Holoprosencephaly: Molecular Study of aCalifornia Population

Luisa Nanni,1 Lisa A. Croen,2 Edward J. Lammer,3 and Maximilian Muenke1,4*1Departments of Pediatrics and Genetics, The Children’s Hospital of Philadelphia, University of Pennsylvania Schoolof Medicine, Philadelphia, Pennsylvania

2March of Dimes Birth Defects Foundation, California Birth Defects Monitoring Program, Emeryville, California3Division of Medical Genetics, Children’s Hospital, Oakland, California4Medical Genetics Branch, National Human Genome Research Institute, the National Institutes of Health,Bethesda, Maryland

Holoprosencephaly (HPE) is a common de-velopmental anomaly of the forebrain andmidface in which the cerebral hemispheresfail to separate into distinct left and righthalves. HPE is extremely heterogeneous. Inaddition to teratogenic agents, severalgenes are implicated in the cause of HPE.Using samples from a population-basedbirth defects registry in California, we per-formed a mutational analysis of the knownHPE genes Sonic Hedgehog (SHH), ZIC2,and SIX3, in addition to two HPE candidategenes, TG-interacting factor (TGIF), andPatched (PTC), on a group of sporadic HPEpatients. This is the first molecular study ofHPE in a population-based sample of pa-tients. Among these patients, a deletion inthe homeodomain of SIX3 and several poly-morphisms in SIX3 and TGIF were identi-fied. No sequence changes were detected inSHH, ZIC2, and PTC. Our results suggestthat mutations in the currently recognizedHPE genes may explain <5% of all sporadicHPE cases. Am. J. Med. Genet. 90:315–319,2000. Published 2000 Wiley-Liss, Inc.†

KEY WORDS: holoprosencephaly; popula-t ion-based study; Sonic

Hedgehog; ZIC2; SIX3; TG-interacting factor; Patched

INTRODUCTION

Holoprosencephaly (HPE) is the most common birthdefect of the human forebrain and midface. Its pheno-typic expression is quite variable ranging from alobarHPE and cyclopia to microforms of HPE such as micro-cephaly, ocular hypotelorism, or single central maxil-lary incisor [DeMyer et al., 1964; Cohen, 1989;Muenke, 1994; Ming and Muenke, 1998]. The preva-lence rate of HPE is 1 in 250 during embryogenesis[Matsunaga and Shiota, 1977], but 1 in 10,000 to 1 in20,000 among live births [Roach et al., 1975; Mastroia-covo et al., 1993; Croen et al., 1996]. Most HPE casesare apparently sporadic, although clear examples ofautosomal dominant (AD) inheritance have been de-scribed [Muenke et al., 1994a].

HPE is heterogeneous; up to 45% of live births withHPE have chromosomal abnormalities [Croen et al.,1996]. Based on recurrent cytogenetic abnormalitiessuch as del(7)(q36), del(18p), del(2)(p21), del(13)(q32),and others, there are at least 12 genetic loci that likelycontain genes critical for normal brain development[Roessler and Muenke, 1998], and alterations in one ormore of these genes may cause HPE. Several genes forHPE are currently known: Sonic Hedgehog (SHH) wasidentified as an HPE candidate gene at locus HPE3[Belloni et al., 1996], and haploinsufficiency for SHHwas shown to cause HPE [Roessler et al., 1996, 1997;Nanni et al., 1999]. SHH encodes a morphogen thatplays a critical role in the development of the ventralneural tube and the differentiation of the floor plate[Echelard et al., 1993; Roelink et al., 1994]. Recently,other HPE genes involved in forebrain developmenthave been identified, and mutations in these geneshave been reported in association with HPE. They in-clude the transcription factors ZIC2 (HPE5) [Brown etal., 1998b] and SIX3 (HPE2) [Wallis et al., 1999] inaddition to two HPE candidate genes: TG-interactingfactor (TGIF) (HPE4) [Gripp et al., 1998] and the mul-

Contract grant sponsor: the Catholic University of Rome, Italy;Contract grant sponsor: the National Institutes of Health; Con-tract grant numbers: HD28732 and HD29862; Contract grantsponsor: the Division of Intramural Research, NHGRI, the Na-tional Institutes of Health.

*Correspondence to: Maximilian Muenke, M.D., Medical Ge-netics Branch, National Human Genome Research Institute, theNational Institutes of Health, 10 Center Drive, MSC 1852, Build-ing 10, 10C101, Bethesda, MD 20892-1852.E-mail: mmuenke@nhgri.nih.gov

Received 2 August 1999; Accepted 9 November 1999

American Journal of Medical Genetics 90:315–319 (2000)

Published 2000 Wiley-Liss, Inc. †This article was pre-pared by a group consisting of both United States governmentemployees and non-United States government employees, and assuch is subject to 17 U.S.C. Sec. 105.

tipass transmembrane protein Patched (PTC) [Ming etal., 1998], a putative receptor for SHH.

In this study we describe the mutational analysis ofthe entire coding region and exon-intron boundaries ofSHH, ZIC2, SIX3, TGIF, and part of the coding regionof PTC, in 23 cytogenetically normal live-born infantswith sporadic HPE, identified from a population-basedcongenital malformation registry. Among these 23 pa-tients, 15 were identified as having sequence varia-tions: a deletion in the SIX3 gene and a number ofpolymorphisms in SIX3 and TGIF. This relativelysmall number provides evidence that mutations in thefive genes studied explain a minority of the sporadicHPE cases.

MATERIALS AND METHODSPatient Samples

Patients were identified by the California Birth De-fects Monitoring Program (CBDMP), which maintainsa population-based congenital malformation registrywith ascertainment from multiple sources [Croen et al.,1991]. For this study live births with a diagnosis ofHPE and normal chromosomes, delivered betweenJanuary 1983 and December 1988 were eligible. Eligi-bility was determined by a medical geneticist (EJL)after review of prenatal ultrasonography, brain imag-ing, and autopsy reports. Details of case ascertainmentand eligibility criteria are presented elsewhere [Croenet al., 1996]. Fifty HPE individuals with normal karyo-types and no recognized genetic syndrome were iden-tified. For these 50 cases, newborn screening filter pa-per blood specimens (blood spots) were requested fromthe Genetics Disease Branch of the California Depart-ment of Health Services. Newborn screening was neverperformed on 17 individuals, most of whom died within24 hours of delivery. We successfully obtained driedblood spots on 23 of the remaining 33 individuals onwhom newborn screening was carried out. All sampleswere obtained according to the guidelines of the Stateof California Health and Welfare Agency Committeefor the Protection of Human Subjects.

Molecular Studies

We performed a mutational study using singlestrand conformational polymorphism analysis (SSCP)for the entire coding region and exon-intron boundariesof SHH, ZIC2, SIX3, and TGIF in a population-basedsample of 23 individuals with sporadic HPE. We alsoanalyzed four of the exons of PTC (exons 8, 13, 14, and17) in which mutations were detected previously in as-sociation with HPE [Ming et al., 1998]. Genomic DNAwas extracted from the 23 blood spots as follows: aftermoistening the dried spot with a drop of phosphate-buffered saline (PBS) buffer, cytological material wasscraped with a slide into a microfuge tube with PBS,and dissolved by pipetting. Cells were lysed by incu-bating the sample at 70°C for 10 min with proteinase Kand buffer AL (QIAamp Blood Kit, Qiagen, Valencia,CA). After adding ethanol (96–100%) to the sample, themixture was applied to a QIAamp spin column (Qia-gen) and centrifuged for 1 min. The column was thenwashed twice with buffer AW (QIA kit, Qiagen). After

an incubation of 5 min at 70°C with buffer AE (QIAkit), DNA was eluted from the column by centrifuga-tion.

Primer pairs to amplify SIX3-specific exons (exon 2was split into six overlapping amplicons) and intron-exon boundaries are as follows: 1F (58 GAGAGATAG-GAGCCAGAG 38) and 1R (58 CCGACTGGGGAGC-TAGGA 38), 2F (58 GGTGTCCCTTACGCCCTTCCTC38) and 2R (58 GGTGGTGAGAATCGGCGAAGTT38), 3F (58 GACCTCTATTCCTCCCACTTCT 38) and3R (58 CCACCTGCTCCGGCGAGA 38), 4F (58TTGTCCATGTTCCAGCTGCCCA 38) and 4R (58GACTCCTTGGTGAACTTGTGGT 3 8 ) , 5F (5 8GCGACCTCTACCACATCCTT 3 8 ) and 5R (5 8GTCTTCTGCTCGCCGTCCCA 38), 6F (58 GGCCCG-GTGGACAAGTACCG 38) and 6R (58 CTTAAACCAGT-TGCCTACTT 38), 7F (58 CAGGCCACCGGCCT-CACTCC 38) and 7R (58 AGCGGAAACTTTCTCCGACT38), 8F (58 GGCCAGCCTCTATCTGAGAA 38) and 8R(58 AGGGGAAGGAGAGGGAGG 38). These primerswere generated by D. Wallis and used in Wallis et al.[1999]. Other primer pairs were published elsewhere:SHH [Roessler et al., 1996, 1997; Vargas et al., 1998],ZIC2 [Brown et al., 1998b], TGIF [Gripp et al., 1998],and PTC [Hahn et al., 1996; Xie et al., 1997]. All poly-merase chain reactions (PCR) were performed in aPTC-100 thermal cycler (MJ Research, Inc.). SSCPanalysis was performed as described elsewhere[Muenke et al., 1994b]. Sequencing of the ampliconsdemonstrating SSCP band shifts was performed by theProtein and DNA Core Facility of The Children’s Hos-pital of Philadelphia on an ABI Prism™ 377 analyzer.

For the deletion detected in SIX3, we subcloned thePCR product from the affected individual using a TAcloning kit (Invitrogen). Plasmid DNA containing themutated allele was extracted (Qiagen spin miniprep)and sequenced.

RESULTSWe screened 23 sporadic HPE cases for SHH, ZIC2,

SIX3, TGIF, and PTC genes. A total of five sequencevariations was detected as band shifts and confirmedby direct sequencing of the amplicons. We identified a9-bp deletion in SIX3. This deletion detected in one ofthe patients was not found in over 200 chromosomesfrom unrelated normal individuals. Furthermore, wefound one putative polymorphism in SIX3 and threeputative polymorphisms in TGIF (Table I). No se-quence changes were identified in SHH, ZIC2, andPTC.

The deletion in SIX3 was detected in a term female

TABLE I. Summary of Sequence Variations in SIX3 andTGIF Genes

Gene Sequence change Position No. of casesa

SIX3 CGC → CGT Arg192Arg 2/23698–706 del 232–234 del 1/23

TGIF CCA → CCG Pro140Pro 5/23CCG → TCG Pro163Ser 2/23CCG → CTG Pro163Leu 5/23

aNumber of cases with sequence variations identified per number of unre-lated HPE patients screened. No sequence variations were found in SHH,ZIC2, and PTC.

316 Nanni et al.

infant, birth weight 2,260 g (small for gestational age)with alobar HPE. She had a single nostril, cleft lip andpalate, microcephaly, midface hypoplasia, flattenedforehead, ocular hypotelorism, up-slanting palpebralfissures, flat nasal bridge, and premaxillary agenesis.The patient had seizures and hypernatremia and diedat age 2 months. Further investigation was not pos-sible as parents were unavailable for study. The SIX3deletion occurred at codons 232–234 and predicts theloss of three amino acids (NPS) located in the homeodo-main of the gene (Fig. 1). This deletion is expected todisrupt transcriptional activation, predicting a loss offunction of SIX3. Interestingly, this is the only deletionin SIX3 identified to date, whereas all other reportedchanges are missense mutations (D. Wallis and M.Muenke, unpublished data).

A putative polymorphism detected in SIX3 occurs atnucleotide C578T and predicts no change in the pri-mary sequence of the translated protein (Arg192Arg).This sequence change was detected in two separateHPE individuals in the present study, and in 25 of 328HPE patients from a different study [Wallis et al.,1999]. Two of these 25 Arg192Arg were present in ho-mozygous form, suggesting that this may be a polymor-phism.

The first of three predicted polymorphisms detectedin TGIF occurs at nucleotide A420G in the wobble po-sition and does not predict an amino acid change(Pro140Pro). It was identified in five different HPE pa-tients among our population and in 20 of 334 HPE pa-tients from a different study (K.W. Gripp and M.Muenke, unpublished data).

At position Pro163 of the TGIF protein two differentvariations were detected: the C487T change predictingan amino acid substitution Pro163Ser and the C488Tresulting in a Pro163Leu substitution. Despite the pre-dicted changes in the primary structure of the TGIFprotein, the Pro163Ser change was observed in 2 of 23HPE patients in our population, in 20 of 334 HPE pa-tients and in 14 of 140 normal controls from a differentstudy (K.W. Gripp and M. Muenke, unpublished data).One of these Pro163Ser was present in homozygousform. The Pro163Leu was detected in 5 of the 23 HPEpatients in the present study, in 22 of 334 HPE pa-tients, and in 16 of 140 normal controls from a differentstudy (K.W. Gripp and M. Muenke, unpublished data).The recurrence of these sequence changes suggeststhat they are indeed polymorphisms, although onlyfunctional study could explain potential effects of thesechanges.

DISCUSSION

This is the first mutational analysis of the three cur-rently defined HPE genes (SHH, ZIC2, SIX3) and twoHPE candidate genes (TGIF, PTC) to be performed in apopulation-based sample of individuals with sporadicHPE. Previous molecular studies have reported muta-tions in these genes among several unrelated patientswith familial as well as sporadic HPE. In this study, weattempted to estimate the frequency of mutations inthese five HPE genes in a representative population-based sample of sporadic HPE. We observed only 1 pa-tient of 23 (4.3%) with a mutation in any of these genes(SIX3).

In a previous study [Nanni et al., 1999], mutations inSHH were detected in only 9 of 266 (3.4%) sporadicHPE cases. In contrast, SHH mutations were detectedin 10 of 27 families (37%) with autosomal dominanttransmission of HPE, based on structural anomalies.

ZIC2 was the second HPE gene identified, whichmaps to 13q32. ZIC2 is a transcription factor that isexpressed in the dorsal neural tube, neural retina, anddistal limb bud during mouse embryonic development[Nagai et al., 1997]. A total of 10 heterozygous muta-tions has been reported, mostly in severely affected pa-tients. Of 10 mutations, 9 were found in sporadic HPEand 1 in a familial case [Brown et al., 1998a, 1998b].

Recently SIX3 was identified as an HPE gene; itmaps to 2p21 [Wallis et al., 1999]. It is homologous tothe Drosophila sine oculis (so) gene, which plays a cru-cial role for the patterning of the visual system [Chey-ette et al., 1994], and it is involved in midline forebrainand eye formation in several organisms [Oliver et al.,1996; Kobayashi et al., 1998; Loosli et al., 1999]. Fourdifferent mutations have been reported in associationwith HPE. These are responsible for 1 in 78 familialHPE cases and 3 in 223 (1.3%) sporadic cases of HPE.These mutations are predicted to interfere with tran-scriptional activation [Wallis et al., 1999].

TGIF is an HPE candidate gene that maps to18p11.3 in the HPE4 minimal critical region. It is ex-pressed during early brain development in mice [Ber-tolino et al., 1996]. TGIF acts as a repressor of retinoicacid (RA) regulated gene transcription, inhibiting com-petitively the binding of the retinoid X receptor (RXR)to a retinoid-responsive promoter [Bertolino et al.,1995]. Interestingly, prenatal retinoic acid exposurecauses HPE-like malformations in humans and mice[Lammer et al., 1985; Sulik et al., 1995]. More recently,TGIF was shown to act in vivo as a corepressor of the

Fig. 1. Representative chromatogram of the 9-bp deletion in the homeodomain of the SIX3 gene detected in an HPE patient. Both normal (Nl) anddeleted (Del) alleles are indicated. Note that base pairs 698–706 (dotted line in normal sequence) are missing in the deleted allele. Boxes indicate DNAsequences following the deletion.

Molecular Study in HPE 317

SMAD2 protein [Wotton et al., 1999], directing tran-scriptional silencing of target genes along the TGF-b /Nodal-related signaling pathway. Cyclopia has been re-ported at high frequency in mice with heterozygousmutations in both nodal and smad2 genes [Conlon etal., 1994]. Four heterozygous missense mutations inTGIF have been recently identified accounting for 1 in51 familial HPE cases and 3 in 240 clinical sporadicHPE cases (1.2%) [Gripp et al., 1998]. Given the role ofTGIF in the RA pathway, these mutations may de-crease TGIF activity, causing increased signaling alongthe RA pathway and mimicking the effect of excessiveretinoic acid exposure. With regard to the Nodal path-way, mutations in TGIF may interfere with repressor/activator elements’ competition in determining tran-scription of Nodal-target genes.

Many of the genes directly or indirectly involved inthe SHH pathway are currently being studied in HPE[Wallis and Muenke, 1999]. PTC, a multipass trans-membrane protein, is the Hh receptor [Marigo et al.,1996]. In the absence of SHH, PTC represses Smooth-ened (SMO) signaling through direct binding. WhenSHH binds to PTC, SMO is released from inhibition,and activation of SHH target genes proceeds. Four dif-ferent mutations in the PTC gene have been reportedin two familial HPE cases and three sporadic cases.One of the mutations was detected in one kindred aswell as in an unrelated sporadic case. These mutationsin PTC may prevent SHH signaling either by perturb-ing SHH binding or by inhibiting activation of SMO[Ming et al., 1998].

Our data suggest that mutations in the currentlyrecognized HPE genes explain only a very small pro-portion of all sporadic HPE cases. Furthermore, thepresent study underscores the importance of muta-tional analysis of all HPE patients with normal chro-mosomes. Lastly, it demonstrates the heterogeneity ofHPE and the importance of the identification of addi-tional genes and environmental factors related to HPEin order to better explain the mechanisms leading toHPE and normal brain development.

ACKNOWLEDGMENTS

We are grateful to George Cunningham and staff atthe Genetics Disease Branch California Department ofHealth Services for providing us with the newbornscreening blood specimens. This work is supported inpart by the Catholic University of Rome, Italy (L.N.),by NIH Grants HD28732 and HD29862, and by theDivision of Intramural Research, NHGRI, NIH (M.M.).

REFERENCES

Belloni E, Muenke M, Roessler E, Traverso G, Siegel-Bartelt J, Frumkin A,Mitchell HF, Donis-Keller H, Helms C, Hing AV, Heng HHQ, Koop B,Martindale D, Rommens JM, Tsui L-C, Scherer SW. 1996. Identifica-tion of Sonic hedgehog as a candidate gene responsible for holoprosen-cephaly. Nat Genet 14:353–356.

Bertolino E, Reimund B, Wildt-Perinic D, Clerc RG. 1995. A novel ho-meobox protein which recognizes a TGT core and functionally inter-feres with a retinoid-responsive motif. J Biol Chem 270:31178–31188.

Bertolino E, Wildt S, Richards G, Clerc RG. 1996. Expression of a novelmurine homeobox gene in the developing cerebellar granular layer dur-ing its proliferation. Dev Dyn 205:410–420.

Brown SA, Brown LY, Yu CC, Warburton D, Muenke M. 1998a. ZIC2, ahuman homologue of odd-paired, is in the 13q32 critical deletion regionand mutations are associated with holoprosencephaly. Am J HumGenet 63:A3.

Brown SA, Warburton D, Brown LY, Yu C-y, Roeder ER, Stengel-Rutkowski S, Hennekam RCM, Muenke M. 1998b. Holoprosencephalydue to mutations in ZIC2, a homologue of Drosophila odd-paired. NatGenet 20:180–183.

Cheyette BNR, Green PJ, Martin K, Garren H, Hartenstein V, ZipurskySL. 1994. The Drosophila sine oculis locus encodes a homeodomain-containing protein required for the development of the entire visualsystem. Neuron 12:977–996.

Cohen MM Jr. 1989. Perspectives on holoprosencephaly: Part I. Epidemi-ology, genetics, and syndromology. Teratology 40:211–235.

Conlon FL, Lyons KM, Takaesu N, Barth KS, Kispert A, Herrmann B,Robertson EJ. 1994. A primery requirement for nodal in the formationand maintanence of the primitive streak in the mouse. Development120:1919–1928.

Croen LA, Shaw GM, Jensvold NJ, Harris JA. 1991. Birth defects moni-toring in California: a resource for epidemiological research. PediatrPerinatal Epidemiol 5:423–427.

Croen LA, Shaw GM, Lammer EJ. 1996. Holoprosencephaly: epidemiologicand clinical characteristics of a California population. Am J HumGenet 64:465–472.

DeMyer W, Zemen W, Palmer CG. 1964. The face predicts the brain: di-agnostic significance of median facial anomalies for holoprosencephaly(arhinencephaly). Pediatrics 34:256–263.

Echelard Y, Epstein DJ, St.-Jacques B, Shen L, Mohler J, McMahon JA,McMahon AP. 1993. Sonic hedgehog, a member of a family of putativesignaling molecules, is implicated in the regulation of CNS polarity.Cell 75:1417–1430.

Gripp KW, Edwards MC, Mowat D, Meinecke P, Richieri-Costa A, ZackaiEH, Elledge S, Muenke M. 1998. Mutations in the transcription factorTGIF in holoprosencephaly. Am J Hum Genet 63:A32.

Hahn H, Wicking C, Zaphiropoulous PG, Gailani MR, Shanley S, Chidam-baram A, Vorechovsky I, Holmberg E, Unden AB, Gillies S, Negus K,Smyth I, Pressman C, Leffell DJ, Gerrard B, Goldstein AM, Dean M,Toftgard R, Chenevix-Trench G, Wainwright B, Bale AE. 1996. Muta-tions of the human homolog of Drosophila patched in the nevoid basalcell carcinoma syndrome. Cell 85:841–851.

Kobayashi M, Toyama R, Takada H, Dawid IB, Kawakami K. 1998. Over-expression of the forebrain-specific homeobox gene six3 induces rostralforebrain enlargement in zebrafish. Development 125:2973–2982.

Lammer E, Chen D, Hoar R, Agnish N, Benk P, Braun J, Curry C, FernhoffP, Grix A, Lott I, Richards J, Sun S. 1985. Retinoic acid embryopathy.N Engl J Med 313:837–841.

Loosli F, Winkler S, Wittbrodt J. 1999. Six3 overexpression initiates theformation of ectopic retina. Genes Dev 13:649–654.

Marigo V, Davey RA, Zuo Y, Cunningham JM, Tabin CJ. 1996. Biochemicalevidence that patched is the hedgehog receptor. Nature 384:176–179.

Mastroiacovo P, Botto LD, Cavalcanti DP, Zampino G, Serafini MA. 1993.Epidemiological and genetic study of holoprosencephaly in 106 casesobserved in the Italian Multicentric Registry 1978–1989. Proc First IntMeet Genet Reprod Epidemiol Res Soc (GRERS) 1:71–82.

Matsunaga E, Shiota K. 1977. Holoprosencephaly in human embryos: epi-demiologic studies of 150 cases. Teratology 16:261–272.

Ming JE, Kaupas ME, Roessler E, Brunner HG, Nance WE, Stratton RF,Sujansky E, Bale SJ, Muenke M. 1998. Mutations of PATCHED inholoprosencephaly. Am J Hum Genet 63:A27.

Ming JE, Muenke M. 1998. Holoprosencephaly: from Homer to Hedgehog.Clin Genet 53:155–163.

Muenke M. 1994. Holoprosencephaly as a genetic model for normal cra-niofacial development. Dev Biol 5:293–301.

Muenke M, Gurrieri F, Bay C, Yi DH, Collins AL, Johnson VP, HennekamRCM, Schaefer GB, Weik L, Lubinski MS, Daack-Hirsch S, Moore CA,Dobyns WB, Murray JC, Price RA. 1994a. Linkage of a human brainmalformation, familial holoprosencephaly, to chromosome 7 and evi-dence for genetic heterogeneity. Proc Natl Acad Sci USA 91:8102–8106.

Muenke M, Schell U, Hehr A, Robin NH, Losken HW, Schinzel A, PulleynLJ, Rutland P, Teardon W, Malcolm S, Winter R. 1994b. A commonmutation in the fibroblast growth factor receptor 1 gene in Pfeiffersyndrome. Nat Genet 8:269–274.

Nagai T, Aruga J, Takada S, Gunther T, Sporle R, Schughart K, MikoshibaK. 1997. The expression of the mouse Zic1, Zic2, and Zic3 gene suggest

318 Nanni et al.

an essential role for Zic genes in body pattern formation. Dev Biol182:299–313.

Nanni L, Ming JE, Bocian M, Steinhaus K, Bianchi DW, Die-Smulders Cd,Giannotti A, Imaizumi K, Jones KL, Campo MD, Martin RA, MeineckeP, Pierpont MEM, Robin NH, Young ID, Roessler E, Muenke M. 1999.The mutational spectrum of the Sonic Hedgehog gene in holoprosen-cephaly: SHH mutations cause a significant proportion of autosomaldominant holoprosencephaly. Hum Mol Genet 8:2479–2488.

Oliver G, Loosli F, Koster R, Wittbrodt J, Gruss P. 1996. Ectopic lensinduction in fish in response to the murine homeobox gene Six3. MechDev 60:233–239.

Roach E, DeMyer W, Conneally PM, Palmer C, Merritt AD. 1975. Holo-prosencephaly: birth data, genetic and demographic analysis of 30families. Birth Defects Orig Artic Ser 11:294–313.

Roelink H, Augeburger A, Heemskerk J, Korzh V, Norlin S, Altaba ARi,Tanabe Y, Placzek M, Edlund T, Jessell TM, Dodd J. 1994. Floorplateand motorneuron induction by vhh-1, a vertebrate homolog of hedgehogexpressed by the notocord. Cell 76:761–775.

Roessler E, Belloni E, Gaudenz K, Jay P, Berta P, Scherer SW, Tsui L-C,Muenke M. 1996. Mutations in the human Sonic Hedgehog gene causeholoprosencephaly. Nat Genet 14:357–360.

Roessler E, Belloni E, Gaudenz K, Vargas F, Scherer SW, Tsui L-C,Muenke M. 1997. Mutations in the C-terminal domain of Sonic Hedge-hog cause Holoprosencephaly. Hum Mol Genet 6:1847–1853.

Roessler E, Muenke M. 1998. Holoprosencephaly: a paradigm for the com-plex genetics of brain development. J Inherit Metab Dis 21:481–497.

Sulik KK, Dehart DB, Rogers JM, Chernoff N. 1995. Teratogenicity of lowdoses of all-trans retinoic acid in presomite mouse embryos. Teratology51:398–403.

Vargas F, Roessler E, Gaudenz K, Belloni E, Whitehead AS, Kirke PN,Mills JL, Hooper G, Stevenson RE, Cordeiro I, Correia P, Felix T,Gereige R, Cunningham ML, Canun S, Antonarakis SE, Strachan T,Tsui LC, Scherer SW, Muenke M. 1998. Analysis of the human SonicHedgehog coding and promoter regions in sacral agenesis, triphalan-geal thumb, and mirror polydactyly. Hum Genet 102:387–392.

Wallis D, Muenke M. 1999. Molecular mechanisms of holoprosencephaly asa model for forebrain development. Mol Genet Metab 68:126–138.

Wallis DE, Roessler E, Hehr U, Nanni L, Wiltshire T, Richieri-Costa A,Gillessen-Kaesbach G, Zackai EH, Rommens J, Muenke M. 1999. Mu-tations in the homeodomain of the human SIX3 gene cause holopros-encephaly. Nat Genet 22:196–198.

Wotton D, Lo RS, Lee S, Massague J. 1999. A Smad transcriptional core-pressor. Cell 97:29–39.

Xie J, Johnson RL, Zhang X, Bare JW, Waldman FM, Cogen PH, MenonAG, Warren RS, Chen LC, Scott MP, Epstein EH Jr. 1997. Mutationsof the PATCHED gene in several types of sporadic extracutaneoustumors. Cancer Res 57:2369–2372.

Molecular Study in HPE 319