a Bonferroni post hoc test. 796
797
Fig. 5 ICAM5 knock-down rescued the impaired behavioral performances in Fmr1 798
KO mice. A-C. MWM test. A. Mean escape latency of reaching the submerged 799
platform during the training period. B and C. Time spend in target quadrant and 800
platform crossings after training. D and E. Social interaction test. D. The scheme of 801
the three-chamber social interaction test. E. Contact time of the testing mouse with a 802
strange mouse. F-I Fear conditioning paradigm test. F. Percentage of freezing during 803
the period of associative conditioned stimulus-unconditioned stimulus (CS-US) 804
pairing. G. Averaged freezing time during the intertrial intervals (ITI) of the testing 805
session. H and I. Contextual fear conditioning and cued fear conditioning 24h after 806
CS-US pairing stimulation. N = 6 for WT, n =7 for WT + Mock, n =7 for WT + 807
ICAM5 shRNA, n = 6 for KO, n = 6 for KO + Mock, and n = 6 for KO + ICAM5 808
shRNA. Data are presented as mean ± SEM, two-way ANOVA was used with a 809
Bonferroni post hoc test for statistical analysis. **p < 0.01, *p < 0.05 compared with 810
WT, and ## p < 0.01, # p < 0.05 compared with Fmr1 KO mice. 811
34 34
812
Fig. 6 ICAM5 knock-down improved the locomotor or anxiety-like behaviors in 813
Fmr1 KO mice. A-D. Open-field test. A. Overall distance traveled during the 5-min 814
open-field test. B-C. Percentages of the distance in center area over total distance (B) 815
and peripheral distance over total distance (C). D. Number of times across the cells 816
per min. E and F. Elevated plus maze. E. Times entered into closed arms over total 817
entries into both closed and open arms. F. Percentage of time spent in closed arms. 818
N = 6 for WT, n =7 for WT + Mock, n =7 for WT + ICAM5 shRNA, n = 6 for KO, n 819
= 9 for KO + Mock, and n = 6 for KO + ICAM5 shRNA. **p < 0.01, *p < 0.05 820
compared with WT, and ## p < 0.01, # p < 0.05 compared with Fmr1 KO mice. G and 821
H. ICAM5 expression in hippocampus after ICAM5 knock-down. I. Confocal images 822
(left) of the KO dentate gyrus transfected with ICAM5 shRNA virus (green) and 823
DAPI staining nucleus (blue), while the percentages of transfected GCs and MCs are 824
shown on the right. N = 7. J-K. Example and statistical analyses of sEPSC amplitude 825
and frequency in EGFP expressed neurons in KO mock and KO ICAM5 shRNA mice. 826
N=18 neurons for KO + Mock and n=14 neurons for KO + ICAM5 shRNA (4 mice 827
per group). L. Representative traces before and after LTD induction (left) and mean 828
fEPSP slopes averaged 50-60 min after LTD induction (right). N = 7 for WT, n = 6 for 829
KO + Mock, and n = 5 for KO + ICAM5 shRNA. Data are presented as mean ± SEM, 830
unpaired two-tailed Student’s t test and two-way ANOVA with a Bonferroni post hoc 831
test were used for statistical analysis. **p < 0.01, and *p < 0.05. 832