REGULARARTICLE

Hydrogen Sulfide-induced Chilling Tolerance of Cucumber

and Involvement of Nitric Oxide

Guoxiu Wu, Bingbing Cai, Chaofan Zhou, Dandan Li, Huangai Bi, Xizhen Ai

State Key Laboratory of Crop Biology, Ministry of Agriculture Key Laboratory of Horticultural Crop Biology and

Germplasm Innovation, College of Horticulture Science and Engineering, Shandong Agricultural University, 61

Daizong St., Tai’an 271018, Shandong, People’s Republic of China

ABSTRACT Hydrogen sulfide (H2S) and nitric oxide (NO) are two signaling molecules that play important roles in various

physiological processes. However, the mechanisms and signal transduction pathways of H2S in plants and the

relationship between the H2S and NO pathways remain unclear. In this study, we assessed changes in endogenous

H2S and NO emission systems, membrane lipid peroxidation and antioxidant systems of cucumber seedlings

subjected to low temperature stress (5 ℃) that were pre-treated with 1.0 mM sodium hydrosulfide (NaHS), 0.15 mM

hypotaurine (HT), 0.1 mM sodium nitroprusside (SNP), 15 μM hemoglobin (Hb), 1 mM NaHS and 15 μM Hb, or

distilled water for 12 h. The results showed that chilling stress increased the activity and mRNA abundances of L/D-

cysteine desulfhydrase (CDes), which in turn induced the accumulation of endogenous H2S. In the same way, the

endogenous NO system was triggered by chilling stress. The chilling injury symptoms were significantly moderated

by 1.0 mM of the H2S donor NaHS and 0.1 mM of the NO donor SNP. On the contrary, treatment with HT or Hb,

the special scavengers of H2S and NO, respectively, prior to chilling stress aggravated these injury symptoms. NaHS

and SNP pre-treatments reduced the malondialdehyde (MDA) levels, hydrogen peroxide (H2O2) accumulation and

production rate of the superoxide anion (O2.-) caused by chilling stress, whereas the activities and mRNA abundances

of superoxide dismutase (SOD), peroxidase (POD), ascorbate peroxidase (APX) and glutathione reductase (GR) were

increased compared with the water-treated seedlings. Furthermore, NaHS and SNP led to greater accumulation of

ascorbic acid (AsA) and reduced glutathione (GSH)and lessened the decrease in the AsA/DHA and GSH/GSSG ratios

of stressed seedlings, thus resulting in the alleviation of oxidative damage. These results suggest that H2S could

alleviate chilling stress by enhancing the antioxidative system in cucumber seedlings, which might have a possible

interaction with NO signaling, because the addition of Hb reversed the positive effects.

Keywords: hydrogen sulfide, cucumber, nitric oxide, chilling stress, oxidative damage.

INTRODUCTION Cucumbers (Cucumis sativus L.) are sensitive to

chilling stress; however, they commonly encounter

chilling stress due to they are mainly cultivated

through the winter in solar greenhouses in the north

of China. Chilling stress causes many changes in the

biochemical and physiological processes and ROS-

homoeostasis of plants [1] and therefore may be a

major limitation to crop productivity.

Hydrogen sulfide (H2S), an endogenous

gasotransmitter that is involved in various

physiological processes in animals and plants. As

early as 1978, Wilson et al. [2] found that the leaves

of crops such as cucumber, corn, and soybean could

Journal of Plant Biology Research 2016 5(3) :58-69 eISSN:2233-0275

pISSN:2233-1980

http://www.inast.org/jpbr.html

*Corresponding author : College of Horticulture Science and

Engineering, Shandong Agricultural University, 61 Daizong St.,

Tai’an, Shandong 271018, PR China (E-mail: axz@sdau.edu.cn ; Tel:

+86-5388246218).

J. Plant Bio. Res. 2016, 5(3): 58-69

59

release H2S in a light-dependent manner. However,

little was known about its physiological function in

higher plants for an extended period of time.

Because excessive H2S might cause an imbalance in

free radicals, which consequently influences plant

metabolism, previously studies focused on its

toxicology. In fact, in 1982, Hällgren et al. [3]

discovered that pine leaves responded to low SO2

stress by releasing H2S. This implied that H2S

exhibits specific physiological effects in vivo, but it

was previously considered that responses were as a

result of its toxic physiological features. Until

recently, H2S was explored as a gas signal molecule,

and its physiological effects have gradually

attracted people’s attention. It is now known that

H2S participates in the regulation of plant growth

and development as well as several physiological

metabolic processes. In addition, studies have

revealed that H2S, as a gasotransmitter, plays

essential roles in the resistance of abiotic stress,

including drought, salinity, low temperature, and

heavy metals [4, 5, 6, 7]. H2S can also improve

photosynthesis by enhancing the activity of Rubisco

and gene expression and by regulating the redox

modification of sulfhydryl compounds [8]. Thus,

recent studies have focused on the crosstalk

between H2S and other molecules involved in plant

growth and development, resulting in some notable

progress.

Nitric oxide (NO), an important plant endogenous

signaling molecule, also mediates complex

biological functions in plants. Previous studies have

shown the involvement of this molecule in almost

all biological processes in plants, including plant

maturation and senescence [9, 10], seed

germination or dormancy [11], as well as ABA-

mediated floral transition and stomatal movement

[12, 13]. Meanwhile, NO has been proved to be

capable of regulating numerous plant responses

toward a variety of biotic and abiotic stresses and to

alleviate certain consequences induced by oxidative

stresses [1].

Recently, it was reported that H2S can interact with

NO and can regulate various plant developmental

processes and stresses. For example, H2S might be

a novel downstream signal molecule in the NO-

induced heat tolerance response in maize [14]. H2S

donors reduced the accumulation of nitric oxide

(NO) induced by abscisic acid (ABA) treatment of

leaf tissues [15]. Shi et al. [16] speculated that NO-

activated H2S might be essential for cadmium stress

response in bermudagrass. However, the specific

response mechanisms of chilling tolerance are less

clear; knowledge of the potential molecular

mechanism and its signaling pathways remain

limited. In the present study, the interrelationships

between H2S and NO and their effect on the

antioxidant system under chilling stress were

investigated. We aimed to explore the molecular

mechanism of the positive effects of H2S and its

signaling pathways in the response of cucumber to

chilling stress.

MATERIALS & METHODS Plant material and growth conditions

Uniform cucumber seeds (‘Jinyou 35’, Tianjin,

China) were soaked in 1.0 mM sodium hydrosulfide

(NaHS), 0.15 mM hypotaurine (HT), 0.1 mM

sodium nitroprusside (SNP), 15 μM hemoglobin

(Hb), 1 mM NaHS and 15 μM Hb, or distilled water

for 12 h. Afterwards, the seeds were germinated on

moist filter paper in the dark at 28 °C for 24 h, and

then grown in a growth chamber with a photon flux

density (PFD) of 600 μmol m-2 s-1, a 26 °C /18 °C thermoperiod, 80% relative humidity (RH) and an

11-h photoperiod (control growth conditions).

When the first leaf was fully expanded, half of the

water-treated seedlings and all of the other

treatments were exposed to low temperatures (5 °C)

while the remaining half of the water-treated

seedlings were maintained under normal conditions

as the control. There were 3 replicates per treatment

and 20 seedlings per replicate. Young, fully

expanded leaves were sampled to analyze the H2S

and NO emission systems at 0 h, 3 h, 6 h, 9 h and 12

h after transferring from the control to the chilling

stressed condition, while the other physiological

indexes were measured at a 24-h time point.

Measurement of H2S emission

H2S emission was assayed as described by Sekiya et

al. [17] with minor modification. Leaves (0.1

grams) were ground into a fine powder in 0.9 ml

pre-chilled extraction medium (20 mM Tris–HCl

buffer, pH 8.0), and the resulting extract was

centrifuged for 15 min at 15,000×g at 4 °C. The

homogenate was mixed in a test tube containing 20

mM Tris–HCl buffer (pH 8.0), and the released H2S

was absorbed into a zinc acetate trap, i.e., a small

glass tube containing zinc acetate that was fixed to

the bottom of the test tube. After 30 min reaction at

37 °C, 100 μL of 30 mM FeCl3 dissolved in 1.2 M

HCl was added to the trap followed by the injection

J. Plant Bio. Res. 2016, 5(3): 58-69

60

of 100 μL 20 mM N,N-dimethyl-p-

phenylenediamine dihydrochloride dissolved in 7.2

M HCl. The amount of H2S in the zinc acetate trap

was determined colorimetrically at 667 nm after

incubation at 37 °C for 15 min.

Detection of L-/D-cysteine desulfhydrase activity

and relative mRNA expression

L-/D-cysteine desulfhydrase (CDes) activity was

estimated by determining the production rate of H2S

according to Riemenschneider et al. [18].

The relative mRNA expression of the CDes gene in

the cucumber seedlings was analyzed using real-

time quantitative RT-PCR using an AceQTM qPCR

SYBR Green Master Mix (Vazyme) according to

the manufacturer’s instructions. The cucumber β-

actin gene (GenBank accession No. DQ115883)

was used as a constitutively expressed internal

control. The primers were designed and synthesized

by BGI Sequencing (Beijing, China). The primers

used for the LCD, DCD and β-actin genes are as

follows:

LCD1: 5′-GGTTCGTCTGGCTGTGATTGATC -

3′

LCD2: 5′-

GGACCTCCTGGAATACAAGAAAGC -3′

DCD1: 5′-GTCCTGGGCCTCACACCTTAAT -3′

DCD2: 5′-CACGACAGTGATTGCTTTGGATGC

-3′

aF: 5′-CCACGAAACTACTTACAACTCCATC -

3′

aR: 5′-GGGCTGTGATTTCCTTGCTC -3′

Each real-time PCR reaction was performed in a

final volume of 25 µl in an iQ5 Multicolor real-time

PCR detection system (Bio-Rad, USA) using the

following program: initial denaturation at 95 °C for

5 min, followed by 40 cycles of 95°C for 10 s, 60°C

for 30 s, and 72 °C for 15 s. A melting curve analysis

was performed after every PCR reaction to confirm

the accuracy of each amplified product. The data

analysis was performed according to the

instructions provided by the manufacturer of the

quantitative real-time PCR instrument (iCycler iQ5,

Bio-Rad). The expression level for each sample was

calculated as 2-△△Ct, where Ct represents the cycle

number at which the fluorescence signal in each

reaction reaches the threshold. All of the samples

were analyzed three times.

Detection of hydrogen peroxide, superoxide anion

and electrolyte leakage

The qualitative detection of hydrogen peroxide

(H2O2) was carried out using 3,3-diaminobenzidine

(DAB) (Beijing Solarbio Science﹠Technology Co.,

Ltd, China) as described by Thordal-Christensen et

al. [19] with minor modification. The leaves of the

seedlings subjected to the various treatments were

soaked in 1 mg·ml-1 DAB for 14 h under dark

conditions. After rinsing with distilled water, the

leaves were boiled in 90% (v/v) ethanol at 70℃ to

remove the pigments, and the H2O2 production was

visualized in the form of reddish-brown coloration.

The H2O2 content was estimated according to the

instructions of the specified in the H2O2 kit (Nanjing

Jiancheng Bioengineering Institute of China).

The qualitative detection of the superoxide anion

(O2·-) was performed using nitroblue tetrazolium

(NBT) (Beijing Biotopped Science﹠Technology

Co., Ltd, China) as described by Jabs et al. [20] with

minor modification. The leaves of the various

treatments seedlings were soaked in 0.5 mg· ml-1

NBT for 1 h under darkness. After rinsing with

distilled water, the leaves were boiled in 90% (v/v)

ethanol at 70℃ for 20 min, and then O2·- production

was visualized in the form of blue-purple

coloration. The O2·- production rate was measured

using the method presented by Wang et al. [21].

The electrolyte leakage (EL) was estimated as

described by Dong et al [22].

Nitric oxide content, nitrate reductase activity and

relative mRNA expression

The nitric oxide (NO) content was estimated

following the method specified in the NO kit

(Nanjing Jiancheng Bioengineering Institute of

China). Nitrate reductase (NR) activity was assayed

as described by Zhao et al. [23]. The relative mRNA

expression of the NR gene in the cucumber

seedlings was analyzed using the same method as

that used for the CDes gene. The primers used were:

NR1: 5′-CAAGAAAGAGCTGGCTATGG-3′;

NR2: 5′-CTACATGGGATGGCAAGAC T-3′.

Malonaldehyde content, antioxidant enzyme

activity and relative mRNA expression All samples were prepared for MDA and enzyme

analyses by homogenization of the fresh tissue in a

solution (4 ml·g-1 fresh weight) containing 50 mM

KH2PO4/K2HPO4 (pH 7.8), 1% PVP, 0.2 mM

EDTA and 1% Triton X-100, using a mortar and

pestle. After the homogenate was centrifuged at

12,000×g for 20 min at 4 °C, the supernatant was

used to determine the enzymatic activities [24]. All

of the spectrophotometric analyses were conducted

using a UV-visible spectrophotometer (UV-2450,

Shimadzu, Japan). The MDA content was measured

J. Plant Bio. Res. 2016, 5(3): 58-69

61

using the thiobarbituric acid (TBA) reaction as

described by Heath and Packer [25]. The SOD

activity was determined according to the method of

Beyer and Fridovich [26]. The POD activity was

assayed using the method of Omran [27]. The

ascorbate peroxidase (APX) activity was measured

by the method of Nakano and Asada [28] and

glutathione reductase (GR) activity by Foyer and

Halliwell [29].

The relative mRNA expression of the SOD, POD,

APX and GR genes in the cucumber seedlings was

analyzed using the same method as that used for the

CDes gene. The primers used are as follows:

SOD1: 5′-GGAAAGATGTGAAGGCTGTGG -3′

SOD2: 5′-GCACCATGTTGTTTTCCAGCAG -3′

POD1: 5′-GGTTTCTATGCCAAAAGCTGCCC-

3′

POD2: 5′-CAGCTTGGTTGTTTGAGGTGGAG-

3′

APX1: 5′-GTGCTACCCTGTTGTGAGTG -3′

APX2: 5′-AACAGCGATGTCAAGGCCAT -3′

GR1: 5′-TGATGAGGCTTTGAGTTTAGAGGAG

-3′

GR2: 5′-AACTTTGGCACCCATACCATTC -3′.

Detection of the GSH, GSSG, AsA and DHA

contents

The GSH and GSSG contents were measured

following the method specified in the glutathione

content kit (Nanjing Jiancheng Bioengineering

Institute of China). The AsA and DHA contents

were estimated using the method of Law et al. [30].

Statistical analysis

The data are presented as the mean ± the standard

deviation (SD) of three replicates. Analysis of

variance (ANOVA) was conducted using Microsoft

Excel software. Duncan’s multiple range test

(DMRT) was applied to analyze differences

between measured parameters.

RESULTS Chilling stress stimulated H2S emission

To explore the influence of chilling stress on the

H2S emission system, the H2S content, activities and

relative mRNA abundances of the H2S emission-

related enzymes L-cysteine desulfhydrase (LCD)

and D-cysteine desulfhydrase (DCD) were detected

in cucumber seedlings under chilling stress. It was

found that chilling stress induced H2S production,

and the activation was the most significant after 6 h

at 5 °C (Figure 1A). The LCD and DCD activities

(Figure 1B) and the relative mRNA abundance of

LCD (Figure 1C) were significantly increased

during the first 6 h of chilling stress, followed by a

decrease, while that of DCD reached a maximum

after 9 h at 5 °C (Figure 1D). These data indicated

that the H2S emission system was stimulated when

the cucumber seedlings were exposed to chilling

stress.

The response of NO to chilling stress in cucumber

seedlings Figure 2A revealed that chilling stress induced

greater NO production in the cucumber seedlings.

In addition, the NR activity and mRNA abundance

were also enhanced by chilling stress in a time-

dependent manner (Figure 2B, C). These up-

regulated responses were remarkable after 9 h of

chilling stress. This result indicated that the NO

signal participated in the response of cucumber

seedlings to chilling stress.

H2S and NO alleviated chilling stress damage in

cucumber seedlings

To testify the effect of H2S and NO on chilling

tolerance in higher plants, we determined the H2O2

content, O2·- production rate and EL, at 5 °C for 24

h, using 1 mM NaHS as an exogenous H2S donor

and 0.15 mM HT as an H2S scavenger; and with 0.1

mM SNP as an exogenous NO donor and 15 µM Hb

as an NO scavenger. NaHS and SNP significantly

alleviated the injury symptoms caused by chilling

stress, to approximately natural levels (Figure 3A).

Furthermore, seedlings treated with NaHS or SNP

showed significantly lower H2O2 accumulation

(Figure 3B, D), O2·- production rate (Figure 3C, E)

and EL (Figure 3F) than the water-pretreated

seedlings; however, the HT- and Hb-pretreated

seedlings exhibited markedly higher levels of the

above parameters than the water-pretreated

seedlings.

The connection between H2S and NO signals in

cucumber seedlings under chilling stress

To reveal the relationship between H2S and the NO

signals in the cucumber seedlings response to

chilling stress, we determined the effects of NO

(SNP as an exogenous NO donor) and Hb (NO

scavenger) on H2S and L-/D-CD activity and

mRNA abundances. Simultaneously, the influences

of H2S (NaHS as an exogenous H2S donor) and HT

(H2S scavenger) on NO, NR activity and mRNA

expression were investigated. Fig. 4A showed that

the SNP improved the H2S production, while Hb

inhibited the H2S emission caused by chilling stress.

J. Plant Bio. Res. 2016, 5(3): 58-69

62

Figure 1. Response of the H2S-emission system to chilling stress in cucumber seedlings. A, H2S content in cucumber

seedlings under chilling stress for different treating time; B, LCD/DCD activities, the second leaf of cucumber

seedlings were sampled for the H2S concentration and LCD/DCD activities assay; C, D, mRNA abundances of LCD

and DCD, total RNA was separately isolated from the same tissues for the LCD/DCD activities determination, and

subjected to real-time PCR analysis. Seedlings were treated at 5 °C for 0h, 3h, 6h, 9h and 12 h. All values shown are

mean ± SD (n = 3).

The activity and mRNA abundance of CDes were

increased by SNP but decreased by Hb under

chilling stress (Figure 4B-E). Seedlings treated with

NaHS+Hb showed a significantly lower H2S

content and CDes activity and mRNA abundance

compared with the NaHS-treated seedlings. Higher

NO, NR activity and mRNA abundance derived

from chilling stress were significantly enhanced by

NaHS but decreased by HT (Figure 5A-C). These

results suggest that H2S and NO signals can

potentially crosstalk in the process of cucumber

response to chilling stress.

H2S and NO signaling alleviates the oxidative

damage from chilling stress

Both NaHS and SNP treatments showed lower

MDA content during chilling stress (Figure 6).

However, the MDA content was markedly

increased by HT and Hb. Seedlings treated with

NaHS +Hb showed a significantly higher MDA

content than the NaHS-treated seedlings, indicating

that Hb partly weakened the effect of NaHS in

MDA accumulation under chilling stress.

Seedlings subjected to chilling stress can activate

their antioxidant system to defend against oxidative

damage [31]. Therefore, we analyzed the

relationship between H2S and NO in regulating this

system. The SOD, POD, APX, and GR activities

were markedly elevated to prevent oxidative

damage under chilling stress (Figure 7A-D), and

their activities increased more significantly in

chilling-stressed seedlings with the addition of

NaHS and SNP. However, seedlings pretreated with

HT and Hb showed lower or similar POD, APX, and

GR activities compared with the water-treated

seedlings under chilling stress. NaHS +Hb-treated

seedlings displayed significantly lower SOD POD,

APX, and GR activities than the NaHS-treated

seedlings, indicating that Hb partly weakened the

positive effect of NaHS in protecting the membrane

against oxidative damage caused by chilling stress.

Real-time PCR showed that the mRNA expressions

of SOD, POD, APX and GR were increased by 26.1

%, 33.0, 33.9 % and 11.8 %, respectively, in the

chilling-stressed seedlings. They were up-regulated

J. Plant Bio. Res. 2016, 5(3): 58-69

63

Figure 2. Response of the NO and NR to chilling stress

in cucumber seedlings. The same tissues for H2S

emission system analysis were sampled for NO emission

system assay. A, NO content; B, NR activity; C, NR

mRNA abundance. Seedlings were treated at 5 °C for 0h,

3h, 6h, 9h and 12 h. All values shown are mean ± SD (n

= 3).

by NaHS or SNP (Figure 7E-H) but down-

regulated by HT, Hb and NaHS +Hb (P < 0.05)

under chilling stress.

The AsA content and AsA/DHA redox state

decreased significantly (P < 0.05) under chilling

stress but markedly elevated by NaHS and SNP

(Figure 8A, B). A noticeable decrease in the AsA

content and AsA/DHA were observed (P < 0.05) in

the HT and Hb treatments. No significant

differences were found in the GSH content between

the water pretreatment and the control, but GSH was

significantly increased by NaHS and SNP under

chilling stress (P < 0.05). When the seedlings were

pretreated with HT or Hb, the GSH contents

declined significantly (P < 0.05) (Figure 8C).

During chilling stress, the GSH/GSSH ratio

decreased obviously, and this decrease was

weakened by NaHS and SNP. However, the effects

of NaHS and SNP were depressed by HT and Hb,

respectively (Figure 8D). In Figure 8, we observed

that seedlings treated with NaHS+Hb showed

significantly lower AsA and GSH contents as well

as AsA/DHA and GSH/GSSH ratios. This

demonstrated that Hb pretreatment obviously

weakened the positive effect of H2S on the

accumulation of antioxidants to some degree.

DISCUSSION In the present study, we noticed that chilling stress

caused seedling dehydration and ROS

accumulation. Meanwhile, both the endogenous

H2S emission system and NO signaling were

activated during this stress (Figure 1, 2). In addition,

exogenous NaHS and SNP, the well-known

respective H2S and NO donors in plants,

dramatically alleviated these negative effects

through the regulation of the antioxidant system,

while their scavengers HT and Hb aggravated the

negative impacts (Figure 3). The NaHS- and SNP-

driven alleviation of ROS accumulation by chilling

stress was significantly prevented when Hb was

added. Therefore, we speculate that endogenous NO

was involved in the responses induced by H2S under

chilling stress.

The activities of the H2S emission-related enzymes

LCD and DCD, as well as the LCD mRNA

expression, were significantly increased during the

first 6 h of chilling stress, followed by a decrease

(Figure 1B, C). Whereas, the gene expression of

DCD was increased from 0 h to 9 h under chilling

stress, subsequently decreased (Figure 1D). This

unsynchronized result may be due to differences in

the transcription regulation of the two genes. The

H2S production rate directly reflects the intensity of

enzymatic activity of H2S-generating proteins, and

it will take time for transcribed mRNA to be

translated into proteins following posttranslational

modification to ensure complete activity [31].

Previous studies confirmed that LCD and DCD are

the most important enzymes involved in the

respective decomposition of L-cysteine and D-

cysteine into H2S in plants [32, 33]. In the present

study, the H2S content in cucumber seedlings

followed the same trend as the activity and gene

expression of LCD and DCD (Figure 1), indicating

J. Plant Bio. Res. 2016, 5(3): 58-69

64

Figure 3. Effects of H2S and NO on H2O2 accumulation, O2

·- production rate and electrolyte leakage in cucumber

seedlings under chilling stress. A, Phenotype of seedling; B, D, H2O2 accumulation; C, E, O2·- production rate; F,

electrolyte leakage. Seeds were soaked with 1.0 mM NaHS (H2S donor), 0.15 mM HT (H2S scavenger), 0.1 mM SNP

(NO donor), 15 µM Hb (NO scavenger) or distilled water (control) respectively for 12 h. One-leaf seedlings were

exposed to 5 °C for 24 h. All values shown are mean ± SD (n = 3). a, b, c and d indicate that mean values are

significantly different among samples (P<0.05).

Figure 4. Effect of NO on H2S emission system in

cucumber seedlings under chilling stress. Seeds

were soaked with 0.1 mM SNP (NO donor), 15 µM

Hb (NO scavenger), 1 mM NaHS (H2S donor), 0.15

mM HT (H2S scavenger), 1 mM NaHS+15 µM Hb

or deionized water (control) for 12 h. One-leaf

seedlings were exposed to 5 °C for 24 h. A, H2S

content; B, C, LCD/DCD activities, the same

tissues were sampled for the H2S concentration and

LCD/DCD activities assay; D, E, mRNA

abundances of LCD and DCD, total RNA was

separately isolated from the same tissues for the

LCD/DCD activities determination, and subjected

to real-time PCR analysis. All values shown are

mean ± SD (n = 3). a, b, c, d, e and f indicate that

mean values are significantly different among

samples (P<0.05).

J. Plant Bio. Res. 2016, 5(3): 58-69

65

that these data are in agreement with previous

studies.

The chilling tolerance of cucumber seedlings

soaked in different concentrations of NaHS (0, 0.2,

0.4, 0.6, 0.8, 1.0, 1.2 mM) was improved in varied

degree, and pretreatment with 1.0 mM NaHS

revealed a significantly protective effect (data not

shown). Therefore, 1.0 mM NaHS wihich is within

the H2S physiological concentrations detected in

animals and plants [4, 34], was used as an

exogenous H2S donor. To exclude the effects of

other compounds derived from NaHS (Na+, HS-or

H+), 0.15 mM HT was used in this study. Based on

Figure 3, we found that HT did not exhibit an

inducible effect similar to that of NaHS. Therefore,

we suggest that H2S, rather than the other

compounds was responsible for the chilling

tolerance of the cucumber seedlings. It is

noteworthy that the H2S emission could be

enhanced by SNP but suppressed by Hb (Figure 4A)

during chilling stress. This may suggest that chilling

stress activates the H2S emission system in an NO-

dependent manner. Furthermore, H2S participated

in NO signaling by affecting the NO content and the

activity and gene expression of NR (Figure 5)

during the process. All of these results imply that

H2S and NO signaling have a potential connection

in the cucumber response to chilling stress.

It is generally considered that ROS are largely

induced as toxic molecules that result in oxidative

damage to nucleic acids, proteins, lipids and

carbohydrate molecules when plants are subjected

to chilling stress. Lipid peroxidation and an increase

in the MDA content can also occur [22]. In this

paper, chilling stress induced the burst of H2O2, O2·-

(Figure 3D, E) and MDA (Figure 6) and caused

ROS-associated damage in the cucumber seedlings.

By contrast, NaHS alleviated the ROS burst and

ROS-triggered cell injury. To avoid this injury,

plants usually activate the antioxidant system,

including enzymatic antioxidant enzymes (SOD,

POD, APX, GR, etc.) and non-enzymatic

antioxidant molecules (AsA, GSH, etc.) to remove

generated ROS. As the first line of defense against

ROS, SOD converts the O2·- into H2O2, and H2O2 is

Figure 5. Effect of H2S on NO emission system in

cucumber under chilling stress. The same tissues for H2S

emission system analysis were sampled for NO emission

system assay. Seeds were soaked with 1.0 mM NaHS

(H2S donor), 0.15 mM HT (H2S scavenger), 0.1 mM

SNP (NO donor), 15 µM Hb (NO scavenger) or

deionized water (control) for 12 h. One-leaf seedlings

were exposed to 5 °C for 24 h. A, NO content; B, NR

activity; C, NR mRNA abundance. All values shown are

mean ± SD (n = 3). a, b, c, d, e and f indicate that mean

values are significantly different among samples

(P<0.05).

Figure 6. Effect of NaHS and SNP on MDA content in

cucumber seedlings under chilling stress. Seeds were

soaked with 1.0 mM NaHS (H2S donor), 0.1 mM HT

(H2S scavenger), 0.1 mM SNP (NO donor), 15 µM Hb

(NO scavenger), 1.0 mM NaHS+15 µM Hb or

deionized water (control) for 12 h. One-leaf seedlings

were exposed to 5 °C for 24 h. All values shown are

mean ± SD (n = 3). a, b, c, d, e and f indicate that mean

values are significantly different among samples

(P<0.05).

J. Plant Bio. Res. 2016, 5(3): 58-69

66

Figure 7. Effects of NaHS and SNP on activities and mRNA expression of antioxidant enzymes in cucumber seedlings

under chilling stress. Seeds were soaked with 1.0 mM NaHS (H2S donor), 0.1 mM HT (H2S scavenger), 0.1 mM SNP

(NO donor), 15 µM Hb (NO scavenger), 1.0 mM NaHS+15 µM Hb or deionized water (control) for 12 h. One-leaf

seedlings were exposed to 5 °C for 24 h. A-D, SOD, POD, APX and GR activity, the second leaf of cucumber seedlings

were sampled for the activities assay. E-H, mRNA expression of SOD, POD, APX and GR, total RNA was separately

isolated from the same tissues for the activities determination, and subjected to real-time PCR analysis. All values

shown are mean ± SD (n = 3). a, b, c, d, e and f indicate that mean values are significantly different among samples

(P<0.05).

J. Plant Bio. Res. 2016, 5(3): 58-69

67

Figure 8. Effects of NaHS and SNP on the contents of AsA and GSH, and the ratio of AsA/DHA and GSH/GSSH in

cucumber seedlings under chilling stress. Seeds were soaked with 1.0 mM NaHS (H2S donor), 0.1 mM HT (H2S

scavenger), 0.1 mM SNP (NO donor), 15 µM Hb (NO scavenger), 1.0 mM NaHS+15 µM Hb or deionized water

(control) for 12 h. One-leaf seedlings were exposed to 5 °C for 24 h. A, C, the contents of AsA and GSH; B, D, the

ratio of AsA/DHA and GSH/GSSH. All values shown are mean ± SD (n = 3). a, b, c, d, e and f indicate that mean

values are significantly different among samples (P<0.05).

then reduced to water by POD, CAT, APX, etc.,

thus preventing further injury to the cell membrane

[35]. GR is responsible for modulating the

glutathione redox state by converting GSSG into

GSH, and GSH is the major non-enzymatic

antioxidant that contributes to plant antioxidant

defense and chilling stress response [22]. From the

results, we found that the activities and mRNA

expressions of SOD, POD, APX, and GR in

cucumber seedlings during chilling exposure were

significantly increased by NaHS and SNP (Figure

7). This provides evidence that higher activities of

antioxidant enzymes is one of the important

mechanisms of resistance to chilling stress induced

by H2S and NO in cucumber seedlings.

AsA and GSH are the key metabolites of the AsA-

GSH cycle [36] and are generally considered to be

one of the main ROS detoxification systems in

plants [37]. Under chilling stress, the AsA content

decreased, while GSH showed no significant

alteration (Figure 8A, C). We thus inferred that AsA

contributed earlier than GSH to the defense against

oxidative damage. The AsA and GSH scavenged

ROS in a way that they were oxidized into DHA and

GSSG, respectively. Consequently, the AsA/DHA

and GSH/GSSG ratios decreased obviously during

chilling stress (Figure 8B, D). NaHS and SNP led to

increase in AsA and GSH and decrease in the

AsA/DHA and GSH/GSSG ratios in the stressed

seedlings. Therefore, we speculate that H2S and NO

might activate the AsA-GSH pathway and regulate

the plant antioxidative defense system.

It was clear that the beneficial effects of NaHS on the

activities and mRNA expression of the antioxidant

enzymes as well as the AsA and GSH contents could

be partly weakened by Hb. This suggested that H2S

up-regulated the antioxidant systems in an NO-

dependent or independent manner. A model based on

the results in this experiment was proposed to

elucidate the signaling pathways of H2S and NO in the

cucumber response to chilling stress. Chilling stress

stimulated H2S and NO signal, and H2S interacting

with NO signal participated in physiological processes

to defend against chilling stress.

CONCLUSION

It is clearly shown that H2S induced chilling

tolerance in cucumber seedlings, as shown by the

decrease in stress-induced electrolyte leakage, the

decreased contents of H2O2 and MDA and the

production rate of O2·-, which occurred partially due

to the induction of antioxidant metabolism.

Interestingly, all of these events interacted with NO,

J. Plant Bio. Res. 2016, 5(3): 58-69

68

therefore, suggested that NO involved in H2S

induced chilling tolerance of cucumber seedlings.

ACKNOWLEDGENT This work was supported by the National Science

Fundation of China (contract no. 31572170) and the

Natural Science Foundation of Shandong Province

(contract no. ZR2015CM005).

REFERENCES

[1] Siddiqui. M.H., Al-Whaibi. M.H and Basalah. M.O.

2011. Role of nitric oxide in tolerance of plants to

abiotic stress. Protoplasma. 248: 447-455.

[2] Wilson. L.G., Bressan. R.A and Filner. P. 1978.

Light-dependent emission of hydrogen sulfide from

plants. Plant Physiology. 61: 184-189.

[3] Hällgren. J.E and Fredriksson. S.A. 1982. Emission

of hydrogen sulfide from sulfur dioxide-fumigated

pine trees. Plant Physiology. 70: 456-459.

[4] Jin. Z.P., Shen. J.J., Qiao. Z.J., Yang. G.D., Wang. R

and Pei. Y.X. 2011. Hydrogen sulfide improves

drought resistance in Arabidopsis thaliana.

Biochemical and Biophysical Research

Communications. 414: 481-486.

[5] Wang. Y.Q., Li. L., Cui. W.T., Xu. S., Shen. W.B and

Wang. R. 2012. Hydrogen sulfide enhances alfalfa

(Medicago sativa) tolerance against salinity during

seed germination by nitric oxide pathway. Plant Soil.

351: 107-119.

[6] Luo. Z.S., Li. D.D., Du. R.X and Mou. W.S. 2015.

Hydrogen sulfide alleviates chilling injury of banana

fruit by enhanced antioxidant system and proline

content. Scientia Horticulturae. 183: 144-151.

[7] Zhang. L.P., Pei. Y.X., Wang. H.J., Jin. Z.P., Liu.

Z.Q., Qiao. Z.J., Fang. H.H and Zhang. Y.J. 2015.

Hydrogen Sulfide alleviates cadmium-induced cell

death through restraining ROS accumulation in roots

of Brassica rapa L. ssp. pekinensis. Oxidative

Medicine and Cellular Longevity. 2015: 1-11.

[8] Chen. J., Wu. F.H., Wang. W.H., Zheng. C.J., Lin.

G.H., Dong. X.J., He. J.X., Pei. Z.M and Zheng. H.L.

2011. Hydrogen sulphide enhances photosynthesis

through promoting chloroplast biogenesis,

photosynthetic enzyme expression, and thiol redox

modification in Spinacia oleracea seedlings. Journal

of Experimental Botany. 62: 4481-4493.

[9] Guo. F.Q and Crawford. N.M. 2005. Arabidopsis

nitric oxide synthase1 is targeted to mitochondria and

protects against oxidative damage and dark-induced

senescence. Plant Cell. 17: 3436-3450.

[10] Mishina. T.E., Lamb. C and Zeier. J. 2007.

Expression of a nitric oxide degrading enzyme

induces a senescence programme in Arabidopsis.

Plant, Cell and Environment. 30: 39-52.

[11] Bethke. P.C., Libourel, I.G and Jones R.L. 2006.

Nitric oxide reduces seed dormancy in Arabidopsis.

J. Exp. Bot. 57: 517-526.

[12] He. Y.K., Tang. R.H., Hao. Y., Stevens. R.D., Cook.

C.W., Ahn. S.M., Jing. L.F., Yang. Z.G., Chen. L.E.,

Guo. F.Q., Fiorani. F., Jackson. R.B., Crawford. N.M

and Pei. Z.M. 2004. Nitric oxide represses the

Arabidopsis floral transition. Science. 305: 1968-

1971.

[13] Neill. S.J., Desikan. R., Clarke. A and Hancock. J.T.

2002. Nitric oxide is a novel component of abscisic

acid signaling in stomatal guard cells. Plant Physiol.

128: 13-16.

[14] Li. Z.G., Yang. S.Z., Long. W.B., Yang. G.X and

Shen. Z.Z. 2013. Hydrogen sulfide may be a novel

downstream signal molecule in nitric oxide-induced

heat tolerance of maize (Zea mays L.) seedlings.

Plant Cell Environ. 36: 1564-1572.

[15] Lisjak. M., Srivastava. N., Teklic. T., Civale. L.,

Lewandowski. K., Wilson. I., Wood. M.E.,

Whiteman. M and Hancock. J.T. 2010. A novel

hydrogen sulfide donor causes stomatal opening and

reduces nitric oxide accumulation. Plant Physiology

and Biochemistry. 48: 931-935.

[16] Shi. H.T., Ye. T.T and Chan. Z.L. 2013. Exogenous

application of hydrogen sulfide donor sodium

hydrosulfide enhanced multiple abiotic stress

tolerance in bermudagrass (Cynodon dactylon (L).

Pers.). Plant Physiology and Biochemistry. 71: 226-

234.

[17] Sekiya. J., Schmid. A., Wilson. L.G and Filner. P.

1982. Emission of hydrogen sulfide by leaf tissue in

response to L-cysteine. Plant Physiology. 70: 430-

436.

[18] Riemenschneider. A., Nikiforova. V., Hoefgen. R.,

de Kok. L.J and Papenbrock. J. 2005. Impact of

elevated H2S on metabolite levels, activity of

enzymes and expression of genes involved in

cysteine metabolism. Plant Physiology and

Biochemistry. 43: 473-483.

[19] Thordal-Christensen. H., Zhang. Z.G, Wei. Y.D and

Collinge. D.B. 1997. Subcellular localization of H2O2

in plants. H2O2 accumulation in papillae and

hypersensitive response during the barley-powdery

mildew interaction. Plant J. 11: 1187-1194.

[20] Jabs. T., Dietrich. R.A and Dangl. J.L. 1996.

Initiation of runaway cell death in an Arabidopsis

mutant by extracellular superoxide. Science. 27:

1853-1856.

[21] Wang. A.G and Luo G.H. 1990. Quantitative

relation between the reaction of hydroxylamine and

superoxide anion radicals in plants. Plant physiology

communications. 6: 55-57.

[22] Dong. X.B., Bi. H.G., Wu. G.X and Ai. X.Z. 2013.

Drought-induced chilling tolerance in cucumber

involves membrane stabilisation improved by

J. Plant Bio. Res. 2016, 5(3): 58-69

69

antioxidant system. International Journal of Plant

Production. 7: 67-80.

[23] Zhao. S.J., Shi. G.A and Dong. X.C. 2002.

Techniques of plant physiological experiment. Press

of Agricultural science and technology in China. 42-

44.

[24] Cho. U.H and Park. J.O. 2000. Mercury-induced

oxidative stress in tomato seedlings. Plant Science.

156: 1-9.

[25] Heath. R.L and Packer. L. 1968. Photoperoxidation

in isolated chloroplasts I. Kinetic and stoichiometry

of fatty acid peroxidation. Archives of Biochemistry

and Biophysics. 125: 189-198.

[26] Beyer. WF.Jr and Fridovich. I. 1987. Assaying for

superoxide dismutase activity: some large

consequences of minor changes in conditions.

Analytical Biochemistry. 161: 559-566.

[27] Omran. R.G. 1980. Peroxide levels and the activities

of catalase, peroxidase, and indoleacetic acid oxidase

during and after chilling cucumber seedlings. Plant

Physiol. 65: 407-408.

[28] Nakano. Y and Asada. K. 1987. Purification of

ascorbate peroxidase in spinach chloroplasts; its

inactivation in ascorbate-depleted medium and

reactivation by monodehydroas- corbate radical. Plant

Cell Physiol. 28: 131-140.

[29] Foyer. C.H and Halliwell. B. 1976. The presence of

glutathione and glutathione reductase in chloroplasts:

a proposed role in ascorbic acid metabolism. Planta.

133: 21-25.

[30] Law. MY., Charles. SA and Halliwell. B. 1983.

Glutathione and ascorbic acid in spinach (Spinacia

oleracea) chloroplasts. The effect of hydrogen

peroxide and of paraquat. Biochemical Journal. 210:

899-903.

[31] Fang. H.H., Jing. T., Liu. Z.Q., Zhang. L.P., Jin. Z.P

and Pei. Y.X. 2014. Hydrogen sulfide interacts with

calcium signaling to enhance the chromium tolerance

in Setaria italic. Cell Calcium. 56: 472-481.

[32] Harrington. H.M and Smith. I.K. 1980. Cysteine

metabolism in cultured tobacco cells. Plant

Physiology. 65: 151-155.

[33] Nagasawa. T., Ishii. T., Kumagai. H and Yamada.

H. 1985. D-cysteine desulfhydrase of escherichia coli.

purification and characterization. International

Orthopaedics. 153: 1-7.

[34] Shen. J.J., Xing. T.J., Yuan. H.H., Liu. Z.Q., Jin.

Z.P., Zhang. L.P and Pei. Y.X. 2013. Hydrogen

sulfide improves drought tolerance in Arabidopsis

thaliana by microRNA expressions. PLOS ONE. 8:

1-8.

[35] Kornyeyev. D., Logan. B.A., Payton. P., Allen. R.D

and Holaday. A.S. 2001. Enhanced photochemical

light utilization and decreased chilling-induced

photoinhibition of photosystem II in cotton

overexpressing genes encoding chloroplast -targeted

antioxidant enzymes. Physiologia Plantarum. 113:

323-331.

[36] Noctor. G and Foyer. C.H. 1998. Ascorbate and

glutathione: keeping active oxygen under control.

Annual Review of Plant Biology. 49: 249-279.

[37] Xu. S., Li. J.L., Zhang. X.Q., Wei. H and Cui. L.J.

2006. Effects of heat acclimation pretreatment on

changes of membrane lipid peroxidation, antioxidant

metabolites, and ultrastructure of chloroplasts in two

cool-season turfgrass species under heat stress.

Environmental and Experimental Botany. 56: 274-

285.